ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags13k13
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC007852.9| Drosophila melanogaster clone BACR33A10, complete... 42 1.5
2emb|BX088548.10| Zebrafish DNA sequence from clone CH211-188E4, ... 42 1.5
3tpg|BK003797.1| TPA: TPA_inf: Drosophila melanogaster HDC06310 (... 42 1.5
4gb|AC007851.6|AC007851 Drosophila melanogaster, chromosome 2R, r... 42 1.5
5gb|AE003816.4| Drosophila melanogaster chromosome 2R, section 34... 42 1.5
6ref|XM_640757.1| Dictyostelium discoideum hypothetical protein (... 40 6.0
7ref|XM_510827.1| PREDICTED: Pan troglodytes similar to Ubiquitin... 40 6.0
8ref|NM_005154.2| Homo sapiens ubiquitin specific peptidase 8 (US... 40 6.0
9gb|AC140193.3| Mus musculus BAC clone RP23-247C12 from chromosom... 40 6.0
10gb|BC020377.1| Mus musculus mucolipin 1, mRNA (cDNA clone IMAGE:... 40 6.0
11gb|DQ249182.1| Homo sapiens isolate 541CLS41 haplotype HLA-B5001... 40 6.0
12gb|DQ249181.1| Homo sapiens isolate 541CLS37 haplotype HLA-B0702... 40 6.0
13gb|DQ249180.1| Homo sapiens isolate 495CLS44 haplotype HLA-B5701... 40 6.0
14gb|DQ249179.1| Homo sapiens isolate 495CLS7 haplotype HLA-B3801/... 40 6.0
15gb|DQ249177.1| Homo sapiens isolate 218CLS60 haplotype HLA-B1501... 40 6.0
16gb|DQ249176.1| Homo sapiens isolate 218CLS51 haplotype HLA-B1402... 40 6.0
17gb|DQ249175.1| Homo sapiens isolate 144CLS7 haplotype HLA-B3801/... 40 6.0
18gb|DQ249174.1| Homo sapiens isolate 144CLS49 haplotype HLA-B0801... 40 6.0
19gb|DQ249173.1| Homo sapiens isolate 135CLS51 haplotype HLA-B1402... 40 6.0
20gb|DQ249172.1| Homo sapiens isolate 135CLS49 haplotype HLA-B0801... 40 6.0
21ref|NG_002397.2| Homo sapiens major histocompatibility complex, ... 40 6.0
22emb|BX248310.3| Human DNA sequence from clone DASS-311G1 on chro... 40 6.0
23emb|AL845443.3| Human DNA sequence from clone DAQB-48K1 on chrom... 40 6.0
24emb|AL662833.4| Human DNA sequence from clone XXbac-101P6 on chr... 40 6.0
25emb|AL671883.3| Human DNA sequence from clone XXbac-248L24 on ch... 40 6.0
26emb|AL591804.5| Human DNA sequence from clone RP11-457O1 on chro... 40 6.0
27emb|BX537420.1|HSM805722 Homo sapiens mRNA; cDNA DKFZp686M2040 (... 40 6.0
28emb|CR388229.14| Human DNA sequence from clone DADB-104B20 on ch... 40 6.0
29emb|BX927178.8| Human DNA sequence from clone DAMA-387C9 on chro... 40 6.0
30emb|CR759828.5| Human DNA sequence from clone DAMC-153L10 on chr... 40 6.0
31gb|BC005651.1| Mus musculus mucolipin 1, mRNA (cDNA clone MGC:71... 40 6.0
32ref|NM_053177.1| Mus musculus mucolipin 1 (Mcoln1), mRNA 40 6.0
33dbj|AK091775.1| Homo sapiens cDNA FLJ34456 fis, clone HLUNG20026... 40 6.0
34dbj|AB226807.1| Aspergillus oryzae cDNA, contig sequence: AoEST3669 40 6.0
35gb|AC037482.14| Homo sapiens chromosome 17, clone RP11-619M15, c... 40 6.0
36gb|AF302009.1|AF302009 Mus musculus mucolipin-1 (Mcoln1) mRNA, c... 40 6.0
37dbj|AB179348.1| Macaca fascicularis testis cDNA clone: QtsA-1806... 40 6.0
38dbj|AK049606.1| Mus musculus 12 days embryo spinal cord cDNA, RI... 40 6.0
39dbj|AK038594.1| Mus musculus adult male hypothalamus cDNA, RIKEN... 40 6.0
40dbj|AK034471.1| Mus musculus adult male diencephalon cDNA, RIKEN... 40 6.0
41dbj|AK028385.1| Mus musculus 18 days pregnant adult female place... 40 6.0
42gb|AC012170.6|AC012170 Homo sapiens chromosome 15 clone RP11-562... 40 6.0
43gb|AC110752.3| Homo sapiens BAC clone RP13-534L4 from 4, complet... 40 6.0
44gb|AC019127.10| Homo sapiens BAC clone RP11-558B7 from 2, comple... 40 6.0
45gb|AC100808.10| Homo sapiens chromosome 17, clone CTD-2534H9, co... 40 6.0
46dbj|BA000025.2| Homo sapiens genomic DNA, chromosome 6p21.3, HLA... 40 6.0
47dbj|BA000041.2| Pan troglodytes DNA, major histocompatibility co... 40 6.0
48dbj|D29956.1|HUMORFA08 Homo sapiens KIAA0055 mRNA, partial cds 40 6.0
49gb|AC004204.1|AC004204 Homo sapiens clone UWGC:y3c018 from 6p21,... 40 6.0
50gb|U51243.1|HSU51243 Human alpha-albumin gene, complete cds 40 6.0
51gb|BC110590.1| Homo sapiens ubiquitin specific peptidase 8, mRNA... 40 6.0
52emb|AL845283.4| Mouse DNA sequence from clone RP23-151F21 on chr... 40 6.0
53gb|AC170806.2| Mus musculus BAC clone RP24-363P6 from chromosome... 40 6.0
54emb|Z71187.1|HSU115G11 Human DNA sequence from clone LL0XNC01-11... 40 6.0
55dbj|D84394.1| Homo sapiens genomic DNA, 237 kb segment from 6p21... 40 6.0
56emb|AL663038.7| Human DNA sequence from clone XXbac-47E12 on chr... 40 6.0 
>gb|AC007852.9| Drosophila melanogaster clone BACR33A10, complete sequence
          Length = 186333

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 251    gtggtgggggtggtttgattt 271
              |||||||||||||||||||||
Sbjct: 172138 gtggtgggggtggtttgattt 172158
to top
>emb|BX088548.10| Zebrafish DNA sequence from clone CH211-188E4, complete sequence
          Length = 152713

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 221   gattcaaatctacagtacagtcatatgtc 249
             |||||||| |||||||||||| |||||||
Sbjct: 51967 gattcaaagctacagtacagtgatatgtc 51939
to top
>tpg|BK003797.1| TPA: TPA_inf: Drosophila melanogaster HDC06310 (HDC06310) gene,
            complete cds
          Length = 2300

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 251  gtggtgggggtggtttgattt 271
            |||||||||||||||||||||
Sbjct: 2143 gtggtgggggtggtttgattt 2123
to top
>gb|AC007851.6|AC007851 Drosophila melanogaster, chromosome 2R, region 50C-50D, BAC clone
             BACR06M19, complete sequence
          Length = 183161

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 251   gtggtgggggtggtttgattt 271
             |||||||||||||||||||||
Sbjct: 13857 gtggtgggggtggtttgattt 13877
to top
>gb|AE003816.4| Drosophila melanogaster chromosome 2R, section 34 of 73 of the complete
              sequence
          Length = 287287

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 251    gtggtgggggtggtttgattt 271
              |||||||||||||||||||||
Sbjct: 158383 gtggtgggggtggtttgattt 158363
to top
>ref|XM_640757.1| Dictyostelium discoideum hypothetical protein (DDB0190152), partial
            mRNA
          Length = 11052

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 265  ttgatttacctttgatcatg 284
            ||||||||||||||||||||
Sbjct: 3817 ttgatttacctttgatcatg 3798
to top
>ref|XM_510827.1| PREDICTED: Pan troglodytes similar to Ubiquitin carboxyl-terminal
            hydrolase 8 (Ubiquitin thiolesterase 8)
            (Ubiquitin-specific processing protease 8)
            (Deubiquitinating enzyme 8) (hUBPy) (LOC453931), mRNA
          Length = 1641

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 222  attcaaatctacagtacagt 241
            ||||||||||||||||||||
Sbjct: 1320 attcaaatctacagtacagt 1339
to top
>ref|NM_005154.2| Homo sapiens ubiquitin specific peptidase 8 (USP8), mRNA
          Length = 4250

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 222  attcaaatctacagtacagt 241
            ||||||||||||||||||||
Sbjct: 2985 attcaaatctacagtacagt 3004
to top
>gb|AC140193.3| Mus musculus BAC clone RP23-247C12 from chromosome 19, complete
             sequence
          Length = 173527

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 252   tggtgggggtggtttgattt 271
             ||||||||||||||||||||
Sbjct: 99629 tggtgggggtggtttgattt 99610
to top
>gb|BC020377.1| Mus musculus mucolipin 1, mRNA (cDNA clone IMAGE:3499432)
          Length = 2458

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 244 tatgtccgtggtgggggtgg 263
           ||||||||||||||||||||
Sbjct: 373 tatgtccgtggtgggggtgg 392
to top
>gb|DQ249182.1| Homo sapiens isolate 541CLS41 haplotype HLA-B5001/HLA-Cw0602 genomic
             sequence
          Length = 346809

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 222   attcaaatctacagtacagt 241
             ||||||||||||||||||||
Sbjct: 99395 attcaaatctacagtacagt 99376
to top
>gb|DQ249181.1| Homo sapiens isolate 541CLS37 haplotype HLA-B070201/HLA-Cw07020103
             genomic sequence
          Length = 341361

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 222   attcaaatctacagtacagt 241
             ||||||||||||||||||||
Sbjct: 98101 attcaaatctacagtacagt 98082
to top
>gb|DQ249180.1| Homo sapiens isolate 495CLS44 haplotype HLA-B570101/HLA-Cw0602 genomic
              sequence
          Length = 265420

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 222    attcaaatctacagtacagt 241
              ||||||||||||||||||||
Sbjct: 102554 attcaaatctacagtacagt 102535
to top
>gb|DQ249179.1| Homo sapiens isolate 495CLS7 haplotype HLA-B3801/HLA-Cw120301 genomic
             sequence
          Length = 338517

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 222   attcaaatctacagtacagt 241
             ||||||||||||||||||||
Sbjct: 98578 attcaaatctacagtacagt 98559
to top
>gb|DQ249177.1| Homo sapiens isolate 218CLS60 haplotype HLA-B15010101/HLA-Cw030401
              genomic sequence
          Length = 351341

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 222    attcaaatctacagtacagt 241
              ||||||||||||||||||||
Sbjct: 114191 attcaaatctacagtacagt 114172
to top
>gb|DQ249176.1| Homo sapiens isolate 218CLS51 haplotype HLA-B140201/HLA-Cw0802 genomic
              sequence
          Length = 363675

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 222    attcaaatctacagtacagt 241
              ||||||||||||||||||||
Sbjct: 114116 attcaaatctacagtacagt 114097
to top
>gb|DQ249175.1| Homo sapiens isolate 144CLS7 haplotype HLA-B3801/HLA-Cw120301 genomic
             sequence
          Length = 328871

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 222   attcaaatctacagtacagt 241
             ||||||||||||||||||||
Sbjct: 99561 attcaaatctacagtacagt 99542
to top
>gb|DQ249174.1| Homo sapiens isolate 144CLS49 haplotype HLA-B080101/HLA-Cw070101 genomic
              sequence
          Length = 338544

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 222    attcaaatctacagtacagt 241
              ||||||||||||||||||||
Sbjct: 110302 attcaaatctacagtacagt 110283
to top
>gb|DQ249173.1| Homo sapiens isolate 135CLS51 haplotype HLA-B140201/HLA-Cw0802 genomic
             sequence
          Length = 336776

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 222   attcaaatctacagtacagt 241
             ||||||||||||||||||||
Sbjct: 93220 attcaaatctacagtacagt 93201
to top
>gb|DQ249172.1| Homo sapiens isolate 135CLS49 haplotype HLA-B080101/HLA-Cw070101
             genomic sequence
          Length = 342745

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 222   attcaaatctacagtacagt 241
             ||||||||||||||||||||
Sbjct: 90911 attcaaatctacagtacagt 90892
to top
>ref|NG_002397.2| Homo sapiens major histocompatibility complex, class I, BC (HLA-BC)
            on chromosome 6
          Length = 89417

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 222  attcaaatctacagtacagt 241
            ||||||||||||||||||||
Sbjct: 9938 attcaaatctacagtacagt 9957
to top
>emb|BX248310.3| Human DNA sequence from clone DASS-311G1 on chromosome 6, complete
             sequence
          Length = 116320

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 222   attcaaatctacagtacagt 241
             ||||||||||||||||||||
Sbjct: 14903 attcaaatctacagtacagt 14922
to top
>emb|AL845443.3| Human DNA sequence from clone DAQB-48K1 on chromosome 6 Contains the
            USP8P pseudogene for ubiquitin specific protease 8, the
            RPL3P2 pseudogene for ribosomal protein L3 pseudogene 2,
            the WASF5P pseudogene for WAS protein family, member 5,
            the HLA-B gene for major histocompatibility complex,
            class I, B, the DHFRP2 pseudogene for dihydrofolate
            reductase 2, the FGFR3P pseudogene for fibroblast growth
            factor receptor 3, the HLA-S gene for major
            histocompatibility complex, class I, S, the MICA gene for
            MHC class I polypeptide-related sequence A and 3 CpG
            islands, complete sequence
          Length = 148076

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 222  attcaaatctacagtacagt 241
            ||||||||||||||||||||
Sbjct: 6330 attcaaatctacagtacagt 6349
to top
>emb|AL662833.4| Human DNA sequence from clone XXbac-101P6 on chromosome 6 contains the
              gene for HCR, the TCF19 gene for  transcription factor 19,
              the POU5F1 gene for POU domain, class 5, transcription
              factor 1, a putative novel transcript, the HLA-C gene for
              major histocompatibility complex, class I, C, a ubiquitin
              specific protease 8 (USP8) pseudogene, a ribosomal protein
              L3 (RPL3) pseudogene, a WAS protein family, member 3
              (WASF3) pseudogene and  three CpG islands, complete
              sequence
          Length = 168887

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 222    attcaaatctacagtacagt 241
              ||||||||||||||||||||
Sbjct: 137834 attcaaatctacagtacagt 137853
to top
>emb|AL671883.3| Human DNA sequence from clone XXbac-248L24 on chromosome 6 contains the
             HLA-C gene for major histocompatibility complex, class I,
             C, a ubiquitin specific protease 8 (USP8) pseudogene, a
             ribosomal protein L3 (RPL3) pseudogene, a WAS protein
             family, member 3 (WASF3) pseudogene, the HLA-B gene for
             major histocompatibility complex, class I, B, a
             dihydrofolate reductase pseudogene, a fibroblast growth
             factor receptor 3 (FGFR3) pseudogene and two CpG islands,
             complete sequence
          Length = 120197

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 222   attcaaatctacagtacagt 241
             ||||||||||||||||||||
Sbjct: 13385 attcaaatctacagtacagt 13404
to top
>emb|AL591804.5| Human DNA sequence from clone RP11-457O1 on chromosome X, complete
             sequence
          Length = 112366

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 153   tacaattagatggcagtaataagt 176
             ||||||||||||| ||||||||||
Sbjct: 15802 tacaattagatgggagtaataagt 15825
to top
>emb|BX537420.1|HSM805722 Homo sapiens mRNA; cDNA DKFZp686M2040 (from clone DKFZp686M2040);
            complete cds
          Length = 4250

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 222  attcaaatctacagtacagt 241
            ||||||||||||||||||||
Sbjct: 2985 attcaaatctacagtacagt 3004
to top
>emb|CR388229.14| Human DNA sequence from clone DADB-104B20 on chromosome 6, complete
              sequence
          Length = 121659

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 222    attcaaatctacagtacagt 241
              ||||||||||||||||||||
Sbjct: 118422 attcaaatctacagtacagt 118441
to top
>emb|BX927178.8| Human DNA sequence from clone DAMA-387C9 on chromosome 6, complete
             sequence
          Length = 106199

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 222   attcaaatctacagtacagt 241
             ||||||||||||||||||||
Sbjct: 17420 attcaaatctacagtacagt 17439
to top
>emb|CR759828.5| Human DNA sequence from clone DAMC-153L10 on chromosome 6, complete
             sequence
          Length = 102821

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 222   attcaaatctacagtacagt 241
             ||||||||||||||||||||
Sbjct: 16839 attcaaatctacagtacagt 16858
to top
>gb|BC005651.1| Mus musculus mucolipin 1, mRNA (cDNA clone MGC:7172 IMAGE:3257440),
           complete cds
          Length = 2039

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 244 tatgtccgtggtgggggtgg 263
           ||||||||||||||||||||
Sbjct: 523 tatgtccgtggtgggggtgg 542
to top
>ref|NM_053177.1| Mus musculus mucolipin 1 (Mcoln1), mRNA
          Length = 2039

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 244 tatgtccgtggtgggggtgg 263
           ||||||||||||||||||||
Sbjct: 523 tatgtccgtggtgggggtgg 542
to top
>dbj|AK091775.1| Homo sapiens cDNA FLJ34456 fis, clone HLUNG2002659, highly similar to
            UBIQUITIN CARBOXYL-TERMINAL HYDROLASE 8 (EC 3.1.2.15)
          Length = 2402

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 222  attcaaatctacagtacagt 241
            ||||||||||||||||||||
Sbjct: 1225 attcaaatctacagtacagt 1244
to top
>dbj|AB226807.1| Aspergillus oryzae cDNA, contig sequence: AoEST3669
          Length = 811

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 1  attcggcacgagggtttgag 20
          ||||||||||||||||||||
Sbjct: 2  attcggcacgagggtttgag 21
to top
>gb|AC037482.14| Homo sapiens chromosome 17, clone RP11-619M15, complete sequence
          Length = 186078

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 264   tttgatttacctttgatcat 283
             ||||||||||||||||||||
Sbjct: 45138 tttgatttacctttgatcat 45157



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 264   tttgatttacctttgatcat 283
             ||||||||||||||||||||
Sbjct: 23773 tttgatttacctttgatcat 23792
to top
>gb|AF302009.1|AF302009 Mus musculus mucolipin-1 (Mcoln1) mRNA, complete cds
          Length = 2003

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 244 tatgtccgtggtgggggtgg 263
           ||||||||||||||||||||
Sbjct: 520 tatgtccgtggtgggggtgg 539
to top
>dbj|AB179348.1| Macaca fascicularis testis cDNA clone: QtsA-18066, similar to human
            ubiquitin specific protease 8 (USP8), mRNA, RefSeq:
            NM_005154.2
          Length = 2523

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 222  attcaaatctacagtacagt 241
            ||||||||||||||||||||
Sbjct: 1350 attcaaatctacagtacagt 1369
to top
>dbj|AK049606.1| Mus musculus 12 days embryo spinal cord cDNA, RIKEN full-length
           enriched library, clone:C530002M15 product:MUCOLIPIDIN
           homolog [Homo sapiens], full insert sequence
          Length = 2001

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 244 tatgtccgtggtgggggtgg 263
           ||||||||||||||||||||
Sbjct: 524 tatgtccgtggtgggggtgg 543
to top
>dbj|AK038594.1| Mus musculus adult male hypothalamus cDNA, RIKEN full-length
           enriched library, clone:A230048M17 product:mucolipin 1,
           full insert sequence
          Length = 2009

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 244 tatgtccgtggtgggggtgg 263
           ||||||||||||||||||||
Sbjct: 536 tatgtccgtggtgggggtgg 555
to top
>dbj|AK034471.1| Mus musculus adult male diencephalon cDNA, RIKEN full-length
           enriched library, clone:9330198A17 product:mucolipin 1,
           full insert sequence
          Length = 2011

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 244 tatgtccgtggtgggggtgg 263
           ||||||||||||||||||||
Sbjct: 534 tatgtccgtggtgggggtgg 553
to top
>dbj|AK028385.1| Mus musculus 18 days pregnant adult female placenta and extra
           embryonic tissue cDNA, RIKEN full-length enriched
           library, clone:3830431I18 product:mucolipin 1, full
           insert sequence
          Length = 1975

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 244 tatgtccgtggtgggggtgg 263
           ||||||||||||||||||||
Sbjct: 500 tatgtccgtggtgggggtgg 519
to top
>gb|AC012170.6|AC012170 Homo sapiens chromosome 15 clone RP11-562A8 map 15q21.1, complete
              sequence
          Length = 198550

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 222    attcaaatctacagtacagt 241
              ||||||||||||||||||||
Sbjct: 142879 attcaaatctacagtacagt 142898
to top
>gb|AC110752.3| Homo sapiens BAC clone RP13-534L4 from 4, complete sequence
          Length = 9342

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 153  tacaattagatggcagtaataagt 176
            ||||||||||| ||||||||||||
Sbjct: 2348 tacaattagatagcagtaataagt 2325
to top
>gb|AC019127.10| Homo sapiens BAC clone RP11-558B7 from 2, complete sequence
          Length = 105118

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 21    cacatattttaacttcatca 40
             ||||||||||||||||||||
Sbjct: 15829 cacatattttaacttcatca 15848
to top
>gb|AC100808.10| Homo sapiens chromosome 17, clone CTD-2534H9, complete sequence
          Length = 148801

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 264   tttgatttacctttgatcat 283
             ||||||||||||||||||||
Sbjct: 78091 tttgatttacctttgatcat 78110



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 264   tttgatttacctttgatcat 283
             ||||||||||||||||||||
Sbjct: 56909 tttgatttacctttgatcat 56928
to top
>dbj|BA000025.2| Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region
          Length = 2229817

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 222    attcaaatctacagtacagt 241
              ||||||||||||||||||||
Sbjct: 665424 attcaaatctacagtacagt 665405
to top
>dbj|BA000041.2| Pan troglodytes DNA, major histocompatibility complex class I region
          Length = 1750601

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 222    attcaaatctacagtacagt 241
              ||||||||||||||||||||
Sbjct: 216513 attcaaatctacagtacagt 216494
to top
>dbj|D29956.1|HUMORFA08 Homo sapiens KIAA0055 mRNA, partial cds
          Length = 4359

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 222  attcaaatctacagtacagt 241
            ||||||||||||||||||||
Sbjct: 3104 attcaaatctacagtacagt 3123
to top
>gb|AC004204.1|AC004204 Homo sapiens clone UWGC:y3c018 from 6p21, complete sequence
          Length = 46797

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 222   attcaaatctacagtacagt 241
             ||||||||||||||||||||
Sbjct: 23686 attcaaatctacagtacagt 23667
to top
>gb|U51243.1|HSU51243 Human alpha-albumin gene, complete cds
          Length = 24454

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 153   tacaattagatggcagtaataagt 176
             ||||||||||| ||||||||||||
Sbjct: 20643 tacaattagatagcagtaataagt 20620
to top
>gb|BC110590.1| Homo sapiens ubiquitin specific peptidase 8, mRNA (cDNA clone
            MGC:129718 IMAGE:40027270), complete cds
          Length = 4091

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 222  attcaaatctacagtacagt 241
            ||||||||||||||||||||
Sbjct: 2956 attcaaatctacagtacagt 2975
to top
>emb|AL845283.4| Mouse DNA sequence from clone RP23-151F21 on chromosome 2, complete
              sequence
          Length = 178403

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 108    aaagacacattagtgaagga 127
              ||||||||||||||||||||
Sbjct: 125281 aaagacacattagtgaagga 125300
to top
>gb|AC170806.2| Mus musculus BAC clone RP24-363P6 from chromosome 8, complete sequence
          Length = 182564

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 244   tatgtccgtggtgggggtgg 263
             ||||||||||||||||||||
Sbjct: 33881 tatgtccgtggtgggggtgg 33900
to top
>emb|Z71187.1|HSU115G11 Human DNA sequence from clone LL0XNC01-115G11 on chromosome X, complete
             sequence
          Length = 42503

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 153   tacaattagatggcagtaataagt 176
             ||||||||||||| ||||||||||
Sbjct: 42380 tacaattagatgggagtaataagt 42357
to top
>dbj|D84394.1| Homo sapiens genomic DNA, 237 kb segment from 6p21.3 region including HLA
              genes, complete sequence
          Length = 236822

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 222    attcaaatctacagtacagt 241
              ||||||||||||||||||||
Sbjct: 136594 attcaaatctacagtacagt 136575
to top
>emb|AL663038.7| Human DNA sequence from clone XXbac-47E12 on chromosome 6, complete
             sequence
          Length = 151964

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 222   attcaaatctacagtacagt 241
             ||||||||||||||||||||
Sbjct: 57432 attcaaatctacagtacagt 57451


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,911,505
Number of Sequences: 3902068
Number of extensions: 3911505
Number of successful extensions: 72668
Number of sequences better than 10.0: 56
Number of HSP's better than 10.0 without gapping: 56
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 72558
Number of HSP's gapped (non-prelim): 110
length of query: 447
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 425
effective length of database: 17,147,199,772
effective search space: 7287559903100
effective search space used: 7287559903100
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top