ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags14j16
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_191218.1| Oryza sativa (japonica cultivar-group), predic... 488 e-134
2dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 216 6e-53
3dbj|AP003076.3| Oryza sativa (japonica cultivar-group) genomic D... 216 6e-53
4gb|AC151710.1| Pan troglodytes chromosome X clone PTB-084K12 map... 44 0.48
5ref|XM_366848.1| Magnaporthe grisea 70-15 chromosome VII hypothe... 44 0.48
6emb|AL357774.11| Human DNA sequence from clone RP11-473N15 on ch... 44 0.48
7emb|AL603708.13| Mouse DNA sequence from clone RP23-381C21 on ch... 44 0.48
8gb|AC150979.15| Medicago truncatula clone mth2-115a17, complete ... 44 0.48
9gb|AC140035.9| Medicago truncatula clone mth2-25n18, complete se... 44 0.48
10gb|AC151796.1| Ornithorhynchus anatinus chromosome UNK clone OAB... 42 1.9
11gb|AC124976.9| Mus musculus chromosome 3, clone RP24-84E6, compl... 42 1.9
12gb|AC093481.8| Mus musculus chromosome 18, clone RP23-62E19, com... 42 1.9
13gb|CP000117.1| Anabaena variabilis ATCC 29413 chromosome, comple... 42 1.9
14gb|AC161438.6| Mus musculus chromosome 18, clone RP23-62E1, comp... 42 1.9
15gb|AC008914.7| Homo sapiens chromosome 5 clone CTD-2270I16, comp... 42 1.9
16gb|AC093870.3| Homo sapiens BAC clone RP11-598G2 from 4, complet... 42 1.9
17ref|XM_228060.3| PREDICTED: Rattus norvegicus ubiquitin associat... 42 1.9
18emb|CR749763.6| Zebrafish DNA sequence from clone CH211-285D14 i... 42 1.9
19gb|AC140790.3| Gallus gallus BAC clone TAM32-50D18 from chromoso... 42 1.9
20gb|AC102908.11| Mus musculus chromosome 16, clone RP24-288K2, co... 40 7.6
21ref|XM_516176.1| PREDICTED: Pan troglodytes similar to IQ motif ... 40 7.6
22gb|AC104283.2| Oryza sativa (japonica cultivar-group) chromosome... 40 7.6
23gb|AC124142.2| Oryza sativa (japonica cultivar-group) chromosome... 40 7.6
24gb|AC153865.3| Mus musculus BAC RP23-373P9 (Roswell Park Cancer... 40 7.6
25gb|AC110249.10| Mus musculus chromosome 14, clone RP23-257O8, co... 40 7.6
26gb|AC131749.2| Mus musculus BAC clone RP23-26G8 from 9, complete... 40 7.6
27emb|CR956422.6| Pig DNA sequence from clone PigE-93N11 on chromo... 40 7.6
28emb|AL391665.28| Human DNA sequence from clone RP11-519K18 on ch... 40 7.6
29emb|AL365335.11| Human DNA sequence from clone RP11-278E14 on ch... 40 7.6
30emb|AL161436.12| Human DNA sequence from clone RP11-377N20 on ch... 40 7.6
31emb|AL009047.1|HS1156N12 Human DNA sequence from clone RP5-1156N... 40 7.6
32emb|BX571865.1| Photorhabdus luminescens subsp. laumondii TTO1 c... 40 7.6
33gb|AC140078.8| Homo sapiens 12 BAC RP13-7D7 (Roswell Park Cancer... 40 7.6
34emb|AL161472.2|ATCHRIV2 Arabidopsis thaliana DNA chromosome 4, c... 40 7.6
35emb|CR751236.6| Zebrafish DNA sequence from clone DKEY-27M6 in l... 40 7.6
36emb|BX901907.7| Zebrafish DNA sequence from clone DKEY-22H13 in ... 40 7.6
37gb|AC117383.4| Homo sapiens 3 BAC RP11-789L4 (Roswell Park Cance... 40 7.6
38ref|NM_136073.2| Drosophila melanogaster CG18397-RA (CG18397), mRNA 40 7.6
39gb|AC025038.6| Homo sapiens chromosome 10 clone RP11-443O13, com... 40 7.6
40gb|AC154180.2| Mus musculus BAC clone RP24-469E6 from chromosome... 40 7.6
41dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.6
42dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.6
43gb|AC009204.5|AC009204 Drosophila melanogaster, chromosome 2L, r... 40 7.6
44gb|AC011756.5|AC011756 Drosophila melanogaster, chromosome 2L, r... 40 7.6
45dbj|AP008246.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.6
46gb|AC022215.4|AC022215 Homo sapiens BAC clone RP11-764I5 from 3,... 40 7.6
47ref|XM_234281.3| PREDICTED: Rattus norvegicus AT rich interactiv... 40 7.6
48emb|BX005383.8| Zebrafish DNA sequence from clone DKEYP-19E1 in ... 40 7.6
49emb|AL928790.4| Zebrafish DNA sequence from clone CH211-146N9, c... 40 7.6
50gb|BT021951.1| Drosophila melanogaster LD01527 full insert cDNA 40 7.6
51gb|AF058919.2|F6N23 Arabidopsis thaliana BAC F6N23 40 7.6
52emb|BX255897.3| Zebrafish DNA sequence from clone DKEY-263B2 in ... 40 7.6
53emb|CT573073.1| Kuenenia stuttgartiensis genome fragment KUST_C ... 40 7.6
54gb|AE003661.3| Drosophila melanogaster chromosome 2L, section 70... 40 7.6
55gb|AE000666.1| Methanothermobacter thermautotrophicus str. Delta... 40 7.6
56emb|AL590387.7| Human DNA sequence from clone RP3-356B20 on chro... 40 7.6
57emb|AL606994.3|OSJN00114 Oryza sativa genomic DNA, chromosome 4,... 40 7.6
58gb|AC087840.16| Mus musculus strain C57BL/6J chromosome 16 clone... 40 7.6
59gb|U60597.1|OAU60597 Ovis aries myeloid antimicrobial peptide pr... 40 7.6

>ref|NM_191218.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1410

 Score =  488 bits (246), Expect = e-134
 Identities = 465/538 (86%)
 Strand = Plus / Plus

                                                                       
Query: 3   cgcctcgtacatggcgtgcgcgagccgtgcctgaagtttcttaacccgaaaagtatagaa 62
           |||||||| ||||||||||||||||| ||| |||| || ||||  || | ||||||||||
Sbjct: 292 cgcctcgtccatggcgtgcgcgagccttgcttgaacttccttagtcccagaagtatagaa 351

                                                                       
Query: 63  aatttggcatttcacgaaggctcgggacttgatgctgtggtcaagaggatcatatacaaa 122
            |||||| |||||  | |||  |   ||||||| |||||||||||||||| |||||||||
Sbjct: 352 gatttggtatttcctggaggtacaaaacttgattctgtggtcaagaggattatatacaaa 411

                                                                       
Query: 123 actgatgacgacgactatgactcacaccactctgaggcaaactctacctatttactgcag 182
            |||||||| ||||||||||  || ||||||||||||||||||| || ||||| ||||| 
Sbjct: 412 tctgatgacaacgactatgatacataccactctgaggcaaactcaacgtatttgctgcaa 471

                                                                       
Query: 183 catgcagaagctaccaggttcaatttgtttacaggattccagacagtttctgaaagagaa 242
           ||||| || ||||||||||||||| |||| |||||||| |||||| || |||| ||||| 
Sbjct: 472 catgctgaggctaccaggttcaatctgttcacaggatttcagacacttcctgagagagag 531

                                                                       
Query: 243 gagagcttcaaggtgaatgagactgttaatgtgcactgtggtttctacagtgacaatggt 302
           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 532 gagagcttcaaggtgaatgaaactgttaatgtgcactgtggtttctacagtgacaatggt 591

                                                                       
Query: 303 ggcttcaaaatttctgatgatgatgtcagatacatgagaacttgtaaagttgtcgtgtct 362
           || ||||||||||||||   |||  | ||||| |||||| ||||||||||||| || |||
Sbjct: 592 ggtttcaaaatttctgacattgacatgagatatatgagatcttgtaaagttgtggtatct 651

                                                                       
Query: 363 acctgcgcattcggtggtggggatgatctatatcaacctattggaatggtcaattcttct 422
           || || || || ||||||||||||||||||||||| ||||||||||||||||||||||| 
Sbjct: 652 acttgtgcgtttggtggtggggatgatctatatcagcctattggaatggtcaattcttca 711

                                                                       
Query: 423 attggaaaggtctgctatgtggctttctgggatgaggtcacgttatcaactcaagaagct 482
           |||||||||||||||||||| ||||||||||||||||||||  |||||||||| ||| ||
Sbjct: 712 attggaaaggtctgctatgttgctttctgggatgaggtcacactatcaactcaggaatct 771

                                                                     
Query: 483 gaaggaaaattaactggcgacaatgaaaagataggaaggtggcgtatcattgttgtca 540
           ||||||||| ||   |  | ||||| || ||||||||||||||| || ||||||||||
Sbjct: 772 gaaggaaaagtagtcgatggcaatggaatgataggaaggtggcgcataattgttgtca 829



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  216 bits (109), Expect = 6e-53
 Identities = 163/181 (90%)
 Strand = Plus / Plus

                                                                            
Query: 253      aggtgaatgagactgttaatgtgcactgtggtttctacagtgacaatggtggcttcaaaa 312
                |||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 31357079 aggtgaatgaaactgttaatgtgcactgtggtttctacagtgacaatggtggtttcaaaa 31357138

                                                                            
Query: 313      tttctgatgatgatgtcagatacatgagaacttgtaaagttgtcgtgtctacctgcgcat 372
                |||||||   |||  | ||||| |||||| ||||||||||||| || ||||| || || |
Sbjct: 31357139 tttctgacattgacatgagatatatgagatcttgtaaagttgtggtatctacttgtgcgt 31357198

                                                                            
Query: 373      tcggtggtggggatgatctatatcaacctattggaatggtcaattcttctattggaaagg 432
                | ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||
Sbjct: 31357199 ttggtggtggggatgatctatatcagcctattggaatggtcaattcttcaattggaaagg 31357258

                 
Query: 433      t 433
                |
Sbjct: 31357259 t 31357259



 Score =  174 bits (88), Expect = 2e-40
 Identities = 148/168 (88%)
 Strand = Plus / Plus

                                                                            
Query: 89       acttgatgctgtggtcaagaggatcatatacaaaactgatgacgacgactatgactcaca 148
                ||||||| |||||||||||||||| ||||||||| |||||||| ||||||||||  || |
Sbjct: 31356827 acttgattctgtggtcaagaggattatatacaaatctgatgacaacgactatgatacata 31356886

                                                                            
Query: 149      ccactctgaggcaaactctacctatttactgcagcatgcagaagctaccaggttcaattt 208
                |||||||||||||||||| || ||||| ||||| ||||| || ||||||||||||||| |
Sbjct: 31356887 ccactctgaggcaaactcaacgtatttgctgcaacatgctgaggctaccaggttcaatct 31356946

                                                                
Query: 209      gtttacaggattccagacagtttctgaaagagaagagagcttcaaggt 256
                ||| |||||||| |||||| || |||| ||||| ||||||||||||||
Sbjct: 31356947 gttcacaggatttcagacacttcctgagagagaggagagcttcaaggt 31356994



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 95/111 (85%)
 Strand = Plus / Plus

                                                                            
Query: 430      aggtctgctatgtggctttctgggatgaggtcacgttatcaactcaagaagctgaaggaa 489
                ||||||||||||| ||||||||||||||||||||  |||||||||| ||| |||||||||
Sbjct: 31357353 aggtctgctatgttgctttctgggatgaggtcacactatcaactcaggaatctgaaggaa 31357412

                                                                   
Query: 490      aattaactggcgacaatgaaaagataggaaggtggcgtatcattgttgtca 540
                || ||   |  | ||||| || ||||||||||||||| || ||||||||||
Sbjct: 31357413 aagtagtcgatggcaatggaatgataggaaggtggcgcataattgttgtca 31357463



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 3        cgcctcgtacatggcgtgcgcgagc 27
                |||||||| ||||||||||||||||
Sbjct: 31356220 cgcctcgtccatggcgtgcgcgagc 31356244



to top

>dbj|AP003076.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0481E12
          Length = 161563

 Score =  216 bits (109), Expect = 6e-53
 Identities = 163/181 (90%)
 Strand = Plus / Plus

                                                                          
Query: 253    aggtgaatgagactgttaatgtgcactgtggtttctacagtgacaatggtggcttcaaaa 312
              |||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 111362 aggtgaatgaaactgttaatgtgcactgtggtttctacagtgacaatggtggtttcaaaa 111421

                                                                          
Query: 313    tttctgatgatgatgtcagatacatgagaacttgtaaagttgtcgtgtctacctgcgcat 372
              |||||||   |||  | ||||| |||||| ||||||||||||| || ||||| || || |
Sbjct: 111422 tttctgacattgacatgagatatatgagatcttgtaaagttgtggtatctacttgtgcgt 111481

                                                                          
Query: 373    tcggtggtggggatgatctatatcaacctattggaatggtcaattcttctattggaaagg 432
              | ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||
Sbjct: 111482 ttggtggtggggatgatctatatcagcctattggaatggtcaattcttcaattggaaagg 111541

               
Query: 433    t 433
              |
Sbjct: 111542 t 111542



 Score =  174 bits (88), Expect = 2e-40
 Identities = 148/168 (88%)
 Strand = Plus / Plus

                                                                          
Query: 89     acttgatgctgtggtcaagaggatcatatacaaaactgatgacgacgactatgactcaca 148
              ||||||| |||||||||||||||| ||||||||| |||||||| ||||||||||  || |
Sbjct: 111110 acttgattctgtggtcaagaggattatatacaaatctgatgacaacgactatgatacata 111169

                                                                          
Query: 149    ccactctgaggcaaactctacctatttactgcagcatgcagaagctaccaggttcaattt 208
              |||||||||||||||||| || ||||| ||||| ||||| || ||||||||||||||| |
Sbjct: 111170 ccactctgaggcaaactcaacgtatttgctgcaacatgctgaggctaccaggttcaatct 111229

                                                              
Query: 209    gtttacaggattccagacagtttctgaaagagaagagagcttcaaggt 256
              ||| |||||||| |||||| || |||| ||||| ||||||||||||||
Sbjct: 111230 gttcacaggatttcagacacttcctgagagagaggagagcttcaaggt 111277



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 95/111 (85%)
 Strand = Plus / Plus

                                                                          
Query: 430    aggtctgctatgtggctttctgggatgaggtcacgttatcaactcaagaagctgaaggaa 489
              ||||||||||||| ||||||||||||||||||||  |||||||||| ||| |||||||||
Sbjct: 111636 aggtctgctatgttgctttctgggatgaggtcacactatcaactcaggaatctgaaggaa 111695

                                                                 
Query: 490    aattaactggcgacaatgaaaagataggaaggtggcgtatcattgttgtca 540
              || ||   |  | ||||| || ||||||||||||||| || ||||||||||
Sbjct: 111696 aagtagtcgatggcaatggaatgataggaaggtggcgcataattgttgtca 111746



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 3      cgcctcgtacatggcgtgcgcgagc 27
              |||||||| ||||||||||||||||
Sbjct: 110503 cgcctcgtccatggcgtgcgcgagc 110527



to top

>gb|AC151710.1| Pan troglodytes chromosome X clone PTB-084K12 map human ortholog q23,
             complete sequence
          Length = 174741

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 236   aagagaagagagcttcaaggtgaatg 261
             |||||||||| |||||||||||||||
Sbjct: 49934 aagagaagagtgcttcaaggtgaatg 49909



to top

>ref|XM_366848.1| Magnaporthe grisea 70-15 chromosome VII hypothetical protein
           (MG02924.4) partial mRNA
          Length = 2007

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 58  tagaaaatttggcatttcacga 79
           ||||||||||||||||||||||
Sbjct: 270 tagaaaatttggcatttcacga 291



to top

>emb|AL357774.11| Human DNA sequence from clone RP11-473N15 on chromosome X Contains the 5'
              end of the PAK3 gene for p21 (CDKN1A)-activated kinase 3,
              complete sequence
          Length = 156498

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 236    aagagaagagagcttcaaggtgaatg 261
              |||||||||| |||||||||||||||
Sbjct: 136028 aagagaagagtgcttcaaggtgaatg 136003



to top

>emb|AL603708.13| Mouse DNA sequence from clone RP23-381C21 on chromosome 11, complete
             sequence
          Length = 198743

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 382   gggatgatctatatcaacctat 403
             ||||||||||||||||||||||
Sbjct: 37073 gggatgatctatatcaacctat 37052



to top

>gb|AC150979.15| Medicago truncatula clone mth2-115a17, complete sequence
          Length = 152779

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 527    tatcattgttgtcaagaatctc 548
              ||||||||||||||||||||||
Sbjct: 131932 tatcattgttgtcaagaatctc 131911



to top

>gb|AC140035.9| Medicago truncatula clone mth2-25n18, complete sequence
          Length = 120870

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 527   tatcattgttgtcaagaatctc 548
             ||||||||||||||||||||||
Sbjct: 29264 tatcattgttgtcaagaatctc 29243



to top

>gb|AC151796.1| Ornithorhynchus anatinus chromosome UNK clone OABb-11A1, complete
             sequence
          Length = 130877

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 293   tgacaatggtggcttcaaaatttct 317
             |||||||| ||||||||||||||||
Sbjct: 17434 tgacaatgttggcttcaaaatttct 17458



to top

>gb|AC124976.9| Mus musculus chromosome 3, clone RP24-84E6, complete sequence
          Length = 218027

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 317    tgatgatgatgtcagatacat 337
              |||||||||||||||||||||
Sbjct: 153820 tgatgatgatgtcagatacat 153840



to top

>gb|AC093481.8| Mus musculus chromosome 18, clone RP23-62E19, complete sequence
          Length = 242587

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 250    tcaaggtgaatgagactgtta 270
              |||||||||||||||||||||
Sbjct: 195434 tcaaggtgaatgagactgtta 195454



to top

>gb|CP000117.1| Anabaena variabilis ATCC 29413 chromosome, complete sequence
          Length = 6365727

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 440     tgtggctttctgggatgaggt 460
               |||||||||||||||||||||
Sbjct: 5392949 tgtggctttctgggatgaggt 5392929



to top

>gb|AC161438.6| Mus musculus chromosome 18, clone RP23-62E1, complete sequence
          Length = 198865

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 250    tcaaggtgaatgagactgtta 270
              |||||||||||||||||||||
Sbjct: 169451 tcaaggtgaatgagactgtta 169431



to top

>gb|AC008914.7| Homo sapiens chromosome 5 clone CTD-2270I16, complete sequence
          Length = 139677

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   agtttctgaaagagaagagag 247
             |||||||||||||||||||||
Sbjct: 76815 agtttctgaaagagaagagag 76795



to top

>gb|AC093870.3| Homo sapiens BAC clone RP11-598G2 from 4, complete sequence
          Length = 193650

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 402   attggaatggtcaattcttct 422
             |||||||||||||||||||||
Sbjct: 68203 attggaatggtcaattcttct 68223



to top

>ref|XM_228060.3| PREDICTED: Rattus norvegicus ubiquitin associated and SH3 domain
           containing, A (predicted) (Ubash3a_predicted), mRNA
          Length = 3485

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 234 gaaagagaagagagcttcaag 254
           |||||||||||||||||||||
Sbjct: 198 gaaagagaagagagcttcaag 178



to top

>emb|CR749763.6| Zebrafish DNA sequence from clone CH211-285D14 in linkage group 4,
             complete sequence
          Length = 66589

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 246   agcttcaaggtgaatgagact 266
             |||||||||||||||||||||
Sbjct: 33299 agcttcaaggtgaatgagact 33319



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 246   agcttcaaggtgaatgagact 266
             |||||||||||||||||||||
Sbjct: 30564 agcttcaaggtgaatgagact 30584



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 246   agcttcaaggtgaatgagact 266
             |||||||||||||||||||||
Sbjct: 24077 agcttcaaggtgaatgagact 24057



to top

>gb|AC140790.3| Gallus gallus BAC clone TAM32-50D18 from chromosome ul, complete sequence
          Length = 176981

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 275    gcactgtggtttctacagtga 295
              |||||||||||||||||||||
Sbjct: 124732 gcactgtggtttctacagtga 124752



to top

>gb|AC102908.11| Mus musculus chromosome 16, clone RP24-288K2, complete sequence
          Length = 174803

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 240   gaagagagcttcaaggtgaa 259
             ||||||||||||||||||||
Sbjct: 63425 gaagagagcttcaaggtgaa 63444



to top

>ref|XM_516176.1| PREDICTED: Pan troglodytes similar to IQ motif containing with AAA
            domain (LOC460042), mRNA
          Length = 3783

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 239  agaagagagcttcaaggtgaatga 262
            |||||||||||||||||| |||||
Sbjct: 3513 agaagagagcttcaaggtaaatga 3536



to top

>gb|AC104283.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1607_F09,
             complete sequence
          Length = 95755

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 279   tgtggtttctacagtgacaa 298
             ||||||||||||||||||||
Sbjct: 87953 tgtggtttctacagtgacaa 87972



to top

>gb|AC124142.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
            OSJNBb0015A05, complete sequence
          Length = 127330

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 279  tgtggtttctacagtgacaa 298
            ||||||||||||||||||||
Sbjct: 5817 tgtggtttctacagtgacaa 5836



to top

>gb|AC153865.3| Mus musculus  BAC RP23-373P9 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 180703

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 296    caatggtggcttcaaaattt 315
              ||||||||||||||||||||
Sbjct: 107042 caatggtggcttcaaaattt 107023



to top

>gb|AC110249.10| Mus musculus chromosome 14, clone RP23-257O8, complete sequence
          Length = 204244

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 316    ctgatgatgatgtcagatac 335
              ||||||||||||||||||||
Sbjct: 138245 ctgatgatgatgtcagatac 138264



to top

>gb|AC131749.2| Mus musculus BAC clone RP23-26G8 from 9, complete sequence
          Length = 234280

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   gatgacgacgactatgactc 145
             ||||||||||||||||||||
Sbjct: 97205 gatgacgacgactatgactc 97224



to top

>emb|CR956422.6| Pig DNA sequence from clone PigE-93N11 on chromosome 6, complete
             sequence
          Length = 184430

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 177   ctgcagcatgcagaagctaccagg 200
             |||||||||||||||||| |||||
Sbjct: 34220 ctgcagcatgcagaagctcccagg 34197



to top

>emb|AL391665.28| Human DNA sequence from clone RP11-519K18 on chromosome 10 Contains the
              3' end of the RAI17 gene for retinoic acid induced 17, the
              5' end of the PPIF gene for peptidylprolyl isomerase F
              (cyclophilin F) and two CpG islands, complete sequence
          Length = 159866

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 236    aagagaagagagcttcaagg 255
              ||||||||||||||||||||
Sbjct: 126388 aagagaagagagcttcaagg 126369



to top

>emb|AL365335.11| Human DNA sequence from clone RP11-278E14 on chromosome 6, complete
             sequence
          Length = 160889

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 478   aagctgaaggaaaattaact 497
             ||||||||||||||||||||
Sbjct: 99075 aagctgaaggaaaattaact 99094



to top

>emb|AL161436.12| Human DNA sequence from clone RP11-377N20 on chromosome 6 Contains part
             of a novel gene, complete sequence
          Length = 124814

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 229   tttctgaaagagaagagagc 248
             ||||||||||||||||||||
Sbjct: 40660 tttctgaaagagaagagagc 40679



to top

>emb|AL009047.1|HS1156N12 Human DNA sequence from clone RP5-1156N12 on chromosome X, complete
             sequence
          Length = 146360

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 303   ggcttcaaaatttctgatga 322
             ||||||||||||||||||||
Sbjct: 42523 ggcttcaaaatttctgatga 42542



to top

>emb|BX571865.1| Photorhabdus luminescens subsp. laumondii TTO1 complete genome; segment
             7/17
          Length = 348813

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 232   ctgaaagagaagagagcttc 251
             ||||||||||||||||||||
Sbjct: 18604 ctgaaagagaagagagcttc 18585



to top

>gb|AC140078.8| Homo sapiens 12 BAC RP13-7D7 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 174598

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 483   gaaggaaaattaactggcga 502
             ||||||||||||||||||||
Sbjct: 73805 gaaggaaaattaactggcga 73824



to top

>emb|AL161472.2|ATCHRIV2 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 2
          Length = 197975

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 236   aagagaagagagcttcaagg 255
             ||||||||||||||||||||
Sbjct: 74523 aagagaagagagcttcaagg 74542



to top

>emb|CR751236.6| Zebrafish DNA sequence from clone DKEY-27M6 in linkage group 23,
             complete sequence
          Length = 108342

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 478   aagctgaaggaaaattaact 497
             ||||||||||||||||||||
Sbjct: 50737 aagctgaaggaaaattaact 50718



to top

>emb|BX901907.7| Zebrafish DNA sequence from clone DKEY-22H13 in linkage group 14,
             complete sequence
          Length = 71551

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 54    agtatagaaaatttggcatt 73
             ||||||||||||||||||||
Sbjct: 56015 agtatagaaaatttggcatt 56034



to top

>gb|AC117383.4| Homo sapiens 3 BAC RP11-789L4 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 194991

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 52    aaagtatagaaaatttggca 71
             ||||||||||||||||||||
Sbjct: 80652 aaagtatagaaaatttggca 80671



to top

>ref|NM_136073.2| Drosophila melanogaster CG18397-RA (CG18397), mRNA
          Length = 6134

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 400  ctattggaatggtcaattcttcta 423
            ||||||||||||||| ||||||||
Sbjct: 1524 ctattggaatggtcacttcttcta 1501



to top

>gb|AC025038.6| Homo sapiens chromosome 10 clone RP11-443O13, complete sequence
          Length = 163132

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 311    aatttctgatgatgatgtca 330
              ||||||||||||||||||||
Sbjct: 102730 aatttctgatgatgatgtca 102749



to top

>gb|AC154180.2| Mus musculus BAC clone RP24-469E6 from chromosome 14, complete sequence
          Length = 187810

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 316    ctgatgatgatgtcagatac 335
              ||||||||||||||||||||
Sbjct: 104392 ctgatgatgatgtcagatac 104373



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
               sequence
          Length = 35498469

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 279     tgtggtttctacagtgacaa 298
               ||||||||||||||||||||
Sbjct: 7257998 tgtggtttctacagtgacaa 7258017



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 279     tgtggtttctacagtgacaa 298
               ||||||||||||||||||||
Sbjct: 2520931 tgtggtttctacagtgacaa 2520950



to top

>gb|AC009204.5|AC009204 Drosophila melanogaster, chromosome 2L, region 36E-37C, BAC clone
              BACR03E19, complete sequence
          Length = 167777

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 400    ctattggaatggtcaattcttcta 423
              ||||||||||||||| ||||||||
Sbjct: 116604 ctattggaatggtcacttcttcta 116627



to top

>gb|AC011756.5|AC011756 Drosophila melanogaster, chromosome 2L, region 36E-37C, BAC clone
             BACR17A06, complete sequence
          Length = 170546

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 400   ctattggaatggtcaattcttcta 423
             ||||||||||||||| ||||||||
Sbjct: 67190 ctattggaatggtcacttcttcta 67213



to top

>dbj|AP008246.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
              clone:B1642C07
          Length = 206004

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 279    tgtggtttctacagtgacaa 298
              ||||||||||||||||||||
Sbjct: 175705 tgtggtttctacagtgacaa 175686



to top

>gb|AC022215.4|AC022215 Homo sapiens BAC clone RP11-764I5 from 3, complete sequence
          Length = 180068

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 52    aaagtatagaaaatttggca 71
             ||||||||||||||||||||
Sbjct: 48063 aaagtatagaaaatttggca 48044



to top

>ref|XM_234281.3| PREDICTED: Rattus norvegicus AT rich interactive domain 4A (Rbp1
            like) (predicted) (Arid4a_predicted), mRNA
          Length = 4822

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 124  ctgatgacgacgactatgac 143
            ||||||||||||||||||||
Sbjct: 1508 ctgatgacgacgactatgac 1527



to top

>emb|BX005383.8| Zebrafish DNA sequence from clone DKEYP-19E1 in linkage group 25,
              complete sequence
          Length = 142728

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 478    aagctgaaggaaaattaact 497
              ||||||||||||||||||||
Sbjct: 118937 aagctgaaggaaaattaact 118956



to top

>emb|AL928790.4| Zebrafish DNA sequence from clone CH211-146N9, complete sequence
          Length = 171673

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 478   aagctgaaggaaaattaact 497
             ||||||||||||||||||||
Sbjct: 90779 aagctgaaggaaaattaact 90760



to top

>gb|BT021951.1| Drosophila melanogaster LD01527 full insert cDNA
          Length = 6147

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 400  ctattggaatggtcaattcttcta 423
            ||||||||||||||| ||||||||
Sbjct: 1520 ctattggaatggtcacttcttcta 1497



to top

>gb|AF058919.2|F6N23 Arabidopsis thaliana BAC F6N23
          Length = 91849

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 236   aagagaagagagcttcaagg 255
             ||||||||||||||||||||
Sbjct: 55649 aagagaagagagcttcaagg 55668



to top

>emb|BX255897.3| Zebrafish DNA sequence from clone DKEY-263B2 in linkage group 20,
              complete sequence
          Length = 181862

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 478    aagctgaaggaaaattaact 497
              ||||||||||||||||||||
Sbjct: 142670 aagctgaaggaaaattaact 142689



to top

>emb|CT573073.1| Kuenenia stuttgartiensis genome fragment KUST_C (3 of 5)
          Length = 893329

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 171    tatttactgcagcatgcaga 190
              ||||||||||||||||||||
Sbjct: 633827 tatttactgcagcatgcaga 633846



to top

>gb|AE003661.3| Drosophila melanogaster chromosome 2L, section 70 of 83 of the complete
             sequence
          Length = 265558

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 400   ctattggaatggtcaattcttcta 423
             ||||||||||||||| ||||||||
Sbjct: 32328 ctattggaatggtcacttcttcta 32351



to top

>gb|AE000666.1| Methanothermobacter thermautotrophicus str. Delta H, complete genome
          Length = 1751377

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 169    cctatttactgcagcatgca 188
              ||||||||||||||||||||
Sbjct: 681510 cctatttactgcagcatgca 681529



to top

>emb|AL590387.7| Human DNA sequence from clone RP3-356B20 on chromosome 6, complete
             sequence
          Length = 76075

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 294   gacaatggtggcttcaaaat 313
             ||||||||||||||||||||
Sbjct: 17716 gacaatggtggcttcaaaat 17735



to top

>emb|AL606994.3|OSJN00114 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0035O13,
              complete sequence
          Length = 143298

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 279    tgtggtttctacagtgacaa 298
              ||||||||||||||||||||
Sbjct: 121735 tgtggtttctacagtgacaa 121754



to top

>gb|AC087840.16| Mus musculus strain C57BL/6J chromosome 16 clone rp23-240k10, complete
             sequence
          Length = 190761

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 240   gaagagagcttcaaggtgaa 259
             ||||||||||||||||||||
Sbjct: 14997 gaagagagcttcaaggtgaa 15016



to top

>gb|U60597.1|OAU60597 Ovis aries myeloid antimicrobial peptide precursor (Map-34) gene,
           complete cds
          Length = 1963

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 245 gagcttcaaggtgaatgagactgt 268
           ||||||||||||||| ||||||||
Sbjct: 887 gagcttcaaggtgaaggagactgt 910


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,887,218
Number of Sequences: 3902068
Number of extensions: 5887218
Number of successful extensions: 124598
Number of sequences better than 10.0: 59
Number of HSP's better than 10.0 without gapping: 59
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 124313
Number of HSP's gapped (non-prelim): 282
length of query: 558
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 535
effective length of database: 17,143,297,704
effective search space: 9171664271640
effective search space used: 9171664271640
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top