ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags14i17
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY055729.1| Physcomitrella patens cold acclimation protein WC... 50 0.008
2emb|CR954246.1| Pseudoalteromonas haloplanktis str. TAC125 chrom... 44 0.50
3gb|AY894635.1| Macaca mulatta clone MMU10 NBPF gene, partial cds 42 2.0
4gb|AY894634.1| Macaca mulatta clone MMU9 NBPF gene, partial cds 42 2.0
5gb|AY894633.1| Macaca mulatta clone MMU7 NBPF gene, partial cds 42 2.0
6gb|AY894632.1| Macaca mulatta clone MMU8 NBPF gene, partial cds 42 2.0
7gb|AY894631.1| Macaca mulatta clone MMU6 NBPF gene, partial cds 42 2.0
8gb|AY894629.1| Macaca mulatta clone MMU3 NBPF gene, partial cds 42 2.0
9gb|AY894628.1| Macaca mulatta clone MMU2 NBPF gene, partial cds 42 2.0
10gb|AY894627.1| Macaca mulatta clone MMU1 NBPF gene, partial cds 42 2.0
11gb|AY894626.1| Macaca mulatta clone MMU4 NBPF gene, partial cds 42 2.0
12gb|AY894624.1| Macaca fascicularis clone MFA10 NBPF gene, partia... 42 2.0
13gb|AY894621.1| Macaca fascicularis clone MFA8 NBPF gene, partial... 42 2.0
14gb|AY894619.1| Macaca fascicularis clone MFA4 NBPF gene, partial... 42 2.0
15ref|NM_128814.2| Arabidopsis thaliana unknown protein AT2G32550 ... 40 7.8
16gb|AY894615.1| Hylobates lar clone HYL8 NBPF gene, partial cds 40 7.8
17gb|AY894613.1| Hylobates lar clone HYL4 NBPF gene, partial cds 40 7.8
18gb|AY894612.1| Hylobates lar clone HYL7 NBPF gene, partial cds 40 7.8
19gb|AY894610.1| Hylobates lar clone HYL1 NBPF gene, partial cds 40 7.8
20gb|AY894609.1| Hylobates lar clone HYL5 NBPF gene, partial cds 40 7.8
21gb|AY894608.1| Hylobates lar clone HYL9 NBPF gene, partial cds 40 7.8
22gb|AY894605.1| Gorilla gorilla clone GGO10 NBPF gene, partial cds 40 7.8
23gb|AY894604.1| Gorilla gorilla clone GGO1 NBPF gene, partial cds 40 7.8
24gb|AY894603.1| Gorilla gorilla clone GGO2 NBPF gene, partial cds 40 7.8
25gb|AY894602.1| Gorilla gorilla clone GGO9 NBPF gene, partial cds 40 7.8
26gb|AY894601.1| Gorilla gorilla clone GGO6 NBPF gene, partial cds 40 7.8
27gb|AY894598.1| Gorilla gorilla clone GGO3 NBPF gene, partial cds 40 7.8
28gb|AY894597.1| Gorilla gorilla clone GGO4 NBPF gene, partial cds 40 7.8
29gb|AY894596.1| Gorilla gorilla clone GGO5 NBPF gene, partial cds 40 7.8
30gb|AY894595.1| Pan troglodytes clone PTR1 NBPF gene, partial cds 40 7.8
31gb|AY894594.1| Pan troglodytes clone PTR10 NBPF gene, partial cds 40 7.8
32gb|AY894593.1| Pan troglodytes clone PTR7 NBPF gene, partial cds 40 7.8
33gb|AY894592.1| Pan troglodytes clone PTR9 NBPF gene, partial cds 40 7.8
34gb|AY894591.1| Pan troglodytes clone PTR2 NBPF gene, partial cds 40 7.8
35gb|AY894590.1| Pan troglodytes clone PTR3 NBPF gene, partial cds 40 7.8
36gb|AY894588.1| Pan troglodytes clone PTR5 NBPF gene, partial cds 40 7.8
37gb|AY894587.1| Pan troglodytes clone PTR6 NBPF gene, partial cds 40 7.8
38gb|AY894586.1| Pan troglodytes clone PTR8 NBPF gene, partial cds 40 7.8
39gb|AY894583.1| Homo sapiens clone HSA8 NBPF gene, partial cds 40 7.8
40gb|AY894581.1| Homo sapiens clone HSA3 NBPF gene, partial cds 40 7.8
41gb|AY894580.1| Homo sapiens clone HSA2 NBPF gene, partial cds 40 7.8
42gb|AY894579.1| Homo sapiens clone HSA7 NBPF gene, partial cds 40 7.8
43gb|AY894578.1| Homo sapiens clone HSA6 NBPF gene, partial cds 40 7.8
44gb|AY894577.1| Homo sapiens clone HSA10 NBPF gene, partial cds 40 7.8
45gb|AY894576.1| Homo sapiens clone HSA1 NBPF gene, partial cds 40 7.8
46gb|AE016827.1| Mannheimia succiniciproducens MBEL55E, complete g... 40 7.8
47gb|AF068720.1| Caenorhabditis elegans cosmid K02H11, complete se... 40 7.8
48gb|AC129080.6| Mus musculus BAC clone RP24-226L20 from chromosom... 40 7.8
49emb|CR853295.9| Human DNA sequence from clone WI2-3658N16 on chr... 40 7.8
50ref|XM_746313.1| Aspergillus fumigatus Af293 hypothetical protei... 40 7.8
51gb|AY102546.1| Arabidopsis thaliana hypothetical protein (At2g32... 40 7.8
52emb|CR936846.7| Zebrafish DNA sequence from clone DKEY-20N3 in l... 40 7.8
53emb|BX546486.21| Human DNA sequence from clone RP11-89F3 on chro... 40 7.8
54emb|BX842679.19| Human DNA sequence from clone XXyac-155B6 on ch... 40 7.8
55emb|AL954711.3| Human DNA sequence from clone RP11-666A1 on chro... 40 7.8
56emb|AL592307.36| Human DNA sequence from clone RP11-458D21 on ch... 40 7.8
57emb|AL592492.10| Human DNA sequence from clone RP11-763B22 on ch... 40 7.8
58emb|AL592284.10| Human DNA sequence from clone RP11-640M9 on chr... 40 7.8
59emb|AL359752.11| Human DNA sequence from clone RP5-1042I8 on chr... 40 7.8
60emb|AL356004.9| Human DNA sequence from clone RP11-94I2 on chrom... 40 7.8
61emb|AL159159.21| Human DNA sequence from clone RP11-88J11 on chr... 40 7.8
62emb|AL137798.8| Human DNA sequence from clone RP5-1182A14 on chr... 40 7.8
63emb|AL138796.6| Human DNA sequence from clone RP4-791M13 on chro... 40 7.8
64emb|AL022240.8|HS328E19 Human DNA sequence from clone RP3-328E19... 40 7.8
65gb|AC073365.14| Homo sapiens 3 BAC RP11-479M14 (Roswell Park Can... 40 7.8
66emb|BX511041.14| Human DNA sequence from clone RP3-377D14 on chr... 40 7.8
67gb|AC182462.3| Pan troglodytes BAC clone CH251-572M16 from chrom... 40 7.8
68dbj|AK098004.1| Homo sapiens cDNA FLJ40685 fis, clone THYMU2023943 40 7.8
69gb|AC004681.3| Arabidopsis thaliana chromosome 2 clone T26B15 ma... 40 7.8
70gb|CP000235.1| Anaplasma phagocytophilum HZ, complete genome 40 7.8
71gb|AC009039.7| Homo sapiens chromosome 16 clone RP11-152O14, com... 40 7.8
72gb|AF356512.1|AF356512 Ehrlichia phagocytophila ankyrin (ank) ge... 40 7.8
73gb|AC009303.3| Homo sapiens BAC clone RP11-98C1 from 2, complete... 40 7.8
74gb|AF100894.1|AF100894 Ehrlichia sp. 'CGE agent' ankyrin (ank) g... 40 7.8
75gb|AF100893.1|AF100893 Ehrlichia sp. 'HGE agent' from USA ankyri... 40 7.8
76gb|AF100892.1|AF100892 Ehrlichia sp. 'HGE agent' from USA ankyri... 40 7.8
77gb|AF100891.1|AF100891 Ehrlichia sp. 'HGE agent' from USA ankyri... 40 7.8
78gb|AF100890.1|AF100890 Ehrlichia sp. 'HGE agent' from USA ankyri... 40 7.8
79gb|AF100885.1|AF100885 Ehrlichia sp. 'HGE agent' from USA ankyri... 40 7.8
80gb|AF100884.1|AF100884 Ehrlichia sp. 'HGE agent' from USA ankyri... 40 7.8
81gb|AF100883.1|AF100883 Ehrlichia sp. 'HGE agent' from USA ankyri... 40 7.8
82gb|AF100882.1|AF100882 Ehrlichia equi ankyrin (ank) gene, comple... 40 7.8
83gb|AC128674.3| Homo sapiens BAC clone RP11-1390M18 from UL, comp... 40 7.8
84gb|AF047897.2|AF047897 Ehrlichia phagocytophila ankyrin protein-... 40 7.8
85gb|AF153716.2|AF153716 Ehrlichia phagocytophila ankyrin protein-... 40 7.8
86gb|AC127384.4| Homo sapiens BAC clone RP11-1390A11 from UL, comp... 40 7.8
87gb|AC007489.3|AC007489 Homo sapiens chromosome 16 clone RP11-122... 40 7.8
88gb|AY954810.1| Arabidopsis thaliana hypothetical protein (At2g32... 40 7.8
89gb|AF020521.2| Ehrlichia sp. 'HGE agent' 160kDa protein (ank) ge... 40 7.8
90gb|AC123705.12| Mus musculus chromosome 12, clone RP23-355K21, c... 40 7.8
91emb|AL731828.22| Mouse DNA sequence from clone RP23-50L5 on chro... 40 7.8
92gb|AC092891.5| Homo sapiens 12 BAC RP11-495C19 (Roswell Park Can... 40 7.8

>gb|AY055729.1| Physcomitrella patens cold acclimation protein WCOR413-like protein
           mRNA, complete cds
          Length = 950

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 138 tgaggaggatgaaggcggcaggcag 162
           |||||||||||||||||||||||||
Sbjct: 484 tgaggaggatgaaggcggcaggcag 460



to top

>emb|CR954246.1| Pseudoalteromonas haloplanktis str. TAC125 chromosome I, complete
              sequence
          Length = 3214944

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 89     gggctagaacatgtagatgagg 110
              ||||||||||||||||||||||
Sbjct: 860347 gggctagaacatgtagatgagg 860368



to top

>gb|AY894635.1| Macaca mulatta clone MMU10 NBPF gene, partial cds
          Length = 1163

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 131 caggagctgaggaggatgaag 151
           |||||||||||||||||||||
Sbjct: 219 caggagctgaggaggatgaag 199



to top

>gb|AY894634.1| Macaca mulatta clone MMU9 NBPF gene, partial cds
          Length = 1163

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 131 caggagctgaggaggatgaag 151
           |||||||||||||||||||||
Sbjct: 219 caggagctgaggaggatgaag 199



to top

>gb|AY894633.1| Macaca mulatta clone MMU7 NBPF gene, partial cds
          Length = 1161

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 131 caggagctgaggaggatgaag 151
           |||||||||||||||||||||
Sbjct: 219 caggagctgaggaggatgaag 199



to top

>gb|AY894632.1| Macaca mulatta clone MMU8 NBPF gene, partial cds
          Length = 1161

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 131 caggagctgaggaggatgaag 151
           |||||||||||||||||||||
Sbjct: 219 caggagctgaggaggatgaag 199



to top

>gb|AY894631.1| Macaca mulatta clone MMU6 NBPF gene, partial cds
          Length = 1161

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 131 caggagctgaggaggatgaag 151
           |||||||||||||||||||||
Sbjct: 219 caggagctgaggaggatgaag 199



to top

>gb|AY894629.1| Macaca mulatta clone MMU3 NBPF gene, partial cds
          Length = 1163

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 131 caggagctgaggaggatgaag 151
           |||||||||||||||||||||
Sbjct: 219 caggagctgaggaggatgaag 199



to top

>gb|AY894628.1| Macaca mulatta clone MMU2 NBPF gene, partial cds
          Length = 1163

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 131 caggagctgaggaggatgaag 151
           |||||||||||||||||||||
Sbjct: 219 caggagctgaggaggatgaag 199



to top

>gb|AY894627.1| Macaca mulatta clone MMU1 NBPF gene, partial cds
          Length = 1164

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 131 caggagctgaggaggatgaag 151
           |||||||||||||||||||||
Sbjct: 219 caggagctgaggaggatgaag 199



to top

>gb|AY894626.1| Macaca mulatta clone MMU4 NBPF gene, partial cds
          Length = 1163

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 131 caggagctgaggaggatgaag 151
           |||||||||||||||||||||
Sbjct: 219 caggagctgaggaggatgaag 199



to top

>gb|AY894624.1| Macaca fascicularis clone MFA10 NBPF gene, partial cds
          Length = 1161

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 131 caggagctgaggaggatgaag 151
           |||||||||||||||||||||
Sbjct: 219 caggagctgaggaggatgaag 199



to top

>gb|AY894621.1| Macaca fascicularis clone MFA8 NBPF gene, partial cds
          Length = 1162

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 131 caggagctgaggaggatgaag 151
           |||||||||||||||||||||
Sbjct: 221 caggagctgaggaggatgaag 201



to top

>gb|AY894619.1| Macaca fascicularis clone MFA4 NBPF gene, partial cds
          Length = 1161

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 131 caggagctgaggaggatgaag 151
           |||||||||||||||||||||
Sbjct: 219 caggagctgaggaggatgaag 199



to top

>ref|NM_128814.2| Arabidopsis thaliana unknown protein AT2G32550 mRNA, complete cds
          Length = 1235

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 aggagctgaggaggatgaag 151
           ||||||||||||||||||||
Sbjct: 129 aggagctgaggaggatgaag 110



to top

>gb|AY894615.1| Hylobates lar clone HYL8 NBPF gene, partial cds
          Length = 1163

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 aggagctgaggaggatgaag 151
           ||||||||||||||||||||
Sbjct: 218 aggagctgaggaggatgaag 199



to top

>gb|AY894613.1| Hylobates lar clone HYL4 NBPF gene, partial cds
          Length = 1163

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 aggagctgaggaggatgaag 151
           ||||||||||||||||||||
Sbjct: 218 aggagctgaggaggatgaag 199



to top

>gb|AY894612.1| Hylobates lar clone HYL7 NBPF gene, partial cds
          Length = 1164

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 aggagctgaggaggatgaag 151
           ||||||||||||||||||||
Sbjct: 218 aggagctgaggaggatgaag 199



to top

>gb|AY894610.1| Hylobates lar clone HYL1 NBPF gene, partial cds
          Length = 1164

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 aggagctgaggaggatgaag 151
           ||||||||||||||||||||
Sbjct: 218 aggagctgaggaggatgaag 199



to top

>gb|AY894609.1| Hylobates lar clone HYL5 NBPF gene, partial cds
          Length = 1161

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 aggagctgaggaggatgaag 151
           ||||||||||||||||||||
Sbjct: 218 aggagctgaggaggatgaag 199



to top

>gb|AY894608.1| Hylobates lar clone HYL9 NBPF gene, partial cds
          Length = 1164

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 aggagctgaggaggatgaag 151
           ||||||||||||||||||||
Sbjct: 218 aggagctgaggaggatgaag 199



to top

>gb|AY894605.1| Gorilla gorilla clone GGO10 NBPF gene, partial cds
          Length = 1163

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 aggagctgaggaggatgaag 151
           ||||||||||||||||||||
Sbjct: 220 aggagctgaggaggatgaag 201



to top

>gb|AY894604.1| Gorilla gorilla clone GGO1 NBPF gene, partial cds
          Length = 1164

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 aggagctgaggaggatgaag 151
           ||||||||||||||||||||
Sbjct: 220 aggagctgaggaggatgaag 201



to top

>gb|AY894603.1| Gorilla gorilla clone GGO2 NBPF gene, partial cds
          Length = 1164

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 aggagctgaggaggatgaag 151
           ||||||||||||||||||||
Sbjct: 220 aggagctgaggaggatgaag 201



to top

>gb|AY894602.1| Gorilla gorilla clone GGO9 NBPF gene, partial cds
          Length = 1162

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 aggagctgaggaggatgaag 151
           ||||||||||||||||||||
Sbjct: 219 aggagctgaggaggatgaag 200



to top

>gb|AY894601.1| Gorilla gorilla clone GGO6 NBPF gene, partial cds
          Length = 1164

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 aggagctgaggaggatgaag 151
           ||||||||||||||||||||
Sbjct: 220 aggagctgaggaggatgaag 201



to top

>gb|AY894598.1| Gorilla gorilla clone GGO3 NBPF gene, partial cds
          Length = 1166

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 aggagctgaggaggatgaag 151
           ||||||||||||||||||||
Sbjct: 220 aggagctgaggaggatgaag 201



to top

>gb|AY894597.1| Gorilla gorilla clone GGO4 NBPF gene, partial cds
          Length = 1164

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 aggagctgaggaggatgaag 151
           ||||||||||||||||||||
Sbjct: 220 aggagctgaggaggatgaag 201



to top

>gb|AY894596.1| Gorilla gorilla clone GGO5 NBPF gene, partial cds
          Length = 1164

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 aggagctgaggaggatgaag 151
           ||||||||||||||||||||
Sbjct: 220 aggagctgaggaggatgaag 201



to top

>gb|AY894595.1| Pan troglodytes clone PTR1 NBPF gene, partial cds
          Length = 1165

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 aggagctgaggaggatgaag 151
           ||||||||||||||||||||
Sbjct: 220 aggagctgaggaggatgaag 201



to top

>gb|AY894594.1| Pan troglodytes clone PTR10 NBPF gene, partial cds
          Length = 1164

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 aggagctgaggaggatgaag 151
           ||||||||||||||||||||
Sbjct: 218 aggagctgaggaggatgaag 199



to top

>gb|AY894593.1| Pan troglodytes clone PTR7 NBPF gene, partial cds
          Length = 1165

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 aggagctgaggaggatgaag 151
           ||||||||||||||||||||
Sbjct: 220 aggagctgaggaggatgaag 201



to top

>gb|AY894592.1| Pan troglodytes clone PTR9 NBPF gene, partial cds
          Length = 1164

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 aggagctgaggaggatgaag 151
           ||||||||||||||||||||
Sbjct: 220 aggagctgaggaggatgaag 201



to top

>gb|AY894591.1| Pan troglodytes clone PTR2 NBPF gene, partial cds
          Length = 1165

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 aggagctgaggaggatgaag 151
           ||||||||||||||||||||
Sbjct: 220 aggagctgaggaggatgaag 201



to top

>gb|AY894590.1| Pan troglodytes clone PTR3 NBPF gene, partial cds
          Length = 1167

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 aggagctgaggaggatgaag 151
           ||||||||||||||||||||
Sbjct: 220 aggagctgaggaggatgaag 201



to top

>gb|AY894588.1| Pan troglodytes clone PTR5 NBPF gene, partial cds
          Length = 1165

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 aggagctgaggaggatgaag 151
           ||||||||||||||||||||
Sbjct: 220 aggagctgaggaggatgaag 201



to top

>gb|AY894587.1| Pan troglodytes clone PTR6 NBPF gene, partial cds
          Length = 1164

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 aggagctgaggaggatgaag 151
           ||||||||||||||||||||
Sbjct: 218 aggagctgaggaggatgaag 199



to top

>gb|AY894586.1| Pan troglodytes clone PTR8 NBPF gene, partial cds
          Length = 1164

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 aggagctgaggaggatgaag 151
           ||||||||||||||||||||
Sbjct: 219 aggagctgaggaggatgaag 200



to top

>gb|AY894583.1| Homo sapiens clone HSA8 NBPF gene, partial cds
          Length = 1166

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 aggagctgaggaggatgaag 151
           ||||||||||||||||||||
Sbjct: 220 aggagctgaggaggatgaag 201



to top

>gb|AY894581.1| Homo sapiens clone HSA3 NBPF gene, partial cds
          Length = 1166

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 aggagctgaggaggatgaag 151
           ||||||||||||||||||||
Sbjct: 220 aggagctgaggaggatgaag 201



to top

>gb|AY894580.1| Homo sapiens clone HSA2 NBPF gene, partial cds
          Length = 1165

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 aggagctgaggaggatgaag 151
           ||||||||||||||||||||
Sbjct: 219 aggagctgaggaggatgaag 200



to top

>gb|AY894579.1| Homo sapiens clone HSA7 NBPF gene, partial cds
          Length = 1166

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 aggagctgaggaggatgaag 151
           ||||||||||||||||||||
Sbjct: 220 aggagctgaggaggatgaag 201



to top

>gb|AY894578.1| Homo sapiens clone HSA6 NBPF gene, partial cds
          Length = 1166

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 aggagctgaggaggatgaag 151
           ||||||||||||||||||||
Sbjct: 220 aggagctgaggaggatgaag 201



to top

>gb|AY894577.1| Homo sapiens clone HSA10 NBPF gene, partial cds
          Length = 1166

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 aggagctgaggaggatgaag 151
           ||||||||||||||||||||
Sbjct: 220 aggagctgaggaggatgaag 201



to top

>gb|AY894576.1| Homo sapiens clone HSA1 NBPF gene, partial cds
          Length = 1164

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 aggagctgaggaggatgaag 151
           ||||||||||||||||||||
Sbjct: 220 aggagctgaggaggatgaag 201



to top

>gb|AE016827.1| Mannheimia succiniciproducens MBEL55E, complete genome
          Length = 2314078

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 483    ttgtttgccatgttcttgta 502
              ||||||||||||||||||||
Sbjct: 407970 ttgtttgccatgttcttgta 407989



to top

>gb|AF068720.1| Caenorhabditis elegans cosmid K02H11, complete sequence
          Length = 27223

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 144   ggatgaaggcggcaggcagg 163
             ||||||||||||||||||||
Sbjct: 21500 ggatgaaggcggcaggcagg 21481



to top

>gb|AC129080.6| Mus musculus BAC clone RP24-226L20 from chromosome 5, complete sequence
          Length = 156781

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 105    atgaggcaaggaggaaggca 124
              ||||||||||||||||||||
Sbjct: 126374 atgaggcaaggaggaaggca 126393



to top

>emb|CR853295.9| Human DNA sequence from clone WI2-3658N16 on chromosome 1, complete
             sequence
          Length = 38649

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 132   aggagctgaggaggatgaag 151
             ||||||||||||||||||||
Sbjct: 38154 aggagctgaggaggatgaag 38173



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 132   aggagctgaggaggatgaag 151
             ||||||||||||||||||||
Sbjct: 31863 aggagctgaggaggatgaag 31882



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 132   aggagctgaggaggatgaag 151
             ||||||||||||||||||||
Sbjct: 25602 aggagctgaggaggatgaag 25621



to top

>ref|XM_746313.1| Aspergillus fumigatus Af293 hypothetical protein (Afu4g14260)
           partial mRNA
          Length = 1500

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 407 tggttcatccacaaaaaggg 426
           ||||||||||||||||||||
Sbjct: 493 tggttcatccacaaaaaggg 512



to top

>gb|AY102546.1| Arabidopsis thaliana hypothetical protein (At2g32550/T26B15.11)
           mRNA, complete cds
          Length = 1266

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 aggagctgaggaggatgaag 151
           ||||||||||||||||||||
Sbjct: 129 aggagctgaggaggatgaag 110



to top

>emb|CR936846.7| Zebrafish DNA sequence from clone DKEY-20N3 in linkage group 1,
             complete sequence
          Length = 80060

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 470   gacattagaattgttgtttg 489
             ||||||||||||||||||||
Sbjct: 35656 gacattagaattgttgtttg 35637



to top

>emb|BX546486.21| Human DNA sequence from clone RP11-89F3 on chromosome 1 Contains a
             profilin 1 (Pfn1) pseudogene, two novel genes and two CpG
             islands, complete sequence
          Length = 129370

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 132   aggagctgaggaggatgaag 151
             ||||||||||||||||||||
Sbjct: 25389 aggagctgaggaggatgaag 25370



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 132   aggagctgaggaggatgaag 151
             ||||||||||||||||||||
Sbjct: 19123 aggagctgaggaggatgaag 19104



to top

>emb|BX842679.19| Human DNA sequence from clone XXyac-155B6 on chromosome 1 Contains a
             novel gene and a phosphodiesterase 4D interacting protein
             (myomegalin) (PDE4DIP) pseudogene, a profilin 1 (PFN1)
             pseudogene, the gene for a novel protein similar to
             chromosome 19 open reading frame 27 (C19orf27) and two
             novel genes, complete sequence
          Length = 163898

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 132   aggagctgaggaggatgaag 151
             ||||||||||||||||||||
Sbjct: 65299 aggagctgaggaggatgaag 65318



to top

>emb|AL954711.3| Human DNA sequence from clone RP11-666A1 on chromosome 1 Contains two
             novel pseudogenes, two novel genes, a profilin 1 (PFN1)
             pseudogene, a peptidylprolyl isomerase A (cyclophilin A)
             (PPIA) pseudogene and three CpG islands, complete sequence
          Length = 172789

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 132   aggagctgaggaggatgaag 151
             ||||||||||||||||||||
Sbjct: 70745 aggagctgaggaggatgaag 70726



to top

>emb|AL592307.36| Human DNA sequence from clone RP11-458D21 on chromosome 1 Contains the
              gene for a novel protein similar to Notch homolog 2
              (Drosophila) NOTCH2, a novel gene and a CpG island,
              complete sequence
          Length = 204307

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 132    aggagctgaggaggatgaag 151
              ||||||||||||||||||||
Sbjct: 114946 aggagctgaggaggatgaag 114927



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 132    aggagctgaggaggatgaag 151
              ||||||||||||||||||||
Sbjct: 108654 aggagctgaggaggatgaag 108635



to top

>emb|AL592492.10| Human DNA sequence from clone RP11-763B22 on chromosome 1 Contains a
             profilin (PFN1) pseudogene, three novel genes, two novel
             pseudogenes (FLJ39739), a cyclophilin-LC (COAS2)
             pseudogene, a pseudogene similar to part of kinase
             suppressor of ras (KSR), the 5' end of a myeloid/lymphoid
             or mixed-lineage leukemia 3 (MLL3) pseudogene and two CpG
             islands, complete sequence
          Length = 158089

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 132   aggagctgaggaggatgaag 151
             ||||||||||||||||||||
Sbjct: 10043 aggagctgaggaggatgaag 10024



to top

>emb|AL592284.10| Human DNA sequence from clone RP11-640M9 on chromosome 1 Contains a novel
              gene, the 5' end of a novel gene a profilin 1 (PFN1)
              pseudogene and a CpG island, complete sequence
          Length = 170669

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 132    aggagctgaggaggatgaag 151
              ||||||||||||||||||||
Sbjct: 167909 aggagctgaggaggatgaag 167890



to top

>emb|AL359752.11| Human DNA sequence from clone RP5-1042I8 on chromosome 1p11-13.2
             Contains the REG4 gene for regenerating islet-derived
             family member 4, a novel pseudogene, a profilin 1 (PFN1)
             pseudogene, the ADAM30 gene for a disintegrin and
             metalloproteinase domain 30 and the 3' end of the NOTCH2
             gene for Notch homolog 2 (Drosophila), complete sequence
          Length = 137955

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 132   aggagctgaggaggatgaag 151
             ||||||||||||||||||||
Sbjct: 49154 aggagctgaggaggatgaag 49173



to top

>emb|AL356004.9| Human DNA sequence from clone RP11-94I2 on chromosome 1 Contains the 3'
              end of the gene for a novel protein similar to putative
              G-protein coupled receptor SH120, the gene for a novel
              protein similar to PDZ domain containing 1 PDZK1, a novel
              gene, a phosphodiesterase 4D interacting protein
              (myomegalin) (PDE4DIP) pseudogene and three CpG islands,
              complete sequence
          Length = 166098

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 132    aggagctgaggaggatgaag 151
              ||||||||||||||||||||
Sbjct: 163607 aggagctgaggaggatgaag 163626



to top

>emb|AL159159.21| Human DNA sequence from clone RP11-88J11 on chromosome 13 Contains the
             3' end of the CDK8 gene for cyclin-dependent kinase 8,
             complete sequence
          Length = 144626

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 556   tgtgagttgagatctgttcc 575
             ||||||||||||||||||||
Sbjct: 17727 tgtgagttgagatctgttcc 17746



to top

>emb|AL137798.8| Human DNA sequence from clone RP5-1182A14 on chromosome 1 Contains the 5'
              end of a novel gene, a novel gene, a macrophage stimulating
              1 (hepatocyte growth factor-like)(MST1) pseudogene and
              three CpG islands, complete sequence
          Length = 146141

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 132    aggagctgaggaggatgaag 151
              ||||||||||||||||||||
Sbjct: 137340 aggagctgaggaggatgaag 137321



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 132    aggagctgaggaggatgaag 151
              ||||||||||||||||||||
Sbjct: 131076 aggagctgaggaggatgaag 131057



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 132    aggagctgaggaggatgaag 151
              ||||||||||||||||||||
Sbjct: 124771 aggagctgaggaggatgaag 124752



to top

>emb|AL138796.6| Human DNA sequence from clone RP4-791M13 on chromosome 1 Contains the
            3' end of a novel gene and the 3' end of the PDE4DIP gene
            for phosphodiesterase 4D interacting protein
            (myomegalin), complete sequence
          Length = 120928

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 132  aggagctgaggaggatgaag 151
            ||||||||||||||||||||
Sbjct: 5519 aggagctgaggaggatgaag 5500



to top

>emb|AL022240.8|HS328E19 Human DNA sequence from clone RP3-328E19 on chromosome 1q12-21.2
             Contains the 5' end of a novel gene, a peptidylprolyl
             isomerase A (cyclophilin A) (PPIA) pseudogene, a novel
             pseudogene, the 3' end of a novel gene and a CpG island,
             complete sequence
          Length = 97619

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 132   aggagctgaggaggatgaag 151
             ||||||||||||||||||||
Sbjct: 94943 aggagctgaggaggatgaag 94962



to top

>gb|AC073365.14| Homo sapiens 3 BAC RP11-479M14 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 179598

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 477   gaattgttgtttgccatgtt 496
             ||||||||||||||||||||
Sbjct: 55025 gaattgttgtttgccatgtt 55044



to top

>emb|BX511041.14| Human DNA sequence from clone RP3-377D14 on chromosome 1, complete
            sequence
          Length = 78698

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 132  aggagctgaggaggatgaag 151
            ||||||||||||||||||||
Sbjct: 5506 aggagctgaggaggatgaag 5487



to top

>gb|AC182462.3| Pan troglodytes BAC clone CH251-572M16 from chromosome 1, complete
              sequence
          Length = 158275

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 132    aggagctgaggaggatgaag 151
              ||||||||||||||||||||
Sbjct: 120811 aggagctgaggaggatgaag 120830



to top

>dbj|AK098004.1| Homo sapiens cDNA FLJ40685 fis, clone THYMU2023943
          Length = 1881

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 aggagctgaggaggatgaag 151
           ||||||||||||||||||||
Sbjct: 422 aggagctgaggaggatgaag 403



to top

>gb|AC004681.3| Arabidopsis thaliana chromosome 2 clone T26B15 map TEn5, complete
             sequence
          Length = 78732

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 132   aggagctgaggaggatgaag 151
             ||||||||||||||||||||
Sbjct: 39868 aggagctgaggaggatgaag 39849



to top

>gb|CP000235.1| Anaplasma phagocytophilum HZ, complete genome
          Length = 1471282

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 125    atactgcaggagctgaggag 144
              ||||||||||||||||||||
Sbjct: 785707 atactgcaggagctgaggag 785688



to top

>gb|AC009039.7| Homo sapiens chromosome 16 clone RP11-152O14, complete sequence
          Length = 163228

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 6      gagtgtctggaggaaacctc 25
              ||||||||||||||||||||
Sbjct: 141468 gagtgtctggaggaaacctc 141487



to top

>gb|AF356512.1|AF356512 Ehrlichia phagocytophila ankyrin (ank) gene, partial cds
          Length = 3300

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 125  atactgcaggagctgaggag 144
            ||||||||||||||||||||
Sbjct: 2260 atactgcaggagctgaggag 2279



to top

>gb|AC009303.3| Homo sapiens BAC clone RP11-98C1 from 2, complete sequence
          Length = 198652

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 343    ttgccctgttcctgtagagccttg 366
              ||||||| ||||||||||||||||
Sbjct: 169427 ttgccctattcctgtagagccttg 169450



to top

>gb|AF100894.1|AF100894 Ehrlichia sp. 'CGE agent' ankyrin (ank) gene, complete cds
          Length = 3740

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 125  atactgcaggagctgaggag 144
            ||||||||||||||||||||
Sbjct: 2817 atactgcaggagctgaggag 2836



to top

>gb|AF100893.1|AF100893 Ehrlichia sp. 'HGE agent' from USA ankyrin (ank) gene, complete cds
          Length = 3740

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 125  atactgcaggagctgaggag 144
            ||||||||||||||||||||
Sbjct: 2817 atactgcaggagctgaggag 2836



to top

>gb|AF100892.1|AF100892 Ehrlichia sp. 'HGE agent' from USA ankyrin (ank) gene, complete cds
          Length = 3740

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 125  atactgcaggagctgaggag 144
            ||||||||||||||||||||
Sbjct: 2817 atactgcaggagctgaggag 2836



to top

>gb|AF100891.1|AF100891 Ehrlichia sp. 'HGE agent' from USA ankyrin (ank) gene, complete cds
          Length = 3740

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 125  atactgcaggagctgaggag 144
            ||||||||||||||||||||
Sbjct: 2817 atactgcaggagctgaggag 2836



to top

>gb|AF100890.1|AF100890 Ehrlichia sp. 'HGE agent' from USA ankyrin (ank) gene, complete cds
          Length = 3740

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 125  atactgcaggagctgaggag 144
            ||||||||||||||||||||
Sbjct: 2817 atactgcaggagctgaggag 2836



to top

>gb|AF100885.1|AF100885 Ehrlichia sp. 'HGE agent' from USA ankyrin (ank) gene, complete cds
          Length = 3743

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 125  atactgcaggagctgaggag 144
            ||||||||||||||||||||
Sbjct: 2820 atactgcaggagctgaggag 2839



to top

>gb|AF100884.1|AF100884 Ehrlichia sp. 'HGE agent' from USA ankyrin (ank) gene, complete cds
          Length = 3743

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 125  atactgcaggagctgaggag 144
            ||||||||||||||||||||
Sbjct: 2820 atactgcaggagctgaggag 2839



to top

>gb|AF100883.1|AF100883 Ehrlichia sp. 'HGE agent' from USA ankyrin (ank) gene, complete cds
          Length = 3743

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 125  atactgcaggagctgaggag 144
            ||||||||||||||||||||
Sbjct: 2820 atactgcaggagctgaggag 2839



to top

>gb|AF100882.1|AF100882 Ehrlichia equi ankyrin (ank) gene, complete cds
          Length = 3662

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 125  atactgcaggagctgaggag 144
            ||||||||||||||||||||
Sbjct: 2817 atactgcaggagctgaggag 2836



to top

>gb|AC128674.3| Homo sapiens BAC clone RP11-1390M18 from UL, complete sequence
          Length = 202721

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 132   aggagctgaggaggatgaag 151
             ||||||||||||||||||||
Sbjct: 82452 aggagctgaggaggatgaag 82433



to top

>gb|AF047897.2|AF047897 Ehrlichia phagocytophila ankyrin protein-A (ank) gene, ankA allele,
            complete cds
          Length = 3733

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 125  atactgcaggagctgaggag 144
            ||||||||||||||||||||
Sbjct: 2826 atactgcaggagctgaggag 2845



to top

>gb|AF153716.2|AF153716 Ehrlichia phagocytophila ankyrin protein-A (ank) gene, ankA allele,
            complete cds
          Length = 3703

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 125  atactgcaggagctgaggag 144
            ||||||||||||||||||||
Sbjct: 2874 atactgcaggagctgaggag 2893



to top

>gb|AC127384.4| Homo sapiens BAC clone RP11-1390A11 from UL, complete sequence
          Length = 202837

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 132    aggagctgaggaggatgaag 151
              ||||||||||||||||||||
Sbjct: 161714 aggagctgaggaggatgaag 161733



to top

>gb|AC007489.3|AC007489 Homo sapiens chromosome 16 clone RP11-122K22, complete sequence
          Length = 180401

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 6      gagtgtctggaggaaacctc 25
              ||||||||||||||||||||
Sbjct: 131434 gagtgtctggaggaaacctc 131415



to top

>gb|AY954810.1| Arabidopsis thaliana hypothetical protein (At2g32550) mRNA,
           complete cds
          Length = 969

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 aggagctgaggaggatgaag 151
           ||||||||||||||||||||
Sbjct: 102 aggagctgaggaggatgaag 83



to top

>gb|AF020521.2| Ehrlichia sp. 'HGE agent' 160kDa protein (ank) gene, complete cds
          Length = 4691

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 125  atactgcaggagctgaggag 144
            ||||||||||||||||||||
Sbjct: 2882 atactgcaggagctgaggag 2901



to top

>gb|AC123705.12| Mus musculus chromosome 12, clone RP23-355K21, complete sequence
          Length = 217397

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 149   aaggcggcaggcaggtgaag 168
             ||||||||||||||||||||
Sbjct: 76478 aaggcggcaggcaggtgaag 76459



to top

>emb|AL731828.22| Mouse DNA sequence from clone RP23-50L5 on chromosome X, complete
              sequence
          Length = 228327

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 301    ctcatctgtttcaagttcat 320
              ||||||||||||||||||||
Sbjct: 124964 ctcatctgtttcaagttcat 124983



to top

>gb|AC092891.5| Homo sapiens 12 BAC RP11-495C19 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 109440

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 410  ttcatccacaaaaagggtta 429
            ||||||||||||||||||||
Sbjct: 2933 ttcatccacaaaaagggtta 2952


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,760,990
Number of Sequences: 3902068
Number of extensions: 4760990
Number of successful extensions: 102602
Number of sequences better than 10.0: 92
Number of HSP's better than 10.0 without gapping: 92
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 102442
Number of HSP's gapped (non-prelim): 160
length of query: 576
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 553
effective length of database: 17,143,297,704
effective search space: 9480243630312
effective search space used: 9480243630312
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top