ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags14p02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AJ567377.2|HVU567377 Hordeum vulgare partial mRNA for sucros... 866 0.0
2dbj|AB029888.1| Triticum aestivum 1-SST mRNA for sucrose:sucrose... 490 e-135
3dbj|AB159786.1| Triticum aestivum 1-SST gene for sucrose:sucrose... 301 1e-78
4dbj|AB088410.1| Triticum aestivum 1-FFT-B mRNA for fructan:fruct... 264 2e-67
5dbj|AB088409.1| Triticum aestivum 1-FFT-A mRNA for fructan:fruct... 242 9e-61
6gb|AY245431.1| Lolium perenne sucrose:sucrose 1-fructosyltransfe... 168 1e-38
7gb|AF494041.1| Lolium perenne fructan 6-fructosyltransferase mRN... 157 4e-35
8dbj|AB186920.1| Lolium perenne mRNA for putative fructosyltransf... 149 1e-32
9emb|AJ297369.1|FAR297369 Festuca arundinacea mRNA for sucrose:su... 145 2e-31
10emb|AJ532550.1|LTE532550 Lolium temulentum mRNA for putative fru... 143 6e-31
11gb|AF192394.1|AF192394 Poa secunda sucrose:fructan 6-fructosyltr... 117 4e-23
12gb|AF492836.1| Lolium perenne putative sucrose:sucrose 1-fructos... 105 1e-19
13dbj|AB125218.1| Lolium perenne mRNA for putative fructosyltransf... 105 1e-19
14gb|AY575557.1| Oryza sativa (indica cultivar-group) cultivar IR6... 96 1e-16
15emb|AJ635225.1| Triticum aestivum mRNA for acid beta-fructofuran... 96 1e-16
16dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 96 1e-16
17gb|AF276704.1|AF276704 Oryza sativa vacuolar acid invertase (INV... 96 1e-16
18dbj|AP004851.3| Oryza sativa (japonica cultivar-group) genomic D... 96 1e-16
19dbj|AK072245.1| Oryza sativa (japonica cultivar-group) cDNA clon... 96 1e-16
20gb|AY575717.1| Triticum monococcum vacuolar invertase1 (vin1) mR... 94 5e-16
21gb|DQ073970.1| Lolium perenne fructosyltransferase-like protein ... 88 3e-14
22gb|AF481763.1| Lolium perenne fructosyltransferase (FT1) mRNA, c... 78 3e-11
23gb|DQ267825.1| Dendrocalamopsis oldhamii vacuolar invertase BObe... 78 3e-11
24emb|AJ623275.1| Hordeum vulgare mRNA for soluble acid invertase ... 72 2e-09
25gb|AF222935.1| Pseudoroegneria spicata sucrose:fructan 6-fructos... 70 7e-09
26emb|AJ532551.1|LTE532551 Lolium temulentum partial mRNA for puta... 70 7e-09
27gb|AF069309.1| Triticum aestivum vacuolar invertase (WIVRV) mRNA... 68 3e-08
28gb|AF222944.1| Heteranthelium piliferum sucrose:fructan 6-fructo... 68 3e-08
29gb|AY302083.1| Saccharum hybrid cultivar soluble acid invertase ... 66 1e-07
30gb|AF222943.1| Haynaldia villosa sucrose:fructan 6-fructosyltran... 66 1e-07
31gb|AF062735.1|AF062735 Saccharum officinarum soluble acid invert... 66 1e-07
32gb|AF211253.1| Agropyron cristatum sucrose:fructan 6-fructosyltr... 64 5e-07
33gb|AF222930.1| Agropyron puberulum sucrose:fructan 6-fructosyltr... 64 5e-07
34gb|AF222948.1| Pascopyrum smithii sucrose:fructan 6-fructosyltra... 62 2e-06
35gb|AF222936.1| Pseudoroegneria stipifolia sucrose:fructan 6-fruc... 62 2e-06
36gb|BT009003.1| Triticum aestivum clone wdk2c.pk017.f14:fis, full... 60 7e-06
37gb|BT008969.1| Triticum aestivum clone wdk1c.pk014.c11:fis, full... 60 7e-06
38gb|AF222947.1| Triticum aestivum sucrose:fructan 6-fructosyltran... 60 7e-06
39gb|AF222945.1| Triticum turgidum sucrose:fructan 6-fructosyltran... 60 7e-06
40gb|AF222942.1| Secale cereale sucrose:fructan 6-fructosyltransfe... 60 7e-06
41gb|AF222941.1| Aegilops tauschii sucrose:fructan 6-fructosyltran... 60 7e-06
42gb|AF222940.1| Aegilops caudata sucrose:fructan 6-fructosyltrans... 60 7e-06
43gb|AF222939.1| Aegilops speltoides sucrose:fructan 6-fructosyltr... 60 7e-06
44gb|AF222934.1| Thinopyrum bessarabicum sucrose:fructan 6-fructos... 60 7e-06
45gb|AF222929.1| Agropyron mongolicum sucrose:fructan 6-fructosylt... 60 7e-06
46gb|AF253410.1| Triticum urartu sucrose:fructan 6-fructosyltransf... 60 7e-06
47emb|AJ532549.1|LTE532549 Lolium temulentum mRNA for putative sol... 60 7e-06
48dbj|AB029887.1| Triticum aestivum 6-SFT mRNA for sucrose:fructan... 60 7e-06
49gb|AF062734.1|AF062734 Saccharum robustum soluble acid invertase... 60 7e-06
50gb|AF083856.1|AF083856 Saccharum hybrid cultivar H65-7052 solubl... 58 3e-05
51gb|AF222937.1| Australopyrum retrofractum sucrose:fructan 6-fruc... 56 1e-04
52emb|AJ563384.1|ZMA563384 Zea mays partial ivr2 gene for vacuolar... 56 1e-04
53gb|AY107166.1| Zea mays PCO109921 mRNA sequence 56 1e-04
54gb|U31451.1|ZMU31451 Zea mays invertase mRNA, partial cds 56 1e-04
55gb|AF252608.1| Pascopyrum smithii sucrose:fructan 6-fructosyltra... 54 4e-04
56gb|AF222946.1| Triticum timopheevii sucrose:fructan 6-fructosylt... 52 0.002
57gb|AF222938.1| Bromus tectorum sucrose:fructan 6-fructosyltransf... 52 0.002
58gb|AF222933.1| Psathyrostachys huashanica sucrose:fructan 6-fruc... 52 0.002
59gb|AF222932.1| Psathyrostachys fragilis sucrose:fructan 6-fructo... 52 0.002
60gb|AF253411.1| Critesion violaceum sucrose:fructan 6-fructosyltr... 52 0.002
61emb|AL355520.8| Human DNA sequence from clone RP4-595C2 on chrom... 48 0.027
62emb|AL139132.16| Human DNA sequence from clone RP11-177A2 on chr... 48 0.027
63tpg|BK002757.1| TPA: TPA_inf: Drosophila melanogaster HDC14963 (... 48 0.027
64gb|AC008043.5| Drosophila melanogaster, chromosome 3R, region 94... 48 0.027
65gb|AE003738.3| Drosophila melanogaster chromosome 3R, section 76... 48 0.027
66emb|AJ563423.1|ZMA563423 Zea mays partial ivr2b pseudogene 48 0.027
67gb|AC009915.5|AC009915 Drosophila melanogaster, chromosome 3R, r... 48 0.027
68ref|NM_123593.1| Arabidopsis thaliana unknown protein AT5G42280 ... 46 0.11
69ref|XM_635128.1| Dictyostelium discoideum hypothetical protein (... 46 0.11
70ref|XM_633972.1| Dictyostelium discoideum hypothetical protein (... 46 0.11
71ref|XM_630605.1| Dictyostelium discoideum hypothetical protein (... 46 0.11
72ref|XM_629759.1| Dictyostelium discoideum hypothetical protein (... 46 0.11
73ref|XM_629699.1| Dictyostelium discoideum unconventional myosin ... 46 0.11
74gb|AE017353.1| Cryptococcus neoformans var. neoformans JEC21 chr... 46 0.11
75gb|AC161235.6| Mus musculus chromosome 3, clone RP24-86C19, comp... 46 0.11
76gb|AC131721.4| Mus musculus BAC clone RP23-142L24 from chromosom... 46 0.11
77gb|AY082350.1| Lolium perenne fructosyltransferase (FT2) mRNA, c... 46 0.11
78ref|XM_568474.1| Cryptococcus neoformans var. neoformans JEC21 h... 46 0.11
79gb|AC124187.3| Mus musculus BAC clone RP23-237I24 from 18, compl... 46 0.11
80emb|BX470150.13| Zebrafish DNA sequence from clone DKEY-164K14 i... 46 0.11
81gb|AC167554.9| Mus musculus chromosome 15, clone RP24-281M24, co... 46 0.11
82ref|XM_791192.1| PREDICTED: Strongylocentrotus purpuratus simila... 46 0.11
83emb|AL139382.12| Human DNA sequence from clone RP11-86N24 on chr... 46 0.11
84gb|AC130456.2| Homo sapiens chromosome 16 clone CTA-363E6, compl... 46 0.11
85emb|AL844607.4| Mouse DNA sequence from clone RP24-280G18 on chr... 46 0.11
86dbj|AK126270.1| Homo sapiens cDNA FLJ44282 fis, clone TRACH2003516 46 0.11
87gb|DQ378281.1| Drosophila virilis strain Tucson 15010-1001.10 fo... 46 0.11
88gb|AF352075.1| Gossypium hirsutum clone JESPR305 microsatellite ... 46 0.11
89gb|AF090533.1| Dictyostelium discoideum unconventional myosin he... 46 0.11
90emb|AL844155.6| Mouse DNA sequence from clone RP23-163L4 on chro... 46 0.11
91gb|AC104634.5| Homo sapiens BAC clone RP11-793L24 from 2, comple... 46 0.11
92gb|AC006560.8| Homo sapiens 12 BAC RPCI11-792F18 (Roswell Park C... 46 0.11
93gb|AC007539.8| Homo sapiens 12 BAC RCPI11-935C2 (Roswell Park Ca... 46 0.11
94gb|AC104069.3| Homo sapiens BAC clone RP11-279B11 from 2, comple... 46 0.11
95dbj|AB023032.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 46 0.11
96gb|U91321.1|HUU91321 Human Chromosome 16 BAC clone CIT987SK-A-36... 46 0.11
97emb|BX957273.10| Zebrafish DNA sequence from clone CH211-210P17 ... 46 0.11
98gb|AF100768.1|AF100768 Zea mays ZM2LRK pseudogene sequence 46 0.11
99emb|AL844545.7| Mouse DNA sequence from clone RP23-383C3 on chro... 46 0.11
100emb|AL935142.8| Zebrafish DNA sequence from clone CH211-227M23, ... 46 0.11
101emb|AL732543.8| Mouse DNA sequence from clone RP23-13D22 on chro... 46 0.11
102gb|AC154098.6| Mus musculus chromosome 3, clone RP23-196L9, comp... 46 0.11
103dbj|AB017910.1| Dictyostelium discoideum myoM gene, complete cds 46 0.11
104ref|NM_129615.2| Arabidopsis thaliana unknown protein AT2G40530 ... 44 0.43
105ref|NM_123617.2| Arabidopsis thaliana unknown protein AT5G42520 ... 44 0.43
106ref|XM_638977.1| Dictyostelium discoideum hypothetical protein (... 44 0.43
107ref|XM_635262.1| Dictyostelium discoideum hypothetical protein (... 44 0.43
108ref|XM_635257.1| Dictyostelium discoideum hypothetical protein (... 44 0.43
109ref|XM_635069.1| Dictyostelium discoideum hypothetical protein (... 44 0.43
110ref|XM_631251.1| Dictyostelium discoideum hypothetical protein (... 44 0.43
111ref|XM_450699.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.43
112ref|XM_422861.1| PREDICTED: Gallus gallus similar to mKIAA1606 p... 44 0.43
113ref|XM_709311.1| Candida albicans SC5314 hypothetical protein (C... 44 0.43
114ref|XM_709271.1| Candida albicans SC5314 hypothetical protein (C... 44 0.43
115gb|AY528719.1| Homo sapiens estrogen-related receptor gamma (ESR... 44 0.43
116gb|AY380572.1| Arabidopsis thaliana basic pentacysteine 6 (BPC6)... 44 0.43
117emb|AL512650.8| Human DNA sequence from clone RP11-23B9 on chrom... 44 0.43
118emb|AL935165.5| Zebrafish DNA sequence from clone CH211-198D18 i... 44 0.43
119gb|AF252607.1| Psathyrostachys juncea sucrose:fructan 6-fructosy... 44 0.43
120gb|BT024874.1| Arabidopsis thaliana At5g42520 mRNA, complete cds 44 0.43
121gb|AF222931.1| Psathyrostachys juncea sucrose:fructan 6-fructosy... 44 0.43
122gb|AC002336.3| Arabidopsis thaliana chromosome 2 clone T2P4 map ... 44 0.43
123gb|BT024670.1| Arabidopsis thaliana unknown protein (At2g40530) ... 44 0.43
124dbj|AK221752.1| Arabidopsis thaliana mRNA for hypothetical prote... 44 0.43
125dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.43
126emb|BX832181.1|CNS09ZRX Arabidopsis thaliana Full-length cDNA Co... 44 0.43
127emb|BX830595.1|CNS0A014 Arabidopsis thaliana Full-length cDNA Co... 44 0.43
128emb|BX832029.1|CNS09ZKV Arabidopsis thaliana Full-length cDNA Co... 44 0.43
129emb|BX831352.1|CNS09ZDY Arabidopsis thaliana Full-length cDNA Co... 44 0.43
130gb|AC116957.2| Dictyostelium discoideum chromosome 2 map 1685067... 44 0.43
131gb|AY088564.1| Arabidopsis thaliana clone 7878 mRNA, complete se... 44 0.43
132gb|AY085405.1| Arabidopsis thaliana clone 15024 mRNA, complete s... 44 0.43
133gb|AC109182.14| Mus musculus chromosome 7, clone RP23-223O9, com... 44 0.43
134dbj|AP005872.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.43
135dbj|AB016888.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 44 0.43
136dbj|AK109547.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.43
137emb|AL671994.9| B.floridae DNA sequence from clone XX-BF10F11, c... 44 0.43
138gb|AC119237.17| Mus musculus chromosome 9, clone RP24-228P8, com... 42 1.7
139ref|NM_100948.2| Arabidopsis thaliana unknown protein AT1G10720 ... 42 1.7
140ref|XM_633536.1| Dictyostelium discoideum hypothetical protein (... 42 1.7
141ref|XM_633393.1| Dictyostelium discoideum hypothetical protein (... 42 1.7
142ref|XM_631807.1| Dictyostelium discoideum hypothetical protein (... 42 1.7
143ref|XM_630717.1| Dictyostelium discoideum hypothetical protein (... 42 1.7
144gb|AC104414.8| Mus musculus chromosome 3, clone RP23-99I7, compl... 42 1.7
145ref|XM_714479.1| Candida albicans SC5314 putative 26S proteasome... 42 1.7
146ref|XM_714350.1| Candida albicans SC5314 putative 26S proteasome... 42 1.7
147gb|AC147058.3| Pan troglodytes BAC clone RP43-154B16 from 7, com... 42 1.7
148gb|AC163498.3| Mus musculus chromosome 1, clone RP23-86J11, comp... 42 1.7
149gb|AY543780.1| Salmo salar clone Alu216 microsatellite sequence 42 1.7
150gb|AC127240.3| Mus musculus BAC clone RP24-387H11 from chromosom... 42 1.7
151gb|AY262029.1| Cryptosporidium hominis 2636 60 kDa glycoprotein ... 42 1.7
152gb|AC109365.2| Oryza sativa (japonica cultivar-group) chromosome... 42 1.7
153gb|AC005022.1| Homo sapiens BAC clone GS1-371A6 from 7, complete... 42 1.7
154gb|AC025116.14| Mus musculus chromosome 1, clone RP23-124O19, co... 42 1.7
155gb|AC131026.11| Medicago truncatula clone mth2-6e18, complete se... 42 1.7
156gb|AY117306.1| Arabidopsis thaliana unknown protein (At1g10720) ... 42 1.7
157gb|AY074279.1| Arabidopsis thaliana unknown protein (At1g10720) ... 42 1.7
158emb|AL603711.6| Mouse DNA sequence from clone RP23-381B19 on chr... 42 1.7
159emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, ... 42 1.7
160emb|AL035522.1|ATT12J5 Arabidopsis thaliana DNA chromosome 4, BA... 42 1.7
161emb|AL022023.1|ATM4E13 Arabidopsis thaliana DNA chromosome 4, BA... 42 1.7
162gb|AC010565.6| Drosophila melanogaster 3L BAC RP98-19A3 (Roswell... 42 1.7
163gb|AC011118.13| Homo sapiens chromosome 8, clone RP11-163D8, com... 42 1.7
164gb|AC118347.2| Oryza sativa (japonica cultivar-group) chromosome... 42 1.7
165gb|AC092492.1|AC092492 Drosophila melanogaster, chromosome 2L, r... 42 1.7
166gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete g... 42 1.7
167dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
168gb|AC007354.3|T16B5 Arabidopsis thaliana chromosome 1 BAC T16B5 ... 42 1.7
169gb|AC116967.2| Dictyostelium discoideum chromosome 2 map 5481549... 42 1.7
170gb|AC009398.6|AC009398 Genomic sequence for Arabidopsis thaliana... 42 1.7
171gb|AY086831.1| Arabidopsis thaliana clone 28214 mRNA, complete s... 42 1.7
172ref|XM_308386.2| Anopheles gambiae str. PEST ENSANGP00000019065 ... 42 1.7
173emb|CT573054.2| Medicago truncatula chromosome 5 clone mte1-76j1... 42 1.7
174gb|AY105896.1| Zea mays PCO140796 mRNA sequence 42 1.7
175gb|AE003624.3| Drosophila melanogaster chromosome 2L, section 33... 42 1.7
176gb|AE003545.3| Drosophila melanogaster chromosome 3L, section 40... 42 1.7
177gb|AC005125.1|AC005125 Drosophila melanogaster, chromosome 2L, r... 42 1.7
178gb|CP000102.1| Methanosphaera stadtmanae DSM 3091, complete genome 42 1.7
179gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 42 1.7
180emb|AL713883.1|CNS07YP0 Mus musculus chromosome 11 region in the... 42 1.7
181gb|DQ213015.1| Nicotiana tabacum sucrose-phosphate synthase isof... 42 1.7
182ref|NM_101023.1| Arabidopsis thaliana unknown protein AT1G11500 ... 40 6.7
183ref|NM_123784.3| Arabidopsis thaliana unknown protein AT5G44170 ... 40 6.7
184ref|NM_115943.1| Arabidopsis thaliana unknown protein AT3G60790 ... 40 6.7
185ref|NM_116749.2| Arabidopsis thaliana DNA binding / transcriptio... 40 6.7
186ref|NM_117080.4| Arabidopsis thaliana transferase, transferring ... 40 6.7
187ref|NM_001036532.1| Arabidopsis thaliana unknown protein AT4G101... 40 6.7
188ref|NM_114688.2| Arabidopsis thaliana unknown protein AT3G48185 ... 40 6.7
189ref|NM_106425.2| Arabidopsis thaliana NIA1 (NITRATE REDUCTASE 1)... 40 6.7
190ref|XM_633249.1| Dictyostelium discoideum hypothetical protein (... 40 6.7
191ref|XM_632697.1| Dictyostelium discoideum hypothetical protein (... 40 6.7
192ref|XM_631774.1| Dictyostelium discoideum PKC domain-containing ... 40 6.7
193ref|XM_642541.1| Dictyostelium discoideum hypothetical protein (... 40 6.7
194ref|XM_642438.1| Dictyostelium discoideum hypothetical protein (... 40 6.7
195ref|XM_641800.1| Dictyostelium discoideum hypothetical protein (... 40 6.7
196ref|XM_637346.1| Dictyostelium discoideum dihydrolipoamide acety... 40 6.7
197ref|XM_637157.1| Dictyostelium discoideum hypothetical protein (... 40 6.7
198ref|XM_636213.1| Dictyostelium discoideum hypothetical protein (... 40 6.7
199ref|XM_635359.1| Dictyostelium discoideum hypothetical protein (... 40 6.7
200ref|XM_630983.1| Dictyostelium discoideum hypothetical protein (... 40 6.7
201ref|XM_630348.1| Dictyostelium discoideum hypothetical protein (... 40 6.7
202ref|XM_629461.1| Dictyostelium discoideum hypothetical protein (... 40 6.7
203gb|AC159273.4| Mus musculus BAC clone RP23-391G8 from chromosome... 40 6.7
204gb|DP000017.1| Sus scrofa target 1 genomic scaffold 40 6.7
205gb|BC082443.1| Xenopus laevis nucleoporin Nup153, mRNA (cDNA clo... 40 6.7
206gb|AC010993.13| Drosophila melanogaster clone BACR27O05, complet... 40 6.7
207ref|XM_362240.1| Magnaporthe grisea 70-15 hypothetical protein (... 40 6.7
208gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete... 40 6.7
209ref|XM_323555.1| Neurospora crassa OR74A hypothetical protein (N... 40 6.7
210ref|XM_955747.1| Neurospora crassa OR74A hypothetical protein (N... 40 6.7
211gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome 40 6.7
212gb|AY809201.1| Schistosoma japonicum SJCHGC04199 protein mRNA, p... 40 6.7
213gb|AC092497.2| Sus scrofa clone RP44-30C22, complete sequence 40 6.7
214ref|XM_705605.1| Candida albicans SC5314 hypothetical protein (C... 40 6.7
215gb|AC144768.2| Mus musculus BAC clone RP23-24K24 from chromosome... 40 6.7
216gb|AY812209.1| Schistosoma japonicum SJCHGC07181 protein mRNA, p... 40 6.7
217gb|AE017286.1| Desulfovibrio vulgaris subsp. vulgaris str. Hilde... 40 6.7
218gb|AC125010.6| Mus musculus chromosome 10, clone RP24-117L12, co... 40 6.7
219gb|U88178.1| Caenorhabditis elegans cosmid W09C3, complete sequence 40 6.7
220ref|NM_178298.2| Danio rerio selenoprotein P, plasma, 1b (sepp1b... 40 6.7
221gb|AY519603.1| Arabidopsis thaliana MYB transcription factor (At... 40 6.7
222gb|AC102228.8| Mus musculus chromosome 13, clone RP24-64M1, comp... 40 6.7
223gb|AC120558.12| Mus musculus chromosome 18, clone RP24-494K12, c... 40 6.7
224gb|AC133890.16| Mus musculus chromosome 10, clone RP23-339N24, c... 40 6.7
225gb|AC118689.16| Mus musculus chromosome 10, clone RP23-293N21, c... 40 6.7
226gb|AY484465.1| Dictyostelium discoideum kinesin family member 12... 40 6.7
227emb|AJ296731.1|PAB296731 Picea abies ATC microsatellite DNA, clo... 40 6.7
228gb|AC146257.3| Pan troglodytes BAC clone CH251-113A6 from Y, com... 40 6.7
229gb|BC086844.1| Danio rerio selenoprotein P, plasma, 1b, mRNA (cD... 40 6.7
230gb|AC132098.4| Mus musculus BAC clone RP24-401I1 from chromosome... 40 6.7
231gb|AC104100.6| Mus musculus BAC clone RP24-374D12 from chromosom... 40 6.7
232gb|AC117251.3| Mus musculus BAC clone RP24-372C12 from chromosom... 40 6.7
233gb|AC122020.3| Mus musculus BAC clone RP24-365G17 from chromosom... 40 6.7
234gb|AC122041.4| Mus musculus BAC clone RP24-443H19 from chromosom... 40 6.7
235ref|XM_816579.1| Trypanosoma cruzi strain CL Brener mucin-associ... 40 6.7
236gb|AC123819.2| Mus musculus BAC clone RP23-460M11 from chromosom... 40 6.7
237ref|XM_814052.1| Trypanosoma cruzi strain CL Brener mucin-associ... 40 6.7
238gb|AC122839.4| Mus musculus BAC clone RP23-193K9 from 8, complet... 40 6.7
239gb|AC116587.4| Mus musculus BAC clone RP23-409C18 from 12, compl... 40 6.7
240gb|BC042927.1| Xenopus laevis hypothetical protein MGC53311, mRN... 40 6.7
241gb|AC098885.3| Mus musculus BAC clone RP23-122L17 from 5, comple... 40 6.7
242ref|XM_725691.1| Plasmodium yoelii yoelii str. 17XNL protein ser... 40 6.7
243gb|AC165082.2| Mus musculus BAC clone RP23-412H17 from chromosom... 40 6.7
244gb|CP000001.1| Bacillus cereus E33L, complete genome 40 6.7
245emb|AL591506.24| Human DNA sequence from clone RP11-112N13 on ch... 40 6.7
246emb|AL355343.18| Human DNA sequence from clone RP11-455I14 on ch... 40 6.7
247emb|AL355582.8| Human DNA sequence from clone RP11-69L15 on chro... 40 6.7
248emb|AL354891.11| Human DNA sequence from clone RP11-44I7 on chro... 40 6.7
249gb|AC044849.12| Homo sapiens chromosome 8, clone RP11-489E7, com... 40 6.7
250ref|XM_795079.1| PREDICTED: Strongylocentrotus purpuratus hypoth... 40 6.7
251gb|BT009503.1| Triticum aestivum clone wr1.pk0085.h8:fis, full i... 40 6.7
252gb|AC137988.2| Trypanosoma cruzi strain Brener chromosome 3 clon... 40 6.7
253gb|AY090950.1| Arabidopsis thaliana putative nitrate reductase 1... 40 6.7
254gb|AY063777.1| Arabidopsis thaliana unknown protein (At3g48185) ... 40 6.7
255emb|CR555306.1| Azoarcus sp. EbN1 complete genome 40 6.7
256emb|AL807368.1|NC62D11 Neurospora crassa DNA linkage group V cos... 40 6.7
257emb|AL606612.3|OSJN00043 Oryza sativa genomic DNA, chromosome 4,... 40 6.7
258emb|AL161516.2|ATCHRIV28 Arabidopsis thaliana DNA chromosome 4, ... 40 6.7
259emb|AL161502.2|ATCHRIV14 Arabidopsis thaliana DNA chromosome 4, ... 40 6.7
260emb|AL096856.1|ATT24C20 Arabidopsis thaliana DNA chromosome 3, B... 40 6.7
261emb|AL049487.1|ATF28M11 Arabidopsis thaliana DNA chromosome 4, B... 40 6.7
262emb|AJ518062.1|PVU518062 Patella vulgata mRNA for caudal protein... 40 6.7
263emb|CR381633.6| Zebrafish DNA sequence from clone CH211-230M9 in... 40 6.7
264emb|CR938710.1| Medicago truncatula chromosome 5 clone mth2-170k... 40 6.7
265emb|CR376857.8| Zebrafish DNA sequence from clone DKEYP-44A3 in ... 40 6.7
266emb|AL607126.9| Mouse DNA sequence from clone RP23-206I16 on chr... 40 6.7
267emb|AL663040.6| Mouse DNA sequence from clone RP23-61M22 on chro... 40 6.7
268emb|AL645570.13| Mouse DNA sequence from clone RP23-377H12 on ch... 40 6.7
269emb|CR450850.9| Zebrafish DNA sequence from clone CH211-113J3 in... 40 6.7
270emb|CR931736.1| Medicago truncatula chromosome 5 clone mte1-84f2... 40 6.7
271gb|AC163892.2| Glomus intraradices clone JGIATSX-5O23, complete ... 40 6.7
272dbj|BS000583.2| Pan troglodytes chromosome Y clone:PTB-614F22, c... 40 6.7
273dbj|BS000631.2| Pan troglodytes chromosome Y clone: PTB-395F06, ... 40 6.7
274dbj|BS000652.2| Pan troglodytes chromosome Y clone: PTBY-013L08,... 40 6.7
275gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 40 6.7
276dbj|AB214491.1| Pinctada martensi DNA, ISSR marker ACG2-5' 40 6.7
277gb|AY072403.1| Arabidopsis thaliana putative protein (At5g44170)... 40 6.7
278gb|AC020701.8| Homo sapiens BAC clone RP11-200K10 from 4, comple... 40 6.7
279gb|AC091165.15| Homo sapiens chromosome 8, clone RP11-366G13, co... 40 6.7
280gb|AC021486.10| Homo sapiens chromosome , clone RP11-73I6, compl... 40 6.7
281gb|AF424624.1|AF424624 Arabidopsis thaliana At1g77760/T32E8_9 mR... 40 6.7
282dbj|AK221092.1| Arabidopsis thaliana mRNA for sucrose-phosphate ... 40 6.7
283dbj|AK220923.1| Arabidopsis thaliana mRNA for sucrose-phosphate ... 40 6.7
284emb|BX664627.16| Zebrafish DNA sequence from clone DKEYP-55D11 i... 40 6.7
285dbj|AK220698.1| Arabidopsis thaliana mRNA for sucrose-phosphate ... 40 6.7
286gb|AC160406.6| Mus musculus 10 BAC RP24-406K6 (Roswell Park Canc... 40 6.7
287gb|BT006282.1| Arabidopsis thaliana At5g44170 mRNA, complete cds 40 6.7
288gb|AF386932.1|AF386932 Arabidopsis thaliana Unknown protein mRNA... 40 6.7
289dbj|AK089862.1| Mus musculus activated spleen cDNA, RIKEN full-l... 40 6.7
290gb|AC093469.11| Mus musculus chromosome 7, clone RP23-21I4, comp... 40 6.7
291gb|AC116732.10| Mus musculus chromosome 3, clone RP23-347F4, com... 40 6.7
292gb|AC015524.7|AC015524 Homo sapiens chromosome 18, clone RP11-20... 40 6.7
293dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.7
294dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.7
295gb|AF322072.1|AF322072 Danio rerio selenoprotein Pb mRNA, comple... 40 6.7
296gb|AC008189.3|AC008189 Drosophila melanogaster, chromosome 3R, r... 40 6.7
297gb|AC105755.4| Homo sapiens BAC clone RP11-46H14 from 4, complet... 40 6.7
298gb|AC008091.6|AC008091 Drosophila melanogaster, chromosome 3R, r... 40 6.7
299gb|AC093393.3| Homo sapiens BAC clone RP11-816B18 from 2, comple... 40 6.7
300gb|AC012193.6|AC012193 Arabidopsis thaliana chromosome 1 BAC T32... 40 6.7
301gb|AC007547.26| Homo sapiens 3 BAC RP11-252O18 (Roswell Park Can... 40 6.7
302gb|AC116986.2| Dictyostelium discoideum chromosome 2 map 2234041... 40 6.7
303gb|AC006999.2|AC006999 Homo sapiens BAC clone RP11-462A19 from Y... 40 6.7
304gb|AC011661.5|AC011661 Genomic sequence for Arabidopsis thaliana... 40 6.7
305gb|AY087748.1| Arabidopsis thaliana clone 3817 mRNA, complete se... 40 6.7
306gb|AC132803.2| Homo sapiens chromosome 5 clone CTC-367F4, comple... 40 6.7
307gb|AC147034.2| Mus musculus BAC clone RP23-189C2 from chromosome... 40 6.7
308gb|AC115927.10| Mus musculus chromosome 1, clone RP24-529H22, co... 40 6.7
309emb|BX248245.10| Zebrafish DNA sequence from clone CH211-203M16 ... 40 6.7
310gb|AC098874.6| Homo sapiens BAC clone RP11-1299G23 from 2, compl... 40 6.7
311dbj|AK175938.1| Arabidopsis thaliana mRNA for sucrose-phosphate ... 40 6.7
312dbj|BS000064.1| Pan troglodytes chromosome 22 clone:RP43-044K09,... 40 6.7
313gb|AF240629.1|AF240629 Homo sapiens chromosome 21 map 21q21 clon... 40 6.7
314dbj|AB005239.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 6.7
315gb|AC155269.2| Mus musculus BAC clone RP23-215E17 from 12, compl... 40 6.7
316gb|AC012392.1|AC012392 Genomic Sequence For Arabidopsis thaliana... 40 6.7
317gb|AC153513.6| Mus musculus 10 BAC RP23-322K8 (Roswell Park Canc... 40 6.7
318gb|AC009888.1|AC009888 Drosophila melanogaster, chromosome 3R, r... 40 6.7
319emb|CR376776.19| Zebrafish DNA sequence from clone CH211-13I23, ... 40 6.7
320gb|AE003736.3| Drosophila melanogaster chromosome 3R, section 74... 40 6.7
321emb|AL135747.4|CNS01DVE Human chromosome 14 DNA sequence BAC R-1... 40 6.7
322gb|AE003769.2| Drosophila melanogaster chromosome 3R, section 10... 40 6.7
323gb|AE003492.3| Drosophila melanogaster chromosome X, section 44 ... 40 6.7
324emb|AL355075.6|CNS05TC9 Human chromosome 14 DNA sequence BAC R-2... 40 6.7
325gb|AE003605.3| Drosophila melanogaster chromosome 3R, section 3 ... 40 6.7
326dbj|AP001679.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 6.7
327emb|AL954136.13| Zebrafish DNA sequence from clone CH211-220E11,... 40 6.7
328gb|AF062907.1|AF062907 Arabidopsis thaliana putative transcripti... 40 6.7
329dbj|AP000820.4| Homo sapiens genomic DNA, chromosome 11q clone:R... 40 6.7
330emb|AL954176.9| Zebrafish DNA sequence from clone CH211-222J14, ... 40 6.7
331emb|AL845373.12| Mouse DNA sequence from clone RP23-211L7 on chr... 40 6.7
332gb|AF096373.1|T9A4 Arabidopsis thaliana BAC T9A4 40 6.7
333emb|BX004970.8| Zebrafish DNA sequence from clone DKEY-9I4, comp... 40 6.7
334gb|AE016879.1| Bacillus anthracis str. Ames, complete genome 40 6.7
335gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ... 40 6.7
336emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome 40 6.7
337gb|AC100746.4| Mus musculus chromosome 5, clone RP24-399G21, com... 40 6.7
338gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome 40 6.7
339gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 40 6.7
340emb|AL935067.2|CNS08CCJ Oryza sativa chromosome 12, . BAC OSJNBa... 40 6.7
341emb|BX000507.2|CNS08CDX Oryza sativa chromosome 12, . BAC OJ1003... 40 6.7
342emb|AL162295.1|ATT4C21 Arabidopsis thaliana DNA chromosome 3, BA... 40 6.7
343gb|AC151001.2| Mus musculus BAC clone RP23-45M16 from 7, complet... 40 6.7
344gb|AC127590.3| Mus musculus BAC clone RP23-147I5 from 13, comple... 40 6.7
345gb|AC132363.3| Mus musculus BAC clone RP23-455N1 from 1, complet... 40 6.7
346gb|AC139159.3| Mus musculus BAC clone RP23-119I13 from 8, comple... 40 6.7
347emb|AL929328.8| Mouse DNA sequence from clone RP23-332P16 on chr... 40 6.7
348emb|AL805904.12| Mouse DNA sequence from clone RP23-47B18 on chr... 40 6.7
349emb|AL928562.7| Mouse DNA sequence from clone RP23-288O19 on chr... 40 6.7
350gb|BT001182.1| Arabidopsis thaliana Unknown protein (At4g05100) ... 40 6.7
351gb|AC155348.1| Brassica rapa subsp. pekinensis chromosome Cytoge... 40 6.7
352emb|AL163195.5|CNS01RIH Human chromosome 14 DNA sequence BAC R-1... 40 6.7
353gb|U06634.1|DDU06634 Dictyostelium discoideum dihydrolipoamide t... 40 6.7
354dbj|AP000957.2| Homo sapiens genomic DNA, chromosome 21q21.1-q21... 40 6.7

>emb|AJ567377.2|HVU567377 Hordeum vulgare partial mRNA for
            sucrose-sucrose-1-fructosyltransferase (1-sst gene)
          Length = 2157

 Score =  866 bits (437), Expect = 0.0
 Identities = 458/465 (98%)
 Strand = Plus / Plus

                                                                        
Query: 2    cgggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcg 61
            |||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||
Sbjct: 1693 cgggtgctcgtggaccactccagtgtccaaagcttcgcgatgggtgggaggttgacgacg 1752

                                                                        
Query: 62   acgtcgagggcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaac 121
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1753 acgtcgagggcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaac 1812

                                                                        
Query: 122  aatgccaccggcacgagcgtcaccgctgagaaactcatcgtgcacgatatggactcgtcg 181
            |||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||
Sbjct: 1813 aatgccaccggcacgagcgtcaccgccgagaagctcatcgtgcacgatatggactcgtcg 1872

                                                                        
Query: 182  tacaaccatatatacacagacgacgacttggtagtcgtcggttaggctgatcgcttacaa 241
            |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 1873 tacaaccatatatacacagacgacgacttggtagtcgtcggttaggctgatcgcgtacaa 1932

                                                                        
Query: 242  gaagttgtggattgattgctcggtcggtggctccctttctcctagacacatgtaatggag 301
            ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 1933 gaagttgtggattgattgctcggtcggtggctccctttctcctagacacatgtgatggag 1992

                                                                        
Query: 302  tactatcgactctgcctatcagtccatttttgttcttccttctctggagtttgatttagt 361
            ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 1993 tactatcgactctgcctatcagtccatttttgttcttccttctcttgagtttgatttagt 2052

                                                                        
Query: 362  aattaagatgaattagatgatgttgatgacagggctatgatgttgttgatgatgatgatt 421
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2053 aattaagatgaattagatgatgttgatgacagggctatgatgttgttgatgatgatgatt 2112

                                                         
Query: 422  gttcacttgtaaatcaatttgttgggaatcaaaatggcatggatg 466
            |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2113 gttcacttgtaaatcaatttgttgggaatcaaaatggcatggatg 2157



to top

>dbj|AB029888.1| Triticum aestivum 1-SST mRNA for sucrose:sucrose
            1-fructosytransferase, complete cds
          Length = 2330

 Score =  490 bits (247), Expect = e-135
 Identities = 433/488 (88%), Gaps = 14/488 (2%)
 Strand = Plus / Plus

                                                                        
Query: 3    gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcga 62
            ||||||||||||||||||||||||| || |||||||||||||| ||||||||||| || |
Sbjct: 1821 gggtgctcgtggaccactccattgtgcagagcttcgcgatgggcgggaggttgacagcaa 1880

                                                                        
Query: 63   cgtcgagggcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaaca 122
            ||||||||||||||||||||||||||||||| ||||| |||||||||||| |||||||||
Sbjct: 1881 cgtcgagggcgtacccgaccgaggccatctacgcggcagcgggggtctacatgttcaaca 1940

                                                                        
Query: 123  atgccaccggcacgagcgtcaccgctgagaaactcatcgtgcacgatatggactcgtcgt 182
            | ||||||||||| ||||||||||| ||||| ||  ||||||| ||||||||||||||||
Sbjct: 1941 acgccaccggcactagcgtcaccgccgagaagcttgtcgtgcatgatatggactcgtcgt 2000

                                                                        
Query: 183  acaaccatatatacacagacgacgacttggtagtcgtcggttaggctgatcgcttacaag 242
            ||||||||||||||||||| || |||||||||||||||| |||| |||||| ||||||| 
Sbjct: 2001 acaaccatatatacacagatgatgacttggtagtcgtcgattagactgatcacttacaac 2060

                                                                        
Query: 243  aagttgtggattgattg--ctcggtcggtggctcccttt-ctcctagacacatgta-atg 298
            ||||| ||||| | |||  |||||||||||||| ||||| ||| | ||||  || | |||
Sbjct: 2061 aagttatggatcggttgttctcggtcggtggcttccttttctcttggacagttggagatg 2120

                                                                        
Query: 299  gagtactatcgactctgcctatcagtccatttttgttcttccttctctggagtttgattt 358
            |||||||| ||||||||||||||| | |||||||||||||| |  |||||  |||| |||
Sbjct: 2121 gagtactagcgactctgcctatcacttcatttttgttcttcgt--tctggtttttggttt 2178

                                                                        
Query: 359  agtaattaagatgaattagatgatgttgatgacagggctatgatgttgttgatgatgatg 418
            ||    |||||||||||||||| ||||||||||||||||||||||||| |||||||||||
Sbjct: 2179 ag----taagatgaattagatggtgttgatgacagggctatgatgttgatgatgatgatg 2234

                                                                        
Query: 419  ---attgttcacttgtaaatcaatttgtt-gggaatcaaaatggcatggatgccaccaag 474
               ||||||||| |||||||||||||||| |||||| |||||||||||||||||||||||
Sbjct: 2235 atcattgttcacatgtaaatcaatttgttggggaatgaaaatggcatggatgccaccaag 2294

                    
Query: 475  tttaagtg 482
            ||||||||
Sbjct: 2295 tttaagtg 2302



to top

>dbj|AB159786.1| Triticum aestivum 1-SST gene for sucrose:sucrose
            1-fructosyltransferase, complete cds
          Length = 3326

 Score =  301 bits (152), Expect = 1e-78
 Identities = 206/224 (91%)
 Strand = Plus / Plus

                                                                        
Query: 3    gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcga 62
            ||||||||||||||||||||||||| || |||||||||||||| ||||||||||| || |
Sbjct: 3103 gggtgctcgtggaccactccattgtgcagagcttcgcgatgggcgggaggttgacagcaa 3162

                                                                        
Query: 63   cgtcgagggcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaaca 122
            ||||||||||||||||||||||||||||||| ||||| |||||||||||| |||||||||
Sbjct: 3163 cgtcgagggcgtacccgaccgaggccatctacgcggcagcgggggtctacatgttcaaca 3222

                                                                        
Query: 123  atgccaccggcacgagcgtcaccgctgagaaactcatcgtgcacgatatggactcgtcgt 182
            | ||||||||||| ||||||||||| ||||| ||  ||||||| ||||||||||||||||
Sbjct: 3223 acgccaccggcactagcgtcaccgccgagaagcttgtcgtgcatgatatggactcgtcgt 3282

                                                        
Query: 183  acaaccatatatacacagacgacgacttggtagtcgtcggttag 226
            ||||||||||||||||||| || |||||||||||||||| ||||
Sbjct: 3283 acaaccatatatacacagatgatgacttggtagtcgtcgattag 3326



to top

>dbj|AB088410.1| Triticum aestivum 1-FFT-B mRNA for fructan:fructan
            1-fructosyltransferase, complete cds
          Length = 2251

 Score =  264 bits (133), Expect = 2e-67
 Identities = 235/269 (87%)
 Strand = Plus / Plus

                                                                        
Query: 3    gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcga 62
            |||||||||||||||||||||| || || |||||||  ||||| |||||| |||||||||
Sbjct: 1769 gggtgctcgtggaccactccatcgtgcagagcttcgtcatgggcgggaggatgacggcga 1828

                                                                        
Query: 63   cgtcgagggcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaaca 122
            ||||||||||||||||||| |||||||| || ||||||||||||||||||||||||||||
Sbjct: 1829 cgtcgagggcgtacccgacggaggccatttacgcggcggcgggggtctacctgttcaaca 1888

                                                                        
Query: 123  atgccaccggcacgagcgtcaccgctgagaaactcatcgtgcacgatatggactcgtcgt 182
            |||||||| || | | | ||||||||||||| ||||| |||||||| ||||| |||||||
Sbjct: 1889 atgccaccagcgccaccatcaccgctgagaagctcattgtgcacgacatggattcgtcgt 1948

                                                                        
Query: 183  acaaccatatatacacagacgacgacttggtagtcgtcggttaggctgatcgcttacaag 242
            ||||||  |||| ||| |||| ||||||||||||| ||| |||| |||||| ||||||| 
Sbjct: 1949 acaaccggatattcacggacgccgacttggtagtcctcgattagactgatcacttacaac 2008

                                         
Query: 243  aagttgtggattgattgctcggtcggtgg 271
            ||||  ||||||  |||||||||| ||||
Sbjct: 2009 aagtaatggattttttgctcggtccgtgg 2037



 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 365  taagatgaattagatgatgttg 386
            ||||||||||||||||||||||
Sbjct: 2134 taagatgaattagatgatgttg 2155



to top

>dbj|AB088409.1| Triticum aestivum 1-FFT-A mRNA for fructan:fructan
            1-fructosyltransferase, complete cds
          Length = 2304

 Score =  242 bits (122), Expect = 9e-61
 Identities = 241/280 (86%), Gaps = 3/280 (1%)
 Strand = Plus / Plus

                                                                        
Query: 3    gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcga 62
            |||||||||||||||||||||| || || ||||||| |||||| |||||| |||||||||
Sbjct: 1808 gggtgctcgtggaccactccatcgtgcagagcttcgtgatgggcgggaggatgacggcga 1867

                                                                        
Query: 63   cgtcgagggcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaaca 122
            | || ||||| |||||||| |||||||| || ||||||||||||||||||||||||||||
Sbjct: 1868 catcaagggcctacccgacggaggccatttacgcggcggcgggggtctacctgttcaaca 1927

                                                                        
Query: 123  atgccaccggcacgagcgtcaccgctgagaaactcatcgtgcacgatatggactcgtcgt 182
            ||||||||||| | ||| ||||||||||||| ||| |||||||||| ||||| |||||||
Sbjct: 1928 atgccaccggcgccagcatcaccgctgagaagctcgtcgtgcacgacatggattcgtcgt 1987

                                                                        
Query: 183  acaaccatatatacacagacgacgacttggtagtcgtcggttaggc---tgatcgcttac 239
            ||||||  |||| ||||||||| |||||| ||||| | | |||| |   | ||| |||||
Sbjct: 1988 acaaccggatattcacagacgaagacttgttagtccttgattagactaatcatcacttac 2047

                                                    
Query: 240  aagaagttgtggattgattgctcggtcggtggctcccttt 279
            |  ||||| |||| || ||||||||||||||||| |||||
Sbjct: 2048 agtaagttatggactgtttgctcggtcggtggcttccttt 2087



 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 365  taagatgaattagatgatgttg 386
            ||||||||||||||||||||||
Sbjct: 2173 taagatgaattagatgatgttg 2194



to top

>gb|AY245431.1| Lolium perenne sucrose:sucrose 1-fructosyltransferase mRNA, complete
            cds
          Length = 1962

 Score =  168 bits (85), Expect = 1e-38
 Identities = 178/209 (85%)
 Strand = Plus / Plus

                                                                        
Query: 3    gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcga 62
            ||||||| |||||||||||||| || || |||||||||||||| |||||| | |||||||
Sbjct: 1751 gggtgctagtggaccactccatcgtgcagagcttcgcgatgggcgggaggatcacggcga 1810

                                                                        
Query: 63   cgtcgagggcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaaca 122
            ||||| ||||||||||||| ||||||||||| ||||| |||||||||||||| |||||||
Sbjct: 1811 cgtcgcgggcgtacccgacggaggccatctacgcggccgcgggggtctacctcttcaaca 1870

                                                                        
Query: 123  atgccaccggcacgagcgtcaccgctgagaaactcatcgtgcacgatatggactcgtcgt 182
            | ||||| ||| | | ||||||||| ||||  ||| |||||||||| |||| |||  |  
Sbjct: 1871 acgccacgggcgccaccgtcaccgccgagaggctcgtcgtgcacgagatggcctcagctg 1930

                                         
Query: 183  acaaccatatatacacagacgacgacttg 211
            |||||||||| | |||  |||||||||||
Sbjct: 1931 acaaccatatcttcacgaacgacgacttg 1959



to top

>gb|AF494041.1| Lolium perenne fructan 6-fructosyltransferase mRNA, complete cds
          Length = 2279

 Score =  157 bits (79), Expect = 4e-35
 Identities = 148/171 (86%)
 Strand = Plus / Plus

                                                                        
Query: 3    gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcga 62
            |||||||||||||||||||||| || |||||||||||||||||||||||| | |||||||
Sbjct: 1738 gggtgctcgtggaccactccatcgtgcaaagcttcgcgatgggtgggagggtcacggcga 1797

                                                                        
Query: 63   cgtcgagggcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaaca 122
            ||||| | | ||||||||| ||||||||||| ||   ||| ||||| |||||||||||||
Sbjct: 1798 cgtcgcgagtgtacccgacggaggccatctacgccagggctggggtgtacctgttcaaca 1857

                                                               
Query: 123  atgccaccggcacgagcgtcaccgctgagaaactcatcgtgcacgatatgg 173
            | ||||||||| | ||||| || || ||||  |||||||||||||| ||||
Sbjct: 1858 acgccaccggcgccagcgtgacagcggagaggctcatcgtgcacgagatgg 1908



to top

>dbj|AB186920.1| Lolium perenne mRNA for putative fructosyltransferase1, complete cds
          Length = 2268

 Score =  149 bits (75), Expect = 1e-32
 Identities = 147/171 (85%)
 Strand = Plus / Plus

                                                                        
Query: 3    gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcga 62
            |||||||||||||||||||||| || || ||||||||||||||||||||| | |||||||
Sbjct: 1732 gggtgctcgtggaccactccatcgtgcagagcttcgcgatgggtgggagggtcacggcga 1791

                                                                        
Query: 63   cgtcgagggcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaaca 122
            ||||| | | ||||||||| ||||||||||| ||   ||| ||||| |||||||||||||
Sbjct: 1792 cgtcgcgagtgtacccgacggaggccatctacgccagggctggggtgtacctgttcaaca 1851

                                                               
Query: 123  atgccaccggcacgagcgtcaccgctgagaaactcatcgtgcacgatatgg 173
            | ||||||||| | ||||| || || ||||  |||||||||||||| ||||
Sbjct: 1852 acgccaccggcgccagcgtgacagcggagaggctcatcgtgcacgagatgg 1902



to top

>emb|AJ297369.1|FAR297369 Festuca arundinacea mRNA for sucrose:sucrose 1-fructosyltransferase
            (1-SST gene)
          Length = 2045

 Score =  145 bits (73), Expect = 2e-31
 Identities = 169/201 (84%)
 Strand = Plus / Plus

                                                                        
Query: 11   gtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcgacgtcgagg 70
            ||||||||||||||||| || ||||||||||||||||||||| | |||||||| ||| ||
Sbjct: 1762 gtggaccactccattgtgcagagcttcgcgatgggtgggaggattacggcgacatcgcgg 1821

                                                                        
Query: 71   gcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaacaatgccacc 130
            ||||||||||| ||||| ||||| || |||||||| |||||||| |||||||| ||||| 
Sbjct: 1822 gcgtacccgactgaggctatctacgcagcggcgggagtctacctcttcaacaacgccacg 1881

                                                                        
Query: 131  ggcacgagcgtcaccgctgagaaactcatcgtgcacgatatggactcgtcgtacaaccat 190
            ||  | | ||||||||| ||||  ||| ||||| |||| |||| |||| |  ||||||||
Sbjct: 1882 ggtgccaccgtcaccgccgagaggctcgtcgtgtacgagatggcctcggctgacaaccat 1941

                                 
Query: 191  atatacacagacgacgacttg 211
            || | |||  |||||||||||
Sbjct: 1942 atcttcacgaacgacgacttg 1962



to top

>emb|AJ532550.1|LTE532550 Lolium temulentum mRNA for putative fructan 6-fructosyltransferase
            (6ft gene)
          Length = 2331

 Score =  143 bits (72), Expect = 6e-31
 Identities = 150/176 (85%)
 Strand = Plus / Plus

                                                                        
Query: 3    gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcga 62
            |||||||||||||||||||||| || || |||||||||||||| |||||| | |||||||
Sbjct: 1747 gggtgctcgtggaccactccatcgtgcagagcttcgcgatgggagggagggtcacggcga 1806

                                                                        
Query: 63   cgtcgagggcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaaca 122
            | ||||||| |||||| || ||||||||||| ||   ||| ||||| |||||||||||||
Sbjct: 1807 catcgagggtgtacccaacggaggccatctacgctagggcaggggtgtacctgttcaaca 1866

                                                                    
Query: 123  atgccaccggcacgagcgtcaccgctgagaaactcatcgtgcacgatatggactcg 178
            ||||||||||| | ||||| || || ||||  ||| |||||||||| |||| ||||
Sbjct: 1867 atgccaccggcgccagcgtgacagcggagaggctcgtcgtgcacgagatggcctcg 1922



to top

>gb|AF192394.1|AF192394 Poa secunda sucrose:fructan 6-fructosyltransferase (6-SFT) mRNA,
            complete cds
          Length = 2057

 Score =  117 bits (59), Expect = 4e-23
 Identities = 146/175 (83%)
 Strand = Plus / Plus

                                                                        
Query: 3    gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcga 62
            |||||||||| ||||||||||| || || |||||||||||||| |||||| | |||||||
Sbjct: 1691 gggtgctcgtagaccactccatcgtgcagagcttcgcgatgggcgggagggtcacggcga 1750

                                                                        
Query: 63   cgtcgagggcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaaca 122
            ||||| ||| ||||||||| ||||| ||||| ||||| || ||||| ||| | |||||||
Sbjct: 1751 cgtcgcgggtgtacccgacagaggctatctacgcggccgcaggggtgtacgttttcaaca 1810

                                                                   
Query: 123  atgccaccggcacgagcgtcaccgctgagaaactcatcgtgcacgatatggactc 177
            | || |||||| | ||||| || || ||||  ||| || ||||||| ||||||||
Sbjct: 1811 acgcaaccggcgccagcgtgacggccgagaggctcgtcatgcacgaaatggactc 1865



to top

>gb|AF492836.1| Lolium perenne putative sucrose:sucrose 1-fructosyltransferase mRNA,
            complete cds
          Length = 2508

 Score =  105 bits (53), Expect = 1e-19
 Identities = 104/121 (85%)
 Strand = Plus / Plus

                                                                        
Query: 3    gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcga 62
            ||||||| |||||||||||||| || || ||||||| |||||||||||||   |||| ||
Sbjct: 1774 gggtgctagtggaccactccatcgtgcagagcttcgtgatgggtgggaggaccacggtga 1833

                                                                        
Query: 63   cgtcgagggcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaaca 122
            | ||| |||| |||||||| ||||||||||| || ||||| ||||| |||||||||||||
Sbjct: 1834 catcgcgggcatacccgacggaggccatctacgccgcggcaggggtgtacctgttcaaca 1893

             
Query: 123  a 123
            |
Sbjct: 1894 a 1894



to top

>dbj|AB125218.1| Lolium perenne mRNA for putative fructosyltransferase2, complete cds
          Length = 2462

 Score =  105 bits (53), Expect = 1e-19
 Identities = 104/121 (85%)
 Strand = Plus / Plus

                                                                        
Query: 3    gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcga 62
            ||||||| |||||||||||||| || || ||||||| |||||||||||||   |||| ||
Sbjct: 1759 gggtgctagtggaccactccatcgtgcagagcttcgtgatgggtgggaggaccacggtga 1818

                                                                        
Query: 63   cgtcgagggcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaaca 122
            | ||| |||| |||||||| ||||||||||| || ||||| ||||| |||||||||||||
Sbjct: 1819 catcgcgggcatacccgacggaggccatctacgccgcggcaggggtgtacctgttcaaca 1878

             
Query: 123  a 123
            |
Sbjct: 1879 a 1879



to top

>gb|AY575557.1| Oryza sativa (indica cultivar-group) cultivar IR64 vacuolar
           invertase 2 mRNA, partial cds
          Length = 503

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 153/188 (81%)
 Strand = Plus / Plus

                                                                       
Query: 2   cgggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcg 61
           ||||||||||| ||||||||||| ||| | |||||||||  ||| |||||||  ||||||
Sbjct: 64  cgggtgctcgtcgaccactccatcgtcgagagcttcgcgcagggggggaggtccacggcg 123

                                                                       
Query: 62  acgtcgagggcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaac 121
           |||||| ||| |||||| || ||||||||||| ||    || || |||| ||| ||||||
Sbjct: 124 acgtcgcgggtgtaccccacggaggccatctacgccaacgccggcgtcttcctcttcaac 183

                                                                       
Query: 122 aatgccaccggcacgagcgtcaccgctgagaaactcatcgtgcacgatatggactcgtcg 181
           || |||||| || || ||||||| ||  |||| ||| |||| ||||| |||||||| || 
Sbjct: 184 aacgccaccagcgcgcgcgtcacggccaagaagctcgtcgtccacgagatggactcctcc 243

                   
Query: 182 tacaacca 189
           ||||||||
Sbjct: 244 tacaacca 251



to top

>emb|AJ635225.1| Triticum aestivum mRNA for acid beta-fructofuranosidase precursor
            (inv1 gene)
          Length = 2250

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 108/128 (84%)
 Strand = Plus / Plus

                                                                        
Query: 3    gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcga 62
            ||||||| |||||||| ||||||||  | ||||| || ||||| ||||||||||||||||
Sbjct: 1855 gggtgctagtggaccattccattgttgagagctttgcaatgggcgggaggttgacggcga 1914

                                                                        
Query: 63   cgtcgagggcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaaca 122
            ||||  ||| |||||| || ||||||||||||||    || ||||||||||| |||||||
Sbjct: 1915 cgtcacgggtgtacccaacggaggccatctatgccaacgctggggtctacctcttcaaca 1974

                    
Query: 123  atgccacc 130
            | ||||||
Sbjct: 1975 acgccacc 1982



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2,
              complete sequence
          Length = 35954743

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 153/188 (81%)
 Strand = Plus / Plus

                                                                          
Query: 2      cgggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcg 61
              ||||||||||| ||||||||||| ||| | |||||||||  ||| |||||||  ||||||
Sbjct: 346316 cgggtgctcgtcgaccactccatcgtcgagagcttcgcgcagggggggaggtccacggcg 346375

                                                                          
Query: 62     acgtcgagggcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaac 121
              |||||| ||| |||||| || ||||||||||| ||    || || |||| ||| ||||||
Sbjct: 346376 acgtcgcgggtgtaccccacggaggccatctacgccaacgccggcgtcttcctcttcaac 346435

                                                                          
Query: 122    aatgccaccggcacgagcgtcaccgctgagaaactcatcgtgcacgatatggactcgtcg 181
              || |||||| || || ||||||| ||  |||| ||| |||| ||||| |||||||| || 
Sbjct: 346436 aacgccaccagcgcgcgcgtcacggccaagaagctcgtcgtccacgagatggactcctcc 346495

                      
Query: 182    tacaacca 189
              ||||||||
Sbjct: 346496 tacaacca 346503



to top

>gb|AF276704.1|AF276704 Oryza sativa vacuolar acid invertase (INV3) gene, complete cds
          Length = 3725

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 153/188 (81%)
 Strand = Plus / Plus

                                                                        
Query: 2    cgggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcg 61
            ||||||||||| ||||||||||| ||| | |||||||||  ||| |||||||  ||||||
Sbjct: 3363 cgggtgctcgtcgaccactccatcgtcgagagcttcgcgcagggggggaggtccacggcg 3422

                                                                        
Query: 62   acgtcgagggcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaac 121
            |||||| ||| |||||| || ||||||||||| ||    || || |||| ||| ||||||
Sbjct: 3423 acgtcgcgggtgtaccccacggaggccatctacgccaacgccggcgtcttcctcttcaac 3482

                                                                        
Query: 122  aatgccaccggcacgagcgtcaccgctgagaaactcatcgtgcacgatatggactcgtcg 181
            || |||||| || || ||||||| ||  |||| ||| |||| ||||| |||||||| || 
Sbjct: 3483 aacgccaccagcgcgcgcgtcacggccaagaagctcgtcgtccacgagatggactcctcc 3542

                    
Query: 182  tacaacca 189
            ||||||||
Sbjct: 3543 tacaacca 3550



to top

>dbj|AP004851.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1359_D06
          Length = 146805

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 153/188 (81%)
 Strand = Plus / Plus

                                                                         
Query: 2     cgggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcg 61
             ||||||||||| ||||||||||| ||| | |||||||||  ||| |||||||  ||||||
Sbjct: 75100 cgggtgctcgtcgaccactccatcgtcgagagcttcgcgcagggggggaggtccacggcg 75159

                                                                         
Query: 62    acgtcgagggcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaac 121
             |||||| ||| |||||| || ||||||||||| ||    || || |||| ||| ||||||
Sbjct: 75160 acgtcgcgggtgtaccccacggaggccatctacgccaacgccggcgtcttcctcttcaac 75219

                                                                         
Query: 122   aatgccaccggcacgagcgtcaccgctgagaaactcatcgtgcacgatatggactcgtcg 181
             || |||||| || || ||||||| ||  |||| ||| |||| ||||| |||||||| || 
Sbjct: 75220 aacgccaccagcgcgcgcgtcacggccaagaagctcgtcgtccacgagatggactcctcc 75279

                     
Query: 182   tacaacca 189
             ||||||||
Sbjct: 75280 tacaacca 75287



to top

>dbj|AK072245.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023002K22, full
            insert sequence
          Length = 2443

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 153/188 (81%)
 Strand = Plus / Plus

                                                                        
Query: 2    cgggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcg 61
            ||||||||||| ||||||||||| ||| | |||||||||  ||| |||||||  ||||||
Sbjct: 1884 cgggtgctcgtcgaccactccatcgtcgagagcttcgcgcagggggggaggtccacggcg 1943

                                                                        
Query: 62   acgtcgagggcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaac 121
            |||||| ||| |||||| || ||||||||||| ||    || || |||| ||| ||||||
Sbjct: 1944 acgtcgcgggtgtaccccacggaggccatctacgccaacgccggcgtcttcctcttcaac 2003

                                                                        
Query: 122  aatgccaccggcacgagcgtcaccgctgagaaactcatcgtgcacgatatggactcgtcg 181
            || |||||| || || ||||||| ||  |||| ||| |||| ||||| |||||||| || 
Sbjct: 2004 aacgccaccagcgcgcgcgtcacggccaagaagctcgtcgtccacgagatggactcctcc 2063

                    
Query: 182  tacaacca 189
            ||||||||
Sbjct: 2064 tacaacca 2071



to top

>gb|AY575717.1| Triticum monococcum vacuolar invertase1 (vin1) mRNA, complete cds
          Length = 2414

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 104/123 (84%)
 Strand = Plus / Plus

                                                                        
Query: 11   gtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcgacgtcgagg 70
            ||||||||||| |||||  | |||||||| |||||||||||||  || ||||||||||||
Sbjct: 1805 gtggaccactcgattgtggagagcttcgccatgggtgggaggtccaccgcgacgtcgagg 1864

                                                                        
Query: 71   gcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaacaatgccacc 130
            | ||| ||||| ||||||||||| || || || || || ||||| |||||||| ||||||
Sbjct: 1865 gtgtatccgacggaggccatctacgccgccgctggcgtgtaccttttcaacaacgccacc 1924

               
Query: 131  ggc 133
            |||
Sbjct: 1925 ggc 1927



to top

>gb|DQ073970.1| Lolium perenne fructosyltransferase-like protein mRNA, complete cds
          Length = 1962

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 143/176 (81%)
 Strand = Plus / Plus

                                                                        
Query: 3    gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcga 62
            ||||||||||||| || || || ||  | |||||||||||||| |||||||  |||| ||
Sbjct: 1772 gggtgctcgtggatcattcgatcgtagagagcttcgcgatgggcgggaggtcaacggtga 1831

                                                                        
Query: 63   cgtcgagggcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaaca 122
            ||||| |||  |||||||| ||||||||||| | ||||||| |||  ||  | |||||||
Sbjct: 1832 cgtcgcgggtatacccgacggaggccatctacgaggcggcgagggcgtatgttttcaaca 1891

                                                                    
Query: 123  atgccaccggcacgagcgtcaccgctgagaaactcatcgtgcacgatatggactcg 178
            | ||||||||| | |  |||||||  |||| |||| | ||||||||||||||||||
Sbjct: 1892 acgccaccggctccactgtcaccgtcgagagactcgtggtgcacgatatggactcg 1947



to top

>gb|AF481763.1| Lolium perenne fructosyltransferase (FT1) mRNA, complete cds
          Length = 2386

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 150/187 (80%)
 Strand = Plus / Plus

                                                                        
Query: 3    gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcga 62
            ||||||||||||||||||| || ||  | |||||||| ||||| || ||||  ||||| |
Sbjct: 1780 gggtgctcgtggaccactcaatcgtggagagcttcgccatgggcggcaggtccacggcaa 1839

                                                                        
Query: 63   cgtcgagggcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaaca 122
            | ||||||| |||||| || |||||||||||||  || || || |  || || |||||||
Sbjct: 1840 catcgagggtgtacccaacggaggccatctatggcgctgccggtgcgtatcttttcaaca 1899

                                                                        
Query: 123  atgccaccggcacgagcgtcaccgctgagaaactcatcgtgcacgatatggactcgtcgt 182
            | |||||||||     |||||||| |||||| ||| | ||||| || ||||||||||| |
Sbjct: 1900 acgccaccggcggctccgtcaccgttgagaagctcgtggtgcatgagatggactcgtcct 1959

                   
Query: 183  acaacca 189
            |||||||
Sbjct: 1960 acaacca 1966



to top

>gb|DQ267825.1| Dendrocalamopsis oldhamii vacuolar invertase BObetaFRUCT3 mRNA,
            complete cds
          Length = 2155

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 144/179 (80%)
 Strand = Plus / Plus

                                                                        
Query: 11   gtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcgacgtcgagg 70
            ||||| |||||||| ||| | |||||||||  ||| ||||||| ||||||||||||| | 
Sbjct: 1783 gtggatcactccatcgtcgagagcttcgcgcagggcgggaggtcgacggcgacgtcgcgc 1842

                                                                        
Query: 71   gcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaacaatgccacc 130
            | |||||| || ||||||||||| ||    || ||||| ||||| |||||||||||||||
Sbjct: 1843 gtgtacccaacggaggccatctacgccaacgcaggggtgtacctcttcaacaatgccacc 1902

                                                                       
Query: 131  ggcacgagcgtcaccgctgagaaactcatcgtgcacgatatggactcgtcgtacaacca 189
              | |  ||||||||||  |||  ||| |||| ||||| |||||||| || ||||||||
Sbjct: 1903 aacgcccgcgtcaccgccaagagcctcgtcgtccacgagatggactcctcctacaacca 1961



to top

>emb|AJ623275.1| Hordeum vulgare mRNA for soluble acid invertase (sai gene)
          Length = 2038

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 84/100 (84%)
 Strand = Plus / Plus

                                                                        
Query: 30   aaagcttcgcgatgggtgggaggttgacggcgacgtcgagggcgtacccgaccgaggcca 89
            ||||||| ||||||||||||||||||||||| || ||  | | ||||||||| |||||||
Sbjct: 1866 aaagctttgcgatgggtgggaggttgacggcaacatcacgagtgtacccgacggaggcca 1925

                                                    
Query: 90   tctatgcggcggcgggggtctacctgttcaacaatgccac 129
            |||| ||    || ||||| ||||| ||||||||||||||
Sbjct: 1926 tctacgccaacgctggggtgtacctcttcaacaatgccac 1965



to top

>gb|AF222935.1| Pseudoroegneria spicata sucrose:fructan 6-fructosyltransferase
           (6-SFT) gene, partial cds
          Length = 311

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 3   gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggt 53
           |||| ||||||||||||||||| || || ||||||||||||||||||||||
Sbjct: 136 gggtactcgtggaccactccatcgtgcagagcttcgcgatgggtgggaggt 186



to top

>emb|AJ532551.1|LTE532551 Lolium temulentum partial mRNA for putative soluble acid invertase
            (inv1:2 gene)
          Length = 1998

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 149/187 (79%)
 Strand = Plus / Plus

                                                                        
Query: 3    gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcga 62
            ||||||||||||||||||| || ||  | |||||||  ||||| || ||||  || ||||
Sbjct: 1392 gggtgctcgtggaccactcaatcgtggagagcttcgtcatgggaggaaggtccacagcga 1451

                                                                        
Query: 63   cgtcgagggcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaaca 122
            ||||||||| ||||||||| ||||| ||||| |  || ||||| |  || || |||||||
Sbjct: 1452 cgtcgagggtgtacccgacggaggctatctacggtgctgcgggtgcatatcttttcaaca 1511

                                                                        
Query: 123  atgccaccggcacgagcgtcaccgctgagaaactcatcgtgcacgatatggactcgtcgt 182
            |||||||| |    | ||||||||  ||||| ||| | ||||| || ||||||||||| |
Sbjct: 1512 atgccaccagtggcaccgtcaccgtcgagaagctcgtggtgcatgagatggactcgtcct 1571

                   
Query: 183  acaacca 189
            |||||||
Sbjct: 1572 acaacca 1578



to top

>gb|AF069309.1| Triticum aestivum vacuolar invertase (WIVRV) mRNA, partial cds
          Length = 1840

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 140/174 (80%), Gaps = 1/174 (0%)
 Strand = Plus / Plus

                                                                        
Query: 3    gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcga 62
            ||||||| ||||||||||| || ||  | |||||||| |||||||| ||||  || ||||
Sbjct: 1247 gggtgctggtggaccactcgatcgtggagagcttcgccatgggtggaaggtccaccgcga 1306

                                                                        
Query: 63   -cgtcgagggcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaac 121
             | ||||||| ||| ||||| ||||||||||| || || || || || ||||| ||||||
Sbjct: 1307 acatcgagggtgtatccgacggaggccatctacgccgccgctggcgtgtaccttttcaac 1366

                                                                  
Query: 122  aatgccaccggcacgagcgtcaccgctgagaaactcatcgtgcacgatatggac 175
            || ||||||||| |   ||||||||  ||||| ||| | |||||||| ||||||
Sbjct: 1367 aacgccaccggcgctgccgtcaccgtggagaagctcgtggtgcacgagatggac 1420



to top

>gb|AF222944.1| Heteranthelium piliferum sucrose:fructan 6-fructosyltransferase
           (6-SFT) gene, partial cds
          Length = 311

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 141/176 (80%), Gaps = 3/176 (1%)
 Strand = Plus / Plus

                                                                       
Query: 3   gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcga 62
           |||||||||||||||||||||| || ||  ||||||| ||||| ||||||  ||||  ||
Sbjct: 136 gggtgctcgtggaccactccatcgtgcagggcttcgccatgggcgggaggacgacgatga 195

                                                                       
Query: 63  cgtcgagggcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaaca 122
           | ||| ||| ||||||||  ||||||  | |   || |||| | ||||||||||||||||
Sbjct: 196 cctcgcgggtgtacccgatggaggcctacca---ggaggcgcgagtctacctgttcaaca 252

                                                                   
Query: 123 atgccaccggcacgagcgtcaccgctgagaaactcatcgtgcacgatatggactcg 178
           ||||||||||| |  |||| || || ||||  ||  |||||||||| |||||||||
Sbjct: 253 atgccaccggcgccggcgtgacggcggagaggcttgtcgtgcacgagatggactcg 308



to top

>gb|AY302083.1| Saccharum hybrid cultivar soluble acid invertase (ShinvA) mRNA,
            partial cds
          Length = 2274

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 147/185 (79%)
 Strand = Plus / Plus

                                                                        
Query: 5    gtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcgacg 64
            |||||||| ||||||||||| ||| | |||||||||  |||||| ||||  ||||| || 
Sbjct: 1714 gtgctcgtcgaccactccatcgtcgagagcttcgcgcagggtggaaggtcaacggccacc 1773

                                                                        
Query: 65   tcgagggcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaacaat 124
            ||| | |  ||||| ||| |||||||||| ||    || || || | ||| |||||||| 
Sbjct: 1774 tcgcgcgtctaccccaccaaggccatctacgccaacgccggcgtgttcctcttcaacaac 1833

                                                                        
Query: 125  gccaccggcacgagcgtcaccgctgagaaactcatcgtgcacgatatggactcgtcgtac 184
            ||||||| | || ||||||||||  |||| ||| |||| ||||| ||||||||||| |||
Sbjct: 1834 gccaccgccgcgcgcgtcaccgccaagaagctcgtcgtccacgagatggactcgtcctac 1893

                 
Query: 185  aacca 189
            |||||
Sbjct: 1894 aacca 1898



to top

>gb|AF222943.1| Haynaldia villosa sucrose:fructan 6-fructosyltransferase (6-SFT)
           gene, partial cds
          Length = 311

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 140/175 (80%), Gaps = 3/175 (1%)
 Strand = Plus / Plus

                                                                       
Query: 3   gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcga 62
           ||||||||||||||||||||||||| ||  ||||||| ||||| ||||||  ||||  ||
Sbjct: 136 gggtgctcgtggaccactccattgtgcagggcttcgccatgggcgggaggacgacgatga 195

                                                                       
Query: 63  cgtcgagggcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaaca 122
           ||||| ||| |||||| |  |||||   ||||  || |||   ||| ||| |||||||||
Sbjct: 196 cgtcgcgggtgtaccccatggaggc---ctatcaggaggcaaaggtgtacttgttcaaca 252

                                                                  
Query: 123 atgccaccggcacgagcgtcaccgctgagaaactcatcgtgcacgatatggactc 177
           ||||||||||  | ||||| || || ||||  ||| |||||||||| ||||||||
Sbjct: 253 atgccaccggtgccagcgtgacggcggagaggctcgtcgtgcacgagatggactc 307



to top

>gb|AF062735.1|AF062735 Saccharum officinarum soluble acid invertase mRNA, partial cds
          Length = 1808

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 147/185 (79%)
 Strand = Plus / Plus

                                                                        
Query: 5    gtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcgacg 64
            |||||||| ||||||||||| ||| | |||||||||  |||||| ||||  ||||| || 
Sbjct: 1495 gtgctcgtcgaccactccatcgtcgagagcttcgcgcagggtggaaggtcaacggccacc 1554

                                                                        
Query: 65   tcgagggcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaacaat 124
            ||| | |  ||||| ||| |||||||||| ||    || || || | ||| |||||||| 
Sbjct: 1555 tcgcgcgtctaccccaccaaggccatctacgccaacgccggcgtgttcctcttcaacaac 1614

                                                                        
Query: 125  gccaccggcacgagcgtcaccgctgagaaactcatcgtgcacgatatggactcgtcgtac 184
            ||||||| | || ||||||||||  |||| ||| |||| ||||| ||||||||||| |||
Sbjct: 1615 gccaccgccgcgcgcgtcaccgccaagaagctcgtcgtccacgagatggactcgtcctac 1674

                 
Query: 185  aacca 189
            |||||
Sbjct: 1675 aacca 1679



to top

>gb|AF211253.1| Agropyron cristatum sucrose:fructan 6-fructosyltransferase (6-SFT)
            mRNA, complete cds
          Length = 2174

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 106/130 (81%), Gaps = 3/130 (2%)
 Strand = Plus / Plus

                                                                        
Query: 3    gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcga 62
            |||||||||||||||||||||| || ||  ||||||||||||| |||||| | |||  ||
Sbjct: 1716 gggtgctcgtggaccactccatcgtgcagggcttcgcgatgggcgggaggatcacgatga 1775

                                                                        
Query: 63   cgtcgagggcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaaca 122
            ||||  ||| ||||||||  |||||   ||||  || ||| || || ||| |||||||||
Sbjct: 1776 cgtcacgggtgtacccgatggaggc---ctatcaggaggcaggagtgtacttgttcaaca 1832

                      
Query: 123  atgccaccgg 132
            ||||||||||
Sbjct: 1833 atgccaccgg 1842



to top

>gb|AF222930.1| Agropyron puberulum sucrose:fructan 6-fructosyltransferase (6-SFT)
           gene, partial cds
          Length = 311

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 106/130 (81%), Gaps = 3/130 (2%)
 Strand = Plus / Plus

                                                                       
Query: 3   gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcga 62
           |||||||||||||||||||||| || ||  ||||||||||||| |||||| | |||  ||
Sbjct: 136 gggtgctcgtggaccactccatcgtgcagggcttcgcgatgggcgggaggatcacgatga 195

                                                                       
Query: 63  cgtcgagggcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaaca 122
           ||||  ||| ||||||||  |||||   ||||  || ||| || || ||| |||||||||
Sbjct: 196 cgtcacgggtgtacccgatggaggc---ctatcaggaggcaggagtgtacttgttcaaca 252

                     
Query: 123 atgccaccgg 132
           ||||||||||
Sbjct: 253 atgccaccgg 262



to top

>gb|AF222948.1| Pascopyrum smithii sucrose:fructan 6-fructosyltransferase (6-SFT)
           gene, partial cds
          Length = 314

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 3   gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggt 53
           |||||||||||||||||||||| || ||  ||||||||||||| |||||||
Sbjct: 136 gggtgctcgtggaccactccatcgtgcagggcttcgcgatgggcgggaggt 186



to top

>gb|AF222936.1| Pseudoroegneria stipifolia sucrose:fructan 6-fructosyltransferase
           (6-SFT) gene, partial cds
          Length = 311

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 3   gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggt 53
           |||| ||||||||||||||||| || || |||||||||||||| |||||||
Sbjct: 136 gggttctcgtggaccactccatcgtgcagagcttcgcgatgggcgggaggt 186



to top

>gb|BT009003.1| Triticum aestivum clone wdk2c.pk017.f14:fis, full insert mRNA
            sequence
          Length = 1612

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                              
Query: 3    gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggagg 52
            |||||||||||||||||||||| || ||  ||||||||||||| ||||||
Sbjct: 1196 gggtgctcgtggaccactccatcgtgcagggcttcgcgatgggcgggagg 1245



to top

>gb|BT008969.1| Triticum aestivum clone wdk1c.pk014.c11:fis, full insert mRNA
            sequence
          Length = 1844

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                              
Query: 3    gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggagg 52
            |||||||||||||||||||||| || ||  ||||||||||||| ||||||
Sbjct: 1270 gggtgctcgtggaccactccatcgtgcagggcttcgcgatgggcgggagg 1319



to top

>gb|AF222947.1| Triticum aestivum sucrose:fructan 6-fructosyltransferase (6-SFT)
           gene, partial cds
          Length = 311

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 3   gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggagg 52
           |||||||||||||||||||||| || ||  ||||||||||||| ||||||
Sbjct: 136 gggtgctcgtggaccactccatcgtgcagggcttcgcgatgggcgggagg 185



to top

>gb|AF222945.1| Triticum turgidum sucrose:fructan 6-fructosyltransferase (6-SFT)
           gene, partial cds
          Length = 311

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 3   gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggagg 52
           |||||||||||||||||||||| || ||  ||||||||||||| ||||||
Sbjct: 136 gggtgctcgtggaccactccatcgtgcagggcttcgcgatgggcgggagg 185



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                       
Query: 114 tgttcaacaatgccaccggcacgagcgtcaccgctgagaaactcatcgtgcacgatatgg 173
           |||||||||||||||||||  | |||||||| || || |  ||| |||||||||| ||||
Sbjct: 244 tgttcaacaatgccaccggtgccagcgtcacggcggaaaggctcgtcgtgcacgagatgg 303

               
Query: 174 actc 177
           ||||
Sbjct: 304 actc 307



to top

>gb|AF222942.1| Secale cereale sucrose:fructan 6-fructosyltransferase (6-SFT) gene,
           partial cds
          Length = 311

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 3   gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggagg 52
           |||||||||||||||||||||| || ||  ||||||||||||| ||||||
Sbjct: 136 gggtgctcgtggaccactccatcgtgcagggcttcgcgatgggcgggagg 185



to top

>gb|AF222941.1| Aegilops tauschii sucrose:fructan 6-fructosyltransferase (6-SFT)
           gene, partial cds
          Length = 311

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 3   gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggagg 52
           |||||||||||||||||||||| || ||  ||||||||||||| ||||||
Sbjct: 136 gggtgctcgtggaccactccatcgtgcagggcttcgcgatgggcgggagg 185



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                       
Query: 114 tgttcaacaatgccaccggcacgagcgtcaccgctgagaaactcatcgtgcacgatatgg 173
           |||||||||||||||||||  | |||||||| || || |  ||| |||||||||| ||||
Sbjct: 244 tgttcaacaatgccaccggtgccagcgtcacggcggaaaggctcgtcgtgcacgagatgg 303

               
Query: 174 actc 177
           ||||
Sbjct: 304 actc 307



to top

>gb|AF222940.1| Aegilops caudata sucrose:fructan 6-fructosyltransferase (6-SFT)
           gene, partial cds
          Length = 311

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 3   gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggagg 52
           |||||||||||||||||||||| || ||  ||||||||||||| ||||||
Sbjct: 136 gggtgctcgtggaccactccatcgtgcagggcttcgcgatgggcgggagg 185



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                       
Query: 114 tgttcaacaatgccaccggcacgagcgtcaccgctgagaaactcatcgtgcacgatatgg 173
           |||||||||||||||||||  | |||||||| || || |  ||| |||||||||| ||||
Sbjct: 244 tgttcaacaatgccaccggtgccagcgtcacggcggaaaggctcgtcgtgcacgagatgg 303

               
Query: 174 actc 177
           ||||
Sbjct: 304 actc 307



to top

>gb|AF222939.1| Aegilops speltoides sucrose:fructan 6-fructosyltransferase (6-SFT)
           gene, partial cds
          Length = 311

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 3   gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggagg 52
           |||||||||||||||||||||| || ||  ||||||||||||| ||||||
Sbjct: 136 gggtgctcgtggaccactccatcgtgcagggcttcgcgatgggcgggagg 185



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 53/64 (82%)
 Strand = Plus / Plus

                                                                       
Query: 114 tgttcaacaatgccaccggcacgagcgtcaccgctgagaaactcatcgtgcacgatatgg 173
           |||||||||||||||||||  | | |||||| || || |  ||| |||||||||| ||||
Sbjct: 244 tgttcaacaatgccaccggtgccaccgtcacggcggaaaggctcgtcgtgcacgagatgg 303

               
Query: 174 actc 177
           ||||
Sbjct: 304 actc 307



to top

>gb|AF222934.1| Thinopyrum bessarabicum sucrose:fructan 6-fructosyltransferase
           (6-SFT) gene, partial cds
          Length = 311

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 3   gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggagg 52
           |||||||||||||||||||||| || ||  ||||||||||||| ||||||
Sbjct: 136 gggtgctcgtggaccactccatcgtgcagggcttcgcgatgggcgggagg 185



to top

>gb|AF222929.1| Agropyron mongolicum sucrose:fructan 6-fructosyltransferase (6-SFT)
           gene, partial cds
          Length = 311

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 3   gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggagg 52
           |||||||||||||||||||||| || ||  ||||||||||||| ||||||
Sbjct: 136 gggtgctcgtggaccactccatcgtgcagggcttcgcgatgggcgggagg 185



to top

>gb|AF253410.1| Triticum urartu sucrose:fructan 6-fructosyltransferase gene,
           partial cds
          Length = 311

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 3   gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggagg 52
           |||||||||||||||||||||| || ||  ||||||||||||| ||||||
Sbjct: 136 gggtgctcgtggaccactccatcgtgcagggcttcgcgatgggcgggagg 185



to top

>emb|AJ532549.1|LTE532549 Lolium temulentum mRNA for putative soluble acid invertase (inv1:4
            gene)
          Length = 2407

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 99/122 (81%)
 Strand = Plus / Plus

                                                                        
Query: 11   gtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcgacgtcgagg 70
            |||||||||||||||||| | ||||| ||   ||||||||||| ||| | ||| ||| | 
Sbjct: 1967 gtggaccactccattgtcgagagctttgcacagggtgggaggtcgacagtgacttcgcga 2026

                                                                        
Query: 71   gcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaacaatgccacc 130
            | |||||| |||||||||||||| ||     | ||||| ||||| |||||||||||||||
Sbjct: 2027 gtgtacccaaccgaggccatctacgccaacaccggggtgtacctcttcaacaatgccacc 2086

              
Query: 131  gg 132
            ||
Sbjct: 2087 gg 2088



to top

>dbj|AB029887.1| Triticum aestivum 6-SFT mRNA for sucrose:fructan
            6-fructosyltransferase, complete cds
          Length = 2220

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                              
Query: 3    gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggagg 52
            |||||||||||||||||||||| || ||  ||||||||||||| ||||||
Sbjct: 1675 gggtgctcgtggaccactccatcgtgcagggcttcgcgatgggcgggagg 1724



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                        
Query: 114  tgttcaacaatgccaccggcacgagcgtcaccgctgagaaactcatcgtgcacgatatgg 173
            |||||||||||||||||||  | |||||||| || || |  ||| |||||||||| ||||
Sbjct: 1783 tgttcaacaatgccaccggtgccagcgtcacggcggaaaggctcgtcgtgcacgagatgg 1842

                
Query: 174  actc 177
            ||||
Sbjct: 1843 actc 1846



to top

>gb|AF062734.1|AF062734 Saccharum robustum soluble acid invertase mRNA, partial cds
          Length = 1808

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                        
Query: 116  ttcaacaatgccaccggcacgagcgtcaccgctgagaaactcatcgtgcacgatatggac 175
            |||||||| ||||||| | || ||||||||||  |||| ||| |||| ||||| ||||||
Sbjct: 1606 ttcaacaacgccaccgccgcgcgcgtcaccgccaagaagctcgtcgtccacgagatggac 1665

                          
Query: 176  tcgtcgtacaacca 189
            ||||| ||||||||
Sbjct: 1666 tcgtcctacaacca 1679



to top

>gb|AF083856.1|AF083856 Saccharum hybrid cultivar H65-7052 soluble acid invertase (scinvh3'2)
            mRNA, partial cds
          Length = 1402

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 146/185 (78%)
 Strand = Plus / Plus

                                                                        
Query: 5    gtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcgacg 64
            |||||||| ||||||||||| ||| | |||||||||  |||||| ||||  ||||| || 
Sbjct: 822  gtgctcgtcgaccactccatcgtcgagagcttcgcgcagggtggaaggtcaacggccacc 881

                                                                        
Query: 65   tcgagggcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaacaat 124
            ||| | |  ||||| ||| |||||||||| ||    || || || | ||| |||||||| 
Sbjct: 882  tcgcgcgtctaccccaccaaggccatctacgccaacgccggcgtgttcctcttcaacaac 941

                                                                        
Query: 125  gccaccggcacgagcgtcaccgctgagaaactcatcgtgcacgatatggactcgtcgtac 184
            ||||||| |  | ||||||||||  |||| ||| |||| ||||| ||||||||||| |||
Sbjct: 942  gccaccgccgtgcgcgtcaccgccaagaagctcgtcgtccacgagatggactcgtcctac 1001

                 
Query: 185  aacca 189
            |||||
Sbjct: 1002 aacca 1006



to top

>gb|AF222937.1| Australopyrum retrofractum sucrose:fructan 6-fructosyltransferase
           (6-SFT) gene, partial cds
          Length = 311

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 105/130 (80%), Gaps = 3/130 (2%)
 Strand = Plus / Plus

                                                                       
Query: 3   gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcga 62
           |||||||||||||||||||||| || ||  |||| |||||||| ||||||   |||  ||
Sbjct: 136 gggtgctcgtggaccactccatcgtgcagggctttgcgatgggcgggaggaccacgatga 195

                                                                       
Query: 63  cgtcgagggcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaaca 122
           ||||  ||| ||||||||  |||||   |||||| | ||| || || ||| |||||||||
Sbjct: 196 cgtcacgggtgtacccgatggaggc---ctatgctgaggcaggagtgtacttgttcaaca 252

                     
Query: 123 atgccaccgg 132
           ||||||||||
Sbjct: 253 atgccaccgg 262



to top

>emb|AJ563384.1|ZMA563384 Zea mays partial ivr2 gene for vacuolar invertase, exons 1-2
          Length = 1978

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 148/188 (78%)
 Strand = Plus / Plus

                                                                        
Query: 2    cgggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcg 61
            ||||||||||| ||||||||||| ||| | |||||||||  ||| |||||||  || || 
Sbjct: 1486 cgggtgctcgtcgaccactccatcgtcgagagcttcgcgcagggcgggaggtccaccgcc 1545

                                                                        
Query: 62   acgtcgagggcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaac 121
            || ||| | |  ||||| |||||||||||||| ||    || || |||| ||| ||||||
Sbjct: 1546 acatcgcgcgtctaccccaccgaggccatctacgccaacgccggcgtcttcctcttcaac 1605

                                                                        
Query: 122  aatgccaccggcacgagcgtcaccgctgagaaactcatcgtgcacgatatggactcgtcg 181
            || ||||||| | || | ||||| ||   ||| ||| |||| ||||| ||||||||||| 
Sbjct: 1606 aacgccaccgccgcgcgggtcacggccacgaagctcgtcgtccacgagatggactcgtca 1665

                    
Query: 182  tacaacca 189
            ||||||||
Sbjct: 1666 tacaacca 1673



to top

>gb|AY107166.1| Zea mays PCO109921 mRNA sequence
          Length = 1901

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 148/188 (78%)
 Strand = Plus / Plus

                                                                        
Query: 2    cgggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcg 61
            ||||||||||| ||||||||||| ||| | |||||||||  ||| |||||||  || || 
Sbjct: 1326 cgggtgctcgtcgaccactccatcgtcgagagcttcgcgcagggcgggaggtccaccgcc 1385

                                                                        
Query: 62   acgtcgagggcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaac 121
            || ||| | |  ||||| |||||||||||||| ||    || || |||| ||| ||||||
Sbjct: 1386 acatcgcgcgtctaccccaccgaggccatctacgccaacgccggcgtcttcctcttcaac 1445

                                                                        
Query: 122  aatgccaccggcacgagcgtcaccgctgagaaactcatcgtgcacgatatggactcgtcg 181
            || ||||||| | || | ||||| ||   ||| ||| |||| ||||| ||||||||||| 
Sbjct: 1446 aacgccaccgccgcgcgggtcacggccacgaagctcgtcgtccacgagatggactcgtca 1505

                    
Query: 182  tacaacca 189
            ||||||||
Sbjct: 1506 tacaacca 1513



to top

>gb|U31451.1|ZMU31451 Zea mays invertase mRNA, partial cds
          Length = 1530

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 148/188 (78%)
 Strand = Plus / Plus

                                                                        
Query: 2    cgggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggaggttgacggcg 61
            ||||||||||| ||||||||||| ||| | |||||||||  ||| |||||||  || || 
Sbjct: 1312 cgggtgctcgtcgaccactccatcgtcgagagcttcgcgcagggcgggaggtccaccgcc 1371

                                                                        
Query: 62   acgtcgagggcgtacccgaccgaggccatctatgcggcggcgggggtctacctgttcaac 121
            || ||| | |  ||||| |||||||||||||| ||    || || |||| ||| ||||||
Sbjct: 1372 acatcgcgcgtctaccccaccgaggccatctacgccaacgccggcgtcttcctcttcaac 1431

                                                                        
Query: 122  aatgccaccggcacgagcgtcaccgctgagaaactcatcgtgcacgatatggactcgtcg 181
            || ||||||| | || | ||||| ||   ||| ||| |||| ||||| ||||||||||| 
Sbjct: 1432 aacgccaccgccgcgcgggtcacggccacgaagctcgtcgtccacgagatggactcgtca 1491

                    
Query: 182  tacaacca 189
            ||||||||
Sbjct: 1492 tacaacca 1499



to top

>gb|AF252608.1| Pascopyrum smithii sucrose:fructan 6-fructosyltransferase (6-SFT)
           mRNA, partial cds
          Length = 1294

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 3   gggtgctcgtggaccactccattgtccaaagcttcgcgatggg 45
           |||||||||||||||||||||| || ||  |||||||||||||
Sbjct: 745 gggtgctcgtggaccactccatcgtgcagggcttcgcgatggg 787



to top

>gb|AF222946.1| Triticum timopheevii sucrose:fructan 6-fructosyltransferase (6-SFT)
           gene, partial cds
          Length = 311

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 3   gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggagg 52
           |||||||||||||||||||||| || ||  ||||||| ||||| ||||||
Sbjct: 136 gggtgctcgtggaccactccatcgtgcagggcttcgccatgggcgggagg 185



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 53/64 (82%)
 Strand = Plus / Plus

                                                                       
Query: 114 tgttcaacaatgccaccggcacgagcgtcaccgctgagaaactcatcgtgcacgatatgg 173
           |||||||||||||||||||  | | |||||| || || |  ||| |||||||||| ||||
Sbjct: 244 tgttcaacaatgccaccggtgccaccgtcacggcggaaaggctcgtcgtgcacgagatgg 303

               
Query: 174 actc 177
           ||||
Sbjct: 304 actc 307



to top

>gb|AF222938.1| Bromus tectorum sucrose:fructan 6-fructosyltransferase (6-SFT)
           gene, partial cds
          Length = 314

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 3   gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggagg 52
           |||||||||| |||||||||||||| ||  ||||||| ||||| ||||||
Sbjct: 136 gggtgctcgtcgaccactccattgtgcagggcttcgccatgggcgggagg 185



to top

>gb|AF222933.1| Psathyrostachys huashanica sucrose:fructan 6-fructosyltransferase
           (6-SFT) gene, partial cds
          Length = 311

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 3   gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggagg 52
           |||| ||||||||||||||||| || ||  ||||||||||||| ||||||
Sbjct: 136 gggtactcgtggaccactccatcgtgcagggcttcgcgatgggcgggagg 185



to top

>gb|AF222932.1| Psathyrostachys fragilis sucrose:fructan 6-fructosyltransferase
           (6-SFT) gene, partial cds
          Length = 311

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 3   gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggagg 52
           |||| ||||||||||||||||| || ||  ||||||||||||| ||||||
Sbjct: 136 gggtactcgtggaccactccatcgtgcagggcttcgcgatgggcgggagg 185



to top

>gb|AF253411.1| Critesion violaceum sucrose:fructan 6-fructosyltransferase gene,
           partial cds
          Length = 311

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 3   gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggagg 52
           ||||||| |||||||||||||| || ||  ||||||||||||| ||||||
Sbjct: 136 gggtgcttgtggaccactccatcgtgcagggcttcgcgatgggcgggagg 185



to top

>emb|AL355520.8| Human DNA sequence from clone RP4-595C2 on chromosome 1q24.1-25.3
              Contains the 3' end of the gene for Ral-A exchange factor
              RalGPS2 and the ANGPTL1 gene for angiopoietin-like 1,
              complete sequence
          Length = 157575

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 401    atgttgttgatgatgatgattgtt 424
              ||||||||||||||||||||||||
Sbjct: 156693 atgttgttgatgatgatgattgtt 156716



to top

>emb|AL139132.16| Human DNA sequence from clone RP11-177A2 on chromosome 1q25.1-31.3
            Contains the FAM20B gene for family with sequence
            similarity 20 (member B), theTOR3A gene for torsin family
            3 (member A), the 3' end of the ABL2 gene for v-abl
            Abelson murine leukemia viral oncogene homolog 2 (arg,
            Abelson-related gene), a novel gene and three CpG
            islands, complete sequence
          Length = 157866

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 401  atgttgttgatgatgatgattgtt 424
            ||||||||||||||||||||||||
Sbjct: 1118 atgttgttgatgatgatgattgtt 1141



to top

>tpg|BK002757.1| TPA: TPA_inf: Drosophila melanogaster HDC14963 (HDC14963) gene,
            complete cds
          Length = 4437

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 400  gatgttgttgatgatgatgattgt 423
            ||||||||||||||||||||||||
Sbjct: 4198 gatgttgttgatgatgatgattgt 4175



to top

>gb|AC008043.5| Drosophila melanogaster, chromosome 3R, region 94A-94A, BAC clone
              BACR05A08, complete sequence
          Length = 169581

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 400    gatgttgttgatgatgatgattgt 423
              ||||||||||||||||||||||||
Sbjct: 148477 gatgttgttgatgatgatgattgt 148454



to top

>gb|AE003738.3| Drosophila melanogaster chromosome 3R, section 76 of 118 of the complete
              sequence
          Length = 287397

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 400    gatgttgttgatgatgatgattgt 423
              ||||||||||||||||||||||||
Sbjct: 131291 gatgttgttgatgatgatgattgt 131268



to top

>emb|AJ563423.1|ZMA563423 Zea mays partial ivr2b pseudogene
          Length = 7411

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                    
Query: 1    gcgggtgctcgtggaccactccattgtccaaagcttcgcg 40
            |||||||||||| ||||||||||| ||| | |||||||||
Sbjct: 6440 gcgggtgctcgtcgaccactccatcgtcgagagcttcgcg 6479



to top

>gb|AC009915.5|AC009915 Drosophila melanogaster, chromosome 3R, region 94A-94A, BAC clone
             BACR09L14, complete sequence
          Length = 167368

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 400   gatgttgttgatgatgatgattgt 423
             ||||||||||||||||||||||||
Sbjct: 41111 gatgttgttgatgatgatgattgt 41088



to top

>ref|NM_123593.1| Arabidopsis thaliana unknown protein AT5G42280 mRNA, complete cds
          Length = 2085

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 398 atgatgttgttgatgatgatgat 420
           |||||||||||||||||||||||
Sbjct: 556 atgatgttgttgatgatgatgat 578



to top

>ref|XM_635128.1| Dictyostelium discoideum hypothetical protein (DDB0216408), partial
            mRNA
          Length = 4086

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 398  atgatgttgttgatgatgatgat 420
            |||||||||||||||||||||||
Sbjct: 1522 atgatgttgttgatgatgatgat 1500



to top

>ref|XM_633972.1| Dictyostelium discoideum hypothetical protein (DDB0185511), partial
           mRNA
          Length = 4578

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 398 atgatgttgttgatgatgatgat 420
           |||||||||||||||||||||||
Sbjct: 961 atgatgttgttgatgatgatgat 939



to top

>ref|XM_630605.1| Dictyostelium discoideum hypothetical protein (DDB0189000), partial
           mRNA
          Length = 2163

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 398 atgatgttgttgatgatgatgat 420
           |||||||||||||||||||||||
Sbjct: 223 atgatgttgttgatgatgatgat 201



to top

>ref|XM_629759.1| Dictyostelium discoideum hypothetical protein (DDB0184155), partial
           mRNA
          Length = 5211

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 399 tgatgttgttgatgatgatgatt 421
           |||||||||||||||||||||||
Sbjct: 974 tgatgttgttgatgatgatgatt 952



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 400  gatgttgttgatgatgatgat 420
            |||||||||||||||||||||
Sbjct: 3929 gatgttgttgatgatgatgat 3909



to top

>ref|XM_629699.1| Dictyostelium discoideum unconventional myosin heavy chain MyoM
            (DDB0191100), partial mRNA
          Length = 5214

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 398  atgatgttgttgatgatgatgat 420
            |||||||||||||||||||||||
Sbjct: 3283 atgatgttgttgatgatgatgat 3261



to top

>gb|AE017353.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 13, complete
              sequence
          Length = 787999

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 398    atgatgttgttgatgatgatgat 420
              |||||||||||||||||||||||
Sbjct: 602818 atgatgttgttgatgatgatgat 602796



to top

>gb|AC161235.6| Mus musculus chromosome 3, clone RP24-86C19, complete sequence
          Length = 206729

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 402   tgttgttgatgatgatgattgtt 424
             |||||||||||||||||||||||
Sbjct: 24347 tgttgttgatgatgatgattgtt 24369



to top

>gb|AC131721.4| Mus musculus BAC clone RP23-142L24 from chromosome 15, complete sequence
          Length = 230892

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 398    atgatgttgttgatgatgatgat 420
              |||||||||||||||||||||||
Sbjct: 123781 atgatgttgttgatgatgatgat 123803



to top

>gb|AY082350.1| Lolium perenne fructosyltransferase (FT2) mRNA, complete cds
          Length = 2337

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                       
Query: 11   gtggaccactccattgtccaaagcttcgcgatgggtgggaggt 53
            |||||||||||||||||| | ||||||||   |||||||||||
Sbjct: 1899 gtggaccactccattgtcgagagcttcgcacagggtgggaggt 1941



to top

>ref|XM_568474.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein
            (CNM01960) partial mRNA
          Length = 2738

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 398  atgatgttgttgatgatgatgat 420
            |||||||||||||||||||||||
Sbjct: 2419 atgatgttgttgatgatgatgat 2397



to top

>gb|AC124187.3| Mus musculus BAC clone RP23-237I24 from 18, complete sequence
          Length = 172828

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 398   atgatgttgttgatgatgatgat 420
             |||||||||||||||||||||||
Sbjct: 49952 atgatgttgttgatgatgatgat 49974



to top

>emb|BX470150.13| Zebrafish DNA sequence from clone DKEY-164K14 in linkage group 23,
              complete sequence
          Length = 209342

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 398    atgatgttgttgatgatgatgat 420
              |||||||||||||||||||||||
Sbjct: 169882 atgatgttgttgatgatgatgat 169904



to top

>gb|AC167554.9| Mus musculus chromosome 15, clone RP24-281M24, complete sequence
          Length = 166875

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 398   atgatgttgttgatgatgatgat 420
             |||||||||||||||||||||||
Sbjct: 89518 atgatgttgttgatgatgatgat 89496



to top

>ref|XM_791192.1| PREDICTED: Strongylocentrotus purpuratus similar to CG18642-PA
           (LOC591637), mRNA
          Length = 999

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 398 atgatgttgttgatgatgatgat 420
           |||||||||||||||||||||||
Sbjct: 939 atgatgttgttgatgatgatgat 917



to top

>emb|AL139382.12| Human DNA sequence from clone RP11-86N24 on chromosome 13 Contains the
             TNFSF11 gene for tumor necrosis factor (ligand)
             superfamily, member 11 and a CpG island, complete sequence
          Length = 200724

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 398   atgatgttgttgatgatgatgat 420
             |||||||||||||||||||||||
Sbjct: 35611 atgatgttgttgatgatgatgat 35589



to top

>gb|AC130456.2| Homo sapiens chromosome 16 clone CTA-363E6, complete sequence
          Length = 220579

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 398    atgatgttgttgatgatgatgat 420
              |||||||||||||||||||||||
Sbjct: 133455 atgatgttgttgatgatgatgat 133477



to top

>emb|AL844607.4| Mouse DNA sequence from clone RP24-280G18 on chromosome 4, complete
            sequence
          Length = 160298

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 398  atgatgttgttgatgatgatgat 420
            |||||||||||||||||||||||
Sbjct: 2776 atgatgttgttgatgatgatgat 2798



to top

>dbj|AK126270.1| Homo sapiens cDNA FLJ44282 fis, clone TRACH2003516
          Length = 2555

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 398  atgatgttgttgatgatgatgat 420
            |||||||||||||||||||||||
Sbjct: 1325 atgatgttgttgatgatgatgat 1347



to top

>gb|DQ378281.1| Drosophila virilis strain Tucson 15010-1001.10 fosmid 26E5, complete
             sequence
          Length = 40479

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 398   atgatgttgttgatgatgatgat 420
             |||||||||||||||||||||||
Sbjct: 19875 atgatgttgttgatgatgatgat 19853



to top

>gb|AF352075.1| Gossypium hirsutum clone JESPR305 microsatellite sequence
          Length = 340

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 398 atgatgttgttgatgatgatgat 420
           |||||||||||||||||||||||
Sbjct: 74  atgatgttgttgatgatgatgat 96



to top

>gb|AF090533.1| Dictyostelium discoideum unconventional myosin heavy chain MyoM
            (myoM) mRNA, complete cds
          Length = 5214

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 398  atgatgttgttgatgatgatgat 420
            |||||||||||||||||||||||
Sbjct: 3283 atgatgttgttgatgatgatgat 3261



to top

>emb|AL844155.6| Mouse DNA sequence from clone RP23-163L4 on chromosome 2, complete
              sequence
          Length = 193188

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 398    atgatgttgttgatgatgatgat 420
              |||||||||||||||||||||||
Sbjct: 162520 atgatgttgttgatgatgatgat 162498



to top

>gb|AC104634.5| Homo sapiens BAC clone RP11-793L24 from 2, complete sequence
          Length = 115758

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 398   atgatgttgttgatgatgatgat 420
             |||||||||||||||||||||||
Sbjct: 21137 atgatgttgttgatgatgatgat 21115



to top

>gb|AC006560.8| Homo sapiens 12 BAC RPCI11-792F18 (Roswell Park Cancer Institute Human
              BAC Library) complete sequence
          Length = 202478

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 398    atgatgttgttgatgatgatgat 420
              |||||||||||||||||||||||
Sbjct: 164672 atgatgttgttgatgatgatgat 164694



to top

>gb|AC007539.8| Homo sapiens 12 BAC RCPI11-935C2 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 177147

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 398   atgatgttgttgatgatgatgat 420
             |||||||||||||||||||||||
Sbjct: 39600 atgatgttgttgatgatgatgat 39622



to top

>gb|AC104069.3| Homo sapiens BAC clone RP11-279B11 from 2, complete sequence
          Length = 155106

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 398   atgatgttgttgatgatgatgat 420
             |||||||||||||||||||||||
Sbjct: 76054 atgatgttgttgatgatgatgat 76076



to top

>dbj|AB023032.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K5J14
          Length = 59762

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 398   atgatgttgttgatgatgatgat 420
             |||||||||||||||||||||||
Sbjct: 45839 atgatgttgttgatgatgatgat 45817



to top

>gb|U91321.1|HUU91321 Human Chromosome 16 BAC clone CIT987SK-A-363E6, complete sequence
          Length = 220633

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 398    atgatgttgttgatgatgatgat 420
              |||||||||||||||||||||||
Sbjct: 133505 atgatgttgttgatgatgatgat 133527



to top

>emb|BX957273.10| Zebrafish DNA sequence from clone CH211-210P17 in linkage group 9,
             complete sequence
          Length = 150430

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 402   tgttgttgatgatgatgattgtt 424
             |||||||||||||||||||||||
Sbjct: 24479 tgttgttgatgatgatgattgtt 24501



to top

>gb|AF100768.1|AF100768 Zea mays ZM2LRK pseudogene sequence
          Length = 2700

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 394  ggctatgatgttgttgatgatgatgat 420
            ||||||| |||||||||||||||||||
Sbjct: 2354 ggctatgttgttgttgatgatgatgat 2380



to top

>emb|AL844545.7| Mouse DNA sequence from clone RP23-383C3 on chromosome 2, complete
             sequence
          Length = 120913

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 398   atgatgttgttgatgatgatgat 420
             |||||||||||||||||||||||
Sbjct: 57582 atgatgttgttgatgatgatgat 57560



to top

>emb|AL935142.8| Zebrafish DNA sequence from clone CH211-227M23, complete sequence
          Length = 160780

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 394    ggctatgatgttgttgatgatgatgat 420
              |||| ||||||||||||||||||||||
Sbjct: 114910 ggctttgatgttgttgatgatgatgat 114936



to top

>emb|AL732543.8| Mouse DNA sequence from clone RP23-13D22 on chromosome 4, complete
             sequence
          Length = 195272

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 398   atgatgttgttgatgatgatgat 420
             |||||||||||||||||||||||
Sbjct: 75681 atgatgttgttgatgatgatgat 75703



to top

>gb|AC154098.6| Mus musculus chromosome 3, clone RP23-196L9, complete sequence
          Length = 201332

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 402    tgttgttgatgatgatgattgtt 424
              |||||||||||||||||||||||
Sbjct: 122167 tgttgttgatgatgatgattgtt 122145



to top

>dbj|AB017910.1| Dictyostelium discoideum myoM gene, complete cds
          Length = 6100

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 398  atgatgttgttgatgatgatgat 420
            |||||||||||||||||||||||
Sbjct: 4060 atgatgttgttgatgatgatgat 4038



to top

>ref|NM_129615.2| Arabidopsis thaliana unknown protein AT2G40530 mRNA, complete cds
          Length = 695

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 399 tgatgttgttgatgatgatgat 420
           ||||||||||||||||||||||
Sbjct: 338 tgatgttgttgatgatgatgat 317



to top

>ref|NM_123617.2| Arabidopsis thaliana unknown protein AT5G42520 mRNA, complete cds
          Length = 1409

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 399 tgatgttgttgatgatgatgat 420
           ||||||||||||||||||||||
Sbjct: 631 tgatgttgttgatgatgatgat 610



to top

>ref|XM_638977.1| Dictyostelium discoideum hypothetical protein (DDB0167752), partial
            mRNA
          Length = 4317

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 399  tgatgttgttgatgatgatgat 420
            ||||||||||||||||||||||
Sbjct: 3810 tgatgttgttgatgatgatgat 3789



to top

>ref|XM_635262.1| Dictyostelium discoideum hypothetical protein (DDB0205134), partial
            mRNA
          Length = 2877

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 399  tgatgttgttgatgatgatgat 420
            ||||||||||||||||||||||
Sbjct: 1026 tgatgttgttgatgatgatgat 1005



to top

>ref|XM_635257.1| Dictyostelium discoideum hypothetical protein (DDB0218367), partial
            mRNA
          Length = 2947

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 398  atgatgttgttgatgatgatgattgt 423
            ||||||||||||||||||||| ||||
Sbjct: 1031 atgatgttgttgatgatgatgtttgt 1006



to top

>ref|XM_635069.1| Dictyostelium discoideum hypothetical protein (DDB0204875), partial
            mRNA
          Length = 5016

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 402  tgttgttgatgatgatgattgt 423
            ||||||||||||||||||||||
Sbjct: 1596 tgttgttgatgatgatgattgt 1575



to top

>ref|XM_631251.1| Dictyostelium discoideum hypothetical protein (DDB0188314), partial
           mRNA
          Length = 1482

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 399 tgatgttgttgatgatgatgat 420
           ||||||||||||||||||||||
Sbjct: 615 tgatgttgttgatgatgatgat 594



to top

>ref|XM_450699.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1786

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 399  tgatgttgttgatgatgatgat 420
            ||||||||||||||||||||||
Sbjct: 1609 tgatgttgttgatgatgatgat 1630



to top

>ref|XM_422861.1| PREDICTED: Gallus gallus similar to mKIAA1606 protein (LOC425067),
            mRNA
          Length = 5561

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 366  aagatgaattagatgatgttgatgac 391
            |||||||||||||||||| |||||||
Sbjct: 1541 aagatgaattagatgatgatgatgac 1566



to top

>ref|XM_709311.1| Candida albicans SC5314 hypothetical protein (CaO19.1759), mRNA
          Length = 1449

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 399 tgatgttgttgatgatgatgat 420
           ||||||||||||||||||||||
Sbjct: 654 tgatgttgttgatgatgatgat 633



to top

>ref|XM_709271.1| Candida albicans SC5314 hypothetical protein (CaO19.9328), mRNA
          Length = 1446

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 399 tgatgttgttgatgatgatgat 420
           ||||||||||||||||||||||
Sbjct: 651 tgatgttgttgatgatgatgat 630



to top

>gb|AY528719.1| Homo sapiens estrogen-related receptor gamma (ESRRG) gene, complete cds
          Length = 590284

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 399    tgatgttgttgatgatgatgat 420
              ||||||||||||||||||||||
Sbjct: 544366 tgatgttgttgatgatgatgat 544345



to top

>gb|AY380572.1| Arabidopsis thaliana basic pentacysteine 6 (BPC6) mRNA, complete
           cds
          Length = 1065

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 399 tgatgttgttgatgatgatgat 420
           ||||||||||||||||||||||
Sbjct: 392 tgatgttgttgatgatgatgat 371



to top

>emb|AL512650.8| Human DNA sequence from clone RP11-23B9 on chromosome 1 Contains part
             of the ESRRG gene for  estrogen-related receptor gamma,
             complete sequence
          Length = 57317

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 399   tgatgttgttgatgatgatgat 420
             ||||||||||||||||||||||
Sbjct: 33247 tgatgttgttgatgatgatgat 33268



to top

>emb|AL935165.5| Zebrafish DNA sequence from clone CH211-198D18 in linkage group 4
             Contains the cugbp2 gene for CUG triplet repeat, RNA
             binding protein 2, the 5' end of a novel gene and a CpG
             island, complete sequence
          Length = 182748

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 399   tgatgttgttgatgatgatgat 420
             ||||||||||||||||||||||
Sbjct: 64353 tgatgttgttgatgatgatgat 64332



to top

>gb|AF252607.1| Psathyrostachys juncea sucrose:fructan 6-fructosyltransferase
           (6-SFT) mRNA, partial cds
          Length = 1315

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 3   gggtgctcgtggaccactccattgtccaaagcttcgcgatgggtgggagg 52
           |||| ||||||||||||||||| || ||  |||| |||||||| ||||||
Sbjct: 745 gggtactcgtggaccactccatcgtgcagggctttgcgatgggcgggagg 794



to top

>gb|BT024874.1| Arabidopsis thaliana At5g42520 mRNA, complete cds
          Length = 1029

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 399 tgatgttgttgatgatgatgat 420
           ||||||||||||||||||||||
Sbjct: 392 tgatgttgttgatgatgatgat 371



to top

>gb|AF222931.1| Psathyrostachys juncea sucrose:fructan 6-fructosyltransferase
           (6-SFT) gene, partial cds
          Length = 311

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 11  gtggaccactccattgtccaaagcttcgcgatgggtgggagg 52
           |||||||||||||| || ||  ||||||||||||| ||||||
Sbjct: 144 gtggaccactccatcgtgcagggcttcgcgatgggcgggagg 185



to top

>gb|AC002336.3| Arabidopsis thaliana chromosome 2 clone T2P4 map CIC10A06, complete
             sequence
          Length = 84675

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 399   tgatgttgttgatgatgatgat 420
             ||||||||||||||||||||||
Sbjct: 35421 tgatgttgttgatgatgatgat 35442



to top

>gb|BT024670.1| Arabidopsis thaliana unknown protein (At2g40530) mRNA, complete cds
          Length = 318

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 399 tgatgttgttgatgatgatgat 420
           ||||||||||||||||||||||
Sbjct: 240 tgatgttgttgatgatgatgat 219



to top

>dbj|AK221752.1| Arabidopsis thaliana mRNA for hypothetical protein, complete cds,
           clone: RAFL21-54-A10
          Length = 1429

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 399 tgatgttgttgatgatgatgat 420
           ||||||||||||||||||||||
Sbjct: 641 tgatgttgttgatgatgatgat 620



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 399      tgatgttgttgatgatgatgat 420
                ||||||||||||||||||||||
Sbjct: 12295590 tgatgttgttgatgatgatgat 12295611



to top

>emb|BX832181.1|CNS09ZRX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH57ZD03 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1355

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 399 tgatgttgttgatgatgatgat 420
           ||||||||||||||||||||||
Sbjct: 623 tgatgttgttgatgatgatgat 602



to top

>emb|BX830595.1|CNS0A014 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB92ZE01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1339

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 399 tgatgttgttgatgatgatgat 420
           ||||||||||||||||||||||
Sbjct: 575 tgatgttgttgatgatgatgat 554



to top

>emb|BX832029.1|CNS09ZKV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH47ZE04 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1350

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 399 tgatgttgttgatgatgatgat 420
           ||||||||||||||||||||||
Sbjct: 588 tgatgttgttgatgatgatgat 567



to top

>emb|BX831352.1|CNS09ZDY Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS80ZE02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1380

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 399 tgatgttgttgatgatgatgat 420
           ||||||||||||||||||||||
Sbjct: 631 tgatgttgttgatgatgatgat 610



to top

>gb|AC116957.2| Dictyostelium discoideum chromosome 2 map 1685067-2090751 strain AX4,
              complete sequence
          Length = 405682

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 399    tgatgttgttgatgatgatgat 420
              ||||||||||||||||||||||
Sbjct: 400218 tgatgttgttgatgatgatgat 400197



to top

>gb|AY088564.1| Arabidopsis thaliana clone 7878 mRNA, complete sequence
          Length = 1403

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 399 tgatgttgttgatgatgatgat 420
           ||||||||||||||||||||||
Sbjct: 625 tgatgttgttgatgatgatgat 604



to top

>gb|AY085405.1| Arabidopsis thaliana clone 15024 mRNA, complete sequence
          Length = 709

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 399 tgatgttgttgatgatgatgat 420
           ||||||||||||||||||||||
Sbjct: 338 tgatgttgttgatgatgatgat 317



to top

>gb|AC109182.14| Mus musculus chromosome 7, clone RP23-223O9, complete sequence
          Length = 191479

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 399    tgatgttgttgatgatgatgat 420
              ||||||||||||||||||||||
Sbjct: 185057 tgatgttgttgatgatgatgat 185036



to top

>dbj|AP005872.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:B1168F12
          Length = 141524

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 399   tgatgttgttgatgatgatgat 420
             ||||||||||||||||||||||
Sbjct: 79144 tgatgttgttgatgatgatgat 79165



to top

>dbj|AB016888.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MDH9
          Length = 85791

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 399   tgatgttgttgatgatgatgat 420
             ||||||||||||||||||||||
Sbjct: 80611 tgatgttgttgatgatgatgat 80590



to top

>dbj|AK109547.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-120-E09, full
            insert sequence
          Length = 1786

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 399  tgatgttgttgatgatgatgat 420
            ||||||||||||||||||||||
Sbjct: 1609 tgatgttgttgatgatgatgat 1630



to top

>emb|AL671994.9| B.floridae DNA sequence from clone XX-BF10F11, complete sequence
          Length = 38776

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 399   tgatgttgttgatgatgatgat 420
             ||||||||||||||||||||||
Sbjct: 20437 tgatgttgttgatgatgatgat 20416



to top

>gb|AC119237.17| Mus musculus chromosome 9, clone RP24-228P8, complete sequence
          Length = 177661

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 398    atgatgttgttgatgatgatg 418
              |||||||||||||||||||||
Sbjct: 117058 atgatgttgttgatgatgatg 117038



to top

>ref|NM_100948.2| Arabidopsis thaliana unknown protein AT1G10720 mRNA, complete cds
          Length = 1615

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 400  gatgttgttgatgatgatgat 420
            |||||||||||||||||||||
Sbjct: 1117 gatgttgttgatgatgatgat 1137



to top

>ref|XM_633536.1| Dictyostelium discoideum hypothetical protein (DDB0218605), partial
            mRNA
          Length = 3675

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 400  gatgttgttgatgatgatgat 420
            |||||||||||||||||||||
Sbjct: 2153 gatgttgttgatgatgatgat 2133



to top

>ref|XM_633393.1| Dictyostelium discoideum hypothetical protein (DDB0186152), partial
           mRNA
          Length = 789

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 398 atgatgttgttgatgatgatgattgttca 426
           |||||| || |||||||||||||||||||
Sbjct: 224 atgatgatgatgatgatgatgattgttca 252



to top

>ref|XM_631807.1| Dictyostelium discoideum hypothetical protein (DDB0187778), partial
           mRNA
          Length = 2868

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 399 tgatgttgttgatgatgatgattgttcacttgt 431
           |||||||| |||||||||||||| |||| ||||
Sbjct: 750 tgatgttgatgatgatgatgatttttcagttgt 718



to top

>ref|XM_630717.1| Dictyostelium discoideum hypothetical protein (DDB0188846), partial
            mRNA
          Length = 2439

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 398  atgatgttgttgatgatgatgattg 422
            |||||| ||||||||||||||||||
Sbjct: 1231 atgatgatgttgatgatgatgattg 1207



to top

>gb|AC104414.8| Mus musculus chromosome 3, clone RP23-99I7, complete sequence
          Length = 212613

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 400    gatgttgttgatgatgatgat 420
              |||||||||||||||||||||
Sbjct: 169474 gatgttgttgatgatgatgat 169454



to top

>ref|XM_714479.1| Candida albicans SC5314 putative 26S proteasome regulatory particle
           subunit Rpn9p (CaO19_9545), mRNA
          Length = 1251

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 398 atgatgttgttgatgatgatg 418
           |||||||||||||||||||||
Sbjct: 838 atgatgttgttgatgatgatg 818



to top

>ref|XM_714350.1| Candida albicans SC5314 putative 26S proteasome regulatory particle
           subunit Rpn9p (CaO19_1993), mRNA
          Length = 1251

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 398 atgatgttgttgatgatgatg 418
           |||||||||||||||||||||
Sbjct: 838 atgatgttgttgatgatgatg 818



to top

>gb|AC147058.3| Pan troglodytes BAC clone RP43-154B16 from 7, complete sequence
          Length = 161951

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 398    atgatgttgttgatgatgatgattgttca 426
              ||||||||| |||||||||||| ||||||
Sbjct: 130141 atgatgttgatgatgatgatgactgttca 130113



to top

>gb|AC163498.3| Mus musculus chromosome 1, clone RP23-86J11, complete sequence
          Length = 192061

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 398   atgatgttgttgatgatgatg 418
             |||||||||||||||||||||
Sbjct: 81392 atgatgttgttgatgatgatg 81412



to top

>gb|AY543780.1| Salmo salar clone Alu216 microsatellite sequence
          Length = 424

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 398 atgatgttgttgatgatgatgattgttca 426
           |||||| || |||||||||||||||||||
Sbjct: 272 atgatgatgatgatgatgatgattgttca 300



to top

>gb|AC127240.3| Mus musculus BAC clone RP24-387H11 from chromosome 8, complete sequence
          Length = 212579

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 398   atgatgttgttgatgatgatg 418
             |||||||||||||||||||||
Sbjct: 63168 atgatgttgttgatgatgatg 63188



to top

>gb|AY262029.1| Cryptosporidium hominis 2636 60 kDa glycoprotein (gp60) gene,
           gp60-Ia allele, partial cds
          Length = 779

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 400 gatgttgttgatgatgatgat 420
           |||||||||||||||||||||
Sbjct: 147 gatgttgttgatgatgatgat 127



to top

>gb|AC109365.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0034P08,
              complete sequence
          Length = 173088

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 400    gatgttgttgatgatgatgat 420
              |||||||||||||||||||||
Sbjct: 172270 gatgttgttgatgatgatgat 172290



to top

>gb|AC005022.1| Homo sapiens BAC clone GS1-371A6 from 7, complete sequence
          Length = 103565

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 398   atgatgttgttgatgatgatgattgttca 426
             ||||||||| |||||||||||| ||||||
Sbjct: 77054 atgatgttgatgatgatgatgactgttca 77082



to top

>gb|AC025116.14| Mus musculus chromosome 1, clone RP23-124O19, complete sequence
          Length = 233298

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 398   atgatgttgttgatgatgatg 418
             |||||||||||||||||||||
Sbjct: 51242 atgatgttgttgatgatgatg 51222



to top

>gb|AC131026.11| Medicago truncatula clone mth2-6e18, complete sequence
          Length = 114815

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 402   tgttgttgatgatgatgattg 422
             |||||||||||||||||||||
Sbjct: 33337 tgttgttgatgatgatgattg 33357



to top

>gb|AY117306.1| Arabidopsis thaliana unknown protein (At1g10720) mRNA, complete cds
          Length = 1321

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 400  gatgttgttgatgatgatgat 420
            |||||||||||||||||||||
Sbjct: 1105 gatgttgttgatgatgatgat 1125



to top

>gb|AY074279.1| Arabidopsis thaliana unknown protein (At1g10720) mRNA, complete cds
          Length = 1595

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 400  gatgttgttgatgatgatgat 420
            |||||||||||||||||||||
Sbjct: 1116 gatgttgttgatgatgatgat 1136



to top

>emb|AL603711.6| Mouse DNA sequence from clone RP23-381B19 on chromosome 11 Contains the
              3' end of the Slfn3 gene for schlafen 3, a novel gene, two
              schlafen (Slfn) pseudogenes, the Pex12 gene for peroxisomal
              biogenesis factor 12 and the Ap2b1 gene for adaptor-related
              protein complex 2 beta 1 subunit, complete sequence
          Length = 204523

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 328    tttttgttcttccttctctgg 348
              |||||||||||||||||||||
Sbjct: 165079 tttttgttcttccttctctgg 165059



to top

>emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 82
          Length = 195165

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 398    atgatgttgttgatgatgatgattg 422
              |||||| ||||||||||||||||||
Sbjct: 178939 atgatgatgttgatgatgatgattg 178915



to top

>emb|AL035522.1|ATT12J5 Arabidopsis thaliana DNA chromosome 4, BAC clone  T12J5 (ESSAII
             project)
          Length = 84499

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 398   atgatgttgttgatgatgatgattg 422
             |||||| ||||||||||||||||||
Sbjct: 49017 atgatgatgttgatgatgatgattg 48993



to top

>emb|AL022023.1|ATM4E13 Arabidopsis thaliana DNA chromosome 4, BAC clone M4E13 (ESSAII project)
          Length = 80346

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 398   atgatgttgttgatgatgatgattg 422
             |||||| ||||||||||||||||||
Sbjct: 79972 atgatgatgttgatgatgatgattg 79948



to top

>gb|AC010565.6| Drosophila melanogaster 3L BAC RP98-19A3 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 159928

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 400   gatgttgttgatgatgatgat 420
             |||||||||||||||||||||
Sbjct: 65401 gatgttgttgatgatgatgat 65421



to top

>gb|AC011118.13| Homo sapiens chromosome 8, clone RP11-163D8, complete sequence
          Length = 135968

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 324   tccatttttgttcttccttct 344
             |||||||||||||||||||||
Sbjct: 71228 tccatttttgttcttccttct 71248



to top

>gb|AC118347.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone
             OSJNBa0043E10, complete sequence
          Length = 124591

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 400   gatgttgttgatgatgatgat 420
             |||||||||||||||||||||
Sbjct: 25676 gatgttgttgatgatgatgat 25696



to top

>gb|AC092492.1|AC092492 Drosophila melanogaster, chromosome 2L, region 30B-30E, BAC clone
             BACR20B09, complete sequence
          Length = 177997

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 399   tgatgttgttgatgatgatgattgt 423
             |||||||| ||||||||||||||||
Sbjct: 75184 tgatgttgatgatgatgatgattgt 75208



to top

>gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete genome
          Length = 2909809

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 49     gaggttgacggcgacgtcgag 69
              |||||||||||||||||||||
Sbjct: 645668 gaggttgacggcgacgtcgag 645688



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 400      gatgttgttgatgatgatgat 420
                |||||||||||||||||||||
Sbjct: 22169028 gatgttgttgatgatgatgat 22169008



to top

>gb|AC007354.3|T16B5 Arabidopsis thaliana chromosome 1 BAC T16B5 sequence, complete sequence
          Length = 70116

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 400   gatgttgttgatgatgatgat 420
             |||||||||||||||||||||
Sbjct: 50726 gatgttgttgatgatgatgat 50706



to top

>gb|AC116967.2| Dictyostelium discoideum chromosome 2 map 5481549-5500786 strain AX4,
            complete sequence
          Length = 19237

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 398  atgatgttgttgatgatgatgattgttca 426
            |||||||||||||||||| ||||| ||||
Sbjct: 5776 atgatgttgttgatgatgttgatttttca 5748



to top

>gb|AC009398.6|AC009398 Genomic sequence for Arabidopsis thaliana BAC F20B24 from chromosome I,
             complete sequence
          Length = 99416

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 400   gatgttgttgatgatgatgat 420
             |||||||||||||||||||||
Sbjct: 64465 gatgttgttgatgatgatgat 64485



to top

>gb|AY086831.1| Arabidopsis thaliana clone 28214 mRNA, complete sequence
          Length = 1565

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 400  gatgttgttgatgatgatgat 420
            |||||||||||||||||||||
Sbjct: 1117 gatgttgttgatgatgatgat 1137



to top

>ref|XM_308386.2| Anopheles gambiae str. PEST ENSANGP00000019065
           (ENSANGG00000016576), partial mRNA
          Length = 1656

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 399 tgatgttgttgatgatgatgattgt 423
           ||||| |||||||||||||||||||
Sbjct: 801 tgatgatgttgatgatgatgattgt 777



to top

>emb|CT573054.2| Medicago truncatula chromosome 5 clone mte1-76j13, COMPLETE SEQUENCE
          Length = 114731

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 401   atgttgttgatgatgatgatt 421
             |||||||||||||||||||||
Sbjct: 82558 atgttgttgatgatgatgatt 82578



to top

>gb|AY105896.1| Zea mays PCO140796 mRNA sequence
          Length = 614

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 16  ccactccattgtccaaagcttcgcgatgg 44
           ||||||| ||||||||||||||| |||||
Sbjct: 195 ccactcctttgtccaaagcttcgagatgg 223



to top

>gb|AE003624.3| Drosophila melanogaster chromosome 2L, section 33 of 83 of the complete
              sequence
          Length = 270771

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 399    tgatgttgttgatgatgatgattgt 423
              |||||||| ||||||||||||||||
Sbjct: 128959 tgatgttgatgatgatgatgattgt 128983



to top

>gb|AE003545.3| Drosophila melanogaster chromosome 3L, section 40 of 83 of the complete
              sequence
          Length = 282115

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 400    gatgttgttgatgatgatgat 420
              |||||||||||||||||||||
Sbjct: 236259 gatgttgttgatgatgatgat 236279



to top

>gb|AC005125.1|AC005125 Drosophila melanogaster, chromosome 2L, region 30A7-30A8, P1 clone
             DS06478, complete sequence
          Length = 66178

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 399   tgatgttgttgatgatgatgattgt 423
             |||||||| ||||||||||||||||
Sbjct: 49462 tgatgttgatgatgatgatgattgt 49438



to top

>gb|CP000102.1| Methanosphaera stadtmanae DSM 3091, complete genome
          Length = 1767403

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 367     agatgaattagatgatgttga 387
               |||||||||||||||||||||
Sbjct: 1696821 agatgaattagatgatgttga 1696801



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 400      gatgttgttgatgatgatgat 420
                |||||||||||||||||||||
Sbjct: 22478939 gatgttgttgatgatgatgat 22478919



to top

>emb|AL713883.1|CNS07YP0 Mus musculus chromosome 11 region in the Om locus area (D11Mit37-Scya6)
             clone 179H3 of library Caltech CITB-BAC from chromosome 11
             of Mus musculus (mouse)
          Length = 168835

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 328   tttttgttcttccttctctgg 348
             |||||||||||||||||||||
Sbjct: 44469 tttttgttcttccttctctgg 44489



to top

>gb|DQ213015.1| Nicotiana tabacum sucrose-phosphate synthase isoform B (SPSB) mRNA,
           complete cds
          Length = 3195

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 398 atgatgttgttgatgatgatg 418
           |||||||||||||||||||||
Sbjct: 100 atgatgttgttgatgatgatg 80



to top

>ref|NM_101023.1| Arabidopsis thaliana unknown protein AT1G11500 mRNA, complete cds
          Length = 537

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 401 atgttgttgatgatgatgat 420
           ||||||||||||||||||||
Sbjct: 126 atgttgttgatgatgatgat 107



to top

>ref|NM_123784.3| Arabidopsis thaliana unknown protein AT5G44170 mRNA, complete cds
          Length = 906

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 400 gatgttgttgatgatgatga 419
           ||||||||||||||||||||
Sbjct: 189 gatgttgttgatgatgatga 170



to top

>ref|NM_115943.1| Arabidopsis thaliana unknown protein AT3G60790 mRNA, complete cds
          Length = 1467

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 392 agggctatgatgttgttgatgatgatgattgt 423
           ||||| |||||| || ||||||||||||||||
Sbjct: 40  agggcaatgatgatgatgatgatgatgattgt 9



to top

>ref|NM_116749.2| Arabidopsis thaliana DNA binding / transcription factor AT4G05100
           mRNA, complete cds
          Length = 1175

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 401 atgttgttgatgatgatgat 420
           ||||||||||||||||||||
Sbjct: 577 atgttgttgatgatgatgat 558



to top

>ref|NM_117080.4| Arabidopsis thaliana transferase, transferring glycosyl groups
            AT4G10120 transcript variant AT4G10120.1 mRNA, complete
            cds
          Length = 3457

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 234  gcttacaagaagttgtggat 253
            ||||||||||||||||||||
Sbjct: 2618 gcttacaagaagttgtggat 2637



to top

>ref|NM_001036532.1| Arabidopsis thaliana unknown protein AT4G10120 transcript variant
            AT4G10120.2 mRNA, complete cds
          Length = 3468

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 234  gcttacaagaagttgtggat 253
            ||||||||||||||||||||
Sbjct: 2629 gcttacaagaagttgtggat 2648



to top

>ref|NM_114688.2| Arabidopsis thaliana unknown protein AT3G48185 mRNA, complete cds
          Length = 533

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 397 tatgatgttgttgatgatgatgat 420
           ||||||| ||||||||||||||||
Sbjct: 237 tatgatgatgttgatgatgatgat 214



to top

>ref|NM_106425.2| Arabidopsis thaliana NIA1 (NITRATE REDUCTASE 1) AT1G77760 (NIA1)
            mRNA, complete cds
          Length = 3034

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 401  atgttgttgatgatgatgat 420
            ||||||||||||||||||||
Sbjct: 2988 atgttgttgatgatgatgat 3007



to top

>ref|XM_633249.1| Dictyostelium discoideum hypothetical protein (DDB0186370), partial
           mRNA
          Length = 975

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 402 tgttgttgatgatgatgatt 421
           ||||||||||||||||||||
Sbjct: 879 tgttgttgatgatgatgatt 860



to top

>ref|XM_632697.1| Dictyostelium discoideum hypothetical protein (DDB0186863), partial
           mRNA
          Length = 6018

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 399 tgatgttgttgatgatgatg 418
           ||||||||||||||||||||
Sbjct: 306 tgatgttgttgatgatgatg 287



to top

>ref|XM_631774.1| Dictyostelium discoideum PKC domain-containing protein, PE/DAG
            binding (DDB0231197), partial mRNA
          Length = 4044

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 398  atgatgttgttgatgatgatgatt 421
            ||||||||| ||||||||||||||
Sbjct: 1122 atgatgttgatgatgatgatgatt 1099



to top

>ref|XM_642541.1| Dictyostelium discoideum hypothetical protein (DDB0201555), partial
           mRNA
          Length = 4500

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 398 atgatgttgttgatgatgatgatt 421
           |||||| |||||||||||||||||
Sbjct: 237 atgatgatgttgatgatgatgatt 214



to top

>ref|XM_642438.1| Dictyostelium discoideum hypothetical protein (DDB0189755), partial
           mRNA
          Length = 2595

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 402 tgttgttgatgatgatgatt 421
           ||||||||||||||||||||
Sbjct: 354 tgttgttgatgatgatgatt 335



to top

>ref|XM_641800.1| Dictyostelium discoideum hypothetical protein (DDB0202303), partial
           mRNA
          Length = 1482

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 401 atgttgttgatgatgatgat 420
           ||||||||||||||||||||
Sbjct: 569 atgttgttgatgatgatgat 588



to top

>ref|XM_637346.1| Dictyostelium discoideum dihydrolipoamide acetyltransferase
           (DDB0215387), partial mRNA
          Length = 1908

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 398 atgatgttgttgatgatgatgattgttc 425
           |||||| || ||||||||||||||||||
Sbjct: 922 atgatgatgatgatgatgatgattgttc 895



to top

>ref|XM_637157.1| Dictyostelium discoideum hypothetical protein (DDB0205330), partial
           mRNA
          Length = 2634

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 402 tgttgttgatgatgatgatt 421
           ||||||||||||||||||||
Sbjct: 776 tgttgttgatgatgatgatt 757



to top

>ref|XM_636213.1| Dictyostelium discoideum hypothetical protein (DDB0206442), partial
           mRNA
          Length = 1584

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 404 ttgttgatgatgatgattgt 423
           ||||||||||||||||||||
Sbjct: 241 ttgttgatgatgatgattgt 222



to top

>ref|XM_635359.1| Dictyostelium discoideum hypothetical protein (DDB0204239), partial
           mRNA
          Length = 2502

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 402 tgttgttgatgatgatgatt 421
           ||||||||||||||||||||
Sbjct: 486 tgttgttgatgatgatgatt 467



to top

>ref|XM_630983.1| Dictyostelium discoideum hypothetical protein (DDB0220682), partial
           mRNA
          Length = 1668

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 399 tgatgttgttgatgatgatgattgttca 426
           ||||| || |||||||||||||||||||
Sbjct: 540 tgatgatgatgatgatgatgattgttca 513



to top

>ref|XM_630348.1| Dictyostelium discoideum hypothetical protein (DDB0189198), partial
            mRNA
          Length = 1368

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 399  tgatgttgttgatgatgatg 418
            ||||||||||||||||||||
Sbjct: 1164 tgatgttgttgatgatgatg 1145



to top

>ref|XM_629461.1| Dictyostelium discoideum hypothetical protein (DDB0191640), partial
           mRNA
          Length = 3606

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 402 tgttgttgatgatgatgatt 421
           ||||||||||||||||||||
Sbjct: 519 tgttgttgatgatgatgatt 500



to top

>gb|AC159273.4| Mus musculus BAC clone RP23-391G8 from chromosome 7, complete sequence
          Length = 227709

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 331   ttgttcttccttctctggag 350
             ||||||||||||||||||||
Sbjct: 30556 ttgttcttccttctctggag 30575



to top

>gb|DP000017.1| Sus scrofa target 1 genomic scaffold
          Length = 1471440

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 337     ttccttctctggagtttgat 356
               ||||||||||||||||||||
Sbjct: 1316844 ttccttctctggagtttgat 1316863



to top

>gb|BC082443.1| Xenopus laevis nucleoporin Nup153, mRNA (cDNA clone MGC:83820
           IMAGE:6642679), complete cds
          Length = 5979

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 401 atgttgttgatgatgatgat 420
           ||||||||||||||||||||
Sbjct: 453 atgttgttgatgatgatgat 472



to top

>gb|AC010993.13| Drosophila melanogaster clone BACR27O05, complete sequence
          Length = 193526

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 399   tgatgttgttgatgatgatg 418
             ||||||||||||||||||||
Sbjct: 82935 tgatgttgttgatgatgatg 82916



to top

>ref|XM_362240.1| Magnaporthe grisea 70-15 hypothetical protein (MG04685.4) partial cds
          Length = 4377

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 395  gctatgatgttgttgatgat 414
            ||||||||||||||||||||
Sbjct: 2327 gctatgatgttgttgatgat 2346



to top

>gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete genome
          Length = 5227419

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 367    agatgaattagatgatgttg 386
              ||||||||||||||||||||
Sbjct: 662379 agatgaattagatgatgttg 662398



to top

>ref|XM_323555.1| Neurospora crassa OR74A hypothetical protein (NCU04216.1) partial
            mRNA
          Length = 1641

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 6    tgctcgtggaccactccattgtcc 29
            ||||||||||| ||||||||||||
Sbjct: 1121 tgctcgtggacgactccattgtcc 1144



to top

>ref|XM_955747.1| Neurospora crassa OR74A hypothetical protein (NCU04216.1) partial
            mRNA
          Length = 1641

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 6    tgctcgtggaccactccattgtcc 29
            ||||||||||| ||||||||||||
Sbjct: 1121 tgctcgtggacgactccattgtcc 1144



to top

>gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome
          Length = 5228663

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 367    agatgaattagatgatgttg 386
              ||||||||||||||||||||
Sbjct: 662451 agatgaattagatgatgttg 662470



to top

>gb|AY809201.1| Schistosoma japonicum SJCHGC04199 protein mRNA, partial cds
          Length = 732

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 402 tgttgttgatgatgatgatt 421
           ||||||||||||||||||||
Sbjct: 240 tgttgttgatgatgatgatt 221



to top

>gb|AC092497.2| Sus scrofa clone RP44-30C22, complete sequence
          Length = 172144

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 337   ttccttctctggagtttgat 356
             ||||||||||||||||||||
Sbjct: 17548 ttccttctctggagtttgat 17567



to top

>ref|XM_705605.1| Candida albicans SC5314 hypothetical protein (CaO19.7807), mRNA
          Length = 2298

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 402 tgttgttgatgatgatgatt 421
           ||||||||||||||||||||
Sbjct: 59  tgttgttgatgatgatgatt 40



to top

>gb|AC144768.2| Mus musculus BAC clone RP23-24K24 from chromosome 7, complete sequence
          Length = 230675

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 402    tgttgttgatgatgatgatt 421
              ||||||||||||||||||||
Sbjct: 174317 tgttgttgatgatgatgatt 174298



to top

>gb|AY812209.1| Schistosoma japonicum SJCHGC07181 protein mRNA, partial cds
          Length = 681

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 402 tgttgttgatgatgatgatt 421
           ||||||||||||||||||||
Sbjct: 473 tgttgttgatgatgatgatt 454



to top

>gb|AE017286.1| Desulfovibrio vulgaris subsp. vulgaris str. Hildenborough plasmid
            pDV, complete sequence
          Length = 202301

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 56   acggcgacgtcgagggcgtacccg 79
            |||||||||||||| |||||||||
Sbjct: 1022 acggcgacgtcgagcgcgtacccg 1045



to top

>gb|AC125010.6| Mus musculus chromosome 10, clone RP24-117L12, complete sequence
          Length = 223541

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 329    ttttgttcttccttctctgg 348
              ||||||||||||||||||||
Sbjct: 149417 ttttgttcttccttctctgg 149436



to top

>gb|U88178.1| Caenorhabditis elegans cosmid W09C3, complete sequence
          Length = 23793

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 401  atgttgttgatgatgatgat 420
            ||||||||||||||||||||
Sbjct: 3843 atgttgttgatgatgatgat 3862



to top

>ref|NM_178298.2| Danio rerio selenoprotein P, plasma, 1b (sepp1b), mRNA
          Length = 1267

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 401 atgttgttgatgatgatgat 420
           ||||||||||||||||||||
Sbjct: 717 atgttgttgatgatgatgat 698



to top

>gb|AY519603.1| Arabidopsis thaliana MYB transcription factor (At4g05100) mRNA,
           complete cds
          Length = 975

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 401 atgttgttgatgatgatgat 420
           ||||||||||||||||||||
Sbjct: 474 atgttgttgatgatgatgat 455



to top

>gb|AC102228.8| Mus musculus chromosome 13, clone RP24-64M1, complete sequence
          Length = 201286

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 401   atgttgttgatgatgatgat 420
             ||||||||||||||||||||
Sbjct: 29053 atgttgttgatgatgatgat 29072



to top

>gb|AC120558.12| Mus musculus chromosome 18, clone RP24-494K12, complete sequence
          Length = 216435

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 401    atgttgttgatgatgatgattgtt 424
              ||||||||||||||||| ||||||
Sbjct: 154932 atgttgttgatgatgatcattgtt 154955



to top

>gb|AC133890.16| Mus musculus chromosome 10, clone RP23-339N24, complete sequence
          Length = 211758

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 402   tgttgttgatgatgatgatt 421
             ||||||||||||||||||||
Sbjct: 15153 tgttgttgatgatgatgatt 15172



to top

>gb|AC118689.16| Mus musculus chromosome 10, clone RP23-293N21, complete sequence
          Length = 163917

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 402    tgttgttgatgatgatgatt 421
              ||||||||||||||||||||
Sbjct: 101502 tgttgttgatgatgatgatt 101521



to top

>gb|AY484465.1| Dictyostelium discoideum kinesin family member 12 gene, complete
           cds
          Length = 6808

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 398 atgatgttgttgatgatgatgatt 421
           |||||| |||||||||||||||||
Sbjct: 541 atgatgatgttgatgatgatgatt 518



to top

>emb|AJ296731.1|PAB296731 Picea abies ATC microsatellite DNA, clone EATC2G09
          Length = 342

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 401 atgttgttgatgatgatgat 420
           ||||||||||||||||||||
Sbjct: 173 atgttgttgatgatgatgat 154



to top

>gb|AC146257.3| Pan troglodytes BAC clone CH251-113A6 from Y, complete sequence
          Length = 174522

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 331  ttgttcttccttctctggag 350
            ||||||||||||||||||||
Sbjct: 2883 ttgttcttccttctctggag 2902



to top

>gb|BC086844.1| Danio rerio selenoprotein P, plasma, 1b, mRNA (cDNA clone
           MGC:103690 IMAGE:7263305), complete cds
          Length = 1357

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 401 atgttgttgatgatgatgat 420
           ||||||||||||||||||||
Sbjct: 744 atgttgttgatgatgatgat 725



to top

>gb|AC132098.4| Mus musculus BAC clone RP24-401I1 from chromosome 18, complete sequence
          Length = 154520

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 401   atgttgttgatgatgatgattgtt 424
             ||||||||||||||||| ||||||
Sbjct: 61911 atgttgttgatgatgatcattgtt 61934



to top

>gb|AC104100.6| Mus musculus BAC clone RP24-374D12 from chromosome 7, complete sequence
          Length = 139125

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 402    tgttgttgatgatgatgatt 421
              ||||||||||||||||||||
Sbjct: 103391 tgttgttgatgatgatgatt 103410



to top

>gb|AC117251.3| Mus musculus BAC clone RP24-372C12 from chromosome 8, complete sequence
          Length = 191927

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 397   tatgatgttgttgatgatgatgat 420
             |||| |||||||||||||||||||
Sbjct: 10422 tatgttgttgttgatgatgatgat 10399



to top

>gb|AC122020.3| Mus musculus BAC clone RP24-365G17 from chromosome 1, complete sequence
          Length = 165592

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 398    atgatgttgttgatgatgatgattgttc 425
              |||||| || ||||||||||||||||||
Sbjct: 139835 atgatgatgatgatgatgatgattgttc 139808



to top

>gb|AC122041.4| Mus musculus BAC clone RP24-443H19 from chromosome 16, complete
             sequence
          Length = 183268

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 402   tgttgttgatgatgatgatt 421
             ||||||||||||||||||||
Sbjct: 33740 tgttgttgatgatgatgatt 33759



to top

>ref|XM_816579.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein
           (MASP) (Tc00.1047053511255.50) partial mRNA
          Length = 1101

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 397 tatgatgttgttgatgatgatgat 420
           ||||| ||||||||||||||||||
Sbjct: 271 tatgacgttgttgatgatgatgat 294



to top

>gb|AC123819.2| Mus musculus BAC clone RP23-460M11 from chromosome 8, complete sequence
          Length = 202899

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 398    atgatgttgttgatgatgat 417
              ||||||||||||||||||||
Sbjct: 165882 atgatgttgttgatgatgat 165901



to top

>ref|XM_814052.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein
           (MASP) (Tc00.1047053510363.220) partial mRNA
          Length = 1149

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 397 tatgatgttgttgatgatgatgat 420
           ||||| ||||||||||||||||||
Sbjct: 325 tatgacgttgttgatgatgatgat 348



to top

>gb|AC122839.4| Mus musculus BAC clone RP23-193K9 from 8, complete sequence
          Length = 177322

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 398 atgatgttgttgatgatgat 417
           ||||||||||||||||||||
Sbjct: 335 atgatgttgttgatgatgat 354



to top

>gb|AC116587.4| Mus musculus BAC clone RP23-409C18 from 12, complete sequence
          Length = 202651

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 359    agtaattaagatgaattaga 378
              ||||||||||||||||||||
Sbjct: 144509 agtaattaagatgaattaga 144528



to top

>gb|BC042927.1| Xenopus laevis hypothetical protein MGC53311, mRNA (cDNA clone
            MGC:53311 IMAGE:5570535), complete cds
          Length = 1529

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 402  tgttgttgatgatgatgatt 421
            ||||||||||||||||||||
Sbjct: 1309 tgttgttgatgatgatgatt 1290



to top

>gb|AC098885.3| Mus musculus BAC clone RP23-122L17 from 5, complete sequence
          Length = 211112

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 397    tatgatgttgttgatgatgatgat 420
              |||| |||||||||||||||||||
Sbjct: 155662 tatgttgttgttgatgatgatgat 155685



to top

>ref|XM_725691.1| Plasmodium yoelii yoelii str. 17XNL protein serine/threonine
           kinase-1 (PY02853) partial mRNA
          Length = 1527

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 398 atgatgttgttgatgatgatgatt 421
           ||||||||| ||||||||||||||
Sbjct: 443 atgatgttgatgatgatgatgatt 466



to top

>gb|AC165082.2| Mus musculus BAC clone RP23-412H17 from chromosome 17, complete sequence
          Length = 196132

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 398    atgatgttgttgatgatgatgatt 421
              ||||||||| ||||||||||||||
Sbjct: 113441 atgatgttggtgatgatgatgatt 113464



to top

>gb|CP000001.1| Bacillus cereus E33L, complete genome
          Length = 5300915

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 367    agatgaattagatgatgttg 386
              ||||||||||||||||||||
Sbjct: 650703 agatgaattagatgatgttg 650722



to top

>emb|AL591506.24| Human DNA sequence from clone RP11-112N13 on chromosome 9 Contains a
              pseudogene similar to reverse transcriptase proteins,
              complete sequence
          Length = 175831

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 398    atgatgttgttgatgatgatgatt 421
              ||||||||| ||||||||||||||
Sbjct: 107718 atgatgttgatgatgatgatgatt 107695



to top

>emb|AL355343.18| Human DNA sequence from clone RP11-455I14 on chromosome 6 Contains the
             5' end of the TIAM2 gene for T-cell lymphoma invasion and
             metastasis 2 (SIF and Tiam 1-like exchange factor (STEF)),
             complete sequence
          Length = 179262

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 398   atgatgttgttgatgatgatgatt 421
             |||||| |||||||||||||||||
Sbjct: 13305 atgatgatgttgatgatgatgatt 13328



to top

>emb|AL355582.8| Human DNA sequence from clone RP11-69L15 on chromosome 9, complete
             sequence
          Length = 115848

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 272   ctccctttctcctagacacatgta 295
             |||||||||||| |||||||||||
Sbjct: 74740 ctccctttctccaagacacatgta 74717



to top

>emb|AL354891.11| Human DNA sequence from clone RP11-44I7 on chromosome 13 Contains part
             of the gene for a novel protein (ortholog of rat putative
             four repeat ion channel), complete sequence
          Length = 103706

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 401   atgttgttgatgatgatgat 420
             ||||||||||||||||||||
Sbjct: 59031 atgttgttgatgatgatgat 59012



to top

>gb|AC044849.12| Homo sapiens chromosome 8, clone RP11-489E7, complete sequence
          Length = 149301

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 367   agatgaattagatgatgttg 386
             ||||||||||||||||||||
Sbjct: 22758 agatgaattagatgatgttg 22739



to top

>ref|XM_795079.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein
           LOC582295 (LOC582295), partial mRNA
          Length = 270

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 398 atgatgttgttgatgatgat 417
           ||||||||||||||||||||
Sbjct: 203 atgatgttgttgatgatgat 222


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,802,673
Number of Sequences: 3902068
Number of extensions: 4802673
Number of successful extensions: 158557
Number of sequences better than 10.0: 354
Number of HSP's better than 10.0 without gapping: 353
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 156080
Number of HSP's gapped (non-prelim): 2447
length of query: 492
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 470
effective length of database: 17,147,199,772
effective search space: 8059183892840
effective search space used: 8059183892840
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top