ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal9k09
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|AL596329.5| Human DNA sequence from clone RP11-179D6 on chro... 44 0.35
2emb|AL390023.8| Human DNA sequence from clone RP5-926E3 on chrom... 44 0.35
3emb|AL157360.8| Human DNA sequence from clone RP11-111C7 on chro... 42 1.4
4gb|AC106798.3| Homo sapiens chromosome 5 clone RP11-434D9, compl... 42 1.4
5gb|AC000100.2| Homo sapiens Chromosome 19 BAC Clone 959a10, comp... 42 1.4
6gb|AC073893.4|AC073893 Homo sapiens BAC clone RP11-978G18 from Y... 42 1.4
7gb|AC010682.3| Homo sapiens BAC clone RP11-251M8 from Y, complet... 42 1.4
8ref|NG_004755.1| Homo sapiens chromosome Y palindromes P1, P2, P... 42 1.4
9emb|AL845323.18| Mouse DNA sequence from clone RP23-304D11 on ch... 42 1.4
10gb|AC005076.2|AC005076 Homo sapiens BAC clone CTA-227L24 from 7q... 42 1.4
11gb|AC141887.5| Mus musculus BAC clone RP23-478L20 from chromosom... 40 5.5
12gb|AY644470.1| Homo sapiens interferon gamma receptor 2 (interfe... 40 5.5
13gb|AY915216.1| Schistosoma japonicum SJCHGC03622 protein mRNA, p... 40 5.5
14emb|AL606527.6| Human DNA sequence from clone RP11-454G24 on chr... 40 5.5
15emb|AL391841.17| Human DNA sequence from clone RP11-123G14 on ch... 40 5.5
16emb|AL389915.19| Human DNA sequence from clone RP11-438P9 on chr... 40 5.5
17emb|AL390732.10| Human DNA sequence from clone RP11-439N12 on ch... 40 5.5
18emb|AL356100.8| Human DNA sequence from clone RP11-359H22 on chr... 40 5.5
19gb|AC092053.3| Homo sapiens chromosome 3 clone RP11-331G2, compl... 40 5.5
20gb|AC104850.2| Homo sapiens chromosome 3 clone RP11-241K18, comp... 40 5.5
21gb|AC125610.4| Homo sapiens 3 BAC RP11-189B7 (Roswell Park Cance... 40 5.5
22gb|AC093431.2| Homo sapiens chromosome 1 clone RP11-574N2, compl... 40 5.5
23gb|AC114288.2| Homo sapiens chromosome 5 clone CTD-2373J16, comp... 40 5.5
24gb|AC008948.8| Homo sapiens chromosome 5 clone CTD-2333K2, compl... 40 5.5
25dbj|AK010208.1| Mus musculus adult male tongue cDNA, RIKEN full-... 40 5.5
26gb|AC078916.19| Homo sapiens 12 BAC RP11-463C23 (Roswell Park Ca... 40 5.5
27dbj|AP000045.1| Homo sapiens genomic DNA, chromosome 21q22.1, se... 40 5.5
28gb|AC092632.2| Homo sapiens BAC clone RP11-337B18 from 2, comple... 40 5.5
29emb|AL954218.1| Pan troglodytes chromosome 22 clone PTB-451A22 m... 40 5.5
30emb|AL954217.1| Pan troglodytes chromosome 22 clone PTB-073G05 m... 40 5.5
31dbj|BS000154.1| Pan troglodytes chromosome 22 clone:RP43-091K15,... 40 5.5
32dbj|AK129657.1| Homo sapiens cDNA FLJ26146 fis, clone ADG00290 40 5.5
33dbj|AP001717.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 5.5
34gb|AC106797.2| Homo sapiens chromosome 5 clone RP11-433I2, compl... 40 5.5
35emb|BX537378.1|HSM805673 Homo sapiens mRNA; cDNA DKFZp686C2482 (... 40 5.5
36gb|AC161256.3| Mus musculus BAC clone RP24-70H20 from chromosome... 40 5.5
37emb|AL603843.15| Mouse DNA sequence from clone RP23-412D17 on ch... 40 5.5
38emb|AL772258.9| Mouse DNA sequence from clone RP23-337P24 on chr... 40 5.5
39emb|AL928658.6| Mouse DNA sequence from clone RP23-238A18 on chr... 40 5.5
40dbj|AP000189.1| Homo sapiens genomic DNA, chromosome 21q22.1, D2... 40 5.5
41dbj|AP000300.1| Homo sapiens genomic DNA, chromosome 21q22.1, D2... 40 5.5
42dbj|AP000113.1| Homo sapiens genomic DNA of 21q22.1, GART and AM... 40 5.5 
>emb|AL596329.5| Human DNA sequence from clone RP11-179D6 on chromosome 13, complete
             sequence
          Length = 85563

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 189   catgtgtatgtttattacagca 210
             ||||||||||||||||||||||
Sbjct: 33616 catgtgtatgtttattacagca 33595
to top
>emb|AL390023.8| Human DNA sequence from clone RP5-926E3 on chromosome 1p32.3-34.1
             Contains part of the gene for a novel protein and a
             pseudogene similar to part of ribosomal protein S11
             (RPS11), complete sequence
          Length = 131237

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 189   catgtgtatgtttattacagca 210
             ||||||||||||||||||||||
Sbjct: 27695 catgtgtatgtttattacagca 27674
to top
>emb|AL157360.8| Human DNA sequence from clone RP11-111C7 on chromosome 13, complete
              sequence
          Length = 148861

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 190    atgtgtatgtttattacagca 210
              |||||||||||||||||||||
Sbjct: 112332 atgtgtatgtttattacagca 112312
to top
>gb|AC106798.3| Homo sapiens chromosome 5 clone RP11-434D9, complete sequence
          Length = 172966

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 189   catgtgtatgtttattacagc 209
             |||||||||||||||||||||
Sbjct: 87049 catgtgtatgtttattacagc 87029
to top
>gb|AC000100.2| Homo sapiens Chromosome 19 BAC Clone 959a10, complete sequence
          Length = 101912

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 190   atgtgtatgtttattacagca 210
             |||||||||||||||||||||
Sbjct: 79193 atgtgtatgtttattacagca 79213
to top
>gb|AC073893.4|AC073893 Homo sapiens BAC clone RP11-978G18 from Y, complete sequence
          Length = 64450

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 190   atgtgtatgtttattacagca 210
             |||||||||||||||||||||
Sbjct: 16266 atgtgtatgtttattacagca 16286
to top
>gb|AC010682.3| Homo sapiens BAC clone RP11-251M8 from Y, complete sequence
          Length = 145383

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 190   atgtgtatgtttattacagca 210
             |||||||||||||||||||||
Sbjct: 87117 atgtgtatgtttattacagca 87097
to top
>ref|NG_004755.1| Homo sapiens chromosome Y palindromes P1, P2, P3 and inverted repeat IR2
               (P1-P2-P3-IR2@) on chromosome Y
          Length = 4538292

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 190     atgtgtatgtttattacagca 210
               |||||||||||||||||||||
Sbjct: 3923914 atgtgtatgtttattacagca 3923894



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 190     atgtgtatgtttattacagca 210
               |||||||||||||||||||||
Sbjct: 2124429 atgtgtatgtttattacagca 2124449
to top
>emb|AL845323.18| Mouse DNA sequence from clone RP23-304D11 on chromosome 2, complete
             sequence
          Length = 228137

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 95    tgctggttagtttgtcagcta 115
             |||||||||||||||||||||
Sbjct: 28163 tgctggttagtttgtcagcta 28183
to top
>gb|AC005076.2|AC005076 Homo sapiens BAC clone CTA-227L24 from 7q21.1-q21.2, complete sequence
          Length = 158146

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 189    catgtgtatgtttattacagc 209
              |||||||||||||||||||||
Sbjct: 150778 catgtgtatgtttattacagc 150798
to top
>gb|AC141887.5| Mus musculus BAC clone RP23-478L20 from chromosome 7, complete sequence
          Length = 163916

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 95     tgctggttagtttgtcagct 114
              ||||||||||||||||||||
Sbjct: 126621 tgctggttagtttgtcagct 126640
to top
>gb|AY644470.1| Homo sapiens interferon gamma receptor 2 (interferon gamma transducer
             1) (IFNGR2) gene, complete cds
          Length = 38374

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    tttatttcattacaggattg 53
             ||||||||||||||||||||
Sbjct: 31624 tttatttcattacaggattg 31643
to top
>gb|AY915216.1| Schistosoma japonicum SJCHGC03622 protein mRNA, partial cds
          Length = 665

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 289 acaacaaaacaatgtccaac 308
           ||||||||||||||||||||
Sbjct: 136 acaacaaaacaatgtccaac 117
to top
>emb|AL606527.6| Human DNA sequence from clone RP11-454G24 on chromosome 1 Contains a
              alcohol dehydrogenase 5 (class III) chi polypeptide (ADH5)
              pseudogene, complete sequence
          Length = 179964

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 187    tccatgtgtatgtttattacagca 210
              |||||||||||||| |||||||||
Sbjct: 123636 tccatgtgtatgttcattacagca 123659
to top
>emb|AL391841.17| Human DNA sequence from clone RP11-123G14 on chromosome 13 Contains
             part of a novel gene (FLJ22153) and a CpG island, complete
             sequence
          Length = 99441

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 233   agctacgggtagaatttggg 252
             ||||||||||||||||||||
Sbjct: 87386 agctacgggtagaatttggg 87367
to top
>emb|AL389915.19| Human DNA sequence from clone RP11-438P9 on chromosome 9 Contains a
            ribosomal protein S16 (RPS16) pseudogene, a
            peptidylprolyl isomerase A (cyclophilin A) (PPIA)
            pseudogene and a CpG island, complete sequence
          Length = 199601

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 189  catgtgtatgtttattacagcagt 212
            |||||||||||||||| |||||||
Sbjct: 4005 catgtgtatgtttattgcagcagt 3982
to top
>emb|AL390732.10| Human DNA sequence from clone RP11-439N12 on chromosome 9 Contains a
              novel gene similar to mouse 9130404H11Rik protein, the CER1
              gene for cerberus 1 homolog, cysteine knot superfamily
              (Xenopus laevis) and the 3' end of a novel gene (FLJ25416),
              complete sequence
          Length = 143246

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 193    tgtatgtttattacagcagt 212
              ||||||||||||||||||||
Sbjct: 112013 tgtatgtttattacagcagt 112032
to top
>emb|AL356100.8| Human DNA sequence from clone RP11-359H22 on chromosome 10 Contains part
              of a novel gene (KIAA0534), complete sequence
          Length = 190361

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 189    catgtgtatgtttattacagcagt 212
              ||||||||||||||| ||||||||
Sbjct: 133099 catgtgtatgtttatcacagcagt 133076
to top
>gb|AC092053.3| Homo sapiens chromosome 3 clone RP11-331G2, complete sequence
          Length = 176593

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 193   tgtatgtttattacagcagt 212
             ||||||||||||||||||||
Sbjct: 71726 tgtatgtttattacagcagt 71707
to top
>gb|AC104850.2| Homo sapiens chromosome 3 clone RP11-241K18, complete sequence
          Length = 173580

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 193  tgtatgtttattacagcagt 212
            ||||||||||||||||||||
Sbjct: 8633 tgtatgtttattacagcagt 8652
to top
>gb|AC125610.4| Homo sapiens 3 BAC RP11-189B7 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 159706

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 90     ttgtatgctggttagtttgt 109
              ||||||||||||||||||||
Sbjct: 108904 ttgtatgctggttagtttgt 108885
to top
>gb|AC093431.2| Homo sapiens chromosome 1 clone RP11-574N2, complete sequence
          Length = 164454

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 187   tccatgtgtatgtttattacagca 210
             |||||||||||||| |||||||||
Sbjct: 56309 tccatgtgtatgttcattacagca 56286
to top
>gb|AC114288.2| Homo sapiens chromosome 5 clone CTD-2373J16, complete sequence
          Length = 84270

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 191   tgtgtatgtttattacagca 210
             ||||||||||||||||||||
Sbjct: 27422 tgtgtatgtttattacagca 27441
to top
>gb|AC008948.8| Homo sapiens chromosome 5 clone CTD-2333K2, complete sequence
          Length = 176656

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 189   catgtgtatgtttattacagcagt 212
             |||||||||||||||| |||||||
Sbjct: 29744 catgtgtatgtttattgcagcagt 29767
to top
>dbj|AK010208.1| Mus musculus adult male tongue cDNA, RIKEN full-length enriched
            library, clone:2310076O14 product:hypothetical Bacterial
            regulatory protein, LysR family containing protein, full
            insert sequence
          Length = 2316

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 29   cagtgtttatttcattacag 48
            ||||||||||||||||||||
Sbjct: 2306 cagtgtttatttcattacag 2287
to top
>gb|AC078916.19| Homo sapiens 12 BAC RP11-463C23 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 172678

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 82     ctctctgtttgtatgctggt 101
              ||||||||||||||||||||
Sbjct: 109874 ctctctgtttgtatgctggt 109893
to top
>dbj|AP000045.1| Homo sapiens genomic DNA, chromosome 21q22.1, segment 16/28, complete
             sequence
          Length = 100000

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    tttatttcattacaggattg 53
             ||||||||||||||||||||
Sbjct: 54334 tttatttcattacaggattg 54353
to top
>gb|AC092632.2| Homo sapiens BAC clone RP11-337B18 from 2, complete sequence
          Length = 199385

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 191    tgtgtatgtttattacagca 210
              ||||||||||||||||||||
Sbjct: 190367 tgtgtatgtttattacagca 190348
to top
>emb|AL954218.1| Pan troglodytes chromosome 22 clone PTB-451A22 map 22q22.11, complete
             sequence
          Length = 124250

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    tttatttcattacaggattg 53
             ||||||||||||||||||||
Sbjct: 44953 tttatttcattacaggattg 44972
to top
>emb|AL954217.1| Pan troglodytes chromosome 22 clone PTB-073G05 map 22q22.11, complete
              sequence
          Length = 160344

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     tttatttcattacaggattg 53
              ||||||||||||||||||||
Sbjct: 135806 tttatttcattacaggattg 135825
to top
>dbj|BS000154.1| Pan troglodytes chromosome 22 clone:RP43-091K15, map 22, complete
            sequences
          Length = 155153

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   tttatttcattacaggattg 53
            ||||||||||||||||||||
Sbjct: 2258 tttatttcattacaggattg 2277
to top
>dbj|AK129657.1| Homo sapiens cDNA FLJ26146 fis, clone ADG00290
          Length = 2167

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   tttatttcattacaggattg 53
            ||||||||||||||||||||
Sbjct: 2125 tttatttcattacaggattg 2106
to top
>dbj|AP001717.1| Homo sapiens genomic DNA, chromosome 21q, section 61/105
          Length = 340000

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    tttatttcattacaggattg 53
             ||||||||||||||||||||
Sbjct: 41484 tttatttcattacaggattg 41503
to top
>gb|AC106797.2| Homo sapiens chromosome 5 clone RP11-433I2, complete sequence
          Length = 169265

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 191  tgtgtatgtttattacagca 210
            ||||||||||||||||||||
Sbjct: 3664 tgtgtatgtttattacagca 3683
to top
>emb|BX537378.1|HSM805673 Homo sapiens mRNA; cDNA DKFZp686C2482 (from clone DKFZp686C2482);
            complete cds
          Length = 3084

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   tttatttcattacaggattg 53
            ||||||||||||||||||||
Sbjct: 3021 tttatttcattacaggattg 3002
to top
>gb|AC161256.3| Mus musculus BAC clone RP24-70H20 from chromosome 9, complete sequence
          Length = 190832

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 285   atacacaacaaaacaatgtccaac 308
             |||||||||||||| |||||||||
Sbjct: 40643 atacacaacaaaactatgtccaac 40666
to top
>emb|AL603843.15| Mouse DNA sequence from clone RP23-412D17 on chromosome 15, complete
              sequence
          Length = 203649

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 29     cagtgtttatttcattacag 48
              ||||||||||||||||||||
Sbjct: 107846 cagtgtttatttcattacag 107865
to top
>emb|AL772258.9| Mouse DNA sequence from clone RP23-337P24 on chromosome 2, complete
              sequence
          Length = 200480

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 267    actgctactttgtcagtaat 286
              ||||||||||||||||||||
Sbjct: 118004 actgctactttgtcagtaat 118023
to top
>emb|AL928658.6| Mouse DNA sequence from clone RP23-238A18 on chromosome 2, complete
              sequence
          Length = 220679

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 182    ctatttccatgtgtatgttt 201
              ||||||||||||||||||||
Sbjct: 186118 ctatttccatgtgtatgttt 186099
to top
>dbj|AP000189.1| Homo sapiens genomic DNA, chromosome 21q22.1, D21S226-AML region, clone
             Q78C10-f32E9, segment 16/21, complete sequence
          Length = 100000

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    tttatttcattacaggattg 53
             ||||||||||||||||||||
Sbjct: 60310 tttatttcattacaggattg 60329
to top
>dbj|AP000300.1| Homo sapiens genomic DNA, chromosome 21q22.1, D21S226-AML region,
             clone:PACB5, complete sequence
          Length = 56188

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    tttatttcattacaggattg 53
             ||||||||||||||||||||
Sbjct: 27102 tttatttcattacaggattg 27121
to top
>dbj|AP000113.1| Homo sapiens genomic DNA of 21q22.1, GART and AML related,
             Q78C10-149C3 region, segment 16/20
          Length = 100000

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    tttatttcattacaggattg 53
             ||||||||||||||||||||
Sbjct: 60310 tttatttcattacaggattg 60329


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,582,940
Number of Sequences: 3902068
Number of extensions: 3582940
Number of successful extensions: 68490
Number of sequences better than 10.0: 42
Number of HSP's better than 10.0 without gapping: 42
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 68402
Number of HSP's gapped (non-prelim): 88
length of query: 413
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 391
effective length of database: 17,147,199,772
effective search space: 6704555110852
effective search space used: 6704555110852
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top