ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags13i08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X94352.1|TACATAGEN T.aestivum mRNA for catalase 1114 0.0
2gb|AF021938.1|AF021938 Hordeum vulgare catalase 1 (CAT1) gene, p... 1114 0.0
3gb|U20777.1|HVU20777 Hordeum vulgare catalase (Cat1) mRNA, compl... 1114 0.0
4dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 646 0.0
5dbj|AP004685.3| Oryza sativa (japonica cultivar-group) genomic D... 646 0.0
6dbj|AK100019.1| Oryza sativa (japonica cultivar-group) cDNA clon... 646 0.0
7dbj|AK069446.1| Oryza sativa (japonica cultivar-group) cDNA clon... 646 0.0
8dbj|D26484.1|RICPOSCATB Oryza sativa (japonica cultivar-group) m... 646 0.0
9gb|DQ078758.1| Oryza sativa (indica cultivar-group) catalase mRN... 638 e-180
10dbj|D64013.1| Oryza sativa (japonica cultivar-group) CatB gene f... 638 e-180
11gb|U16132.1|HVU16132 Hordeum vulgare catalase mRNA, partial cds 583 e-163
12emb|Z99634.1|SCCATALAS Secale cereale mRNA for catalase (cat2 gene) 525 e-146
13gb|AY103601.1| Zea mays PCO144994 mRNA sequence 490 e-135
14emb|X60135.1|ZMCATA1 Z.mays cat1 gene for catalase 1 482 e-133
15emb|X12538.1|ZMCAT1 Maize cat-1 mRNA for catalase-1 isoenzyme (E... 474 e-130
16gb|BT018650.1| Zea mays clone EL01N0505F10.d mRNA sequence 458 e-125
17gb|AF207906.1| Zantedeschia aethiopica catalase 1 (cat1) mRNA, c... 238 2e-59
18gb|AF475100.1| Triticum aestivum catalase isozyme mRNA, partial cds 202 9e-49
19gb|AF104454.1|AF104454 Brassica juncea catalase (CAT4) mRNA, com... 202 9e-49
20emb|X52135.1|GHCAT1 Cotton mRNA for cottonseed catalase subunit ... 200 4e-48
21ref|NM_119675.2| Arabidopsis thaliana CAT2 (CATALASE 2); catalas... 194 2e-46
22ref|NM_001036714.1| Arabidopsis thaliana CAT2 (CATALASE 2); cata... 194 2e-46
23gb|AY113854.1| Arabidopsis thaliana putative catalase (At4g35090... 194 2e-46
24gb|AY074301.1| Arabidopsis thaliana putative catalase (At4g35090... 194 2e-46
25emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, ... 194 2e-46
26emb|AL035522.1|ATT12J5 Arabidopsis thaliana DNA chromosome 4, BA... 194 2e-46
27emb|AL022023.1|ATM4E13 Arabidopsis thaliana DNA chromosome 4, BA... 194 2e-46
28gb|AY054663.1| Arabidopsis thaliana catalase (At4g35090; M4E13.1... 194 2e-46
29gb|AF248491.1|AF248491 Raphanus sativus catalase (cat) gene, com... 194 2e-46
30gb|AF031318.2|AF031318 Raphanus sativus catalase (Cat1) mRNA, co... 194 2e-46
31gb|AF243517.1|AF243517 Helianthus annuus catalase 2 (CATA2) mRNA... 188 1e-44
32gb|AY641732.1| Camellia sinensis catalase mRNA, partial cds 184 2e-43
33emb|AJ874263.1| Populus deltoides cat1 gene for catalase, exons 1-8 184 2e-43
34emb|AJ496418.1|PPE496418 Prunus persica mRNA for catalase (cat1 ... 182 9e-43
35gb|AF104452.1|AF104452 Brassica juncea catalase (CAT2) mRNA, com... 178 1e-41
36emb|AJ297612.1|DLA297612 Digitalis lanata partial mRNA for catal... 174 2e-40
37gb|AY128695.1| Capsicum annuum catalase 3 (CAT3) mRNA, complete cds 174 2e-40
38emb|X64271.1|ATCATRNA A.thaliana mRNA for catalase 168 1e-38
39emb|X94447.1|ATCATAL A.thaliana cat gene for catalase 163 8e-37
40gb|AY173073.1| Hypericum perforatum catalase (cat1) mRNA, comple... 163 8e-37
41dbj|D55645.1|CUCCAT1 Pumpkin mRNA for catalase (cat1), complete cds 151 3e-33
42gb|L28740.1|HNNCATA Helianthus annuus catalase mRNA, complete cds 149 1e-32
43emb|Z36977.1|NPCAT3MR N.plumbaginifolia mRNA for catalase (cat3 ... 141 3e-30
44gb|AF035256.1|AF035256 Glycine max catalase (cat5) mRNA, partial... 139 1e-29
45dbj|D13557.1|VIRCAT Vigna radiata mRNA for catalase, complete cds 135 2e-28
46gb|AF104453.1|AF104453 Brassica juncea catalase (CAT3) mRNA, com... 131 3e-27
47gb|AF104451.1|AF104451 Brassica juncea catalase (CAT1) mRNA, com... 131 3e-27
48gb|AF035255.1|AF035255 Glycine max catalase (cat4) mRNA, complet... 129 1e-26
49ref|NM_101914.2| Arabidopsis thaliana CAT1 (CATALASE 1); catalas... 117 4e-23
50gb|BT010373.1| Arabidopsis thaliana At1g20630 mRNA, complete cds 117 4e-23
51gb|AY136424.1| Arabidopsis thaliana expressed protein (At1g20630... 117 4e-23
52gb|AF151368.1|AF151368 Hevea brasiliensis catalase (cat) mRNA, c... 117 4e-23
53gb|AC069251.5|AC069251 Genomic sequence for Arabidopsis thaliana... 117 4e-23
54gb|AC027665.4|AC027665 Genomic sequence for Arabidopsis thaliana... 117 4e-23
55gb|AF021937.1|AF021937 Arabidopsis thaliana catalase 3 (CAT3) an... 117 4e-23
56emb|AJ302710.1|BPE302710 Betula pendula partial mRNA for catalas... 111 3e-21
57gb|AF243518.1|AF243518 Helianthus annuus catalase 3 (CATA3) mRNA... 109 1e-20
58gb|AF069319.1|AF069319 Mesembryanthemum crystallinum leaf catala... 109 1e-20
59ref|NM_101913.2| Arabidopsis thaliana CAT3 (CATALASE 3); catalas... 107 4e-20
60ref|NM_202144.1| Arabidopsis thaliana CAT3 (CATALASE 3); catalas... 107 4e-20
61ref|NM_001035996.1| Arabidopsis thaliana CAT3 (CATALASE 3); cata... 107 4e-20
62ref|NM_001035995.1| Arabidopsis thaliana CAT3 (CATALASE 3); cata... 107 4e-20
63ref|NM_001035994.1| Arabidopsis thaliana CAT3 (CATALASE 3); cata... 107 4e-20
64emb|X56675.1|GHLCCSU2 G. hirsutum mRNA for cotton catalase subun... 107 4e-20
65gb|AY058104.1| Arabidopsis thaliana At1g20620/F5M15_4 mRNA, comp... 107 4e-20
66gb|AY056447.1| Arabidopsis thaliana At1g20620/F5M15_4 mRNA, comp... 107 4e-20
67emb|BX815559.1|CNS0ABH4 Arabidopsis thaliana Full-length cDNA Co... 107 4e-20
68emb|AJ496419.1|PPE496419 Prunus persica mRNA for catalase (cat2 ... 105 2e-19
69emb|AJ132444.1|PPE132444 Prunus persica mRNA for catalase 1, par... 105 2e-19
70gb|U43340.1| Arabidopsis thaliana catalase 1 (CAT1) mRNA, comple... 101 2e-18
71dbj|D21161.1|RCCCATALAA Ricinus communis gene for catalase CAT1,... 101 2e-18
72emb|AJ295295.1|BPE295295 Betula pendula partial mRNA for catalas... 100 1e-17
73gb|U43147.1|ATU43147 Arabidopsis thaliana catalase 3 (CAT3) gene... 100 1e-17
74gb|AF139539.2|AF139539 Raphanus sativus catalase 3 (Cat3) mRNA, ... 98 4e-17
75gb|AY087477.1| Arabidopsis thaliana clone 35868 mRNA, complete s... 94 6e-16
76gb|AF035254.1|AF035254 Glycine max catalase (cat3) mRNA, complet... 94 6e-16
77emb|AJ299450.1|PPI299450 Pinus pinea partial mRNA for catalase 1... 90 9e-15
78dbj|AB109090.1| Acacia ampliceps cat mRNA for catalase, complete... 90 9e-15
79emb|X60169.1|PSCATAL Pisum sativum mRNA for catalase 88 4e-14
80gb|DQ226689.1| Boechera divaricarpa isolate SLW-348-443-G06 mRNA... 86 1e-13
81emb|Z12021.1|GMCATALG G.max gene for catalase 86 1e-13
82gb|DQ124022.1| Coffea arabica clone MN-SSH2-H06 mRNA sequence 86 1e-13
83gb|AF035253.1|AF035253 Glycine max catalase (cat2) mRNA, complet... 86 1e-13
84gb|AF035252.1|AF035252 Glycine max catalase (cat1) mRNA, complet... 86 1e-13
85gb|AF390210.2| Suaeda maritima subsp. salsa catalase (CAT1) mRNA... 82 2e-12
86gb|AF236127.1| Vitis vinifera catalase (GCat) mRNA, complete cds 82 2e-12
87gb|AY128694.1| Capsicum annuum catalase 2 (CAT2) mRNA, partial cds 80 9e-12
88gb|AY442179.2| Solanum tuberosum catalase mRNA, partial cds 78 4e-11
89ref|XM_470174.1| Oryza sativa (japonica cultivar-group), predic... 76 1e-10
90gb|BT012965.1| Lycopersicon esculentum clone 114156F, mRNA sequence 76 1e-10
91gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 76 1e-10
92gb|AY339372.1| Oryza sativa (japonica cultivar-group) catalase m... 76 1e-10
93gb|AC098693.2| Oryza sativa (japonica cultivar-group) chromosome... 76 1e-10
94dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 76 1e-10
95dbj|AK066378.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 1e-10
96dbj|AK062174.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 1e-10
97dbj|AB020502.1| Oryza sativa mRNA for catalase, complete cds 76 1e-10
98dbj|D86611.1| Oryza sativa (japonica cultivar-group) CatC gene f... 76 1e-10
99gb|AY726007.1| Petunia x hybrida catalase gene, partial cds 74 6e-10
100emb|AJ973128.1| Andrographis paniculata partial cat gene for put... 74 6e-10
101gb|DQ123920.1| Coffea arabica x Coffea canephora clone HT-SSH1-A... 74 6e-10
102gb|AF139538.2|AF139538 Raphanus sativus catalase 2 (cat2) mRNA, ... 74 6e-10
103emb|Z36975.1|NPCAT1MR N.plumbaginifolia mRNA for catalase (cat1 ... 72 2e-09
104gb|U93244.1|NTU93244 Nicotiana tabacum catalase 1 (cat1) mRNA, c... 72 2e-09
105gb|AF170272.1|AF170272 Manihot esculenta catalase CAT1 mRNA, com... 72 2e-09
106emb|Z99633.1|SACATALAS Soldanella alpina mRNA for catalase (cat1... 70 9e-09
107gb|AY500290.1| Solanum tuberosum catalase (CAT2) mRNA, complete cds 68 3e-08
108gb|AY450630.1| Solanum tuberosum clone plbr1 catalase mRNA, part... 68 3e-08
109emb|Z37106.1|STCATGP S.tuberosum cat gene encoding catalase (par... 68 3e-08
110gb|AF006067.1|AF006067 Nicotiana glutinosa catalase-1 mRNA, comp... 68 3e-08
111gb|AF537135.1| Phaseolus vulgaris cultivar Negro Jamapa catalase... 66 1e-07
112gb|AF096252.1|AF096252 Lycopersicon esculentum ethylene-responsi... 66 1e-07
113dbj|AP006107.1| Lotus japonicus genomic DNA, chromosome 1, clone... 66 1e-07
114emb|Z36976.1|NPCAT2MR N.plumbaginifolia mRNA for catalase (cat2 ... 64 5e-07
115gb|DQ118681.1| Oryza sativa (indica cultivar-group) catalase-C m... 64 5e-07
116gb|AY272049.1| Avicennia marina catalase (Cat1) gene, complete cds 64 5e-07
117gb|AF328861.1|AF328861 Avicennia marina catalase mRNA, complete cds 64 5e-07
118gb|U68219.2|BNU68219 Brassica napus catalase (LSC650) mRNA, part... 64 5e-07
119gb|DQ255945.1| Avicennia marina truncated catalase 2 mRNA, compl... 64 5e-07
120gb|M93719.1|TOMCAT1A Lycopersicon esculentum catalase (cat1) mRN... 62 2e-06
121emb|X71653.1|SMCATSM S.melongena CATSM mRNA for catalase 60 8e-06
122emb|X54819.1|ZMCAT2R Maize mRNA for catalase 2 60 8e-06
123emb|AJ616025.1| Homogyne alpina mRNA for catalase (cat1 gene) 60 8e-06
124emb|Z54358.1|ZMCAT2GN Z.mays cat2 gene 60 8e-06
125gb|AY110648.1| Zea mays CL1739_1 mRNA sequence 60 8e-06
126gb|AY107763.1| Zea mays PCO104975 mRNA sequence 60 8e-06
127emb|AJ874264.1| Populus deltoides cat2 gene for catalase, exons 1-8 60 8e-06
128gb|U03473.1|NTU03473 Nicotiana tabacum SR1 salicylic acid bindin... 60 8e-06
129gb|DQ294281.1| Solanum tuberosum clone 048E08 catalase isozyme 1... 60 8e-06
130gb|DQ268837.1| Solanum tuberosum clone 120C07 catalase isozyme 1... 60 8e-06
131gb|U27082.1|STU27082 Solanum tuberosum catalase (CAT1) mRNA, com... 60 8e-06
132gb|L41694.1|PS300032E Eucalyptus globulus bicostata symbiont (F0... 60 8e-06
133gb|U07627.1|NTU07627 Nicotiana tabacum Petit Havana SR1 catalase... 60 8e-06
134gb|U07626.1|NSU07626 Nicotiana sylvestris catalase (CAT-1) mRNA,... 60 8e-06
135gb|J02976.1|MZECAT2 Maize catalase (Cat2) mRNA, 3' end 60 8e-06
136gb|AF227952.1|AF227952 Capsicum annuum catalase (CAT) mRNA, comp... 58 3e-05
137emb|AJ131046.1|CAR131046 Cicer arietinum mRNA for catalase 56 1e-04
138gb|DQ004737.1| Phaseolus lunatus catalase (CAT1) mRNA, partial cds 56 1e-04
139gb|AF069320.1|AF069320 Mesembryanthemum crystallinum root catala... 54 5e-04
140emb|Y13220.1|CRCATALAS Chlamydomonas reinhardtii mRNA for catalase 52 0.002
141gb|AY973614.1| Manihot esculenta catalase CAT2 mRNA, partial cds 52 0.002
142gb|AF016902.1|AF016902 Chlamydomonas reinhardtii catalase (CAT) ... 52 0.002
143emb|AJ849640.1| Secale cereale mRNA for catalase (cat1b gene) 50 0.008
144gb|AF443179.1|AF443179 Nicotiana tabacum catalase mRNA, partial cds 50 0.008
145gb|AF243519.1|AF243519 Helianthus annuus catalase 4 (CATA4) mRNA... 50 0.008
146gb|AF112368.1|AF112368 Lycopersicon esculentum catalase 2 mRNA, ... 50 0.008
147ref|XM_365841.1| Magnaporthe grisea 70-15 hypothetical protein (... 48 0.032
148gb|AY987854.1| Euphorbia characias catalase mRNA, complete cds 48 0.032
149gb|AF149283.1|AF149283 Phaseolus vulgaris catalase 1 (CAT1) mRNA... 48 0.032
150dbj|D86327.1| Triticum aestivum mRNA for catalase, complete cds 48 0.032
151gb|AF332973.2| Zantedeschia aethiopica catalase 2 (Cat2) mRNA, c... 46 0.13
152dbj|D21162.1|RCCCATALAB Ricinus communis gene for catalase CAT2,... 46 0.13
153gb|AY159321.1| Simian immunodeficiency virus isolate SIVdrl1FAO,... 44 0.50
154gb|U64156.1|HIVU64156 HIV-1 isolate MM351 from Australia, revers... 44 0.50
155gb|AC091333.6| Mus musculus chromosome 7, clone RP23-325M1, comp... 42 2.0
156gb|AC138549.3| Mus musculus BAC clone RP23-173C1 from chromosome... 42 2.0
157gb|AY802593.1| HIV-1 isolate CA10424 from USA reverse transcript... 42 2.0
158gb|AY802587.1| HIV-1 isolate CA4230 from USA reverse transcripta... 42 2.0
159gb|DQ024058.1| HIV-1 isolate mA142 from Martinique reverse trans... 42 2.0
160gb|AF260737.1|AF260737 Cucurbita pepo catalase mRNA, partial cds 42 2.0
161gb|AY170463.1| Morus alba catalase (CAT1) mRNA, partial cds 42 2.0
162gb|AY365745.1| HIV-1 isolate 106239 from Argentina pol protein (... 42 2.0
163dbj|D55647.1|CUCCAT3 Pumpkin mRNA for catalase (cat3), complete cds 42 2.0
164gb|DQ025189.1| HIV-1 isolate pE90394 from Puerto Rico reverse tr... 40 7.9
165gb|DQ025104.1| HIV-1 isolate pE85105 from Puerto Rico reverse tr... 40 7.9
166gb|CP000148.1| Geobacter metallireducens GS-15, complete genome 40 7.9
167ref|XM_507430.1| PREDICTED Oryza sativa (japonica cultivar-group... 40 7.9
168ref|XM_463869.1| Oryza sativa (japonica cultivar-group), mRNA 40 7.9
169ref|XM_506682.2| PREDICTED Oryza sativa (japonica cultivar-group... 40 7.9
170ref|XM_463870.1| Oryza sativa (japonica cultivar-group), mRNA 40 7.9
171gb|AY701391.1| HIV-1 isolate RW0550 from USA reverse transcripta... 40 7.9
172gb|AY388831.1| HIV-1 from USA isolate P00046 nonfunctional pol p... 40 7.9
173gb|AY388830.1| HIV-1 from USA isolate P00046 nonfunctional pol p... 40 7.9
174gb|AY388829.1| HIV-1 from USA isolate P00046 nonfunctional pol p... 40 7.9
175gb|AY362104.1| HIV-1 isolate 111925 from United Kingdom pol prot... 40 7.9
176gb|AY362101.1| HIV-1 isolate 134795 from United Kingdom pol prot... 40 7.9
177gb|AY362100.1| HIV-1 isolate 134284 from United Kingdom pol prot... 40 7.9
178gb|AY316083.1| HIV-1 from Spain isolate 67.00 pol protein (pol) ... 40 7.9
179gb|AY471869.1| HIV-1 isolate 206140 from USA pol protein (pol) g... 40 7.9
180gb|AY528204.1| HIV-1 isolate A0387 from USA pol protein (pol) ge... 40 7.9
181gb|AY528203.1| HIV-1 isolate A0386 from USA pol protein (pol) ge... 40 7.9
182gb|AY528202.1| HIV-1 isolate A0385 from USA pol protein (pol) ge... 40 7.9
183gb|AY527896.1| HIV-1 isolate A0079 from USA pol protein (pol) ge... 40 7.9
184gb|AY527895.1| HIV-1 isolate A0078 from USA pol protein (pol) ge... 40 7.9
185gb|AY149565.1| HIV-1 isolate DK.IM.123-f.RT reverse transcriptas... 40 7.9
186gb|AY275769.1| HIV-1 isolate 128PR_RT from Brazil pol protein (p... 40 7.9
187gb|AY815698.1| Schistosoma japonicum SJCHGC08499 protein mRNA, c... 40 7.9
188gb|AY334713.1| HIV-1 isolate 51581.f from Puerto Rico pol protei... 40 7.9
189gb|AY665713.1| Equine herpesvirus 1 strain Ab4, complete genome 40 7.9
190gb|AY714472.1| HIV-1 isolate F56706_RT from USA reverse transcri... 40 7.9
191gb|AY714470.1| HIV-1 from USA reverse transcriptase (Pol) gene, ... 40 7.9
192gb|AY714434.1| HIV-1 isolate F74928_RT from USA reverse transcri... 40 7.9
193gb|AY165273.1| HIV-1 isolate 01SE-22264 from Sweden gag-pol fusi... 40 7.9
194gb|AY338958.1| Cucumis sativus catalase-like (cat) mRNA, partial... 40 7.9
195gb|DQ157817.1| HIV-1 isolate PE.5895 from Peru protease (pol) ge... 40 7.9
196emb|AL606504.14| Human DNA sequence from clone RP11-358K2 on chr... 40 7.9
197gb|AF454535.1| HIV-1 isolate 66936VI from Czech Republic reverse... 40 7.9
198gb|AY213503.1| HIV-1 isolate BRP2177RT from Brazil reverse trans... 40 7.9
199gb|AY213272.1| HIV-1 isolate BRRJ917RT from Brazil reverse trans... 40 7.9
200gb|AY260398.1| HIV-1 isolate 213 from France reverse transcripta... 40 7.9
201gb|AY260380.1| HIV-1 isolate 195 from France reverse transcripta... 40 7.9
202gb|AY464052.1| Equine herpesvirus 1 strain V592, complete genome 40 7.9
203gb|AY075969.1| HIV-1 isolate 91USG191814pc2 from USA pol polypro... 40 7.9
204emb|X61626.1|OSCATAL O.sativa mRNA for catalase 40 7.9
205gb|DQ087444.1| Cerebratulus lacteus catalase mRNA, partial cds 40 7.9
206gb|AY877247.1| HIV-1 isolate BR02SP167 from Brazil reverse trans... 40 7.9
207gb|AY877199.1| HIV-1 isolate BR02SP183 from Brazil reverse trans... 40 7.9
208emb|AL596129.27| Mouse DNA sequence from clone RP23-294E23 on ch... 40 7.9
209emb|AL138642.1|ATF21F14 Arabidopsis thaliana DNA chromosome 3, B... 40 7.9
210gb|DQ059651.1| HIV-1 isolate TV811 from Canada reverse transcrip... 40 7.9
211emb|AJ419504.1|HIM419504 Human immunodeficiency virus type 1 par... 40 7.9
212emb|AJ419503.1|HIM419503 Human immunodeficiency virus type 1 par... 40 7.9
213gb|AY801196.1| HIV-1 isolate CA34461 from USA reverse transcript... 40 7.9
214gb|AY801175.1| HIV-1 isolate CA48112 from USA reverse transcript... 40 7.9
215gb|AY801006.1| HIV-1 isolate CA9339 from USA reverse transcripta... 40 7.9
216gb|AY800826.1| HIV-1 isolate CA38923 from USA reverse transcript... 40 7.9
217gb|AY800825.1| HIV-1 isolate CA23866 from USA reverse transcript... 40 7.9
218gb|AY802331.1| HIV-1 isolate CA34658 from USA reverse transcript... 40 7.9
219gb|AY802716.1| HIV-1 isolate CA34319 from USA reverse transcript... 40 7.9
220gb|AY802695.1| HIV-1 isolate CA38099 from USA reverse transcript... 40 7.9
221gb|AY802638.1| HIV-1 isolate CA9908 from USA reverse transcripta... 40 7.9
222gb|AY802637.1| HIV-1 isolate CA9945 from USA reverse transcripta... 40 7.9
223gb|AY802261.1| HIV-1 isolate CA42734 from USA reverse transcript... 40 7.9
224gb|AY802088.1| HIV-1 isolate CA41281 from USA reverse transcript... 40 7.9
225gb|AY802087.1| HIV-1 isolate CA23850 from USA reverse transcript... 40 7.9
226gb|AY802072.1| HIV-1 isolate CA48146 from USA reverse transcript... 40 7.9
227gb|AY802071.1| HIV-1 isolate CA37957 from USA reverse transcript... 40 7.9
228gb|AY802070.1| HIV-1 isolate CA37955 from USA reverse transcript... 40 7.9
229gb|AY802069.1| HIV-1 isolate CA48556 from USA reverse transcript... 40 7.9
230gb|AY802068.1| HIV-1 isolate CA34970 from USA reverse transcript... 40 7.9
231gb|AY802067.1| HIV-1 isolate CA23736 from USA reverse transcript... 40 7.9
232gb|AY802028.1| HIV-1 isolate CA48162 from USA reverse transcript... 40 7.9
233gb|AY802027.1| HIV-1 isolate CA38013 from USA reverse transcript... 40 7.9
234gb|AY802026.1| HIV-1 isolate CA34332 from USA reverse transcript... 40 7.9
235gb|AY802025.1| HIV-1 isolate CA21221 from USA reverse transcript... 40 7.9
236gb|AY801890.1| HIV-1 isolate CA37850 from USA reverse transcript... 40 7.9
237gb|AY801889.1| HIV-1 isolate CA35213 from USA reverse transcript... 40 7.9
238gb|AY801888.1| HIV-1 isolate CA20096 from USA reverse transcript... 40 7.9
239gb|AY801797.1| HIV-1 isolate CA19882 from USA reverse transcript... 40 7.9
240gb|AY801674.1| HIV-1 isolate CA21206 from USA reverse transcript... 40 7.9
241gb|AY800715.1| HIV-1 isolate CA1437 from USA reverse transcripta... 40 7.9
242gb|AF459197.1| HIV-1 isolate patient AD-110 from USA pol protein... 40 7.9
243gb|AF517515.1| HIV-1 from Italy patient 30, off-therapy group, p... 40 7.9
244gb|AF517488.1| HIV-1 from Italy patient 30, off-therapy group, p... 40 7.9
245gb|AF347403.1| HIV-1 isolate 986192 from Germany truncated pol p... 40 7.9
246gb|AF347367.1| HIV-1 isolate 984898 from Germany pol protein (po... 40 7.9
247gb|AF347305.1| HIV-1 isolate 974412 from Germany pol protein (po... 40 7.9
248gb|AF347298.1| HIV-1 isolate 970850 from Germany pol protein (po... 40 7.9
249gb|AF347279.1| HIV-1 isolate 5483 from Germany pol protein (pol)... 40 7.9
250gb|AF347208.1| HIV-1 isolate 2570 from Germany truncated pol pro... 40 7.9
251gb|AF347179.1| HIV-1 isolate 001936-2 from Germany pol protein (... 40 7.9
252gb|AC135319.28| Medicago truncatula clone mth2-6g4, complete seq... 40 7.9
253gb|AF357723.1| HIV1 isolate 680046h031998 from USA pol protein (... 40 7.9
254gb|AF357610.1| HIV1 isolate 280745l022598 from USA pol protein (... 40 7.9
255gb|DP000057.1| Dasypus novemcinctus target 117 genomic scaffold 40 7.9
256dbj|AB213691.1| Human immunodeficiency virus 1 genes for gag-pol... 40 7.9
257gb|AC106732.2| Homo sapiens chromosome 5 clone CTD-2275D24, comp... 40 7.9
258gb|AF480744.1| HIV-1 isolate VT02rt from Brazil reverse transcri... 40 7.9
259gb|DQ370267.1| HIV-1 isolate 308a-872 from Italy pol protein (po... 40 7.9
260gb|DQ370204.1| HIV-1 isolate 1406A-2845 from Italy pol protein (... 40 7.9
261gb|AF360825.1|AF360825 HIV-1 isolate LI75ARG from Argentina reve... 40 7.9
262gb|AF349318.1|AF349318 HIV-1 isolate RDI002 from USA pol polypro... 40 7.9
263gb|AF349317.1|AF349317 HIV-1 isolate RDI001 from USA pol polypro... 40 7.9
264gb|AY042732.1| HIV-1 isolate 36010-32 reverse transcriptase (pol... 40 7.9
265gb|AY042731.1| HIV-1 isolate 36010-0 reverse transcriptase (pol)... 40 7.9
266gb|AY032506.1| HIV-1 isolate NC6600-2000 from USA pol polyprotei... 40 7.9
267gb|AY032477.1| HIV-1 isolate NC6571-2000 from USA pol polyprotei... 40 7.9
268gb|AY032325.1| HIV-1 isolate NC6368-2000 from USA pol polyprotei... 40 7.9
269gb|AY031902.1| HIV-1 isolate NC5348-1999 from USA pol polyprotei... 40 7.9
270gb|AY031885.1| HIV-1 isolate NC5331-1999 from USA pol polyprotei... 40 7.9
271gb|AY031867.1| HIV-1 isolate NC5312-1999 from USA pol polyprotei... 40 7.9
272gb|AY031838.1| HIV-1 isolate NC5281-1999 from USA pol polyprotei... 40 7.9
273gb|AY031732.1| HIV-1 isolate NC5166-1999 from USA pol polyprotei... 40 7.9
274gb|AY031483.1| HIV-1 isolate NC4824-1999 from USA pol polyprotei... 40 7.9
275gb|AY031315.1| HIV-1 isolate NC4472-1999 from USA pol polyprotei... 40 7.9
276gb|AY031243.1| HIV-1 isolate NC4385-1999 from USA pol polyprotei... 40 7.9
277gb|AY031114.1| HIV-1 isolate NC4125-1999 from USA pol polyprotei... 40 7.9
278gb|AY031017.1| HIV-1 isolate NC4022-1999 from USA pol polyprotei... 40 7.9
279gb|AY030960.1| HIV-1 isolate NC3962-1998 from USA pol polyprotei... 40 7.9
280gb|AY030907.1| HIV-1 isolate NC3902-1999 from USA pol polyprotei... 40 7.9
281gb|AY030854.1| HIV-1 isolate NC2309-1999 from USA pol polyprotei... 40 7.9
282gb|AY030776.1| HIV-1 isolate NC1872-1998 from USA pol polyprotei... 40 7.9
283gb|AY030711.1| HIV-1 isolate NC1623-1998 from USA pol polyprotei... 40 7.9
284gb|AY030556.1| HIV-1 isolate NC1411-1998 from USA pol polyprotei... 40 7.9
285gb|DQ024658.1| HIV-1 isolate pC58692 from Puerto Rico reverse tr... 40 7.9
286gb|DQ024489.1| HIV-1 isolate pC49522 from Puerto Rico reverse tr... 40 7.9
287gb|DQ024345.1| HIV-1 isolate pB39592 from Puerto Rico reverse tr... 40 7.9
288gb|DQ024294.1| HIV-1 isolate mf057 from Martinique reverse trans... 40 7.9
289gb|DQ024283.1| HIV-1 isolate mf002 from Martinique reverse trans... 40 7.9
290gb|DQ024262.1| HIV-1 isolate me267 from Martinique reverse trans... 40 7.9
291gb|DQ024117.1| HIV-1 isolate mC141 from Martinique reverse trans... 40 7.9
292gb|DQ023887.1| HIV-1 isolate gD026 from Guadeloupe reverse trans... 40 7.9
293gb|DQ023807.1| HIV-1 isolate gB213 from Guadeloupe reverse trans... 40 7.9
294gb|DQ023795.1| HIV-1 isolate gB146 from Guadeloupe reverse trans... 40 7.9
295gb|AY756840.1| HIV-1 isolate 3086 from Malawi pol protein (pol) ... 40 7.9
296gb|AF330773.1|AF330773 HIV-1 patient 13 reverse transcriptase (p... 40 7.9
297emb|AJ577871.1|HIM577871 Human immunodeficiency virus 1 partial ... 40 7.9
298dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.9
299gb|AF266535.1|AF266535 HIV-1 clone L092RT from Italy reverse tra... 40 7.9
300gb|AF301318.1|AF301318 HIV-1 clone AA1295 from USA reverse trans... 40 7.9
301gb|AF301298.1|AF301298 HIV-1 clone AA0409 from USA reverse trans... 40 7.9
302gb|AY901796.1| HIV-1 isolate 1211 protease (pol) gene, partial cds 40 7.9
303gb|AY995449.1| HIV-1 isolate 2209-1044A from Italy pol protein (... 40 7.9
304gb|AC073178.9|AC073178 Arabidopsis thaliana chromosome 1 BAC F10... 40 7.9
305gb|AC018364.5|AC018364 Arabidopsis thaliana chromosome 1 BAC F23... 40 7.9
306gb|AF514256.1| HIV-1 isolate 7858-090700 from USA reverse transc... 40 7.9
307gb|AF514159.1| HIV-1 isolate 3902-012500 from USA reverse transc... 40 7.9
308gb|AF514150.1| HIV-1 isolate 2309-111699 from USA reverse transc... 40 7.9
309gb|AF514009.1| HIV-1 isolate 796-011999 from USA reverse transcr... 40 7.9
310gb|AF456533.1| HIV-1 isolate AR15800 from Argentina pol protein ... 40 7.9
311gb|AY003331.1| HIV-1 isolate 066F04 from USA pol protein (pol) g... 40 7.9
312gb|AY000467.1| HIV-1 isolate 038G10 from USA pol protein (pol) g... 40 7.9
313gb|AY000466.1| HIV-1 isolate 072E07 from USA pol protein (pol) g... 40 7.9
314gb|AY000465.1| HIV-1 isolate 088B02 from USA pol protein (pol) g... 40 7.9
315gb|AY000464.1| HIV-1 isolate 062D07 from USA pol protein (pol) g... 40 7.9
316gb|AY000463.1| HIV-1 isolate 062D03 from USA pol protein (pol) g... 40 7.9
317gb|AY000462.1| HIV-1 isolate 038G05 from USA pol protein (pol) g... 40 7.9
318gb|AY000461.1| HIV-1 isolate 062D02 from USA pol protein (pol) g... 40 7.9
319gb|AY000459.1| HIV-1 isolate 072E04 from USA pol protein (pol) g... 40 7.9
320gb|AY000458.1| HIV-1 isolate 088A09 from USA pol protein (pol) g... 40 7.9
321gb|AY000456.1| HIV-1 isolate 072E02 from USA pol protein (pol) g... 40 7.9
322gb|AY000455.1| HIV-1 isolate 079C03 from USA pol protein (pol) g... 40 7.9
323gb|AY000448.1| HIV-1 isolate 079C01 from USA pol protein (pol) g... 40 7.9
324gb|AY000441.1| HIV-1 isolate 088B06 from USA pol protein (pol) g... 40 7.9
325gb|AY000439.1| HIV-1 isolate 062D04 from USA pol protein (pol) g... 40 7.9
326gb|AY000438.1| HIV-1 isolate 088A03 from USA pol protein (pol) g... 40 7.9
327gb|AY000435.1| HIV-1 isolate 088B09 from USA pol protein (pol) g... 40 7.9
328gb|AY000434.1| HIV-1 isolate 088B08 from USA pol protein (pol) g... 40 7.9
329gb|AY000433.1| HIV-1 isolate 088B05 from USA pol protein (pol) g... 40 7.9
330gb|AY000432.1| HIV-1 isolate 062D05 from USA pol protein (pol) g... 40 7.9
331gb|AY000429.1| HIV-1 isolate 038G12 from USA pol protein (pol) g... 40 7.9
332gb|AY000428.1| HIV-1 isolate 038G11 from USA pol protein (pol) g... 40 7.9
333gb|AY000427.1| HIV-1 isolate 038G08 from USA pol protein (pol) g... 40 7.9
334gb|AY000426.1| HIV-1 isolate 038G04 from USA pol protein (pol) g... 40 7.9
335gb|AY000425.1| HIV-1 isolate 038G03 from USA pol protein (pol) g... 40 7.9
336gb|AY000424.1| HIV-1 isolate 072E05 from USA pol protein (pol) g... 40 7.9
337gb|AY000423.1| HIV-1 isolate 062D08 from USA pol protein (pol) g... 40 7.9
338gb|AY000422.1| HIV-1 isolate 062D01 from USA pol protein (pol) g... 40 7.9
339gb|AY000421.1| HIV-1 isolate 038G06 from USA pol protein (pol) g... 40 7.9
340gb|AY102485.1| HIV-1 isolate SU502 from Sudan pol protein (pol) ... 40 7.9
341gb|AY153945.1| HIV-1 isolate G240 from Thailand reverse transcri... 40 7.9
342gb|AY153921.1| HIV-1 isolate G212 from Thailand reverse transcri... 40 7.9
343gb|AF090531.1|AF090531 HIV-1 isolate 260Pt8W8C from USA reverse ... 40 7.9
344gb|AF090530.1|AF090530 HIV-1 isolate 260Pt8BC from USA reverse t... 40 7.9
345gb|AF090512.1|AF090512 HIV-1 isolate 260Pt29W8P from USA reverse... 40 7.9
346gb|AF090511.1|AF090511 HIV-1 isolate 260Pt29BC from USA reverse ... 40 7.9
347dbj|AP004121.3| Oryza sativa (japonica cultivar-group) genomic D... 40 7.9
348dbj|AP004867.2| Oryza sativa (japonica cultivar-group) genomic D... 40 7.9
349gb|AY441935.1| HIV-1 isolate SP36_00 from Brazil nonfunctional r... 40 7.9
350gb|AY670050.1| HIV-1 isolate 02cl5.24 from United Kingdom pol pr... 40 7.9
351gb|AY670049.1| HIV-1 isolate 02cl5.23 from United Kingdom pol pr... 40 7.9
352gb|AY670048.1| HIV-1 isolate 02cl5.22 from United Kingdom pol pr... 40 7.9
353gb|AY670046.1| HIV-1 isolate 02cl5.20 from United Kingdom pol pr... 40 7.9
354gb|AY669980.1| HIV-1 isolate 00cl3.9 from United Kingdom pol pro... 40 7.9
355gb|AY669966.1| HIV-1 isolate 02cl2.57 from United Kingdom pol pr... 40 7.9
356gb|AY669965.1| HIV-1 isolate 02cl2.56 from United Kingdom pol pr... 40 7.9
357gb|AY669964.1| HIV-1 isolate 02cl2.55 from United Kingdom pol pr... 40 7.9
358gb|AY669959.1| HIV-1 isolate 02cl2.50 from United Kingdom pol pr... 40 7.9
359gb|AY669914.1| HIV-1 isolate 00cl2.5 from United Kingdom pol pro... 40 7.9
360emb|AJ276532.1|HIM276532 Human immunodeficiency virus type 1 par... 40 7.9
361emb|AJ425908.1|HIM425908 Human immunodeficiency virus type 1 par... 40 7.9
362emb|X80505.1|ASEXECD A.salmonicida genes exeC and exeD 40 7.9
363emb|AJ332571.1|HSA332571 Homo sapiens genomic sequence surroundi... 40 7.9
364dbj|AK099923.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 7.9
365dbj|AK099231.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 7.9
366dbj|AK071061.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 7.9
367dbj|AK068433.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 7.9
368dbj|AK065094.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 7.9
369gb|AY906963.1| HIV-1 isolate Dj336 from Djibouti nonfunctional p... 40 7.9
370gb|AY771592.1| HIV-1 isolate BREPM275 from Brazil, complete genome 40 7.9
371gb|AY771583.1| HIV-1 isolate BREPMPOL275 from Brazil pol protein... 40 7.9
372gb|AY771531.1| HIV-1 isolate BREPMPOL207 from Brazil pol protein... 40 7.9
373gb|AY771453.1| HIV-1 isolate BREPMPOL101 from Brazil pol protein... 40 7.9
374emb|AJ634002.1| Schedonorus arundinaceus mRNA for catalase (cat1... 40 7.9
375gb|AY801640.1| HIV-1 isolate CA17396 from USA reverse transcript... 40 7.9
376gb|AY802003.1| HIV-1 isolate CA21154 from USA reverse transcript... 40 7.9
377gb|AY802195.1| HIV-1 isolate CA24527 from USA reverse transcript... 40 7.9
378gb|AY802196.1| HIV-1 isolate CA34911 from USA reverse transcript... 40 7.9
379gb|AY855793.1| HIV-1 isolate 1355-492A from Italy pol protein (p... 40 7.9
380gb|AY855745.1| HIV-1 isolate 555A from Italy pol protein (pol) g... 40 7.9
381gb|AY855624.1| HIV-1 isolate 205A from Italy pol protein (pol) g... 40 7.9
382gb|AY855618.1| HIV-1 isolate 194A from Italy pol protein (pol) g... 40 7.9
383gb|AY365977.1| HIV-1 isolate 120063 from Argentina pol protein (... 40 7.9
384gb|AY365716.1| HIV-1 isolate 105048 from Argentina pol protein (... 40 7.9
385gb|AY365715.1| HIV-1 isolate 105044 from Argentina pol protein (... 40 7.9
386gb|AY365536.1| HIV-1 isolate 96926 from Argentina pol protein (p... 40 7.9
387gb|U64125.1|HIVU64125 HIV-1 isolate DH365 from Australia, revers... 40 7.9
388gb|U64124.1|HIVU64124 HIV-1 isolate DH321 from Australia, revers... 40 7.9
389gb|U64123.1|HIVU64123 HIV-1 isolate DH289 from Australia, revers... 40 7.9
390gb|U64122.1|HIVU64122 HIV-1 isolate DH200 from Australia, revers... 40 7.9
391gb|DQ089181.1| Capra hircus voucher YP 2860 control region, part... 40 7.9
392gb|DQ089160.1| Capra hircus voucher YP 2790 control region, part... 40 7.9
393gb|AF538304.1| HIV-1 clone C24 from Australia gag protein (gag) ... 40 7.9
394dbj|AB037061.1| Human immunodeficiency virus type 1 RT gene for ... 40 7.9
395dbj|D29966.1|RICCA Rice CatA gene for catalase, complete cds 40 7.9

>emb|X94352.1|TACATAGEN T.aestivum mRNA for catalase
          Length = 1869

 Score = 1114 bits (562), Expect = 0.0
 Identities = 575/578 (99%), Gaps = 1/578 (0%)
 Strand = Plus / Plus

                                                                        
Query: 2    cactcaactataggcacatggnacggttttggtgtcaacacctacaccttaatcagcagg 61
            |||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 704  cactcaactacaggcacatgg-acggttttggtgtcaacacctacaccttaatcagcagg 762

                                                                        
Query: 62   gatggaaaggctcacctggttaagttccattggaaacctacatgtggtgtgaagtgcctc 121
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 763  gatggaaaggctcacctggttaagttccattggaaacctacatgtggtgtgaagtgcctc 822

                                                                        
Query: 122  ttggatgatgaagccgttactgttggaggcacctgccacacccatgccacaaaggacttg 181
            |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 823  ttggatgatgaagctgttactgttggaggcacctgccacacccatgccacaaaggacttg 882

                                                                        
Query: 182  actgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgat 241
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 883  actgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgat 942

                                                                        
Query: 242  gctgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagag 301
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 943  gctgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagag 1002

                                                                        
Query: 302  gacatcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttc 361
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1003 gacatcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttc 1062

                                                                        
Query: 362  ttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtccctggaatccactac 421
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1063 ttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtccctggaatccactac 1122

                                                                        
Query: 422  tctgatgataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgt 481
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1123 tctgatgataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgt 1182

                                                                        
Query: 482  cttggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaac 541
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1183 cttggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaac 1242

                                                  
Query: 542  catcatgatggcttaatgaatttcattcacagggatga 579
            ||||||||||||||||||||||||||||||||||||||
Sbjct: 1243 catcatgatggcttaatgaatttcattcacagggatga 1280



to top

>gb|AF021938.1|AF021938 Hordeum vulgare catalase 1 (CAT1) gene, partial cds
          Length = 2130

 Score = 1114 bits (562), Expect = 0.0
 Identities = 575/578 (99%), Gaps = 1/578 (0%)
 Strand = Plus / Plus

                                                                        
Query: 2    cactcaactataggcacatggnacggttttggtgtcaacacctacaccttaatcagcagg 61
            |||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 686  cactcaactacaggcacatgg-acggttttggtgtcaacacctacaccttaatcagcagg 744

                                                                        
Query: 62   gatggaaaggctcacctggttaagttccattggaaacctacatgtggtgtgaagtgcctc 121
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 745  gatggaaaggctcacctggttaagttccattggaaacctacatgtggtgtgaagtgcctc 804

                                                                        
Query: 122  ttggatgatgaagccgttactgttggaggcacctgccacacccatgccacaaaggacttg 181
            |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 805  ttggatgatgaagctgttactgttggaggcacctgccacacccatgccacaaaggacttg 864

                                                                        
Query: 182  actgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgat 241
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 865  actgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgat 924

                                                                        
Query: 242  gctgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagag 301
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 925  gctgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagag 984

                                                                        
Query: 302  gacatcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttc 361
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 985  gacatcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttc 1044

                                                                        
Query: 362  ttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtccctggaatccactac 421
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1045 ttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtccctggaatccactac 1104

                                                                        
Query: 422  tctgatgataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgt 481
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1105 tctgatgataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgt 1164

                                                                        
Query: 482  cttggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaac 541
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1165 cttggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaac 1224

                                                  
Query: 542  catcatgatggcttaatgaatttcattcacagggatga 579
            ||||||||||||||||||||||||||||||||||||||
Sbjct: 1225 catcatgatggcttaatgaatttcattcacagggatga 1262



to top

>gb|U20777.1|HVU20777 Hordeum vulgare catalase (Cat1) mRNA, complete cds
          Length = 1879

 Score = 1114 bits (562), Expect = 0.0
 Identities = 575/578 (99%), Gaps = 1/578 (0%)
 Strand = Plus / Plus

                                                                        
Query: 2    cactcaactataggcacatggnacggttttggtgtcaacacctacaccttaatcagcagg 61
            |||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 663  cactcaactacaggcacatgg-acggttttggtgtcaacacctacaccttaatcagcagg 721

                                                                        
Query: 62   gatggaaaggctcacctggttaagttccattggaaacctacatgtggtgtgaagtgcctc 121
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 722  gatggaaaggctcacctggttaagttccattggaaacctacatgtggtgtgaagtgcctc 781

                                                                        
Query: 122  ttggatgatgaagccgttactgttggaggcacctgccacacccatgccacaaaggacttg 181
            |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 782  ttggatgatgaagctgttactgttggaggcacctgccacacccatgccacaaaggacttg 841

                                                                        
Query: 182  actgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgat 241
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 842  actgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgat 901

                                                                        
Query: 242  gctgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagag 301
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 902  gctgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagag 961

                                                                        
Query: 302  gacatcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttc 361
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 962  gacatcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttc 1021

                                                                        
Query: 362  ttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtccctggaatccactac 421
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1022 ttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtccctggaatccactac 1081

                                                                        
Query: 422  tctgatgataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgt 481
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1082 tctgatgataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgt 1141

                                                                        
Query: 482  cttggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaac 541
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1142 cttggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaac 1201

                                                  
Query: 542  catcatgatggcttaatgaatttcattcacagggatga 579
            ||||||||||||||||||||||||||||||||||||||
Sbjct: 1202 catcatgatggcttaatgaatttcattcacagggatga 1239



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  646 bits (326), Expect = 0.0
 Identities = 516/578 (89%), Gaps = 1/578 (0%)
 Strand = Plus / Plus

                                                                            
Query: 2        cactcaactataggcacatggnacggttttggtgtcaacacctacaccttaatcagcagg 61
                |||||||||| |||||||||| | |||||||||||||||||||||||| ||||||  | |
Sbjct: 30430452 cactcaactacaggcacatgg-agggttttggtgtcaacacctacaccctaatcaataag 30430510

                                                                            
Query: 62       gatggaaaggctcacctggttaagttccattggaaacctacatgtggtgtgaagtgcctc 121
                ||||||||| ||||||| || || ||||| ||||| ||||| |||||||| || ||||| 
Sbjct: 30430511 gatggaaagcctcaccttgtcaaattccactggaagcctacctgtggtgtcaaatgcctg 30430570

                                                                            
Query: 122      ttggatgatgaagccgttactgttggaggcacctgccacacccatgccacaaaggacttg 181
                |||||||||||||| || |||||||| ||||||||||||| ||||||||| |||||||||
Sbjct: 30430571 ttggatgatgaagctgtgactgttggcggcacctgccacagccatgccacgaaggacttg 30430630

                                                                            
Query: 182      actgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgat 241
                ||||||||||||||||| |||||||||||||| |||||||||| ||||||||| ||||||
Sbjct: 30430631 actgattctattgcagcagggaattacccagagtggaagctttacatccagactattgat 30430690

                                                                            
Query: 242      gctgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagag 301
                 ||||||| ||||| ||||||||||| || |||||||||||||||||||| |||||||||
Sbjct: 30430691 cctgatcatgaggacagatttgacttcgatcctcttgatgtcaccaagacatggccagag 30430750

                                                                            
Query: 302      gacatcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttc 361
                || |||||||| ||||| ||||||||||||||||| |||||||| |||||||| || |||
Sbjct: 30430751 gatatcatccccctgcagccagttggacggatggtcctgaacaaaaacattgataacttc 30430810

                                                                            
Query: 362      ttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtccctggaatccactac 421
                || || |||||||||||||||||||||||||||||  | | ||||||||||||||| |||
Sbjct: 30430811 tttgcagaaaatgaacagcttgctttctgcccagcgataattgtccctggaatccattac 30430870

                                                                            
Query: 422      tctgatgataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgt 481
                |||||||||||||||||||||||||| || ||||| ||||||||||||||||||||||||
Sbjct: 30430871 tctgatgataagctgctccagacaagaattttctcctatgctgatacccaaaggcaccgt 30430930

                                                                            
Query: 482      cttggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaac 541
                ||||| |||||||| |||||||| || |||||||| || ||||||||  |||||||||||
Sbjct: 30430931 cttggcccaaactatttgatgcttcctgtgaatgcaccaaaatgtgcataccacaacaac 30430990

                                                      
Query: 542      catcatgatggcttaatgaatttcattcacagggatga 579
                || || |||||||  ||||||||||| |||||||||||
Sbjct: 30430991 caccacgatggctccatgaatttcatgcacagggatga 30431028



to top

>dbj|AP004685.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0017G10
          Length = 166700

 Score =  646 bits (326), Expect = 0.0
 Identities = 516/578 (89%), Gaps = 1/578 (0%)
 Strand = Plus / Plus

                                                                         
Query: 2     cactcaactataggcacatggnacggttttggtgtcaacacctacaccttaatcagcagg 61
             |||||||||| |||||||||| | |||||||||||||||||||||||| ||||||  | |
Sbjct: 67813 cactcaactacaggcacatgg-agggttttggtgtcaacacctacaccctaatcaataag 67871

                                                                         
Query: 62    gatggaaaggctcacctggttaagttccattggaaacctacatgtggtgtgaagtgcctc 121
             ||||||||| ||||||| || || ||||| ||||| ||||| |||||||| || ||||| 
Sbjct: 67872 gatggaaagcctcaccttgtcaaattccactggaagcctacctgtggtgtcaaatgcctg 67931

                                                                         
Query: 122   ttggatgatgaagccgttactgttggaggcacctgccacacccatgccacaaaggacttg 181
             |||||||||||||| || |||||||| ||||||||||||| ||||||||| |||||||||
Sbjct: 67932 ttggatgatgaagctgtgactgttggcggcacctgccacagccatgccacgaaggacttg 67991

                                                                         
Query: 182   actgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgat 241
             ||||||||||||||||| |||||||||||||| |||||||||| ||||||||| ||||||
Sbjct: 67992 actgattctattgcagcagggaattacccagagtggaagctttacatccagactattgat 68051

                                                                         
Query: 242   gctgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagag 301
              ||||||| ||||| ||||||||||| || |||||||||||||||||||| |||||||||
Sbjct: 68052 cctgatcatgaggacagatttgacttcgatcctcttgatgtcaccaagacatggccagag 68111

                                                                         
Query: 302   gacatcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttc 361
             || |||||||| ||||| ||||||||||||||||| |||||||| |||||||| || |||
Sbjct: 68112 gatatcatccccctgcagccagttggacggatggtcctgaacaaaaacattgataacttc 68171

                                                                         
Query: 362   ttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtccctggaatccactac 421
             || || |||||||||||||||||||||||||||||  | | ||||||||||||||| |||
Sbjct: 68172 tttgcagaaaatgaacagcttgctttctgcccagcgataattgtccctggaatccattac 68231

                                                                         
Query: 422   tctgatgataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgt 481
             |||||||||||||||||||||||||| || ||||| ||||||||||||||||||||||||
Sbjct: 68232 tctgatgataagctgctccagacaagaattttctcctatgctgatacccaaaggcaccgt 68291

                                                                         
Query: 482   cttggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaac 541
             ||||| |||||||| |||||||| || |||||||| || ||||||||  |||||||||||
Sbjct: 68292 cttggcccaaactatttgatgcttcctgtgaatgcaccaaaatgtgcataccacaacaac 68351

                                                   
Query: 542   catcatgatggcttaatgaatttcattcacagggatga 579
             || || |||||||  ||||||||||| |||||||||||
Sbjct: 68352 caccacgatggctccatgaatttcatgcacagggatga 68389



to top

>dbj|AK100019.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013145C05, full
            insert sequence
          Length = 1877

 Score =  646 bits (326), Expect = 0.0
 Identities = 516/578 (89%), Gaps = 1/578 (0%)
 Strand = Plus / Plus

                                                                        
Query: 2    cactcaactataggcacatggnacggttttggtgtcaacacctacaccttaatcagcagg 61
            |||||||||| |||||||||| | |||||||||||||||||||||||| ||||||  | |
Sbjct: 780  cactcaactacaggcacatgg-agggttttggtgtcaacacctacaccctaatcaataag 838

                                                                        
Query: 62   gatggaaaggctcacctggttaagttccattggaaacctacatgtggtgtgaagtgcctc 121
            ||||||||| ||||||| || || ||||| ||||| ||||| |||||||| || ||||| 
Sbjct: 839  gatggaaagcctcaccttgtcaaattccactggaagcctacctgtggtgtcaaatgcctg 898

                                                                        
Query: 122  ttggatgatgaagccgttactgttggaggcacctgccacacccatgccacaaaggacttg 181
            |||||||||||||| || |||||||| ||||||||||||| ||||||||| |||||||||
Sbjct: 899  ttggatgatgaagctgtgactgttggcggcacctgccacagccatgccacgaaggacttg 958

                                                                        
Query: 182  actgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgat 241
            ||||||||||||||||| |||||||||||||| |||||||||| ||||||||| ||||||
Sbjct: 959  actgattctattgcagcagggaattacccagagtggaagctttacatccagactattgat 1018

                                                                        
Query: 242  gctgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagag 301
             ||||||| ||||| ||||||||||| || |||||||||||||||||||| |||||||||
Sbjct: 1019 cctgatcatgaggacagatttgacttcgatcctcttgatgtcaccaagacatggccagag 1078

                                                                        
Query: 302  gacatcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttc 361
            || |||||||| ||||| ||||||||||||||||| |||||||| |||||||| || |||
Sbjct: 1079 gatatcatccccctgcagccagttggacggatggtcctgaacaaaaacattgataacttc 1138

                                                                        
Query: 362  ttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtccctggaatccactac 421
            || || |||||||||||||||||||||||||||||  | | ||||||||||||||| |||
Sbjct: 1139 tttgcagaaaatgaacagcttgctttctgcccagcgataattgtccctggaatccattac 1198

                                                                        
Query: 422  tctgatgataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgt 481
            |||||||||||||||||||||||||| || ||||| ||||||||||||||||||||||||
Sbjct: 1199 tctgatgataagctgctccagacaagaattttctcctatgctgatacccaaaggcaccgt 1258

                                                                        
Query: 482  cttggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaac 541
            ||||| |||||||| |||||||| || |||||||| || ||||||||  |||||||||||
Sbjct: 1259 cttggcccaaactatttgatgcttcctgtgaatgcaccaaaatgtgcataccacaacaac 1318

                                                  
Query: 542  catcatgatggcttaatgaatttcattcacagggatga 579
            || || |||||||  ||||||||||| |||||||||||
Sbjct: 1319 caccacgatggctccatgaatttcatgcacagggatga 1356



to top

>dbj|AK069446.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023019H14, full
            insert sequence
          Length = 1898

 Score =  646 bits (326), Expect = 0.0
 Identities = 516/578 (89%), Gaps = 1/578 (0%)
 Strand = Plus / Plus

                                                                        
Query: 2    cactcaactataggcacatggnacggttttggtgtcaacacctacaccttaatcagcagg 61
            |||||||||| |||||||||| | |||||||||||||||||||||||| ||||||  | |
Sbjct: 692  cactcaactacaggcacatgg-agggttttggtgtcaacacctacaccctaatcaataag 750

                                                                        
Query: 62   gatggaaaggctcacctggttaagttccattggaaacctacatgtggtgtgaagtgcctc 121
            ||||||||| ||||||| || || ||||| ||||| ||||| |||||||| || ||||| 
Sbjct: 751  gatggaaagcctcaccttgtcaaattccactggaagcctacctgtggtgtcaaatgcctg 810

                                                                        
Query: 122  ttggatgatgaagccgttactgttggaggcacctgccacacccatgccacaaaggacttg 181
            |||||||||||||| || |||||||| ||||||||||||| ||||||||| |||||||||
Sbjct: 811  ttggatgatgaagctgtgactgttggcggcacctgccacagccatgccacgaaggacttg 870

                                                                        
Query: 182  actgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgat 241
            ||||||||||||||||| |||||||||||||| |||||||||| ||||||||| ||||||
Sbjct: 871  actgattctattgcagcagggaattacccagagtggaagctttacatccagactattgat 930

                                                                        
Query: 242  gctgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagag 301
             ||||||| ||||| ||||||||||| || |||||||||||||||||||| |||||||||
Sbjct: 931  cctgatcatgaggacagatttgacttcgatcctcttgatgtcaccaagacatggccagag 990

                                                                        
Query: 302  gacatcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttc 361
            || |||||||| ||||| ||||||||||||||||| |||||||| |||||||| || |||
Sbjct: 991  gatatcatccccctgcagccagttggacggatggtcctgaacaaaaacattgataacttc 1050

                                                                        
Query: 362  ttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtccctggaatccactac 421
            || || |||||||||||||||||||||||||||||  | | ||||||||||||||| |||
Sbjct: 1051 tttgcagaaaatgaacagcttgctttctgcccagcgataattgtccctggaatccattac 1110

                                                                        
Query: 422  tctgatgataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgt 481
            |||||||||||||||||||||||||| || ||||| ||||||||||||||||||||||||
Sbjct: 1111 tctgatgataagctgctccagacaagaattttctcctatgctgatacccaaaggcaccgt 1170

                                                                        
Query: 482  cttggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaac 541
            ||||| |||||||| |||||||| || |||||||| || ||||||||  |||||||||||
Sbjct: 1171 cttggcccaaactatttgatgcttcctgtgaatgcaccaaaatgtgcataccacaacaac 1230

                                                  
Query: 542  catcatgatggcttaatgaatttcattcacagggatga 579
            || || |||||||  ||||||||||| |||||||||||
Sbjct: 1231 caccacgatggctccatgaatttcatgcacagggatga 1268



to top

>dbj|D26484.1|RICPOSCATB Oryza sativa (japonica cultivar-group) mRNA for catalase, complete
            cds
          Length = 1832

 Score =  646 bits (326), Expect = 0.0
 Identities = 516/578 (89%), Gaps = 1/578 (0%)
 Strand = Plus / Plus

                                                                        
Query: 2    cactcaactataggcacatggnacggttttggtgtcaacacctacaccttaatcagcagg 61
            |||||||||| |||||||||| | |||||||||||||||||||||||| ||||||  | |
Sbjct: 717  cactcaactacaggcacatgg-agggttttggtgtcaacacctacaccctaatcaataag 775

                                                                        
Query: 62   gatggaaaggctcacctggttaagttccattggaaacctacatgtggtgtgaagtgcctc 121
            ||||||||| ||||||| || || ||||| ||||| ||||| |||||||| || ||||| 
Sbjct: 776  gatggaaagcctcaccttgtcaaattccactggaagcctacctgtggtgtcaaatgcctg 835

                                                                        
Query: 122  ttggatgatgaagccgttactgttggaggcacctgccacacccatgccacaaaggacttg 181
            |||||||||||||| || |||||||| ||||||||||||| ||||||||| |||||||||
Sbjct: 836  ttggatgatgaagctgtgactgttggcggcacctgccacagccatgccacgaaggacttg 895

                                                                        
Query: 182  actgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgat 241
            ||||||||||||||||| |||||||||||||| |||||||||| ||||||||| ||||||
Sbjct: 896  actgattctattgcagcagggaattacccagagtggaagctttacatccagactattgat 955

                                                                        
Query: 242  gctgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagag 301
             ||||||| ||||| ||||||||||| || |||||||||||||||||||| |||||||||
Sbjct: 956  cctgatcatgaggacagatttgacttcgatcctcttgatgtcaccaagacatggccagag 1015

                                                                        
Query: 302  gacatcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttc 361
            || |||||||| ||||| ||||||||||||||||| |||||||| |||||||| || |||
Sbjct: 1016 gatatcatccccctgcagccagttggacggatggtcctgaacaaaaacattgataacttc 1075

                                                                        
Query: 362  ttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtccctggaatccactac 421
            || || |||||||||||||||||||||||||||||  | | ||||||||||||||| |||
Sbjct: 1076 tttgcagaaaatgaacagcttgctttctgcccagcgataattgtccctggaatccattac 1135

                                                                        
Query: 422  tctgatgataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgt 481
            |||||||||||||||||||||||||| || ||||| ||||||||||||||||||||||||
Sbjct: 1136 tctgatgataagctgctccagacaagaattttctcctatgctgatacccaaaggcaccgt 1195

                                                                        
Query: 482  cttggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaac 541
            ||||| |||||||| |||||||| || |||||||| || ||||||||  |||||||||||
Sbjct: 1196 cttggcccaaactatttgatgcttcctgtgaatgcaccaaaatgtgcataccacaacaac 1255

                                                  
Query: 542  catcatgatggcttaatgaatttcattcacagggatga 579
            || || |||||||  ||||||||||| |||||||||||
Sbjct: 1256 caccacgatggctccatgaatttcatgcacagggatga 1293



to top

>gb|DQ078758.1| Oryza sativa (indica cultivar-group) catalase mRNA, complete cds
          Length = 1479

 Score =  638 bits (322), Expect = e-180
 Identities = 515/578 (89%), Gaps = 1/578 (0%)
 Strand = Plus / Plus

                                                                        
Query: 2    cactcaactataggcacatggnacggttttggtgtcaacacctacaccttaatcagcagg 61
            |||||||||| |||||||||| | |||||||||||||||||||||||| ||||||  | |
Sbjct: 587  cactcaactacaggcacatgg-agggttttggtgtcaacacctacaccctaatcaataag 645

                                                                        
Query: 62   gatggaaaggctcacctggttaagttccattggaaacctacatgtggtgtgaagtgcctc 121
            ||||||||| ||||||| || || ||||| ||||| ||||| |||||||| || ||||| 
Sbjct: 646  gatggaaagcctcaccttgtcaaattccactggaagcctacctgtggtgtcaaatgcctg 705

                                                                        
Query: 122  ttggatgatgaagccgttactgttggaggcacctgccacacccatgccacaaaggacttg 181
            |||||||||||||| || |||||||| ||||||||||||| ||||||||| |||||||||
Sbjct: 706  ttggatgatgaagctgtgactgttggcggcacctgccacagccatgccacgaaggacttg 765

                                                                        
Query: 182  actgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgat 241
            |||||||||||||||||  ||||||||||||| |||||||||| ||||||||| ||||||
Sbjct: 766  actgattctattgcagcaaggaattacccagagtggaagctttacatccagactattgat 825

                                                                        
Query: 242  gctgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagag 301
             ||||||| ||||| ||||||||||| || |||||||||||||||||||| |||||||||
Sbjct: 826  cctgatcatgaggacagatttgacttcgatcctcttgatgtcaccaagacatggccagag 885

                                                                        
Query: 302  gacatcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttc 361
            || |||||||| ||||| ||||||||||||||||| |||||||| |||||||| || |||
Sbjct: 886  gatatcatccccctgcagccagttggacggatggtcctgaacaaaaacattgataacttc 945

                                                                        
Query: 362  ttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtccctggaatccactac 421
            || || |||||||||||||||||||||||||||||  | | ||||||||||||||| |||
Sbjct: 946  tttgcagaaaatgaacagcttgctttctgcccagcgataattgtccctggaatccattac 1005

                                                                        
Query: 422  tctgatgataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgt 481
            |||||||||||||||||||||||||| || ||||| ||||||||||||||||||||||||
Sbjct: 1006 tctgatgataagctgctccagacaagaattttctcctatgctgatacccaaaggcaccgt 1065

                                                                        
Query: 482  cttggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaac 541
            ||||| |||||||| |||||||| || |||||||| || ||||||||  |||||||||||
Sbjct: 1066 cttggcccaaactatttgatgcttcctgtgaatgcaccaaaatgtgcataccacaacaac 1125

                                                  
Query: 542  catcatgatggcttaatgaatttcattcacagggatga 579
            || || |||||||  ||||||||||| |||||||||||
Sbjct: 1126 caccacgatggctccatgaatttcatgcacagggatga 1163



to top

>dbj|D64013.1| Oryza sativa (japonica cultivar-group) CatB gene for catalase,
            complete cds
          Length = 4985

 Score =  638 bits (322), Expect = e-180
 Identities = 515/578 (89%), Gaps = 1/578 (0%)
 Strand = Plus / Plus

                                                                        
Query: 2    cactcaactataggcacatggnacggttttggtgtcaacacctacaccttaatcagcagg 61
            |||||||| | |||||||||| | |||||||||||||||||||||||| ||||||  | |
Sbjct: 3166 cactcaaccacaggcacatgg-agggttttggtgtcaacacctacaccctaatcaataag 3224

                                                                        
Query: 62   gatggaaaggctcacctggttaagttccattggaaacctacatgtggtgtgaagtgcctc 121
            ||||||||| ||||||| || || ||||| ||||| ||||| |||||||| || ||||| 
Sbjct: 3225 gatggaaagcctcaccttgtcaaattccactggaagcctacctgtggtgtcaaatgcctg 3284

                                                                        
Query: 122  ttggatgatgaagccgttactgttggaggcacctgccacacccatgccacaaaggacttg 181
            |||||||||||||| || |||||||| ||||||||||||| ||||||||| |||||||||
Sbjct: 3285 ttggatgatgaagctgtgactgttggcggcacctgccacagccatgccacgaaggacttg 3344

                                                                        
Query: 182  actgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgat 241
            ||||||||||||||||| |||||||||||||| |||||||||| ||||||||| ||||||
Sbjct: 3345 actgattctattgcagcagggaattacccagagtggaagctttacatccagactattgat 3404

                                                                        
Query: 242  gctgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagag 301
             ||||||| ||||| ||||||||||| || |||||||||||||||||||| |||||||||
Sbjct: 3405 cctgatcatgaggacagatttgacttcgatcctcttgatgtcaccaagacatggccagag 3464

                                                                        
Query: 302  gacatcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttc 361
            || |||||||| ||||| ||||||||||||||||| |||||||| |||||||| || |||
Sbjct: 3465 gatatcatccccctgcagccagttggacggatggtcctgaacaaaaacattgataacttc 3524

                                                                        
Query: 362  ttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtccctggaatccactac 421
            || || |||||||||||||||||||||||||||||  | | ||||||||||||||| |||
Sbjct: 3525 tttgcagaaaatgaacagcttgctttctgcccagcgataattgtccctggaatccattac 3584

                                                                        
Query: 422  tctgatgataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgt 481
            |||||||||||||||||||||||||| || ||||| ||||||||||||||||||||||||
Sbjct: 3585 tctgatgataagctgctccagacaagaattttctcctatgctgatacccaaaggcaccgt 3644

                                                                        
Query: 482  cttggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaac 541
            ||||| |||||||| |||||||| || |||||||| || ||||||||  |||||||||||
Sbjct: 3645 cttggcccaaactatttgatgcttcctgtgaatgcaccaaaatgtgcataccacaacaac 3704

                                                  
Query: 542  catcatgatggcttaatgaatttcattcacagggatga 579
            || || |||||||  ||||||||||| |||||||||||
Sbjct: 3705 caccacgatggctccatgaatttcatgcacagggatga 3742



to top

>gb|U16132.1|HVU16132 Hordeum vulgare catalase mRNA, partial cds
          Length = 326

 Score =  583 bits (294), Expect = e-163
 Identities = 307/310 (99%), Gaps = 1/310 (0%)
 Strand = Plus / Plus

                                                                       
Query: 2   cactcaactataggcacatggnacggttttggtgtcaacacctacaccttaatcagcagg 61
           |||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 18  cactcaactacaggcacatgg-acggttttggtgtcaacacctacaccttaatcagcagg 76

                                                                       
Query: 62  gatggaaaggctcacctggttaagttccattggaaacctacatgtggtgtgaagtgcctc 121
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 77  gatggaaaggctcacctggttaagttccattggaaacctacatgtggtgtgaagtgcctc 136

                                                                       
Query: 122 ttggatgatgaagccgttactgttggaggcacctgccacacccatgccacaaaggacttg 181
           |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 137 ttggatgatgaagctgttactgttggaggcacctgccacacccatgccacaaaggacttg 196

                                                                       
Query: 182 actgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgat 241
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 197 actgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgat 256

                                                                       
Query: 242 gctgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagag 301
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 257 gctgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagag 316

                     
Query: 302 gacatcatcc 311
           ||||||||||
Sbjct: 317 gacatcatcc 326



to top

>emb|Z99634.1|SCCATALAS Secale cereale mRNA for catalase (cat2 gene)
          Length = 809

 Score =  525 bits (265), Expect = e-146
 Identities = 341/365 (93%), Gaps = 1/365 (0%)
 Strand = Plus / Plus

                                                                       
Query: 2   cactcaactataggcacatggnacggttttggtgtcaacacctacaccttaatcagcagg 61
           |||||||||| |||||||||| ||||||||||||||||||||||||| || |||||||| 
Sbjct: 419 cactcaactacaggcacatgg-acggttttggtgtcaacacctacacgtttatcagcagc 477

                                                                       
Query: 62  gatggaaaggctcacctggttaagttccattggaaacctacatgtggtgtgaagtgcctc 121
           ||||| ||||||||||||||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 478 gatgggaaggctcacctggttaaattccattggaaacccacatgtggtgtgaagtgcctc 537

                                                                       
Query: 122 ttggatgatgaagccgttactgttggaggcacctgccacacccatgccacaaaggacttg 181
           ||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 538 ttggatgatgatgctgttactgttggaggcacctgccacacccatgccacaaaggacttg 597

                                                                       
Query: 182 actgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgat 241
           |||||||||||||| ||||||||||||||||  |||||| ||||||| |||||| |||||
Sbjct: 598 actgattctattgcggctgggaattacccagtgtggaaggttttcattcagaccgttgat 657

                                                                       
Query: 242 gctgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagag 301
           |||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 658 gctgatcatgaggataaatttgactttgaccctcttgatgtcaccaagacctggccagag 717

                                                                       
Query: 302 gacatcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttc 361
           || ||||||| |||||||||||||||||||||||| || ||||||||||| || ||||||
Sbjct: 718 gatatcatccaactgcaaccagttggacggatggtgctcaacaagaacatcgataatttc 777

                
Query: 362 ttcgc 366
           |||||
Sbjct: 778 ttcgc 782



to top

>gb|AY103601.1| Zea mays PCO144994 mRNA sequence
          Length = 2149

 Score =  490 bits (247), Expect = e-135
 Identities = 494/575 (85%), Gaps = 1/575 (0%)
 Strand = Plus / Plus

                                                                        
Query: 2    cactcaactataggcacatggnacggttttggtgtcaacacctacaccttaatcagcagg 61
            |||||||||| |||||||||| | || ||||||||||| ||||||||||| |||| ||||
Sbjct: 825  cactcaactacaggcacatgg-agggctttggtgtcaatacctacaccttgatcaacagg 883

                                                                        
Query: 62   gatggaaaggctcacctggttaagttccattggaaacctacatgtggtgtgaagtgcctc 121
            ||||||||| ||||||| || || ||||||||||| ||||| ||||||||||| ||| | 
Sbjct: 884  gatggaaagcctcaccttgtgaaattccattggaagcctacttgtggtgtgaaatgcttg 943

                                                                        
Query: 122  ttggatgatgaagccgttactgttggaggcacctgccacacccatgccacaaaggacttg 181
             | || |||||||| || |||||||||||||||||||||| |||||| || |||||  | 
Sbjct: 944  ctcgacgatgaagctgtgactgttggaggcacctgccacagccatgcgacgaaggatcta 1003

                                                                        
Query: 182  actgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgat 241
              |||||| || ||||||||||||||||| ||||||||||| | ||||||||| ||||||
Sbjct: 1004 tatgattccatcgcagctgggaattaccctgaatggaagctctacatccagactattgat 1063

                                                                        
Query: 242  gctgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagag 301
              ||| || |||||||  |||||||||||||| || |||||||||||||||||||| |||
Sbjct: 1064 cttgaccatgaggataagtttgactttgacccgctcgatgtcaccaagacctggcctgag 1123

                                                                        
Query: 302  gacatcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttc 361
            || |||||||| ||||| || |||||||||||||| |||||||||||| | ||||| |||
Sbjct: 1124 gatatcatcccgctgcagcccgttggacggatggtcctgaacaagaacgtcgacaacttc 1183

                                                                        
Query: 362  ttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtccctggaatccactac 421
            || || || ||||||||| ||||||||||||||||  | | ||| |||||||| ||||| 
Sbjct: 1184 tttgcagagaatgaacagattgctttctgcccagcgattattgttcctggaattcactat 1243

                                                                        
Query: 422  tctgatgataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgt 481
            ||||||||||||||||||||||| || |||||||| |||||||||||||| |||||||| 
Sbjct: 1244 tctgatgataagctgctccagacgagaatcttctcctatgctgatacccagaggcaccgc 1303

                                                                        
Query: 482  cttggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaac 541
            ||||||||||||||  ||||||| || |||||||| || |||||||| |||||||| |||
Sbjct: 1304 cttggtccaaactatctgatgcttcctgtgaatgcaccaaaatgtgcccaccacaataac 1363

                                               
Query: 542  catcatgatggcttaatgaatttcattcacaggga 576
            || |||||||| || ||||| ||||| ||||||||
Sbjct: 1364 caccatgatgggttcatgaacttcatgcacaggga 1398



to top

>emb|X60135.1|ZMCATA1 Z.mays cat1 gene for catalase 1
          Length = 6933

 Score =  482 bits (243), Expect = e-133
 Identities = 493/575 (85%), Gaps = 1/575 (0%)
 Strand = Plus / Plus

                                                                        
Query: 2    cactcaactataggcacatggnacggttttggtgtcaacacctacaccttaatcagcagg 61
            |||||||||| |||||||||| | || ||||||||||| ||||||||||| |||| ||||
Sbjct: 4846 cactcaactacaggcacatgg-agggctttggtgtcaatacctacaccttgatcaacagg 4904

                                                                        
Query: 62   gatggaaaggctcacctggttaagttccattggaaacctacatgtggtgtgaagtgcctc 121
            ||||||||| ||||||| || || ||||||||||| ||||| ||||||||||| ||| | 
Sbjct: 4905 gatggaaagcctcaccttgtgaaattccattggaagcctacttgtggtgtgaaatgcttg 4964

                                                                        
Query: 122  ttggatgatgaagccgttactgttggaggcacctgccacacccatgccacaaaggacttg 181
             | ||  ||||||| || |||||||||||||||||||||| |||||| || |||||  | 
Sbjct: 4965 ctcgacaatgaagctgtgactgttggaggcacctgccacagccatgcgacgaaggatcta 5024

                                                                        
Query: 182  actgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgat 241
              |||||| || ||||||||||||||||| ||||||||||| | ||||||||| ||||||
Sbjct: 5025 tatgattccatcgcagctgggaattaccctgaatggaagctctacatccagactattgat 5084

                                                                        
Query: 242  gctgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagag 301
              ||| || |||||||  |||||||||||||| || |||||||||||||||||||| |||
Sbjct: 5085 cttgaccatgaggataagtttgactttgacccgctcgatgtcaccaagacctggcctgag 5144

                                                                        
Query: 302  gacatcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttc 361
            || |||||||| ||||| || |||||||||||||| |||||||||||| | ||||| |||
Sbjct: 5145 gatatcatcccgctgcagcccgttggacggatggtcctgaacaagaacgtcgacaacttc 5204

                                                                        
Query: 362  ttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtccctggaatccactac 421
            || || || ||||||||| ||||||||||||||||  | | ||| |||||||| ||||| 
Sbjct: 5205 tttgcagagaatgaacagattgctttctgcccagcgattattgttcctggaattcactat 5264

                                                                        
Query: 422  tctgatgataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgt 481
            ||||||||||||||||||||||| || |||||||| |||||||||||||| |||||||| 
Sbjct: 5265 tctgatgataagctgctccagacgagaatcttctcctatgctgatacccagaggcaccgc 5324

                                                                        
Query: 482  cttggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaac 541
            ||||||||||||||  ||||||| || |||||||| || |||||||| |||||||| |||
Sbjct: 5325 cttggtccaaactatctgatgcttcctgtgaatgcaccaaaatgtgcccaccacaataac 5384

                                               
Query: 542  catcatgatggcttaatgaatttcattcacaggga 576
            || |||||||| || ||||| ||||| ||||||||
Sbjct: 5385 caccatgatgggttcatgaacttcatgcacaggga 5419



to top

>emb|X12538.1|ZMCAT1 Maize cat-1 mRNA for catalase-1 isoenzyme (EC 1.11.1.6)
          Length = 2079

 Score =  474 bits (239), Expect = e-130
 Identities = 492/575 (85%), Gaps = 1/575 (0%)
 Strand = Plus / Plus

                                                                        
Query: 2    cactcaactataggcacatggnacggttttggtgtcaacacctacaccttaatcagcagg 61
            |||||||||| |||||||||| | || ||||||||||| |||||| |||| |||| ||||
Sbjct: 755  cactcaactacaggcacatgg-agggctttggtgtcaatacctactccttgatcaacagg 813

                                                                        
Query: 62   gatggaaaggctcacctggttaagttccattggaaacctacatgtggtgtgaagtgcctc 121
            ||||||||| ||||||| || || ||||||||||| ||||| ||||||||||| ||| | 
Sbjct: 814  gatggaaagcctcaccttgtgaaattccattggaagcctacttgtggtgtgaaatgcttg 873

                                                                        
Query: 122  ttggatgatgaagccgttactgttggaggcacctgccacacccatgccacaaaggacttg 181
             | ||  ||||||| || |||||||||||||||||||||| |||||| || |||||  | 
Sbjct: 874  ctcgacaatgaagctgtgactgttggaggcacctgccacagccatgcgacgaaggatcta 933

                                                                        
Query: 182  actgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgat 241
              |||||| || ||||||||||||||||| ||||||||||| | ||||||||| ||||||
Sbjct: 934  tatgattccatcgcagctgggaattaccctgaatggaagctctacatccagactattgat 993

                                                                        
Query: 242  gctgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagag 301
              ||| || |||||||  |||||||||||||| || |||||||||||||||||||| |||
Sbjct: 994  cttgaccatgaggataagtttgactttgacccgctcgatgtcaccaagacctggcctgag 1053

                                                                        
Query: 302  gacatcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttc 361
            || |||||||| ||||| || |||||||||||||| |||||||||||| | ||||| |||
Sbjct: 1054 gatatcatcccgctgcagcccgttggacggatggtcctgaacaagaacgtcgacaacttc 1113

                                                                        
Query: 362  ttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtccctggaatccactac 421
            || || || ||||||||| ||||||||||||||||  | | ||| |||||||| ||||| 
Sbjct: 1114 tttgcagagaatgaacagattgctttctgcccagcgattagtgttcctggaattcactat 1173

                                                                        
Query: 422  tctgatgataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgt 481
            ||||||||||||||||||||||| || |||||||| |||||||||||||| |||||||| 
Sbjct: 1174 tctgatgataagctgctccagacgagaatcttctcctatgctgatacccagaggcaccgc 1233

                                                                        
Query: 482  cttggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaac 541
            ||||||||||||||  ||||||| || |||||||| || |||||||| |||||||| |||
Sbjct: 1234 cttggtccaaactatctgatgcttcctgtgaatgcaccaaaatgtgcccaccacaataac 1293

                                               
Query: 542  catcatgatggcttaatgaatttcattcacaggga 576
            || |||||||| || ||||| ||||| ||||||||
Sbjct: 1294 caccatgatgggttcatgaacttcatgcacaggga 1328



to top

>gb|BT018650.1| Zea mays clone EL01N0505F10.d mRNA sequence
          Length = 1928

 Score =  458 bits (231), Expect = e-125
 Identities = 490/575 (85%), Gaps = 1/575 (0%)
 Strand = Plus / Plus

                                                                        
Query: 2    cactcaactataggcacatggnacggttttggtgtcaacacctacaccttaatcagcagg 61
            |||||||||| |||||||||| | || ||||||||||| ||||||||||| |||| ||||
Sbjct: 662  cactcaactacaggcacatgg-agggctttggtgtcaatacctacaccttgatcaacagg 720

                                                                        
Query: 62   gatggaaaggctcacctggttaagttccattggaaacctacatgtggtgtgaagtgcctc 121
            ||||||||| ||||||| || || ||||||||||| |||||   | ||||||| ||| | 
Sbjct: 721  gatggaaagcctcaccttgtgaaattccattggaagcctactccttgtgtgaaatgcttg 780

                                                                        
Query: 122  ttggatgatgaagccgttactgttggaggcacctgccacacccatgccacaaaggacttg 181
             | ||  ||||||| || |||||||||||||||||||||| |||||| || |||||  | 
Sbjct: 781  ctcgacaatgaagctgtgactgttggaggcacctgccacagccatgcgacgaaggatcta 840

                                                                        
Query: 182  actgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgat 241
              |||||| || ||||||||||||||||| ||||||||||| | ||||||||| ||||||
Sbjct: 841  tatgattccatcgcagctgggaattaccctgaatggaagctctacatccagactattgat 900

                                                                        
Query: 242  gctgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagag 301
              ||| || |||||||  |||||||||||||| || |||||||||||||||||||| |||
Sbjct: 901  cttgaccatgaggataagtttgactttgacccgctcgatgtcaccaagacctggcctgag 960

                                                                        
Query: 302  gacatcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttc 361
            || |||||||| ||||| || |||||||||||||| |||||||||||| | ||||| |||
Sbjct: 961  gatatcatcccgctgcagcccgttggacggatggtcctgaacaagaacgtcgacaacttc 1020

                                                                        
Query: 362  ttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtccctggaatccactac 421
            || || || ||||||||| ||||||||||||||||  | | ||| |||||||| ||||| 
Sbjct: 1021 tttgcagagaatgaacagattgctttctgcccagcgattattgttcctggaattcactat 1080

                                                                        
Query: 422  tctgatgataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgt 481
            ||||||||||||||||||||||| || |||||||| |||||||||||||| |||||||| 
Sbjct: 1081 tctgatgataagctgctccagacgagaatcttctcctatgctgatacccagaggcaccgc 1140

                                                                        
Query: 482  cttggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaac 541
            ||||||||||||||  ||||||| || |||||||| || |||||||| |||||||| |||
Sbjct: 1141 cttggtccaaactatctgatgcttcctgtgaatgcaccaaaatgtgcccaccacaataac 1200

                                               
Query: 542  catcatgatggcttaatgaatttcattcacaggga 576
            || |||||||| || ||||| ||||| ||||||||
Sbjct: 1201 caccatgatgggttcatgaacttcatgcacaggga 1235



to top

>gb|AF207906.1| Zantedeschia aethiopica catalase 1 (cat1) mRNA, complete cds
          Length = 1917

 Score =  238 bits (120), Expect = 2e-59
 Identities = 405/500 (81%)
 Strand = Plus / Plus

                                                                        
Query: 80   gttaagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaagccgtt 139
            ||||||||||| |||||||| |||||||| ||||| |  || ||||||||||| || |||
Sbjct: 732  gttaagttccactggaaacccacatgtggagtgaaatctctgttggatgatgaggctgtt 791

                                                                        
Query: 140  actgttggaggcacctgccacacccatgccacaaaggacttgactgattctattgcagct 199
               ||||||||  ||   || |  |||||||| |||||  | |||||| | ||||| |||
Sbjct: 792  gtggttggaggtgccaatcatagtcatgccaccaaggatcttactgatgccattgctgct 851

                                                                        
Query: 200  gggaattacccagaatggaagcttttcatccagaccattgatgctgatcacgaggataga 259
            || || ||||| || |||||||| |  || ||||  || ||| | ||||| ||||| || 
Sbjct: 852  ggtaactaccctgagtggaagctctatattcagataatggatccggatcatgaggacagg 911

                                                                        
Query: 260  tttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaa 319
            || || |||||||| ||||||||||||||||| ||||| || || ||| | || || || 
Sbjct: 912  ttcgattttgacccacttgatgtcaccaagacatggcctgaagatatcttgcctctccag 971

                                                                        
Query: 320  ccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacag 379
            ||||||||||| |||||  |||||||||| || || || ||||| || || |||||||||
Sbjct: 972  ccagttggacgcatggtcttgaacaagaatatcgataacttctttgcagagaatgaacag 1031

                                                                        
Query: 380  cttgctttctgcccagcagtcactgtccctggaatccactactctgatgataagctgctc 439
            || ||||| ||||||||| ||| ||| ||||||||| | || || || |||||| |||| 
Sbjct: 1032 ctagctttttgcccagcaatcattgtgcctggaatctattattcagacgataagttgcta 1091

                                                                        
Query: 440  cagacaaggatcttctcatatgctgatacccaaaggcaccgtcttggtccaaactacttg 499
            ||||| ||||||||||| ||||||||||| || || ||||| || || ||||||||||||
Sbjct: 1092 cagactaggatcttctcctatgctgatactcagagacaccgcctggggccaaactacttg 1151

                                                                        
Query: 500  atgctccccgtgaatgccccgaaatgtgctcaccacaacaaccatcatgatggcttaatg 559
            |||||||| |  ||||| || ||||||||||||||||||||||| ||||| || || |||
Sbjct: 1152 atgctcccagcaaatgcaccaaaatgtgctcaccacaacaaccaccatgagggttttatg 1211

                                
Query: 560  aatttcattcacagggatga 579
            |||||||| |||||||||||
Sbjct: 1212 aatttcatgcacagggatga 1231



to top

>gb|AF475100.1| Triticum aestivum catalase isozyme mRNA, partial cds
          Length = 807

 Score =  202 bits (102), Expect = 9e-49
 Identities = 158/177 (89%), Gaps = 2/177 (1%)
 Strand = Plus / Plus

                                                                       
Query: 2   cactcaactataggcacatggnacggttttggtgtcaacacctacaccttaatcagcagg 61
           |||||||||| |||||||||| ||||||||||||||||||||||||||||||| |||| |
Sbjct: 629 cactcaactacaggcacatgg-acggttttggtgtcaacacctacaccttaatnagcang 687

                                                                       
Query: 62  gatggaaaggctcacctggttaagttccattggaaacctacatgtggtgtgaagtgcctc 121
           ||||||||||| ||||| ||||||||||||||||| ||||| || || ||||||||||||
Sbjct: 688 gatggaaaggcgcaccttgttaagttccattggaagcctacntgnggggtgaagtgcctc 747

                                                                    
Query: 122 ttggatgatgaagccgttactgttggaggcacctgccacacccatgccacaaaggac 178
           ||  |||||||| || ||||||| ||||||||||||| || ||||||| |||| |||
Sbjct: 748 ttanatgatgaaaccnttactgtaggaggcacctgccnca-ccatgccncaaangac 803



to top

>gb|AF104454.1|AF104454 Brassica juncea catalase (CAT4) mRNA, complete cds
          Length = 1792

 Score =  202 bits (102), Expect = 9e-49
 Identities = 261/314 (83%)
 Strand = Plus / Plus

                                                                        
Query: 263  gactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaacca 322
            |||||||||||||| |||||||||||||||||||| ||||| ||| | || || || || 
Sbjct: 920  gactttgaccctctcgatgtcaccaagacctggcctgaggatatcttgcctctccagccc 979

                                                                        
Query: 323  gttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagctt 382
            ||||| || |||||  |||||||||||||||| || ||||| ||||| || || ||||||
Sbjct: 980  gttgggcgtatggtgttgaacaagaacattgataacttctttgcggagaacgagcagctt 1039

                                                                        
Query: 383  gctttctgcccagcagtcactgtccctggaatccactactctgatgataagctgctccag 442
            ||||||||||| ||  ||| ||| || || || ||||||||||| ||||||||||| || 
Sbjct: 1040 gctttctgccctgcgatcattgttccggggatacactactctgacgataagctgcttcaa 1099

                                                                        
Query: 443  acaaggatcttctcatatgctgatacccaaaggcaccgtcttggtccaaactacttgatg 502
            ||| |  ||||||| ||||||||||| || || ||||||||||| || |||||  ||  |
Sbjct: 1100 acacgtgtcttctcctatgctgatactcagagacaccgtcttggacctaactatctgcag 1159

                                                                        
Query: 503  ctccccgtgaatgccccgaaatgtgctcaccacaacaaccatcatgatggcttaatgaat 562
            || || || ||||| || ||||||||||||||||||||||| ||||| || || ||||||
Sbjct: 1160 ctaccggttaatgctccaaaatgtgctcaccacaacaaccaccatgaaggattcatgaat 1219

                          
Query: 563  ttcattcacaggga 576
            ||||| ||||||||
Sbjct: 1220 ttcatgcacaggga 1233



to top

>emb|X52135.1|GHCAT1 Cotton mRNA for cottonseed catalase subunit 1 (EC 1.11.1.6)
          Length = 1666

 Score =  200 bits (101), Expect = 4e-48
 Identities = 299/365 (81%)
 Strand = Plus / Plus

                                                                        
Query: 215  tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 274
            |||||||| ||||||||||| |||||| |||| || || |||| ||||||||||||||||
Sbjct: 847  tggaagctcttcatccagacaattgatcctgaccatgaagataaatttgactttgaccct 906

                                                                        
Query: 275  cttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatg 334
            |||||||| || ||||||||||| ||||||||| | || ||||| || ||||| ||  ||
Sbjct: 907  cttgatgtgactaagacctggcctgaggacatcttgcccctgcagcctgttggccgcttg 966

                                                                        
Query: 335  gtactgaacaagaacattgacaatttcttcgcggaaaatgaacagcttgctttctgccca 394
            ||  |||| |||||||||||||| |||||||| ||||||||||||||||| || ||||| 
Sbjct: 967  gttttgaataagaacattgacaacttcttcgccgaaaatgaacagcttgcattttgccct 1026

                                                                        
Query: 395  gcagtcactgtccctggaatccactactctgatgataagctgctccagacaaggatcttc 454
            ||  |    || ||||||||| ||||||| ||||||||| ||||||||||  | || |||
Sbjct: 1027 gccattgtggttcctggaatctactactcagatgataagttgctccagactcgtatattc 1086

                                                                        
Query: 455  tcatatgctgatacccaaaggcaccgtcttggtccaaactacttgatgctccccgtgaat 514
            || ||  |||||||||| |||||| | ||||| ||||||||  ||   ||||| |  |||
Sbjct: 1087 tcctactctgatacccagaggcacagacttgggccaaactatctgcaactcccagccaat 1146

                                                                        
Query: 515  gccccgaaatgtgctcaccacaacaaccatcatgatggcttaatgaatttcattcacagg 574
            || || || |||||||| |||||||| || || || || || ||||||||||| ||||||
Sbjct: 1147 gctcccaagtgtgctcatcacaacaatcaccacgaaggttttatgaatttcatgcacagg 1206

                 
Query: 575  gatga 579
            |||||
Sbjct: 1207 gatga 1211



to top

>ref|NM_119675.2| Arabidopsis thaliana CAT2 (CATALASE 2); catalase AT4G35090 (CAT2)
            transcript variant AT4G35090.1 mRNA, complete cds
          Length = 1856

 Score =  194 bits (98), Expect = 2e-46
 Identities = 395/494 (79%)
 Strand = Plus / Plus

                                                                        
Query: 83   aagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaagccgttact 142
            ||||||||||||||||| || ||||| || ||||  || ||||| || || ||  ||  |
Sbjct: 739  aagttccattggaaaccaacttgtggagtcaagtctcttttggaagaagatgcaattcgt 798

                                                                        
Query: 143  gttggaggcacctgccacacccatgccacaaaggacttgactgattctattgcagctggg 202
            |||||||| |||  |||||  ||||| ||  | ||||||  ||| ||||| || ||||| 
Sbjct: 799  gttggaggaaccaaccacagtcatgcgactcaagacttgtatgactctatagctgctgga 858

                                                                        
Query: 203  aattacccagaatggaagcttttcatccagaccattgatgctgatcacgaggatagattt 262
            || ||||| ||||||||||| || ||||| | ||||||| ||| | | || || |  || 
Sbjct: 859  aactaccctgaatggaagctctttatccaaatcattgatcctgctgatgaagacaagttc 918

                                                                        
Query: 263  gactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaacca 322
            ||||||||||| || ||||| |||||||||||||| ||||| ||| | || || ||||| 
Sbjct: 919  gactttgacccgctcgatgtgaccaagacctggcctgaggatatcttgcctcttcaacct 978

                                                                        
Query: 323  gttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagctt 382
            |||||||| |||||  ||||||||||||||||||| ||||| || || ||||| || |||
Sbjct: 979  gttggacgtatggtgttgaacaagaacattgacaacttctttgcagagaatgagcaactt 1038

                                                                        
Query: 383  gctttctgcccagcagtcactgtccctggaatccactactctgatgataagctgctccag 442
            |||||||| || ||| | | |||||| || || || ||||| |||||||||||||| || 
Sbjct: 1039 gctttctgtcctgcaattattgtcccagggatacattactcagatgataagctgcttcaa 1098

                                                                        
Query: 443  acaaggatcttctcatatgctgatacccaaaggcaccgtcttggtccaaactacttgatg 502
            ||  |  ||||||| ||||| ||||| || || ||||||||||| ||||||||| |   |
Sbjct: 1099 acccgtgtcttctcctatgccgatactcagagacaccgtcttggaccaaactaccttcag 1158

                                                                        
Query: 503  ctccccgtgaatgccccgaaatgtgctcaccacaacaaccatcatgatggcttaatgaat 562
            || || || ||||| || ||||||||||||||||||||||| ||||| || || ||||||
Sbjct: 1159 ctgccagtcaatgctccaaaatgtgctcaccacaacaaccaccatgagggattcatgaat 1218

                          
Query: 563  ttcattcacaggga 576
            ||||| ||||||||
Sbjct: 1219 ttcatgcacaggga 1232



to top

>ref|NM_001036714.1| Arabidopsis thaliana CAT2 (CATALASE 2); catalase AT4G35090 (CAT2)
            transcript variant AT4G35090.2 mRNA, complete cds
          Length = 2259

 Score =  194 bits (98), Expect = 2e-46
 Identities = 395/494 (79%)
 Strand = Plus / Plus

                                                                        
Query: 83   aagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaagccgttact 142
            ||||||||||||||||| || ||||| || ||||  || ||||| || || ||  ||  |
Sbjct: 738  aagttccattggaaaccaacttgtggagtcaagtctcttttggaagaagatgcaattcgt 797

                                                                        
Query: 143  gttggaggcacctgccacacccatgccacaaaggacttgactgattctattgcagctggg 202
            |||||||| |||  |||||  ||||| ||  | ||||||  ||| ||||| || ||||| 
Sbjct: 798  gttggaggaaccaaccacagtcatgcgactcaagacttgtatgactctatagctgctgga 857

                                                                        
Query: 203  aattacccagaatggaagcttttcatccagaccattgatgctgatcacgaggatagattt 262
            || ||||| ||||||||||| || ||||| | ||||||| ||| | | || || |  || 
Sbjct: 858  aactaccctgaatggaagctctttatccaaatcattgatcctgctgatgaagacaagttc 917

                                                                        
Query: 263  gactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaacca 322
            ||||||||||| || ||||| |||||||||||||| ||||| ||| | || || ||||| 
Sbjct: 918  gactttgacccgctcgatgtgaccaagacctggcctgaggatatcttgcctcttcaacct 977

                                                                        
Query: 323  gttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagctt 382
            |||||||| |||||  ||||||||||||||||||| ||||| || || ||||| || |||
Sbjct: 978  gttggacgtatggtgttgaacaagaacattgacaacttctttgcagagaatgagcaactt 1037

                                                                        
Query: 383  gctttctgcccagcagtcactgtccctggaatccactactctgatgataagctgctccag 442
            |||||||| || ||| | | |||||| || || || ||||| |||||||||||||| || 
Sbjct: 1038 gctttctgtcctgcaattattgtcccagggatacattactcagatgataagctgcttcaa 1097

                                                                        
Query: 443  acaaggatcttctcatatgctgatacccaaaggcaccgtcttggtccaaactacttgatg 502
            ||  |  ||||||| ||||| ||||| || || ||||||||||| ||||||||| |   |
Sbjct: 1098 acccgtgtcttctcctatgccgatactcagagacaccgtcttggaccaaactaccttcag 1157

                                                                        
Query: 503  ctccccgtgaatgccccgaaatgtgctcaccacaacaaccatcatgatggcttaatgaat 562
            || || || ||||| || ||||||||||||||||||||||| ||||| || || ||||||
Sbjct: 1158 ctgccagtcaatgctccaaaatgtgctcaccacaacaaccaccatgagggattcatgaat 1217

                          
Query: 563  ttcattcacaggga 576
            ||||| ||||||||
Sbjct: 1218 ttcatgcacaggga 1231



to top

>gb|AY113854.1| Arabidopsis thaliana putative catalase (At4g35090) mRNA, complete cds
          Length = 1510

 Score =  194 bits (98), Expect = 2e-46
 Identities = 395/494 (79%)
 Strand = Plus / Plus

                                                                        
Query: 83   aagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaagccgttact 142
            ||||||||||||||||| || ||||| || ||||  || ||||| || || ||  ||  |
Sbjct: 667  aagttccattggaaaccaacttgtggagtcaagtctcttttggaagaagatgcaattcgt 726

                                                                        
Query: 143  gttggaggcacctgccacacccatgccacaaaggacttgactgattctattgcagctggg 202
            |||||||| |||  |||||  ||||| ||  | ||||||  ||| ||||| || ||||| 
Sbjct: 727  gttggaggaaccaaccacagtcatgcgactcaagacttgtatgactctatagctgctgga 786

                                                                        
Query: 203  aattacccagaatggaagcttttcatccagaccattgatgctgatcacgaggatagattt 262
            || ||||| ||||||||||| || ||||| | ||||||| ||| | | || || |  || 
Sbjct: 787  aactaccctgaatggaagctctttatccaaatcattgatcctgctgatgaagacaagttc 846

                                                                        
Query: 263  gactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaacca 322
            ||||||||||| || ||||| |||||||||||||| ||||| ||| | || || ||||| 
Sbjct: 847  gactttgacccgctcgatgtgaccaagacctggcctgaggatatcttgcctcttcaacct 906

                                                                        
Query: 323  gttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagctt 382
            |||||||| |||||  ||||||||||||||||||| ||||| || || ||||| || |||
Sbjct: 907  gttggacgtatggtgttgaacaagaacattgacaacttctttgcagagaatgagcaactt 966

                                                                        
Query: 383  gctttctgcccagcagtcactgtccctggaatccactactctgatgataagctgctccag 442
            |||||||| || ||| | | |||||| || || || ||||| |||||||||||||| || 
Sbjct: 967  gctttctgtcctgcaattattgtcccagggatacattactcagatgataagctgcttcaa 1026

                                                                        
Query: 443  acaaggatcttctcatatgctgatacccaaaggcaccgtcttggtccaaactacttgatg 502
            ||  |  ||||||| ||||| ||||| || || ||||||||||| ||||||||| |   |
Sbjct: 1027 acccgtgtcttctcctatgccgatactcagagacaccgtcttggaccaaactaccttcag 1086

                                                                        
Query: 503  ctccccgtgaatgccccgaaatgtgctcaccacaacaaccatcatgatggcttaatgaat 562
            || || || ||||| || ||||||||||||||||||||||| ||||| || || ||||||
Sbjct: 1087 ctgccagtcaatgctccaaaatgtgctcaccacaacaaccaccatgagggattcatgaat 1146

                          
Query: 563  ttcattcacaggga 576
            ||||| ||||||||
Sbjct: 1147 ttcatgcacaggga 1160



to top

>gb|AY074301.1| Arabidopsis thaliana putative catalase (At4g35090) mRNA, complete cds
          Length = 1775

 Score =  194 bits (98), Expect = 2e-46
 Identities = 395/494 (79%)
 Strand = Plus / Plus

                                                                        
Query: 83   aagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaagccgttact 142
            ||||||||||||||||| || ||||| || ||||  || ||||| || || ||  ||  |
Sbjct: 739  aagttccattggaaaccaacttgtggagtcaagtctcttttggaagaagatgcaattcgt 798

                                                                        
Query: 143  gttggaggcacctgccacacccatgccacaaaggacttgactgattctattgcagctggg 202
            |||||||| |||  |||||  ||||| ||  | ||||||  ||| ||||| || ||||| 
Sbjct: 799  gttggaggaaccaaccacagtcatgcgactcaagacttgtatgactctatagctgctgga 858

                                                                        
Query: 203  aattacccagaatggaagcttttcatccagaccattgatgctgatcacgaggatagattt 262
            || ||||| ||||||||||| || ||||| | ||||||| ||| | | || || |  || 
Sbjct: 859  aactaccctgaatggaagctctttatccaaatcattgatcctgctgatgaagacaagttc 918

                                                                        
Query: 263  gactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaacca 322
            ||||||||||| || ||||| |||||||||||||| ||||| ||| | || || ||||| 
Sbjct: 919  gactttgacccgctcgatgtgaccaagacctggcctgaggatatcttgcctcttcaacct 978

                                                                        
Query: 323  gttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagctt 382
            |||||||| |||||  ||||||||||||||||||| ||||| || || ||||| || |||
Sbjct: 979  gttggacgtatggtgttgaacaagaacattgacaacttctttgcagagaatgagcaactt 1038

                                                                        
Query: 383  gctttctgcccagcagtcactgtccctggaatccactactctgatgataagctgctccag 442
            |||||||| || ||| | | |||||| || || || ||||| |||||||||||||| || 
Sbjct: 1039 gctttctgtcctgcaattattgtcccagggatacattactcagatgataagctgcttcaa 1098

                                                                        
Query: 443  acaaggatcttctcatatgctgatacccaaaggcaccgtcttggtccaaactacttgatg 502
            ||  |  ||||||| ||||| ||||| || || ||||||||||| ||||||||| |   |
Sbjct: 1099 acccgtgtcttctcctatgccgatactcagagacaccgtcttggaccaaactaccttcag 1158

                                                                        
Query: 503  ctccccgtgaatgccccgaaatgtgctcaccacaacaaccatcatgatggcttaatgaat 562
            || || || ||||| || ||||||||||||||||||||||| ||||| || || ||||||
Sbjct: 1159 ctgccagtcaatgctccaaaatgtgctcaccacaacaaccaccatgagggattcatgaat 1218

                          
Query: 563  ttcattcacaggga 576
            ||||| ||||||||
Sbjct: 1219 ttcatgcacaggga 1232



to top

>emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 82
          Length = 195165

 Score =  194 bits (98), Expect = 2e-46
 Identities = 395/494 (79%)
 Strand = Plus / Minus

                                                                          
Query: 83     aagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaagccgttact 142
              ||||||||||||||||| || ||||| || ||||  || ||||| || || ||  ||  |
Sbjct: 156915 aagttccattggaaaccaacttgtggagtcaagtctcttttggaagaagatgcaattcgt 156856

                                                                          
Query: 143    gttggaggcacctgccacacccatgccacaaaggacttgactgattctattgcagctggg 202
              |||||||| |||  |||||  ||||| ||  | ||||||  ||| ||||| || ||||| 
Sbjct: 156855 gttggaggaaccaaccacagtcatgcgactcaagacttgtatgactctatagctgctgga 156796

                                                                          
Query: 203    aattacccagaatggaagcttttcatccagaccattgatgctgatcacgaggatagattt 262
              || ||||| ||||||||||| || ||||| | ||||||| ||| | | || || |  || 
Sbjct: 156795 aactaccctgaatggaagctctttatccaaatcattgatcctgctgatgaagacaagttc 156736

                                                                          
Query: 263    gactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaacca 322
              ||||||||||| || ||||| |||||||||||||| ||||| ||| | || || ||||| 
Sbjct: 156735 gactttgacccgctcgatgtgaccaagacctggcctgaggatatcttgcctcttcaacct 156676

                                                                          
Query: 323    gttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagctt 382
              |||||||| |||||  ||||||||||||||||||| ||||| || || ||||| || |||
Sbjct: 156675 gttggacgtatggtgttgaacaagaacattgacaacttctttgcagagaatgagcaactt 156616

                                                                          
Query: 383    gctttctgcccagcagtcactgtccctggaatccactactctgatgataagctgctccag 442
              |||||||| || ||| | | |||||| || || || ||||| |||||||||||||| || 
Sbjct: 156615 gctttctgtcctgcaattattgtcccagggatacattactcagatgataagctgcttcaa 156556

                                                                          
Query: 443    acaaggatcttctcatatgctgatacccaaaggcaccgtcttggtccaaactacttgatg 502
              ||  |  ||||||| ||||| ||||| || || ||||||||||| ||||||||| |   |
Sbjct: 156555 acccgtgtcttctcctatgccgatactcagagacaccgtcttggaccaaactaccttcag 156496

                                                                          
Query: 503    ctccccgtgaatgccccgaaatgtgctcaccacaacaaccatcatgatggcttaatgaat 562
              || || || ||||| || ||||||||||||||||||||||| ||||| || || ||||||
Sbjct: 156495 ctgccagtcaatgctccaaaatgtgctcaccacaacaaccaccatgagggattcatgaat 156436

                            
Query: 563    ttcattcacaggga 576
              ||||| ||||||||
Sbjct: 156435 ttcatgcacaggga 156422



to top

>emb|AL035522.1|ATT12J5 Arabidopsis thaliana DNA chromosome 4, BAC clone  T12J5 (ESSAII
             project)
          Length = 84499

 Score =  194 bits (98), Expect = 2e-46
 Identities = 395/494 (79%)
 Strand = Plus / Minus

                                                                         
Query: 83    aagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaagccgttact 142
             ||||||||||||||||| || ||||| || ||||  || ||||| || || ||  ||  |
Sbjct: 26993 aagttccattggaaaccaacttgtggagtcaagtctcttttggaagaagatgcaattcgt 26934

                                                                         
Query: 143   gttggaggcacctgccacacccatgccacaaaggacttgactgattctattgcagctggg 202
             |||||||| |||  |||||  ||||| ||  | ||||||  ||| ||||| || ||||| 
Sbjct: 26933 gttggaggaaccaaccacagtcatgcgactcaagacttgtatgactctatagctgctgga 26874

                                                                         
Query: 203   aattacccagaatggaagcttttcatccagaccattgatgctgatcacgaggatagattt 262
             || ||||| ||||||||||| || ||||| | ||||||| ||| | | || || |  || 
Sbjct: 26873 aactaccctgaatggaagctctttatccaaatcattgatcctgctgatgaagacaagttc 26814

                                                                         
Query: 263   gactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaacca 322
             ||||||||||| || ||||| |||||||||||||| ||||| ||| | || || ||||| 
Sbjct: 26813 gactttgacccgctcgatgtgaccaagacctggcctgaggatatcttgcctcttcaacct 26754

                                                                         
Query: 323   gttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagctt 382
             |||||||| |||||  ||||||||||||||||||| ||||| || || ||||| || |||
Sbjct: 26753 gttggacgtatggtgttgaacaagaacattgacaacttctttgcagagaatgagcaactt 26694

                                                                         
Query: 383   gctttctgcccagcagtcactgtccctggaatccactactctgatgataagctgctccag 442
             |||||||| || ||| | | |||||| || || || ||||| |||||||||||||| || 
Sbjct: 26693 gctttctgtcctgcaattattgtcccagggatacattactcagatgataagctgcttcaa 26634

                                                                         
Query: 443   acaaggatcttctcatatgctgatacccaaaggcaccgtcttggtccaaactacttgatg 502
             ||  |  ||||||| ||||| ||||| || || ||||||||||| ||||||||| |   |
Sbjct: 26633 acccgtgtcttctcctatgccgatactcagagacaccgtcttggaccaaactaccttcag 26574

                                                                         
Query: 503   ctccccgtgaatgccccgaaatgtgctcaccacaacaaccatcatgatggcttaatgaat 562
             || || || ||||| || ||||||||||||||||||||||| ||||| || || ||||||
Sbjct: 26573 ctgccagtcaatgctccaaaatgtgctcaccacaacaaccaccatgagggattcatgaat 26514

                           
Query: 563   ttcattcacaggga 576
             ||||| ||||||||
Sbjct: 26513 ttcatgcacaggga 26500



to top

>emb|AL022023.1|ATM4E13 Arabidopsis thaliana DNA chromosome 4, BAC clone M4E13 (ESSAII project)
          Length = 80346

 Score =  194 bits (98), Expect = 2e-46
 Identities = 395/494 (79%)
 Strand = Plus / Minus

                                                                         
Query: 83    aagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaagccgttact 142
             ||||||||||||||||| || ||||| || ||||  || ||||| || || ||  ||  |
Sbjct: 57948 aagttccattggaaaccaacttgtggagtcaagtctcttttggaagaagatgcaattcgt 57889

                                                                         
Query: 143   gttggaggcacctgccacacccatgccacaaaggacttgactgattctattgcagctggg 202
             |||||||| |||  |||||  ||||| ||  | ||||||  ||| ||||| || ||||| 
Sbjct: 57888 gttggaggaaccaaccacagtcatgcgactcaagacttgtatgactctatagctgctgga 57829

                                                                         
Query: 203   aattacccagaatggaagcttttcatccagaccattgatgctgatcacgaggatagattt 262
             || ||||| ||||||||||| || ||||| | ||||||| ||| | | || || |  || 
Sbjct: 57828 aactaccctgaatggaagctctttatccaaatcattgatcctgctgatgaagacaagttc 57769

                                                                         
Query: 263   gactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaacca 322
             ||||||||||| || ||||| |||||||||||||| ||||| ||| | || || ||||| 
Sbjct: 57768 gactttgacccgctcgatgtgaccaagacctggcctgaggatatcttgcctcttcaacct 57709

                                                                         
Query: 323   gttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagctt 382
             |||||||| |||||  ||||||||||||||||||| ||||| || || ||||| || |||
Sbjct: 57708 gttggacgtatggtgttgaacaagaacattgacaacttctttgcagagaatgagcaactt 57649

                                                                         
Query: 383   gctttctgcccagcagtcactgtccctggaatccactactctgatgataagctgctccag 442
             |||||||| || ||| | | |||||| || || || ||||| |||||||||||||| || 
Sbjct: 57648 gctttctgtcctgcaattattgtcccagggatacattactcagatgataagctgcttcaa 57589

                                                                         
Query: 443   acaaggatcttctcatatgctgatacccaaaggcaccgtcttggtccaaactacttgatg 502
             ||  |  ||||||| ||||| ||||| || || ||||||||||| ||||||||| |   |
Sbjct: 57588 acccgtgtcttctcctatgccgatactcagagacaccgtcttggaccaaactaccttcag 57529

                                                                         
Query: 503   ctccccgtgaatgccccgaaatgtgctcaccacaacaaccatcatgatggcttaatgaat 562
             || || || ||||| || ||||||||||||||||||||||| ||||| || || ||||||
Sbjct: 57528 ctgccagtcaatgctccaaaatgtgctcaccacaacaaccaccatgagggattcatgaat 57469

                           
Query: 563   ttcattcacaggga 576
             ||||| ||||||||
Sbjct: 57468 ttcatgcacaggga 57455



to top

>gb|AY054663.1| Arabidopsis thaliana catalase (At4g35090; M4E13.140) mRNA, complete
            cds
          Length = 1759

 Score =  194 bits (98), Expect = 2e-46
 Identities = 395/494 (79%)
 Strand = Plus / Plus

                                                                        
Query: 83   aagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaagccgttact 142
            ||||||||||||||||| || ||||| || ||||  || ||||| || || ||  ||  |
Sbjct: 739  aagttccattggaaaccaacttgtggagtcaagtctcttttggaagaagatgcaattctt 798

                                                                        
Query: 143  gttggaggcacctgccacacccatgccacaaaggacttgactgattctattgcagctggg 202
            |||||||| |||  |||||  ||||| ||  | ||||||  ||| ||||| || ||||| 
Sbjct: 799  gttggaggaaccaaccacagtcatgcgactcaagacttgtatgactctatagctgctgga 858

                                                                        
Query: 203  aattacccagaatggaagcttttcatccagaccattgatgctgatcacgaggatagattt 262
            || ||||| ||||||||||| || ||||| | ||||||| ||| | | || || |  || 
Sbjct: 859  aactaccctgaatggaagctctttatccaaatcattgatcctgctgatgaagacaagttc 918

                                                                        
Query: 263  gactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaacca 322
            ||||||||||| || ||||| |||||||||||||| ||||| ||| | || || ||||| 
Sbjct: 919  gactttgacccgctcgatgtgaccaagacctggcctgaggatatcttgcctcttcaacct 978

                                                                        
Query: 323  gttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagctt 382
            |||||||| |||||  ||||||||||||||||||| ||||| || || ||||| || |||
Sbjct: 979  gttggacgtatggtgttgaacaagaacattgacaacttctttgcagagaatgagcaactt 1038

                                                                        
Query: 383  gctttctgcccagcagtcactgtccctggaatccactactctgatgataagctgctccag 442
            |||||||| || ||| | | |||||| || || || ||||| |||||||||||||| || 
Sbjct: 1039 gctttctgtcctgcaattattgtcccagggatacattactcagatgataagctgcttcaa 1098

                                                                        
Query: 443  acaaggatcttctcatatgctgatacccaaaggcaccgtcttggtccaaactacttgatg 502
            ||  |  ||||||| ||||| ||||| || || ||||||||||| ||||||||| |   |
Sbjct: 1099 acccgtgtcttctcctatgccgatactcagagacaccgtcttggaccaaactaccttcag 1158

                                                                        
Query: 503  ctccccgtgaatgccccgaaatgtgctcaccacaacaaccatcatgatggcttaatgaat 562
            || || || ||||| || ||||||||||||||||||||||| ||||| || || ||||||
Sbjct: 1159 ctgccagtcaatgctccaaaatgtgctcaccacaacaaccaccatgagggattcatgaat 1218

                          
Query: 563  ttcattcacaggga 576
            ||||| ||||||||
Sbjct: 1219 ttcatgcacaggga 1232



to top

>gb|AF248491.1|AF248491 Raphanus sativus catalase (cat) gene, complete cds
          Length = 4780

 Score =  194 bits (98), Expect = 2e-46
 Identities = 260/314 (82%)
 Strand = Plus / Plus

                                                                        
Query: 263  gactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaacca 322
            |||||||||||||| ||||| |||||||||||||| |||||  || | || || || || 
Sbjct: 3648 gactttgaccctctcgatgtgaccaagacctggcctgaggatctcttgcctctccagccc 3707

                                                                        
Query: 323  gttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagctt 382
            ||||| || |||||  |||||||||||||||| || ||||| ||||| ||||| ||||||
Sbjct: 3708 gttggtcgtatggtgttgaacaagaacattgataacttctttgcggagaatgagcagctt 3767

                                                                        
Query: 383  gctttctgcccagcagtcactgtccctggaatccactactctgatgataagctgctccag 442
            || |||||||| ||  ||| ||| || || || |||||||||||||| |||||||| || 
Sbjct: 3768 gccttctgccctgcgatcattgttccggggatacactactctgatgacaagctgcttcaa 3827

                                                                        
Query: 443  acaaggatcttctcatatgctgatacccaaaggcaccgtcttggtccaaactacttgatg 502
            ||| |  ||||||| ||||| ||||| || || ||||||||||| || |||||| |   |
Sbjct: 3828 acacgtgtcttctcctatgcggatactcagagacaccgtcttggacctaactaccttcag 3887

                                                                        
Query: 503  ctccccgtgaatgccccgaaatgtgctcaccacaacaaccatcatgatggcttaatgaat 562
            || || |||||||| || ||||||||||||||||||||||| ||||| ||||| ||||||
Sbjct: 3888 ctaccagtgaatgctccaaaatgtgctcaccacaacaaccaccatgagggcttcatgaat 3947

                          
Query: 563  ttcattcacaggga 576
            ||||| ||||||||
Sbjct: 3948 ttcatgcacaggga 3961



to top

>gb|AF031318.2|AF031318 Raphanus sativus catalase (Cat1) mRNA, complete cds
          Length = 1658

 Score =  194 bits (98), Expect = 2e-46
 Identities = 260/314 (82%)
 Strand = Plus / Plus

                                                                        
Query: 263  gactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaacca 322
            |||||||||||||| ||||| |||||||||||||| |||||  || | || || || || 
Sbjct: 902  gactttgaccctctcgatgtgaccaagacctggcctgaggatctcttgcctctccagccc 961

                                                                        
Query: 323  gttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagctt 382
            ||||| || |||||  |||||||||||||||| || ||||| ||||| ||||| ||||||
Sbjct: 962  gttggtcgtatggtgttgaacaagaacattgataacttctttgcggagaatgagcagctt 1021

                                                                        
Query: 383  gctttctgcccagcagtcactgtccctggaatccactactctgatgataagctgctccag 442
            || |||||||| ||  ||| ||| || || || |||||||||||||| |||||||| || 
Sbjct: 1022 gccttctgccctgcgatcattgttccggggatacactactctgatgacaagctgcttcaa 1081

                                                                        
Query: 443  acaaggatcttctcatatgctgatacccaaaggcaccgtcttggtccaaactacttgatg 502
            ||| |  ||||||| ||||| ||||| || || ||||||||||| || |||||| |   |
Sbjct: 1082 acacgtgtcttctcctatgcggatactcagagacaccgtcttggacctaactaccttcag 1141

                                                                        
Query: 503  ctccccgtgaatgccccgaaatgtgctcaccacaacaaccatcatgatggcttaatgaat 562
            || || |||||||| || ||||||||||||||||||||||| ||||| ||||| ||||||
Sbjct: 1142 ctaccagtgaatgctccaaaatgtgctcaccacaacaaccaccatgagggcttcatgaat 1201

                          
Query: 563  ttcattcacaggga 576
            ||||| ||||||||
Sbjct: 1202 ttcatgcacaggga 1215



to top

>gb|AF243517.1|AF243517 Helianthus annuus catalase 2 (CATA2) mRNA, complete cds
          Length = 1736

 Score =  188 bits (95), Expect = 1e-44
 Identities = 320/395 (81%)
 Strand = Plus / Plus

                                                                        
Query: 185  gattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgct 244
            ||||||||||| | ||||||||| || ||||||||||||||||| ||||| || ||| | 
Sbjct: 820  gattctattgcggatgggaattatccggaatggaagcttttcattcagactatggatccg 879

                                                                        
Query: 245  gatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggac 304
            ||||| |||||||| |||||||||||||| |||||||| |||||||||||||| ||||| 
Sbjct: 880  gatcatgaggataggtttgactttgacccgcttgatgtgaccaagacctggcccgaggat 939

                                                                        
Query: 305  atcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 364
            ||| | ||  |||| || || || || |||||  |||||||||||||||| || ||||| 
Sbjct: 940  atcttgcctttgcagcctgtgggtcgtatggttttgaacaagaacattgataacttcttt 999

                                                                        
Query: 365  gcggaaaatgaacagcttgctttctgcccagcagtcactgtccctggaatccactactct 424
            ||||| |||||||| || || || ||||| ||  ||| ||| ||||| ||  | || || 
Sbjct: 1000 gcggagaatgaacaactggcgttttgccctgcgatcattgtgcctgggatttattattcg 1059

                                                                        
Query: 425  gatgataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgtctt 484
            |||||||||||||| || ||  | |||||||| |||||||| || || ||||| ||||||
Sbjct: 1060 gatgataagctgcttcaaacgcgtatcttctcgtatgctgacacgcagaggcatcgtctt 1119

                                                                        
Query: 485  ggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaaccat 544
            || || ||||| |||  ||| || |  || || || || |||||||| || || || |||
Sbjct: 1120 ggaccgaactatttgcagcttcctgctaacgctcctaagtgtgctcatcataataatcat 1179

                                               
Query: 545  catgatggcttaatgaatttcattcacagggatga 579
            |||||||| || ||||||||||| |||||||||||
Sbjct: 1180 catgatggattcatgaatttcatgcacagggatga 1214



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 24  acggttttggtgtcaacacctacac 48
           |||||| ||||||||||||||||||
Sbjct: 659 acggttctggtgtcaacacctacac 683



to top

>gb|AY641732.1| Camellia sinensis catalase mRNA, partial cds
          Length = 782

 Score =  184 bits (93), Expect = 2e-43
 Identities = 426/537 (79%)
 Strand = Plus / Plus

                                                                       
Query: 31  tggtgtcaacacctacaccttaatcagcagggatggaaaggctcacctggttaagttcca 90
           |||||| ||||||||||| ||||||| ||  | ||| |||||||||   || ||||| ||
Sbjct: 235 tggtgttaacacctacactttaatcaacaaagctgggaaggctcactatgtcaagtttca 294

                                                                       
Query: 91  ttggaaacctacatgtggtgtgaagtgcctcttggatgatgaagccgttactgttggagg 150
           |||||||||||| ||||| ||||||||  | ||||| || || ||| |||  ||||| ||
Sbjct: 295 ttggaaacctacctgtggagtgaagtgtttgttggaggaagaggccattaaggttggggg 354

                                                                       
Query: 151 cacctgccacacccatgccacaaaggacttgactgattctattgcagctgggaattaccc 210
             |    |||| ||||||||| |||||  ||  ||| || || ||||||||||| |||||
Sbjct: 355 agctaatcacagccatgccaccaaggatctgtatgactcaatagcagctgggaactaccc 414

                                                                       
Query: 211 agaatggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttga 270
            |||||||| |||||||||||||  || ||| ||||||| || || |||||||| |||||
Sbjct: 415 tgaatggaaacttttcatccagataatcgatcctgatcatgaagacagatttgattttga 474

                                                                       
Query: 271 ccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacg 330
            || |||||||| |||||||||||||| ||||||||||| || ||||| || || || ||
Sbjct: 475 tccacttgatgtaaccaagacctggcctgaggacatcatacctctgcagccggtgggccg 534

                                                                       
Query: 331 gatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagcttgctttctg 390
             ||||  |||| |||||||| || || ||||| || || ||||| |||||||| || ||
Sbjct: 535 cttggtcttgaataagaacatggataacttctttgcagagaatgagcagcttgcattttg 594

                                                                       
Query: 391 cccagcagtcactgtccctggaatccactactctgatgataagctgctccagacaaggat 450
           ||| ||  ||| ||| |||||  || |||| || |||||||||||||| || ||  ||||
Sbjct: 595 ccctgctatcattgtacctggtgtctactattcagatgataagctgcttcaaactcggat 654

                                                                       
Query: 451 cttctcatatgctgatacccaaaggcaccgtcttggtccaaactacttgatgctccccgt 510
            ||||| || ||||||||||| |||||||||||||| || |||||  ||  ||| || | 
Sbjct: 655 attctcctacgctgatacccagaggcaccgtcttggacctaactatctgcagcttccagc 714

                                                                    
Query: 511 gaatgccccgaaatgtgctcaccacaacaaccatcatgatggcttaatgaatttcat 567
            ||||| || || |||||||| |||||||| || ||||| || || |||||||||||
Sbjct: 715 taatgctcccaagtgtgctcatcacaacaatcaccatgagggtttcatgaatttcat 771



to top

>emb|AJ874263.1| Populus deltoides cat1 gene for catalase, exons 1-8
          Length = 3947

 Score =  184 bits (93), Expect = 2e-43
 Identities = 315/389 (80%)
 Strand = Plus / Plus

                                                                        
Query: 191  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 250
            ||||||||||| |  || || || ||||| |||||||||||||| |||||| |||| || 
Sbjct: 2420 attgcagctggcacctatcctgagtggaaacttttcatccagacaattgatcctgaccat 2479

                                                                        
Query: 251  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 310
            || |  || ||||| |||||||| |||||||| |||||||||||||| ||||| ||| | 
Sbjct: 2480 gaagccaggtttgattttgacccacttgatgtaaccaagacctggcctgaggatatcttg 2539

                                                                        
Query: 311  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaa 370
            || ||||| |||||||| ||  ||||  |||| |||||||| ||||| ||||| || |||
Sbjct: 2540 cccctgcagccagttggtcgcttggtcttgaataagaacatcgacaacttctttgctgaa 2599

                                                                        
Query: 371  aatgaacagcttgctttctgcccagcagtcactgtccctggaatccactactctgatgat 430
            ||||| ||||||||||||||||| ||  |    || ||||| ||  |||| || ||||| 
Sbjct: 2600 aatgagcagcttgctttctgccctgctattgtggttcctggtatttactattcagatgac 2659

                                                                        
Query: 431  aagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgtcttggtcca 490
            ||||| ||||||||  | |||||||| |||||||||||||| |||||||||||||| |||
Sbjct: 2660 aagctactccagactcgaatcttctcctatgctgatacccagaggcaccgtcttggacca 2719

                                                                        
Query: 491  aactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaaccatcatgat 550
            |||||  ||  |||||| |  ||||| || || |||||||| || ||||| || ||||| 
Sbjct: 2720 aactatctgcagctccctgctaatgctcccaagtgtgctcatcataacaatcaccatgaa 2779

                                         
Query: 551  ggcttaatgaatttcattcacagggatga 579
            || || ||||||||||| |||||||||||
Sbjct: 2780 ggtttcatgaatttcatgcacagggatga 2808



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 89   cattggaaacctacatgtggtgtgaa 114
            |||||||||||||| |||||||||||
Sbjct: 2318 cattggaaacctacttgtggtgtgaa 2343



to top

>emb|AJ496418.1|PPE496418 Prunus persica mRNA for catalase (cat1 gene)
          Length = 1813

 Score =  182 bits (92), Expect = 9e-43
 Identities = 320/396 (80%)
 Strand = Plus / Plus

                                                                        
Query: 184  tgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgc 243
            |||||| ||||||||||| || ||||| || ||||| ||||  || ||||| |||||| |
Sbjct: 776  tgattccattgcagctggcaactaccctgagtggaaactttatattcagacaattgatcc 835

                                                                        
Query: 244  tgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 303
            |||||| ||||| ||||||||||||||||| |||||||| || ||||||||||| || ||
Sbjct: 836  tgatcatgaggacagatttgactttgacccacttgatgtaactaagacctggcctgaaga 895

                                                                        
Query: 304  catcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttctt 363
             ||  | || ||||| |||||||| ||  |||| ||||| || |||||||| || |||||
Sbjct: 896  tattcttcctctgcagccagttggccgtctggttctgaataaaaacattgataacttctt 955

                                                                        
Query: 364  cgcggaaaatgaacagcttgctttctgcccagcagtcactgtccctggaatccactactc 423
             || || |||||||| ||||| || ||||| ||  |   |||||||||  || |||| ||
Sbjct: 956  tgcagagaatgaacaacttgcattttgccctgccattgttgtccctggtgtctactattc 1015

                                                                        
Query: 424  tgatgataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgtct 483
             ||||||||| ||||||| ||  | |||||||| ||| ||||||| || |||||||||||
Sbjct: 1016 agatgataagttgctccaaactcgaatcttctcctattctgatactcagaggcaccgtct 1075

                                                                        
Query: 484  tggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaacca 543
            ||| || |||||  ||  |||||| |||||||| || || ||| |||| || ||||| ||
Sbjct: 1076 tggcccgaactatctgcagctcccagtgaatgctcccaagtgttctcatcataacaatca 1135

                                                
Query: 544  tcatgatggcttaatgaatttcattcacagggatga 579
            |||||| || || ||||||||||| |||||||||||
Sbjct: 1136 tcatgagggattcatgaatttcatgcacagggatga 1171



to top

>gb|AF104452.1|AF104452 Brassica juncea catalase (CAT2) mRNA, complete cds
          Length = 1778

 Score =  178 bits (90), Expect = 1e-41
 Identities = 258/314 (82%)
 Strand = Plus / Plus

                                                                        
Query: 263  gactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaacca 322
            |||||||||||||| |||||||||||||| ||||| || || ||| | || || || || 
Sbjct: 910  gactttgaccctctcgatgtcaccaagacttggcctgaagatatcttgcctctccagccc 969

                                                                        
Query: 323  gttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagctt 382
            ||||| || |||||  |||||||||||||||| || ||||| ||||| ||||| ||||||
Sbjct: 970  gttgggcgtatggtgttgaacaagaacattgataacttctttgcggagaatgagcagctt 1029

                                                                        
Query: 383  gctttctgcccagcagtcactgtccctggaatccactactctgatgataagctgctccag 442
            || ||||| || ||  ||| ||| || || || ||||||||||| ||||||||||| |||
Sbjct: 1030 gccttctgtcctgctatcattgttccggggatacactactctgacgataagctgcttcag 1089

                                                                        
Query: 443  acaaggatcttctcatatgctgatacccaaaggcaccgtcttggtccaaactacttgatg 502
            ||| |  ||||||| |||||||| || || || ||||||||||| || |||||| |   |
Sbjct: 1090 acacgtgtcttctcttatgctgacactcagagacaccgtcttggacctaactacctccag 1149

                                                                        
Query: 503  ctccccgtgaatgccccgaaatgtgctcaccacaacaaccatcatgatggcttaatgaat 562
            || || || ||||| || || |||||||||||||||||||| ||||| ||||| ||||||
Sbjct: 1150 ctaccagttaatgctccaaagtgtgctcaccacaacaaccaccatgaaggcttcatgaat 1209

                          
Query: 563  ttcattcacaggga 576
            ||||| ||||||||
Sbjct: 1210 ttcatgcacaggga 1223



to top

>emb|AJ297612.1|DLA297612 Digitalis lanata partial mRNA for catalase (cat gene)
          Length = 992

 Score =  174 bits (88), Expect = 2e-40
 Identities = 316/392 (80%)
 Strand = Plus / Plus

                                                                       
Query: 188 tctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgat 247
           ||||||||||| || || || ||||| ||||| || || || ||||| || ||| | |||
Sbjct: 91  tctattgcagcaggcaactatccagagtggaaactgtttattcagactatagatccagat 150

                                                                       
Query: 248 cacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatc 307
           ||||| || |||||||| |||||||| |||||||| ||||| || ||||| ||||| |||
Sbjct: 151 cacgaagacagatttgattttgacccacttgatgtgaccaaaacatggcctgaggatatc 210

                                                                       
Query: 308 atcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcg 367
            | || || || ||||| || || |||||  |||||||||||||||| || ||||| || 
Sbjct: 211 ttgcctctccagccagtcggtcgcatggttttgaacaagaacattgataacttctttgct 270

                                                                       
Query: 368 gaaaatgaacagcttgctttctgcccagcagtcactgtccctggaatccactactctgat 427
           || ||||||||| | ||||||||||| ||  |   |||||||||  |  |||| ||||||
Sbjct: 271 gagaatgaacagttggctttctgccctgctattgttgtccctggtgtttactattctgat 330

                                                                       
Query: 428 gataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgtcttggt 487
           |||||||||||||| ||  |||| || |||||| ||||||| || |||||||||||||| 
Sbjct: 331 gataagctgctccaaacccggatattttcatattctgatacacagaggcaccgtcttggg 390

                                                                       
Query: 488 ccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaaccatcat 547
           ||||||||  ||  |||||| |  |||||||| |||||||| || |||||||| ||||||
Sbjct: 391 ccaaactatctgcagctcccagctaatgcccccaaatgtgcccatcacaacaatcatcat 450

                                           
Query: 548 gatggcttaatgaatttcattcacagggatga 579
           || || || ||||| || || |||||||||||
Sbjct: 451 gaaggtttcatgaactttatgcacagggatga 482



to top

>gb|AY128695.1| Capsicum annuum catalase 3 (CAT3) mRNA, complete cds
          Length = 1745

 Score =  174 bits (88), Expect = 2e-40
 Identities = 256/312 (82%)
 Strand = Plus / Plus

                                                                        
Query: 184  tgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgc 243
            |||||| ||||| |||||||| || ||| | ||||| || |||||||| || || ||| |
Sbjct: 800  tgattcaattgctgctgggaactatccaaagtggaaactgttcatccaaactatcgatcc 859

                                                                        
Query: 244  tgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 303
            |||||| || || | |||||||||||||||  | ||||| ||||||| |||||| |||||
Sbjct: 860  tgatcatgaagacaaatttgactttgaccccttagatgtaaccaagatctggcctgagga 919

                                                                        
Query: 304  catcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttctt 363
            |||  | ||| | ||||||||||| ||  ||||| |||||||||| || ||||| |||||
Sbjct: 920  cattttgccattacaaccagttggtcgcttggtattgaacaagaatatcgacaacttctt 979

                                                                        
Query: 364  cgcggaaaatgaacagcttgctttctgcccagcagtcactgtccctggaatccactactc 423
             |  || || || ||||||||||| ||||| ||  | | ||||||||| ||||| |||||
Sbjct: 980  tgtagagaacgagcagcttgctttttgccctgccattattgtccctggtatccattactc 1039

                                                                        
Query: 424  tgatgataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgtct 483
             ||||||||||| |||||||| ||| | |||||||||||||||||||| || ||||||||
Sbjct: 1040 ggatgataagcttctccagactagggtattctcatatgctgatacccagagacaccgtct 1099

                        
Query: 484  tggtccaaacta 495
            ||| ||||||||
Sbjct: 1100 tgggccaaacta 1111



to top

>emb|X64271.1|ATCATRNA A.thaliana mRNA for catalase
          Length = 1803

 Score =  168 bits (85), Expect = 1e-38
 Identities = 313/389 (80%)
 Strand = Plus / Plus

                                                                        
Query: 188  tctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgat 247
            ||||| || ||||| || ||||| ||||||||||| || ||||| | ||||||| ||| |
Sbjct: 826  tctatagctgctggaaactaccctgaatggaagctctttatccaaatcattgatcctgct 885

                                                                        
Query: 248  cacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatc 307
             | || || |  || ||||||||||| || ||||| |||||||||||||| ||||| |||
Sbjct: 886  gatgaagacaagttcgactttgacccgctcgatgtgaccaagacctggcctgaggatatc 945

                                                                        
Query: 308  atcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcg 367
             | || || ||||| |||||||| |||||  ||||||||||||||||||| ||||| || 
Sbjct: 946  ttgcctcttcaacctgttggacgtatggtgttgaacaagaacattgacaacttctttgca 1005

                                                                        
Query: 368  gaaaatgaacagcttgctttctgcccagcagtcactgtccctggaatccactactctgat 427
            || ||||| || ||||||||||| || ||| | | |||||| || || || ||||| |||
Sbjct: 1006 gagaatgagcaacttgctttctgtcctgcaattattgtcccagggatacattactcagat 1065

                                                                        
Query: 428  gataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgtcttggt 487
            ||||||||||| || ||  |  ||||||| ||||| ||||| || || |||||  | || 
Sbjct: 1066 gataagctgcttcaaacccgtgtcttctcctatgccgatactcagagacaccgcttggga 1125

                                                                        
Query: 488  ccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaaccatcat 547
            ||||||||| |   ||| || || ||||| || ||||||||||||||||||||||| |||
Sbjct: 1126 ccaaactaccttcagctgccagtcaatgctccaaaatgtgctcaccacaacaaccaccat 1185

                                         
Query: 548  gatggcttaatgaatttcattcacaggga 576
            || || || ||||||||||| ||||||||
Sbjct: 1186 gagggattcatgaatttcatgcacaggga 1214



to top

>emb|X94447.1|ATCATAL A.thaliana cat gene for catalase
          Length = 3677

 Score =  163 bits (82), Expect = 8e-37
 Identities = 391/494 (79%)
 Strand = Plus / Plus

                                                                        
Query: 83   aagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaagccgttact 142
            ||||||||||||||||| || ||||| || ||||  || ||||| || || ||  ||  |
Sbjct: 2468 aagttccattggaaaccaacttgtggagtcaagtctcttttggaagaagatgcaattcgt 2527

                                                                        
Query: 143  gttggaggcacctgccacacccatgccacaaaggacttgactgattctattgcagctggg 202
            |||||||| |||  |||||  ||||| ||  | ||||||  ||| ||||| || ||||| 
Sbjct: 2528 gttggaggaaccaaccacagtcatgcgactcaagacttgtatgactctatagctgctgga 2587

                                                                        
Query: 203  aattacccagaatggaagcttttcatccagaccattgatgctgatcacgaggatagattt 262
            || ||||| ||||||||||| || ||||| | ||||||| ||| | | || || |  || 
Sbjct: 2588 aactaccctgaatggaagctctttatccaaatcattgatcctgctgatgaagacaagttc 2647

                                                                        
Query: 263  gactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaacca 322
            ||||||||||| || ||||| |||||||||||||| || || ||| | || || ||||| 
Sbjct: 2648 gactttgacccgctcgatgtaaccaagacctggcctgaagatatcttgcctctccaacct 2707

                                                                        
Query: 323  gttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagctt 382
            |||||||| |||||  ||||||||||||||||||| ||||| || || ||||| || |||
Sbjct: 2708 gttggacgtatggtgttgaacaagaacattgacaacttctttgcagagaatgagcaactt 2767

                                                                        
Query: 383  gctttctgcccagcagtcactgtccctggaatccactactctgatgataagctgctccag 442
            || ||||| || ||| | | ||| || || || |||||||| || || |||||||| || 
Sbjct: 2768 gccttctgtcctgcaattattgttccagggatacactactcagacgacaagctgcttcaa 2827

                                                                        
Query: 443  acaaggatcttctcatatgctgatacccaaaggcaccgtcttggtccaaactacttgatg 502
            ||  |  ||||||| ||||| ||||| || || ||||||||||| ||||||||| |   |
Sbjct: 2828 acccgtgtcttctcctatgccgatactcagagacaccgtcttggaccaaactaccttcag 2887

                                                                        
Query: 503  ctccccgtgaatgccccgaaatgtgctcaccacaacaaccatcatgatggcttaatgaat 562
            || || || ||||| || ||||||||||||||||||||||| ||||| || || ||||||
Sbjct: 2888 ctaccagtcaatgctccaaaatgtgctcaccacaacaaccaccatgagggattcatgaat 2947

                          
Query: 563  ttcattcacaggga 576
            ||||| ||||||||
Sbjct: 2948 ttcatgcacaggga 2961



to top

>gb|AY173073.1| Hypericum perforatum catalase (cat1) mRNA, complete cds
          Length = 1800

 Score =  163 bits (82), Expect = 8e-37
 Identities = 315/390 (80%), Gaps = 2/390 (0%)
 Strand = Plus / Plus

                                                                        
Query: 191  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 250
            ||||| ||||| || || || ||||||||||| ||||||||||| |||||| ||||||| 
Sbjct: 857  attgctgctggtaactatccggaatggaagctcttcatccagacgattgatcctgatcat 916

                                                                        
Query: 251  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 310
            |||||||| ||||||||||||||||||||||| |||||||| ||||| || |||||  | 
Sbjct: 917  gaggataggtttgactttgaccctcttgatgtgaccaagacatggccggaagacattttg 976

                                                                        
Query: 311  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaa 370
            || || || || ||||| ||  |||| |||||||||||||| ||||| ||||| || || 
Sbjct: 977  cctcttcagcctgttggccgcttggtcctgaacaagaacatcgacaacttctttgctgag 1036

                                                                        
Query: 371  aatgaacagcttgctttctgcccagcagtcactgtccctggaatccactactctgatgat 430
            ||||| |||||||| |||||||| ||  |   ||| ||||| ||| ||||||| || |||
Sbjct: 1037 aatgagcagcttgcattctgccctgccattgttgttcctggcatctactactcagacgat 1096

                                                                        
Query: 431  aagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgtcttggtcca 490
            ||||| || |||||  | |||||||| ||  | || || || || ||||||||||| || 
Sbjct: 1097 aagcttcttcagactcgaatcttctcttactcggacactcagagacaccgtcttgggccc 1156

                                                                        
Query: 491  aacta-cttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaaccatcatga 549
            ||||| ||| | |||||| || ||||| || || | ||| || || ||||||||||||||
Sbjct: 1157 aactatcttca-gctccctgtcaatgctcccaagtctgcccatcataacaaccatcatga 1215

                                          
Query: 550  tggcttaatgaatttcattcacagggatga 579
             || || ||||| ||||| |||||||||||
Sbjct: 1216 aggtttcatgaacttcatgcacagggatga 1245



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 83  aagttccattggaaacctacatgtggtgtgaag 115
           |||||||| ||||| ||||| ||||||||||||
Sbjct: 749 aagttccactggaagcctacttgtggtgtgaag 781



to top

>dbj|D55645.1|CUCCAT1 Pumpkin mRNA for catalase (cat1), complete cds
          Length = 1800

 Score =  151 bits (76), Expect = 3e-33
 Identities = 253/312 (81%)
 Strand = Plus / Plus

                                                                        
Query: 184  tgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgc 243
            |||||| |||||||| || || ||||| || |||||||||||||| ||||| |||||  |
Sbjct: 883  tgattcaattgcagcaggcaactaccccgagtggaagcttttcattcagactattgaccc 942

                                                                        
Query: 244  tgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 303
            |||||| || || | || ||||||||||||||| ||||| |||||||| ||||| |||||
Sbjct: 943  tgatcatgaagacaaatatgactttgaccctctagatgtaaccaagacatggcctgagga 1002

                                                                        
Query: 304  catcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttctt 363
             ||| | || ||||| |||||||| || |||||  |||| |||||||| || || |||||
Sbjct: 1003 tatcttgcccctgcagccagttggccgcatggttttgaataagaacatcgataacttctt 1062

                                                                        
Query: 364  cgcggaaaatgaacagcttgctttctgcccagcagtcactgtccctggaatccactactc 423
             || || |||||||| || ||||| || || ||  | |  || |||||| || |||| ||
Sbjct: 1063 tgcagagaatgaacaactggctttttgtcctgccattatagttcctggagtctactattc 1122

                                                                        
Query: 424  tgatgataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgtct 483
             ||||| ||  |||| ||||| ||||||||||| ||||||||||| || |||||||||||
Sbjct: 1123 agatgacaaattgcttcagaccaggatcttctcctatgctgatactcagaggcaccgtct 1182

                        
Query: 484  tggtccaaacta 495
            ||| ||||||||
Sbjct: 1183 tggaccaaacta 1194



to top

>gb|L28740.1|HNNCATA Helianthus annuus catalase mRNA, complete cds
          Length = 1735

 Score =  149 bits (75), Expect = 1e-32
 Identities = 315/395 (79%)
 Strand = Plus / Plus

                                                                        
Query: 185  gattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgct 244
            ||||| ||||| ||||| || ||||| || ||||||||||| ||||||||||||||| | 
Sbjct: 785  gattcgattgctgctggaaactaccccgagtggaagctttttatccagaccattgatccg 844

                                                                        
Query: 245  gatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggac 304
            |||||||||||| |  | ||||||||||| |||||||| |||||||||||||| ||||| 
Sbjct: 845  gatcacgaggatcggctcgactttgacccgcttgatgttaccaagacctggcctgaggat 904

                                                                        
Query: 305  atcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 364
            ||| | ||  |||| || || || ||  ||||  |||||||||| |||||||| ||||| 
Sbjct: 905  atctttccgttgcagcctgtgggtcgtctggttttgaacaagaatattgacaacttcttt 964

                                                                        
Query: 365  gcggaaaatgaacagcttgctttctgcccagcagtcactgtccctggaatccactactct 424
            || || ||||||||||| || || || || ||  ||| ||| ||||||||| | || |||
Sbjct: 965  gctgagaatgaacagctggcattttgtcctgctatcattgttcctggaatctattattct 1024

                                                                        
Query: 425  gatgataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgtctt 484
            ||||||||| |||| || ||  | || ||||| ||| |||| || || ||||||||||||
Sbjct: 1025 gatgataagttgctgcaaacccgtattttctcgtattctgacactcagaggcaccgtctt 1084

                                                                        
Query: 485  ggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaaccat 544
            || || ||||| |||  ||| || |  ||||| || || |||||||| || || || || 
Sbjct: 1085 ggaccgaactatttgcagcttcctgcaaatgctcctaagtgtgctcatcataataatcac 1144

                                               
Query: 545  catgatggcttaatgaatttcattcacagggatga 579
             ||||||| || ||||||||||| ||||| |||||
Sbjct: 1145 tatgatggattcatgaatttcatgcacagagatga 1179



to top

>emb|Z36977.1|NPCAT3MR N.plumbaginifolia mRNA for catalase (cat3 gene)
          Length = 1688

 Score =  141 bits (71), Expect = 3e-30
 Identities = 305/383 (79%)
 Strand = Plus / Plus

                                                                        
Query: 185  gattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgct 244
            ||||| ||||| ||||| || || ||||| ||||| || |||||||| |  || ||| ||
Sbjct: 803  gattcaattgctgctggaaactatccagagtggaaactgttcatccaaattatcgatcct 862

                                                                        
Query: 245  gatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggac 304
            ||||| || || ||||||||||||||||| || ||||| |||||||||||||| ||||||
Sbjct: 863  gatcatgaagacagatttgactttgaccccctagatgtaaccaagacctggcctgaggac 922

                                                                        
Query: 305  atcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 364
            ||| | ||| |||| |||||||| ||  ||||| |||| ||||| || || || ||||| 
Sbjct: 923  atcttgccattgcagccagttggtcgcttggtattgaataagaatatcgataacttcttt 982

                                                                        
Query: 365  gcggaaaatgaacagcttgctttctgcccagcagtcactgtccctggaatccactactct 424
            || || |||||||||||||| || || || ||  |   |||||||||  |  |||  || 
Sbjct: 983  gcagagaatgaacagcttgccttttggcctgccattgttgtccctggtgtttactgttcg 1042

                                                                        
Query: 425  gatgataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgtctt 484
            ||||| ||||| |||||||| ||||| ||||||||| ||||| |||| || |||||||||
Sbjct: 1043 gatgacaagcttctccagactaggatattctcatattctgatgcccagagacaccgtctt 1102

                                                                        
Query: 485  ggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaaccat 544
            || ||||||||  ||  |||||| || || || || || |||||||| ||||| || || 
Sbjct: 1103 gggccaaactatctgcagctcccagttaacgctcccaagtgtgctcatcacaataatcac 1162

                                   
Query: 545  catgatggcttaatgaatttcat 567
            ||||| || || |||||||||||
Sbjct: 1163 catgaaggtttcatgaatttcat 1185



to top

>gb|AF035256.1|AF035256 Glycine max catalase (cat5) mRNA, partial cds
          Length = 1134

 Score =  139 bits (70), Expect = 1e-29
 Identities = 280/350 (80%)
 Strand = Plus / Plus

                                                                       
Query: 230 cagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtcaccaag 289
           ||||| || ||| |||| ||||| || | |||||||||||||||||||||||| || |||
Sbjct: 264 cagacaatagatcctgagcacgaagacaaatttgactttgaccctcttgatgttactaag 323

                                                                       
Query: 290 acctggccagaggacatcatcccactgcaaccagttggacggatggtactgaacaagaac 349
           || ||||| |||||||| || ||  |||| || ||||| ||  |||| ||||| ||||||
Sbjct: 324 acttggcctgaggacattatacccttgcagcctgttggtcgcttggtcctgaataagaac 383

                                                                       
Query: 350 attgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtccct 409
           || || |||||||| || || |||||||| ||||| || ||||| ||  |    || |||
Sbjct: 384 atagataatttctttgctgagaatgaacaacttgcattttgccctgccattgtggttcct 443

                                                                       
Query: 410 ggaatccactactctgatgataagctgctccagacaaggatcttctcatatgctgatacc 469
           ||  |  ||||||| ||||||||| |||| || || ||||| ||||| ||||||||| | 
Sbjct: 444 ggtgtatactactcagatgataagatgcttcaaaccaggatattctcttatgctgattca 503

                                                                       
Query: 470 caaaggcaccgtcttggtccaaactacttgatgctccccgtgaatgccccgaaatgtgct 529
           ||||||||| | ||||| ||||||||  ||   || || |  ||||| || || ||||||
Sbjct: 504 caaaggcacagacttggaccaaactatctgcaacttcctgctaatgctcccaagtgtgct 563

                                                             
Query: 530 caccacaacaaccatcatgatggcttaatgaatttcattcacagggatga 579
           ||||||||||| |||||||| || || |||||||||||||||||||||||
Sbjct: 564 caccacaacaatcatcatgaaggtttcatgaatttcattcacagggatga 613



to top

>dbj|D13557.1|VIRCAT Vigna radiata mRNA for catalase, complete cds
          Length = 1824

 Score =  135 bits (68), Expect = 2e-28
 Identities = 314/396 (79%)
 Strand = Plus / Plus

                                                                        
Query: 184  tgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgc 243
            |||||| ||||| ||||| || || || || ||||| || ||||| ||||| || ||| |
Sbjct: 821  tgattcgattgctgctggtaactatcctgagtggaaactattcattcagacaatagatcc 880

                                                                        
Query: 244  tgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 303
            ||| ||||| || | |||||||||||||||||||||||| |||||||| ||||| |||||
Sbjct: 881  tgagcacgaagacaaatttgactttgaccctcttgatgtaaccaagacttggcccgagga 940

                                                                        
Query: 304  catcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttctt 363
            ||| || ||  |||| || ||||| ||  |||| ||||| |||||||| || || |||||
Sbjct: 941  cattatacccttgcagcctgttggtcgcttggtcctgaataagaacatagataacttctt 1000

                                                                        
Query: 364  cgcggaaaatgaacagcttgctttctgcccagcagtcactgtccctggaatccactactc 423
             || || |||||||| ||||| || ||||| ||  | |  || |||||  |  | |||||
Sbjct: 1001 tgctgagaatgaacaacttgcattttgccctgccataatagttcctggtgtatattactc 1060

                                                                        
Query: 424  tgatgataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgtct 483
            |||||||||| |||| || || ||||| ||||| ||||||||| | || |||||| | ||
Sbjct: 1061 tgatgataagatgcttcaaaccaggatattctcttatgctgattcacagaggcacaggct 1120

                                                                        
Query: 484  tggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaacca 543
            ||| ||||||||  || | || || |  ||||| || || | ||||||||||||||| ||
Sbjct: 1121 tggaccaaactatctgctacttcctgccaatgctcccaagtctgctcaccacaacaatca 1180

                                                
Query: 544  tcatgatggcttaatgaatttcattcacagggatga 579
             ||||| || || ||||||||||| |||||||||||
Sbjct: 1181 ccatgaaggtttcatgaatttcatccacagggatga 1216



to top

>gb|AF104453.1|AF104453 Brassica juncea catalase (CAT3) mRNA, complete cds
          Length = 1769

 Score =  131 bits (66), Expect = 3e-27
 Identities = 324/410 (79%)
 Strand = Plus / Plus

                                                                        
Query: 167  gccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttttc 226
            |||||| ||||||||  ||| || ||||| ||||| || ||||| || |||||||| || 
Sbjct: 813  gccacacaggacttgtatgactccattgctgctggaaactaccctgagtggaagctcttt 872

                                                                        
Query: 227  atccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtcacc 286
            ||||||  ||||||| | | | |||| || |  || ||||||||||| || |||||||||
Sbjct: 873  atccaggtcattgatccagctgacgaagacaagttcgactttgacccactcgatgtcacc 932

                                                                        
Query: 287  aagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaacaag 346
            ||||||||||| ||| |  |  | || || ||||| ||||| || |||||  ||||||||
Sbjct: 933  aagacctggcctgagaatcttttgcctctccaacccgttggtcgtatggtgttgaacaag 992

                                                                        
Query: 347  aacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtc 406
            ||||||||||| ||||| ||||| ||||| |||||||| || ||||| ||  ||| ||| 
Sbjct: 993  aacattgacaacttctttgcggagaatgagcagcttgccttttgccctgctatcattgtt 1052

                                                                        
Query: 407  cctggaatccactactctgatgataagctgctccagacaaggatcttctcatatgctgat 466
            ||||| || || ||||| || || |||||||| |||||  |  ||||||| |||||||| 
Sbjct: 1053 cctgggatacattactcggacgacaagctgcttcagacgcgtgtcttctcttatgctgac 1112

                                                                        
Query: 467  acccaaaggcaccgtcttggtccaaactacttgatgctccccgtgaatgccccgaaatgt 526
            || || || ||||| ||||| || |||||| |   ||| || || ||||| || ||||||
Sbjct: 1113 actcagagacaccgccttggaccgaactaccttcagctgccagttaatgcacccaaatgt 1172

                                                              
Query: 527  gctcaccacaacaaccatcatgatggcttaatgaatttcattcacaggga 576
            ||||| |||||||| || ||||| || || ||||| ||||| ||||||||
Sbjct: 1173 gctcatcacaacaatcaccatgaggggttcatgaacttcatgcacaggga 1222



to top

>gb|AF104451.1|AF104451 Brassica juncea catalase (CAT1) mRNA, complete cds
          Length = 1778

 Score =  131 bits (66), Expect = 3e-27
 Identities = 324/410 (79%)
 Strand = Plus / Plus

                                                                        
Query: 167  gccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttttc 226
            |||||| ||||||||  ||| || ||||| ||||| || ||||| || |||||||| || 
Sbjct: 793  gccacacaggacttgtatgactccattgctgctggaaactaccctgagtggaagctcttt 852

                                                                        
Query: 227  atccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtcacc 286
            ||||||  ||||||| | | | |||| || |  || ||||||||||| || |||||||||
Sbjct: 853  atccaggtcattgatccagctgacgaagacaagttcgactttgacccactcgatgtcacc 912

                                                                        
Query: 287  aagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaacaag 346
            ||||||||||| ||| |  |  | || || ||||| ||||| || |||||  ||||||||
Sbjct: 913  aagacctggcctgagaatcttttgcctctccaacccgttggtcgtatggtgttgaacaag 972

                                                                        
Query: 347  aacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtc 406
            ||||||||||| ||||| ||||| ||||| |||||||| || ||||| ||  ||| ||| 
Sbjct: 973  aacattgacaacttctttgcggagaatgagcagcttgccttttgccctgctatcattgtt 1032

                                                                        
Query: 407  cctggaatccactactctgatgataagctgctccagacaaggatcttctcatatgctgat 466
            ||||| || || ||||| || || |||||||| |||||  |  ||||||| |||||||| 
Sbjct: 1033 cctgggatacattactcggacgacaagctgcttcagacgcgtgtcttctcttatgctgac 1092

                                                                        
Query: 467  acccaaaggcaccgtcttggtccaaactacttgatgctccccgtgaatgccccgaaatgt 526
            || || || ||||| ||||| || |||||| |   ||| || || ||||| || ||||||
Sbjct: 1093 actcagagacaccgccttggaccgaactaccttcagctgccagttaatgcacccaaatgt 1152

                                                              
Query: 527  gctcaccacaacaaccatcatgatggcttaatgaatttcattcacaggga 576
            ||||| |||||||| || ||||| || || ||||| ||||| ||||||||
Sbjct: 1153 gctcatcacaacaatcaccatgaggggttcatgaacttcatgcacaggga 1202



to top

>gb|AF035255.1|AF035255 Glycine max catalase (cat4) mRNA, complete cds
          Length = 1719

 Score =  129 bits (65), Expect = 1e-26
 Identities = 257/321 (80%)
 Strand = Plus / Plus

                                                                        
Query: 259  atttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgca 318
            |||||||||||||||||||||||| || ||||| ||||| |||||||| || ||  ||||
Sbjct: 880  atttgactttgaccctcttgatgttactaagacttggcctgaggacattatacccttgca 939

                                                                        
Query: 319  accagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaaca 378
             || ||||| ||  |||| ||||| || ||||| || |||||||| || || ||||||||
Sbjct: 940  gcctgttggtcgcttggtcctgaataaaaacatagataatttctttgctgagaatgaaca 999

                                                                        
Query: 379  gcttgctttctgcccagcagtcactgtccctggaatccactactctgatgataagctgct 438
             ||||| || ||||| ||  |    || |||||  |  ||||||| ||||||||| ||||
Sbjct: 1000 acttgcattttgccctgccattgtggttcctggtgtatactactcagatgataagatgct 1059

                                                                        
Query: 439  ccagacaaggatcttctcatatgctgatacccaaaggcaccgtcttggtccaaactactt 498
             ||||| ||||| ||||| ||||||||| | ||||||||| | ||||| ||||||||  |
Sbjct: 1060 tcagaccaggatattctcttatgctgattcacaaaggcacagacttggaccaaactatct 1119

                                                                        
Query: 499  gatgctccccgtgaatgccccgaaatgtgctcaccacaacaaccatcatgatggcttaat 558
            |   || || |  ||||| || || |||||||||||||| || |||||||| || || ||
Sbjct: 1120 gcaacttcctgctaatgctcccaagtgtgctcaccacaataatcatcatgaaggtttcat 1179

                                 
Query: 559  gaatttcattcacagggatga 579
            |||||||||||||||||||||
Sbjct: 1180 gaatttcattcacagggatga 1200



to top

>ref|NM_101914.2| Arabidopsis thaliana CAT1 (CATALASE 1); catalase AT1G20630 (CAT1)
            mRNA, complete cds
          Length = 1929

 Score =  117 bits (59), Expect = 4e-23
 Identities = 140/167 (83%)
 Strand = Plus / Plus

                                                                        
Query: 413  atccactactctgatgataagctgctccagacaaggatcttctcatatgctgatacccaa 472
            |||||||| || ||||||||||| ||||||||  |||||||||| || |||||||  || 
Sbjct: 1079 atccactattcagatgataagctactccagacccggatcttctcctacgctgatagtcag 1138

                                                                        
Query: 473  aggcaccgtcttggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcac 532
            || ||||||||||| ||||||||  ||   || || || |||||||| ||||||||||||
Sbjct: 1139 agacaccgtcttggaccaaactatctgcaactacctgttaatgcccctaaatgtgctcac 1198

                                                           
Query: 533  cacaacaaccatcatgatggcttaatgaatttcattcacagggatga 579
            |||||||| || |||||||| || ||||| ||||| |||||||||||
Sbjct: 1199 cacaacaatcaccatgatggttttatgaacttcatgcacagggatga 1245



to top

>gb|BT010373.1| Arabidopsis thaliana At1g20630 mRNA, complete cds
          Length = 1479

 Score =  117 bits (59), Expect = 4e-23
 Identities = 140/167 (83%)
 Strand = Plus / Plus

                                                                        
Query: 413  atccactactctgatgataagctgctccagacaaggatcttctcatatgctgatacccaa 472
            |||||||| || ||||||||||| ||||||||  |||||||||| || |||||||  || 
Sbjct: 997  atccactattcagatgataagctactccagacccggatcttctcctacgctgatagtcag 1056

                                                                        
Query: 473  aggcaccgtcttggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcac 532
            || ||||||||||| ||||||||  ||   || || || |||||||| ||||||||||||
Sbjct: 1057 agacaccgtcttggaccaaactatctgcaactacctgttaatgcccctaaatgtgctcac 1116

                                                           
Query: 533  cacaacaaccatcatgatggcttaatgaatttcattcacagggatga 579
            |||||||| || |||||||| || ||||| ||||| |||||||||||
Sbjct: 1117 cacaacaatcaccatgatggttttatgaacttcatgcacagggatga 1163



to top

>gb|AY136424.1| Arabidopsis thaliana expressed protein (At1g20630) mRNA, complete cds
          Length = 1746

 Score =  117 bits (59), Expect = 4e-23
 Identities = 140/167 (83%)
 Strand = Plus / Plus

                                                                        
Query: 413  atccactactctgatgataagctgctccagacaaggatcttctcatatgctgatacccaa 472
            |||||||| || ||||||||||| ||||||||  |||||||||| || |||||||  || 
Sbjct: 1079 atccactattcagatgataagctactccagacccggatcttctcctacgctgatagtcag 1138

                                                                        
Query: 473  aggcaccgtcttggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcac 532
            || ||||||||||| ||||||||  ||   || || || |||||||| ||||||||||||
Sbjct: 1139 agacaccgtcttggaccaaactatctgcaactacctgttaatgcccctaaatgtgctcac 1198

                                                           
Query: 533  cacaacaaccatcatgatggcttaatgaatttcattcacagggatga 579
            |||||||| || |||||||| || ||||| ||||| |||||||||||
Sbjct: 1199 cacaacaatcaccatgatggttttatgaacttcatgcacagggatga 1245



to top

>gb|AF151368.1|AF151368 Hevea brasiliensis catalase (cat) mRNA, complete cds
          Length = 1745

 Score =  117 bits (59), Expect = 4e-23
 Identities = 167/203 (82%)
 Strand = Plus / Plus

                                                                        
Query: 191  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 250
            ||||||||||| || || ||||||||||| |||| ||||||||| || ||| ||||||| 
Sbjct: 844  attgcagctggcaactatccagaatggaaactttacatccagacaatggatcctgatcat 903

                                                                        
Query: 251  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 310
            || || | |||||| ||||| || |||||||| || ||||||||||| ||||| ||| | 
Sbjct: 904  gaagacaaatttgattttgatccacttgatgtgactaagacctggcccgaggatatcctg 963

                                                                        
Query: 311  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaa 370
            || || ||||| ||||| ||  ||||  |||| |||||||||||||||||||| || || 
Sbjct: 964  cctcttcaaccggttggccgcttggtcttgaataagaacattgacaatttctttgctgag 1023

                                   
Query: 371  aatgaacagcttgctttctgccc 393
            ||||| || ||||| ||||||||
Sbjct: 1024 aatgagcaacttgcgttctgccc 1046



 Score = 48.1 bits (24), Expect = 0.032
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                    
Query: 524  tgtgctcaccacaacaaccatcatgatggcttaatgaatttcattcacagggatga 579
            |||||||| |||||||| || ||||| || || ||||||||||| ||||| |||||
Sbjct: 1177 tgtgctcatcacaacaatcaccatgacggtttcatgaatttcatgcacagagatga 1232



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 92  tggaaacctacatgtggtgtgaagtg 117
           ||||||||||| ||||||||||||||
Sbjct: 745 tggaaacctacttgtggtgtgaagtg 770



to top

>gb|AC069251.5|AC069251 Genomic sequence for Arabidopsis thaliana BAC F2D10 from chromosome I,
             complete sequence
          Length = 143879

 Score =  117 bits (59), Expect = 4e-23
 Identities = 140/167 (83%)
 Strand = Plus / Plus

                                                                         
Query: 413   atccactactctgatgataagctgctccagacaaggatcttctcatatgctgatacccaa 472
             |||||||| || ||||||||||| ||||||||  |||||||||| || |||||||  || 
Sbjct: 39303 atccactattcagatgataagctactccagacccggatcttctcctacgctgatagtcag 39362

                                                                         
Query: 473   aggcaccgtcttggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcac 532
             || ||||||||||| ||||||||  ||   || || || |||||||| ||||||||||||
Sbjct: 39363 agacaccgtcttggaccaaactatctgcaactacctgttaatgcccctaaatgtgctcac 39422

                                                            
Query: 533   cacaacaaccatcatgatggcttaatgaatttcattcacagggatga 579
             |||||||| || |||||||| || ||||| ||||| |||||||||||
Sbjct: 39423 cacaacaatcaccatgatggttttatgaacttcatgcacagggatga 39469



 Score =  107 bits (54), Expect = 4e-20
 Identities = 144/174 (82%)
 Strand = Plus / Plus

                                                                         
Query: 191   attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 250
             |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 35671 attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 35730

                                                                         
Query: 251   gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 310
             |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 35731 gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 35790

                                                                   
Query: 311   ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 364
             || |||||||| ||||| ||  |||| ||||||| || ||||||||||||||||
Sbjct: 35791 cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaatttcttc 35844



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 137/173 (79%)
 Strand = Plus / Plus

                                                                         
Query: 407   cctggaatccactactctgatgataagctgctccagacaaggatcttctcatatgctgat 466
             ||||||||| ||||||| || || ||||||||||||   ||||||||  | |||| ||| 
Sbjct: 35887 cctggaatctactactcagacgacaagctgctccagtgtaggatctttgcttatggtgac 35946

                                                                         
Query: 467   acccaaaggcaccgtcttggtccaaactacttgatgctccccgtgaatgccccgaaatgt 526
             || || || || || ||||| || || || |||  ||| || || ||||| || ||||||
Sbjct: 35947 actcagagacatcgccttggaccgaattatttgcagcttccagtcaatgctcccaaatgt 36006

                                                                  
Query: 527   gctcaccacaacaaccatcatgatggcttaatgaatttcattcacagggatga 579
             |||||||||||||| || ||||| || || ||||| ||||| ||||| |||||
Sbjct: 36007 gctcaccacaacaatcaccatgaaggttttatgaacttcatgcacagagatga 36059



to top

>gb|AC027665.4|AC027665 Genomic sequence for Arabidopsis thaliana BAC F5M15 from chromosome I,
             complete sequence
          Length = 99231

 Score =  117 bits (59), Expect = 4e-23
 Identities = 140/167 (83%)
 Strand = Plus / Minus

                                                                         
Query: 413   atccactactctgatgataagctgctccagacaaggatcttctcatatgctgatacccaa 472
             |||||||| || ||||||||||| ||||||||  |||||||||| || |||||||  || 
Sbjct: 15812 atccactattcagatgataagctactccagacccggatcttctcctacgctgatagtcag 15753

                                                                         
Query: 473   aggcaccgtcttggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcac 532
             || ||||||||||| ||||||||  ||   || || || |||||||| ||||||||||||
Sbjct: 15752 agacaccgtcttggaccaaactatctgcaactacctgttaatgcccctaaatgtgctcac 15693

                                                            
Query: 533   cacaacaaccatcatgatggcttaatgaatttcattcacagggatga 579
             |||||||| || |||||||| || ||||| ||||| |||||||||||
Sbjct: 15692 cacaacaatcaccatgatggttttatgaacttcatgcacagggatga 15646



 Score =  107 bits (54), Expect = 4e-20
 Identities = 144/174 (82%)
 Strand = Plus / Minus

                                                                         
Query: 191   attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 250
             |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 19444 attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 19385

                                                                         
Query: 251   gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 310
             |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 19384 gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 19325

                                                                   
Query: 311   ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 364
             || |||||||| ||||| ||  |||| ||||||| || ||||||||||||||||
Sbjct: 19324 cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaatttcttc 19271



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 137/173 (79%)
 Strand = Plus / Minus

                                                                         
Query: 407   cctggaatccactactctgatgataagctgctccagacaaggatcttctcatatgctgat 466
             ||||||||| ||||||| || || ||||||||||||   ||||||||  | |||| ||| 
Sbjct: 19228 cctggaatctactactcagacgacaagctgctccagtgtaggatctttgcttatggtgac 19169

                                                                         
Query: 467   acccaaaggcaccgtcttggtccaaactacttgatgctccccgtgaatgccccgaaatgt 526
             || || || || || ||||| || || || |||  ||| || || ||||| || ||||||
Sbjct: 19168 actcagagacatcgccttggaccgaattatttgcagcttccagtcaatgctcccaaatgt 19109

                                                                  
Query: 527   gctcaccacaacaaccatcatgatggcttaatgaatttcattcacagggatga 579
             |||||||||||||| || ||||| || || ||||| ||||| ||||| |||||
Sbjct: 19108 gctcaccacaacaatcaccatgaaggttttatgaacttcatgcacagagatga 19056



to top

>gb|AF021937.1|AF021937 Arabidopsis thaliana catalase 3 (CAT3) and catalase 1 (CAT1) genes,
            complete cds
          Length = 7707

 Score =  117 bits (59), Expect = 4e-23
 Identities = 140/167 (83%)
 Strand = Plus / Plus

                                                                        
Query: 413  atccactactctgatgataagctgctccagacaaggatcttctcatatgctgatacccaa 472
            |||||||| || ||||||||||| ||||||||  |||||||||| || |||||||  || 
Sbjct: 6370 atccactattcagatgataagctactccagacccggatcttctcctacgctgatagtcag 6429

                                                                        
Query: 473  aggcaccgtcttggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcac 532
            || ||||||||||| ||||||||  ||   || || || |||||||| ||||||||||||
Sbjct: 6430 agacaccgtcttggaccaaactatctgcaactacctgttaatgcccctaaatgtgctcac 6489

                                                           
Query: 533  cacaacaaccatcatgatggcttaatgaatttcattcacagggatga 579
            |||||||| || |||||||| || ||||| ||||| |||||||||||
Sbjct: 6490 cacaacaatcaccatgatggttttatgaacttcatgcacagggatga 6536



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 143/174 (82%)
 Strand = Plus / Plus

                                                                        
Query: 191  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 250
            |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 2738 attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 2797

                                                                        
Query: 251  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 310
            |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 2798 gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 2857

                                                                  
Query: 311  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 364
            || |||||||| ||||| ||  |||| ||||||| || ||||||||| ||||||
Sbjct: 2858 cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaacttcttc 2911



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 137/173 (79%)
 Strand = Plus / Plus

                                                                        
Query: 407  cctggaatccactactctgatgataagctgctccagacaaggatcttctcatatgctgat 466
            ||||||||| ||||||| || || ||||||||||||   ||||||||  | |||| ||| 
Sbjct: 2954 cctggaatctactactcagacgacaagctgctccagtgtaggatctttgcttatggtgac 3013

                                                                        
Query: 467  acccaaaggcaccgtcttggtccaaactacttgatgctccccgtgaatgccccgaaatgt 526
            || || || || || ||||| || || || |||  ||| || || ||||| || ||||||
Sbjct: 3014 actcagagacatcgccttggaccgaattatttgcagcttccagtcaatgctcccaaatgt 3073

                                                                 
Query: 527  gctcaccacaacaaccatcatgatggcttaatgaatttcattcacagggatga 579
            |||||||||||||| || ||||| || || ||||| ||||| ||||| |||||
Sbjct: 3074 gctcaccacaacaatcaccatgaaggttttatgaacttcatgcacagagatga 3126



to top

>emb|AJ302710.1|BPE302710 Betula pendula partial mRNA for catalase (cat gene)
          Length = 451

 Score =  111 bits (56), Expect = 3e-21
 Identities = 257/324 (79%)
 Strand = Plus / Plus

                                                                       
Query: 226 catccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtcac 285
           ||||||||  |||||  ||||||| ||||| | ||||||||||||||| |||||||| ||
Sbjct: 121 catccagataattgaccctgatcatgaggacaaatttgactttgacccacttgatgtgac 180

                                                                       
Query: 286 caagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaacaa 345
           ||| | |||||| ||||||||  | || ||||| |||||||| ||  ||||  |||||||
Sbjct: 181 caaaatctggcccgaggacattctgcccctgcagccagttggccgcttggtcttgaacaa 240

                                                                       
Query: 346 gaacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactgt 405
           |||||| ||||| |||||||| || |||||||| ||||| || |||||  |  |    ||
Sbjct: 241 gaacatcgacaacttcttcgcagagaatgaacaacttgcattttgcccttccattgtggt 300

                                                                       
Query: 406 ccctggaatccactactctgatgataagctgctccagacaaggatcttctcatatgctga 465
            |||||  || ||||||| ||||| ||| ||||||||||  | ||||| || ||| ||||
Sbjct: 301 tcctggtgtctactactcagatgacaagttgctccagactcgaatcttttcctattctga 360

                                                                       
Query: 466 tacccaaaggcaccgtcttggtccaaactacttgatgctccccgtgaatgccccgaaatg 525
           ||| || ||||||||||| || ||||||||| ||   ||||| |  ||||| || |||||
Sbjct: 361 tactcagaggcaccgtctcggaccaaactacctgcaactcccagctaatgctcccaaatg 420

                                   
Query: 526 tgctcaccacaacaaccatcatga 549
            ||||| |||||||| || |||||
Sbjct: 421 cgctcatcacaacaatcaccatga 444



to top

>gb|AF243518.1|AF243518 Helianthus annuus catalase 3 (CATA3) mRNA, complete cds
          Length = 1860

 Score =  109 bits (55), Expect = 1e-20
 Identities = 118/139 (84%)
 Strand = Plus / Plus

                                                                        
Query: 243  ctgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagg 302
            ||||||| || |||||  ||||||||||||| || |||| ||||| ||||||||| ||||
Sbjct: 864  ctgatcatgaagataggcttgactttgacccgctcgatggcaccatgacctggcccgagg 923

                                                                        
Query: 303  acatcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttct 362
            ||||||| ||  |||| || ||||| || |||||  ||||||||||||||||||| ||||
Sbjct: 924  acatcatacctttgcagcccgttgggcgtatggtgttgaacaagaacattgacaacttct 983

                               
Query: 363  tcgcggaaaatgaacagct 381
            | || ||||||||||||||
Sbjct: 984  ttgctgaaaatgaacagct 1002



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 75/91 (82%)
 Strand = Plus / Plus

                                                                        
Query: 462  ctgatacccaaaggcaccgtcttggtccaaactacttgatgctccccgtgaatgccccga 521
            |||||||||||||||||||||| || || || ||||||  |||||| || ||||| || |
Sbjct: 1083 ctgatacccaaaggcaccgtctcggaccgaattacttgcagctccctgtcaatgcaccta 1142

                                           
Query: 522  aatgtgctcaccacaacaaccatcatgatgg 552
            | |||||||| || || || ||| |||||||
Sbjct: 1143 agtgtgctcatcataataatcattatgatgg 1173



to top

>gb|AF069319.1|AF069319 Mesembryanthemum crystallinum leaf catalase mRNA, complete cds
          Length = 1845

 Score =  109 bits (55), Expect = 1e-20
 Identities = 229/287 (79%)
 Strand = Plus / Plus

                                                                        
Query: 254  gatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatccca 313
            |||| ||||||||||||||| || ||||| |||||||| ||||| ||||||||  | || 
Sbjct: 925  gataaatttgactttgacccactagatgttaccaagacttggcctgaggacattttgccg 984

                                                                        
Query: 314  ctgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaat 373
            ||||| ||||| || ||  ||||  ||||||| ||||||||||| ||||| || ||||||
Sbjct: 985  ctgcagccagtgggtcgtttggttttgaacaaaaacattgacaacttctttgcagaaaat 1044

                                                                        
Query: 374  gaacagcttgctttctgcccagcagtcactgtccctggaatccactactctgatgataag 433
            || ||||| || || ||||| |   |    || |||||  || ||||||| |||||||||
Sbjct: 1045 gagcagctggccttttgccctggtattgtggttcctggtgtctactactcagatgataag 1104

                                                                        
Query: 434  ctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgtcttggtccaaac 493
            || || ||||| || || ||||| || ||||||||||| || ||||||||||| || |||
Sbjct: 1105 ctcctgcagactagaattttctcgtacgctgatacccagagacaccgtcttggacccaac 1164

                                                           
Query: 494  tacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaa 540
            ||| ||  ||| || || ||||| || || |||||||||||||||||
Sbjct: 1165 tacctgcagcttccagttaatgcaccaaagtgtgctcaccacaacaa 1211



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 83  aagttccattggaaacctacatgtggtgt 111
           ||||||||||||||||| || ||||||||
Sbjct: 754 aagttccattggaaaccaacctgtggtgt 782



to top

>ref|NM_101913.2| Arabidopsis thaliana CAT3 (CATALASE 3); catalase AT1G20620 (CAT3)
            transcript variant AT1G20620.1 mRNA, complete cds
          Length = 1832

 Score =  107 bits (54), Expect = 4e-20
 Identities = 144/174 (82%)
 Strand = Plus / Plus

                                                                        
Query: 191  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 250
            |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 834  attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 893

                                                                        
Query: 251  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 310
            |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 894  gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 953

                                                                  
Query: 311  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 364
            || |||||||| ||||| ||  |||| ||||||| || ||||||||||||||||
Sbjct: 954  cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaatttcttc 1007



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 137/173 (79%)
 Strand = Plus / Plus

                                                                        
Query: 407  cctggaatccactactctgatgataagctgctccagacaaggatcttctcatatgctgat 466
            ||||||||| ||||||| || || ||||||||||||   ||||||||  | |||| ||| 
Sbjct: 1050 cctggaatctactactcagacgacaagctgctccagtgtaggatctttgcttatggtgac 1109

                                                                        
Query: 467  acccaaaggcaccgtcttggtccaaactacttgatgctccccgtgaatgccccgaaatgt 526
            || || || || || ||||| || || || |||  ||| || || ||||| || ||||||
Sbjct: 1110 actcagagacatcgccttggaccgaattatttgcagcttccagtcaatgctcccaaatgt 1169

                                                                 
Query: 527  gctcaccacaacaaccatcatgatggcttaatgaatttcattcacagggatga 579
            |||||||||||||| || ||||| || || ||||| ||||| ||||| |||||
Sbjct: 1170 gctcaccacaacaatcaccatgaaggttttatgaacttcatgcacagagatga 1222



to top

>ref|NM_202144.1| Arabidopsis thaliana CAT3 (CATALASE 3); catalase AT1G20620 (CAT3)
            transcript variant AT1G20620.2 mRNA, complete cds
          Length = 1931

 Score =  107 bits (54), Expect = 4e-20
 Identities = 144/174 (82%)
 Strand = Plus / Plus

                                                                        
Query: 191  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 250
            |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 834  attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 893

                                                                        
Query: 251  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 310
            |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 894  gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 953

                                                                  
Query: 311  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 364
            || |||||||| ||||| ||  |||| ||||||| || ||||||||||||||||
Sbjct: 954  cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaatttcttc 1007



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 137/173 (79%)
 Strand = Plus / Plus

                                                                        
Query: 407  cctggaatccactactctgatgataagctgctccagacaaggatcttctcatatgctgat 466
            ||||||||| ||||||| || || ||||||||||||   ||||||||  | |||| ||| 
Sbjct: 1050 cctggaatctactactcagacgacaagctgctccagtgtaggatctttgcttatggtgac 1109

                                                                        
Query: 467  acccaaaggcaccgtcttggtccaaactacttgatgctccccgtgaatgccccgaaatgt 526
            || || || || || ||||| || || || |||  ||| || || ||||| || ||||||
Sbjct: 1110 actcagagacatcgccttggaccgaattatttgcagcttccagtcaatgctcccaaatgt 1169

                                                                 
Query: 527  gctcaccacaacaaccatcatgatggcttaatgaatttcattcacagggatga 579
            |||||||||||||| || ||||| || || ||||| ||||| ||||| |||||
Sbjct: 1170 gctcaccacaacaatcaccatgaaggttttatgaacttcatgcacagagatga 1222



to top

>ref|NM_001035996.1| Arabidopsis thaliana CAT3 (CATALASE 3); catalase AT1G20620 (CAT3)
            transcript variant AT1G20620.5 mRNA, complete cds
          Length = 1817

 Score =  107 bits (54), Expect = 4e-20
 Identities = 144/174 (82%)
 Strand = Plus / Plus

                                                                        
Query: 191  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 250
            |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 850  attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 909

                                                                        
Query: 251  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 310
            |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 910  gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 969

                                                                  
Query: 311  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 364
            || |||||||| ||||| ||  |||| ||||||| || ||||||||||||||||
Sbjct: 970  cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaatttcttc 1023



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 137/173 (79%)
 Strand = Plus / Plus

                                                                        
Query: 407  cctggaatccactactctgatgataagctgctccagacaaggatcttctcatatgctgat 466
            ||||||||| ||||||| || || ||||||||||||   ||||||||  | |||| ||| 
Sbjct: 1066 cctggaatctactactcagacgacaagctgctccagtgtaggatctttgcttatggtgac 1125

                                                                        
Query: 467  acccaaaggcaccgtcttggtccaaactacttgatgctccccgtgaatgccccgaaatgt 526
            || || || || || ||||| || || || |||  ||| || || ||||| || ||||||
Sbjct: 1126 actcagagacatcgccttggaccgaattatttgcagcttccagtcaatgctcccaaatgt 1185

                                                                 
Query: 527  gctcaccacaacaaccatcatgatggcttaatgaatttcattcacagggatga 579
            |||||||||||||| || ||||| || || ||||| ||||| ||||| |||||
Sbjct: 1186 gctcaccacaacaatcaccatgaaggttttatgaacttcatgcacagagatga 1238



to top

>ref|NM_001035995.1| Arabidopsis thaliana CAT3 (CATALASE 3); catalase AT1G20620 (CAT3)
            transcript variant AT1G20620.4 mRNA, complete cds
          Length = 1930

 Score =  107 bits (54), Expect = 4e-20
 Identities = 144/174 (82%)
 Strand = Plus / Plus

                                                                        
Query: 191  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 250
            |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 850  attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 909

                                                                        
Query: 251  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 310
            |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 910  gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 969

                                                                  
Query: 311  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 364
            || |||||||| ||||| ||  |||| ||||||| || ||||||||||||||||
Sbjct: 970  cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaatttcttc 1023



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 137/173 (79%)
 Strand = Plus / Plus

                                                                        
Query: 407  cctggaatccactactctgatgataagctgctccagacaaggatcttctcatatgctgat 466
            ||||||||| ||||||| || || ||||||||||||   ||||||||  | |||| ||| 
Sbjct: 1066 cctggaatctactactcagacgacaagctgctccagtgtaggatctttgcttatggtgac 1125

                                                                        
Query: 467  acccaaaggcaccgtcttggtccaaactacttgatgctccccgtgaatgccccgaaatgt 526
            || || || || || ||||| || || || |||  ||| || || ||||| || ||||||
Sbjct: 1126 actcagagacatcgccttggaccgaattatttgcagcttccagtcaatgctcccaaatgt 1185

                                                                 
Query: 527  gctcaccacaacaaccatcatgatggcttaatgaatttcattcacagggatga 579
            |||||||||||||| || ||||| || || ||||| ||||| ||||| |||||
Sbjct: 1186 gctcaccacaacaatcaccatgaaggttttatgaacttcatgcacagagatga 1238



to top

>ref|NM_001035994.1| Arabidopsis thaliana CAT3 (CATALASE 3); catalase AT1G20620 (CAT3)
            transcript variant AT1G20620.3 mRNA, complete cds
          Length = 1901

 Score =  107 bits (54), Expect = 4e-20
 Identities = 144/174 (82%)
 Strand = Plus / Plus

                                                                        
Query: 191  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 250
            |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 850  attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 909

                                                                        
Query: 251  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 310
            |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 910  gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 969

                                                                  
Query: 311  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 364
            || |||||||| ||||| ||  |||| ||||||| || ||||||||||||||||
Sbjct: 970  cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaatttcttc 1023



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 137/173 (79%)
 Strand = Plus / Plus

                                                                        
Query: 407  cctggaatccactactctgatgataagctgctccagacaaggatcttctcatatgctgat 466
            ||||||||| ||||||| || || ||||||||||||   ||||||||  | |||| ||| 
Sbjct: 1066 cctggaatctactactcagacgacaagctgctccagtgtaggatctttgcttatggtgac 1125

                                                                        
Query: 467  acccaaaggcaccgtcttggtccaaactacttgatgctccccgtgaatgccccgaaatgt 526
            || || || || || ||||| || || || |||  ||| || || ||||| || ||||||
Sbjct: 1126 actcagagacatcgccttggaccgaattatttgcagcttccagtcaatgctcccaaatgt 1185

                                                                 
Query: 527  gctcaccacaacaaccatcatgatggcttaatgaatttcattcacagggatga 579
            |||||||||||||| || ||||| || || ||||| ||||| ||||| |||||
Sbjct: 1186 gctcaccacaacaatcaccatgaaggttttatgaacttcatgcacagagatga 1238



to top

>emb|X56675.1|GHLCCSU2 G. hirsutum mRNA for cotton catalase subunit 2
          Length = 1763

 Score =  107 bits (54), Expect = 4e-20
 Identities = 195/242 (80%)
 Strand = Plus / Plus

                                                                        
Query: 251  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 310
            |||||||| ||||| |||||||| |||||||| |||||||| ||||||||||||||| ||
Sbjct: 872  gaggataggtttgattttgacccacttgatgtaaccaagacatggccagaggacatcttc 931

                                                                        
Query: 311  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaa 370
            ||| |||| ||| | || || |||||  | ||||||||||| || || ||||| || || 
Sbjct: 932  ccattgcagccaatgggtcgaatggtgttaaacaagaacatcgataacttctttgctgag 991

                                                                        
Query: 371  aatgaacagcttgctttctgcccagcagtcactgtccctggaatccactactctgatgat 430
            || || ||  | || ||||||||  |  ||| ||||||||| ||| | || || ||||||
Sbjct: 992  aacgagcaattagccttctgcccttccctcattgtccctggcatctattattcagatgat 1051

                                                                        
Query: 431  aagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgtcttggtcca 490
            ||| |||| || || || |||||||| ||| |||| || ||||||||||||||||| |||
Sbjct: 1052 aagttgcttcaaactagaatcttctcctattctgacactcaaaggcaccgtcttggacca 1111

              
Query: 491  aa 492
            ||
Sbjct: 1112 aa 1113



to top

>gb|AY058104.1| Arabidopsis thaliana At1g20620/F5M15_4 mRNA, complete cds
          Length = 1759

 Score =  107 bits (54), Expect = 4e-20
 Identities = 144/174 (82%)
 Strand = Plus / Plus

                                                                        
Query: 191  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 250
            |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 832  attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 891

                                                                        
Query: 251  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 310
            |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 892  gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 951

                                                                  
Query: 311  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 364
            || |||||||| ||||| ||  |||| ||||||| || ||||||||||||||||
Sbjct: 952  cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaatttcttc 1005



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 137/173 (79%)
 Strand = Plus / Plus

                                                                        
Query: 407  cctggaatccactactctgatgataagctgctccagacaaggatcttctcatatgctgat 466
            ||||||||| ||||||| || || ||||||||||||   ||||||||  | |||| ||| 
Sbjct: 1048 cctggaatctactactcagacgacaagctgctccagtgtaggatctttgcttatggtgac 1107

                                                                        
Query: 467  acccaaaggcaccgtcttggtccaaactacttgatgctccccgtgaatgccccgaaatgt 526
            || || || || || ||||| || || || |||  ||| || || ||||| || ||||||
Sbjct: 1108 actcagagacatcgccttggaccgaattatttgcagcttccagtcaatgctcccaaatgt 1167

                                                                 
Query: 527  gctcaccacaacaaccatcatgatggcttaatgaatttcattcacagggatga 579
            |||||||||||||| || ||||| || || ||||| ||||| ||||| |||||
Sbjct: 1168 gctcaccacaacaatcaccatgaaggttttatgaacttcatgcacagagatga 1220



to top

>gb|AY056447.1| Arabidopsis thaliana At1g20620/F5M15_4 mRNA, complete cds
          Length = 1757

 Score =  107 bits (54), Expect = 4e-20
 Identities = 144/174 (82%)
 Strand = Plus / Plus

                                                                        
Query: 191  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 250
            |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 829  attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 888

                                                                        
Query: 251  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 310
            |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 889  gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 948

                                                                  
Query: 311  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 364
            || |||||||| ||||| ||  |||| ||||||| || ||||||||||||||||
Sbjct: 949  cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaatttcttc 1002



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 137/173 (79%)
 Strand = Plus / Plus

                                                                        
Query: 407  cctggaatccactactctgatgataagctgctccagacaaggatcttctcatatgctgat 466
            ||||||||| ||||||| || || ||||||||||||   ||||||||  | |||| ||| 
Sbjct: 1045 cctggaatctactactcagacgacaagctgctccagtgtaggatctttgcttatggtgac 1104

                                                                        
Query: 467  acccaaaggcaccgtcttggtccaaactacttgatgctccccgtgaatgccccgaaatgt 526
            || || || || || ||||| || || || |||  ||| || || ||||| || ||||||
Sbjct: 1105 actcagagacatcgccttggaccgaattatttgcagcttccagtcaatgctcccaaatgt 1164

                                                                 
Query: 527  gctcaccacaacaaccatcatgatggcttaatgaatttcattcacagggatga 579
            |||||||||||||| || ||||| || || ||||| ||||| ||||| |||||
Sbjct: 1165 gctcaccacaacaatcaccatgaaggttttatgaacttcatgcacagagatga 1217



to top

>emb|BX815559.1|CNS0ABH4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS71ZD06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1709

 Score =  107 bits (54), Expect = 4e-20
 Identities = 144/174 (82%)
 Strand = Plus / Plus

                                                                       
Query: 191 attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 250
           |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 810 attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 869

                                                                       
Query: 251 gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 310
           |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 870 gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 929

                                                                 
Query: 311 ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 364
           || |||||||| ||||| ||  |||| ||||||| || ||||||||||||||||
Sbjct: 930 cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaatttcttc 983



 Score = 48.1 bits (24), Expect = 0.032
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 512  aatgccccgaaatgtgctcaccacaacaaccatcatgatggcttaatgaatttcattcac 571
            ||||| || |||||||||||||||||||| || ||||| ||  | ||||| ||||| |||
Sbjct: 1131 aatgctcccaaatgtgctcaccacaacaatcaccatgaaggtcttatgaacttcatgcac 1190

                    
Query: 572  agggatga 579
            || |||||
Sbjct: 1191 agagatga 1198



to top

>emb|AJ496419.1|PPE496419 Prunus persica mRNA for catalase (cat2 gene)
          Length = 1777

 Score =  105 bits (53), Expect = 2e-19
 Identities = 146/177 (82%)
 Strand = Plus / Plus

                                                                        
Query: 403  tgtccctggaatccactactctgatgataagctgctccagacaaggatcttctcatatgc 462
            ||||||||| ||| |||| || ||||||||| ||||||| ||  | |||||| ||||| |
Sbjct: 1087 tgtccctggtatctactattcagatgataaggtgctccaaactcgaatcttcgcatattc 1146

                                                                        
Query: 463  tgatacccaaaggcaccgtcttggtccaaactacttgatgctccccgtgaatgccccgaa 522
            |||||| || |||||||||||||| || |||||  ||  |||||| |||||||| || ||
Sbjct: 1147 tgatactcagaggcaccgtcttggcccgaactatctgcagctcccagtgaatgctcccaa 1206

                                                                     
Query: 523  atgtgctcaccacaacaaccatcatgatggcttaatgaatttcattcacagggatga 579
             ||| |||| || ||||| |||||||| || || ||||||||||| |||||||||||
Sbjct: 1207 gtgtcctcatcataacaatcatcatgagggattcatgaatttcatgcacagggatga 1263



 Score =  105 bits (53), Expect = 2e-19
 Identities = 164/201 (81%)
 Strand = Plus / Plus

                                                                        
Query: 184  tgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgc 243
            |||||| ||||||||||| || ||||| || ||||| ||||  || ||||| || ||| |
Sbjct: 868  tgattccattgcagctggcaactaccctgagtggaaactttatattcagacaatggatcc 927

                                                                        
Query: 244  tgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 303
            |||||||||||| |||||||||||||||||||||||  | || ||||||||||| || ||
Sbjct: 928  tgatcacgaggacagatttgactttgaccctcttgacttaactaagacctggcctgaaga 987

                                                                        
Query: 304  catcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttctt 363
             ||| | || ||||| |||||||| ||  |||| ||||| || ||||| || || |||||
Sbjct: 988  tatccttcccctgcagccagttggccgtttggttctgaataaaaacatcgataacttctt 1047

                                 
Query: 364  cgcggaaaatgaacagcttgc 384
             || || |||||||| |||||
Sbjct: 1048 tgcagagaatgaacaacttgc 1068



to top

>emb|AJ132444.1|PPE132444 Prunus persica mRNA for catalase 1, partial
          Length = 1610

 Score =  105 bits (53), Expect = 2e-19
 Identities = 146/177 (82%)
 Strand = Plus / Plus

                                                                       
Query: 403 tgtccctggaatccactactctgatgataagctgctccagacaaggatcttctcatatgc 462
           ||||||||| ||| |||| || ||||||||| ||||||| ||  | |||||| ||||| |
Sbjct: 781 tgtccctggtatctactattcagatgataagatgctccaaactcgaatcttcgcatattc 840

                                                                       
Query: 463 tgatacccaaaggcaccgtcttggtccaaactacttgatgctccccgtgaatgccccgaa 522
           |||||| || |||||||||||||| || |||||  ||  |||||| |||||||| || ||
Sbjct: 841 tgatactcagaggcaccgtcttggcccgaactatctgcagctcccagtgaatgctcccaa 900

                                                                    
Query: 523 atgtgctcaccacaacaaccatcatgatggcttaatgaatttcattcacagggatga 579
            ||| |||| || ||||| |||||||| || || ||||||||||| |||||||||||
Sbjct: 901 gtgtcctcatcataacaatcatcatgagggattcatgaatttcatgcacagggatga 957



 Score =  105 bits (53), Expect = 2e-19
 Identities = 164/201 (81%)
 Strand = Plus / Plus

                                                                       
Query: 184 tgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgc 243
           |||||| ||||||||||| || ||||| || ||||| ||||  || ||||| || ||| |
Sbjct: 562 tgattccattgcagctggcaactaccctgagtggaaactttatattcagacaatggatcc 621

                                                                       
Query: 244 tgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 303
           |||||||||||| |||||||||||||||||||||||  | || ||||||||||| || ||
Sbjct: 622 tgatcacgaggacagatttgactttgaccctcttgacttaactaagacctggcctgaaga 681

                                                                       
Query: 304 catcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttctt 363
            ||| | || ||||| |||||||| ||  |||| ||||| || ||||| || || |||||
Sbjct: 682 tatccttcccctgcagccagttggccgtttggttctgaataaaaacatcgataacttctt 741

                                
Query: 364 cgcggaaaatgaacagcttgc 384
            || || |||||||| |||||
Sbjct: 742 tgcagagaatgaacaacttgc 762



to top

>gb|U43340.1| Arabidopsis thaliana catalase 1 (CAT1) mRNA, complete cds
          Length = 1928

 Score =  101 bits (51), Expect = 2e-18
 Identities = 138/167 (82%)
 Strand = Plus / Plus

                                                                        
Query: 413  atccactactctgatgataagctgctccagacaaggatcttctcatatgctgatacccaa 472
            |||||||| || ||||||||  | ||||||||  |||||||||| || |||||||  || 
Sbjct: 1078 atccactattcagatgataacgtactccagacccggatcttctcctacgctgatagtcag 1137

                                                                        
Query: 473  aggcaccgtcttggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcac 532
            || ||||||||||| ||||||||  ||   || || || |||||||| ||||||||||||
Sbjct: 1138 agacaccgtcttggaccaaactatctgcaactacctgttaatgcccctaaatgtgctcac 1197

                                                           
Query: 533  cacaacaaccatcatgatggcttaatgaatttcattcacagggatga 579
            |||||||| || |||||||| || ||||| ||||| |||||||||||
Sbjct: 1198 cacaacaatcaccatgatggttttatgaacttcatgcacagggatga 1244



to top

>dbj|D21161.1|RCCCATALAA Ricinus communis gene for catalase CAT1, complete cds (exon 1-8)
          Length = 3711

 Score =  101 bits (51), Expect = 2e-18
 Identities = 120/143 (83%)
 Strand = Plus / Plus

                                                                        
Query: 437  ctccagacaaggatcttctcatatgctgatacccaaaggcaccgtcttggtccaaactac 496
            |||||||| |||||||| |||||| ||||||| || |||||||||||||| |||||||| 
Sbjct: 2359 ctccagactaggatcttttcatattctgatactcagaggcaccgtcttggaccaaactat 2418

                                                                        
Query: 497  ttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaaccatcatgatggctta 556
            ||   |||||| || ||||| || || |||||||| ||||| || |||||||| || || 
Sbjct: 2419 ttacagctccctgttaatgctccaaagtgtgctcatcacaataatcatcatgaaggtttc 2478

                                   
Query: 557  atgaatttcattcacagggatga 579
            ||||||||||| || ||||||||
Sbjct: 2479 atgaatttcatgcatagggatga 2501



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 167/210 (79%)
 Strand = Plus / Plus

                                                                        
Query: 184  tgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgc 243
            |||||| ||| | ||||| || || ||||| ||||| |||| ||||||||  || ||| |
Sbjct: 2106 tgattcaatttcggctggaaactatccagagtggaaactttacatccagataatggatcc 2165

                                                                        
Query: 244  tgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 303
            || ||| || || | |||||||||||| || ||||| || ||||| |||||||| |||||
Sbjct: 2166 tgctcatgaagacaaatttgactttgatccacttgacgtgaccaaaacctggcccgagga 2225

                                                                        
Query: 304  catcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttctt 363
             ||| | || ||||| |||||||| ||  ||||  |||| ||||||||||| || |||||
Sbjct: 2226 tatcctacccctgcagccagttggccgcctggtcttgaataagaacattgataacttctt 2285

                                          
Query: 364  cgcggaaaatgaacagcttgctttctgccc 393
             || || ||||| |||||||| || |||||
Sbjct: 2286 tgctgagaatgagcagcttgcattttgccc 2315



to top

>emb|AJ295295.1|BPE295295 Betula pendula partial mRNA for catalase (cat gene)
          Length = 451

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 131/158 (82%)
 Strand = Plus / Plus

                                                                       
Query: 226 catccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtcac 285
           ||||||||  |||||  ||||||| ||||| | ||||||||||||||| |||||||| ||
Sbjct: 121 catccagataattgaccctgatcatgaggacaaatttgactttgacccacttgatgtgac 180

                                                                       
Query: 286 caagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaacaa 345
           ||| | |||||| ||||||||  | || ||||| |||||||| ||  ||||  |||||||
Sbjct: 181 caaaatctggcccgaggacattctgcccctgcagccagttggccgcttggtcttgaacaa 240

                                                 
Query: 346 gaacattgacaatttcttcgcggaaaatgaacagcttg 383
           |||||| ||||| |||||||| || |||||||| ||||
Sbjct: 241 gaacatcgacaacttcttcgcagagaatgaacaacttg 278



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 107/133 (80%)
 Strand = Plus / Plus

                                                                       
Query: 417 actactctgatgataagctgctccagacaaggatcttctcatatgctgatacccaaaggc 476
           ||||||| ||||| ||| ||||||||||  | ||||| || ||| ||||||| || ||||
Sbjct: 312 actactcagatgacaagttgctccagactcgaatcttttcctattctgatactcagaggc 371

                                                                       
Query: 477 accgtcttggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccaca 536
           ||||||| || ||||||||| ||   ||||| |  ||||| || ||||| ||||| ||||
Sbjct: 372 accgtctcggaccaaactacctgcaactcccagctaatgctcccaaatgcgctcatcaca 431

                        
Query: 537 acaaccatcatga 549
           |||| || |||||
Sbjct: 432 acaatcaccatga 444



to top

>gb|U43147.1|ATU43147 Arabidopsis thaliana catalase 3 (CAT3) gene, complete cds
          Length = 4058

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 143/174 (82%)
 Strand = Plus / Plus

                                                                        
Query: 191  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 250
            |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 2740 attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 2799

                                                                        
Query: 251  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 310
            |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 2800 gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 2859

                                                                  
Query: 311  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 364
            || |||||||| ||||| ||  |||| ||||||| || ||||||||| ||||||
Sbjct: 2860 cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaacttcttc 2913



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 137/173 (79%)
 Strand = Plus / Plus

                                                                        
Query: 407  cctggaatccactactctgatgataagctgctccagacaaggatcttctcatatgctgat 466
            ||||||||| ||||||| || || ||||||||||||   ||||||||  | |||| ||| 
Sbjct: 2956 cctggaatctactactcagacgacaagctgctccagtgtaggatctttgcttatggtgac 3015

                                                                        
Query: 467  acccaaaggcaccgtcttggtccaaactacttgatgctccccgtgaatgccccgaaatgt 526
            || || || || || ||||| || || || |||  ||| || || ||||| || ||||||
Sbjct: 3016 actcagagacatcgccttggaccgaattatttgcagcttccagtcaatgctcccaaatgt 3075

                                                                 
Query: 527  gctcaccacaacaaccatcatgatggcttaatgaatttcattcacagggatga 579
            |||||||||||||| || ||||| || || ||||| ||||| ||||| |||||
Sbjct: 3076 gctcaccacaacaatcaccatgaaggttttatgaacttcatgcacagagatga 3128



to top

>gb|AF139539.2|AF139539 Raphanus sativus catalase 3 (Cat3) mRNA, complete cds
          Length = 1801

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 142/173 (82%)
 Strand = Plus / Plus

                                                                        
Query: 407  cctggaatccactactctgatgataagctgctccagacaaggatcttctcatatgctgat 466
            ||||| ||| ||||||| ||||||||||||||||||   ||||||||  | |||| ||| 
Sbjct: 1034 cctgggatctactactcagatgataagctgctccagtgtaggatctttgcgtatggtgac 1093

                                                                        
Query: 467  acccaaaggcaccgtcttggtccaaactacttgatgctccccgtgaatgccccgaaatgt 526
            || || || || |||||||| ||||||||||||  ||| || || ||||| || ||||||
Sbjct: 1094 actcagagacatcgtcttggaccaaactacttgcagctgccggttaatgctccaaaatgt 1153

                                                                 
Query: 527  gctcaccacaacaaccatcatgatggcttaatgaatttcattcacagggatga 579
            |||||||||||||| || ||||| || || ||||| ||||| ||||| |||||
Sbjct: 1154 gctcaccacaacaatcaccatgaaggtttcatgaacttcatgcacagagatga 1206



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Plus

                                                                       
Query: 206 tacccagaatggaagcttttcatccagaccattgatgctgatcacgaggatagatttgac 265
           ||||| || |||||||||||||||||||| || ||| |||   | |||||||  || || 
Sbjct: 833 taccctgagtggaagcttttcatccagacaatggatcctgcggatgaggataagttcgat 892

                                                 
Query: 266 tttgaccctcttgatgtcaccaagacctggccagagga 303
           || ||||| |||||||| ||||||| |||||| |||||
Sbjct: 893 ttcgacccgcttgatgtgaccaagatctggcctgagga 930



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 37/41 (90%), Gaps = 1/41 (2%)
 Strand = Plus / Plus

                                                    
Query: 8   actataggcacatggnacggttttggtgtcaacacctacac 48
           ||||||||||||||| | ||||| |||||| ||||||||||
Sbjct: 636 actataggcacatggaa-ggtttcggtgtccacacctacac 675



to top

>gb|AY087477.1| Arabidopsis thaliana clone 35868 mRNA, complete sequence
          Length = 1756

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 131/159 (82%)
 Strand = Plus / Plus

                                                                        
Query: 206  tacccagaatggaagcttttcatccagaccattgatgctgatcacgaggatagatttgac 265
            ||||| || ||||| ||||||||||||||||| ||| |||   | |||||||  ||||||
Sbjct: 847  taccccgagtggaaacttttcatccagaccatggatcctgcagatgaggataagtttgac 906

                                                                        
Query: 266  tttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagtt 325
            |||||||| |||||||| ||||||| |||||| ||||| ||  | || |||||||| |||
Sbjct: 907  tttgacccacttgatgtgaccaagatctggcctgaggatattttgcctctgcaaccggtt 966

                                                   
Query: 326  ggacggatggtactgaacaagaacattgacaatttcttc 364
            || ||  |||| ||||||| || ||||||||| ||||||
Sbjct: 967  ggtcgcttggttctgaacaggaccattgacaacttcttc 1005



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 137/173 (79%)
 Strand = Plus / Plus

                                                                        
Query: 407  cctggaatccactactctgatgataagctgctccagacaaggatcttctcatatgctgat 466
            ||||||||| ||||||| || || ||||||||||||   ||||||||  | |||| ||| 
Sbjct: 1048 cctggaatctactactcagacgacaagctgctccagtgtaggatctttgcttatggtgac 1107

                                                                        
Query: 467  acccaaaggcaccgtcttggtccaaactacttgatgctccccgtgaatgccccgaaatgt 526
            || || || || || ||||| || || || |||  ||| || || ||||| || ||||||
Sbjct: 1108 actcagagacatcgccttggaccgaattatttgcagcttccagtcaatgctcccaaatgt 1167

                                                                 
Query: 527  gctcaccacaacaaccatcatgatggcttaatgaatttcattcacagggatga 579
            |||||||||||||| || ||||| || || ||||| ||||| ||||| |||||
Sbjct: 1168 gctcaccacaacaatcaccatgaaggttttatgaacttcatgcacagagatga 1220



to top

>gb|AF035254.1|AF035254 Glycine max catalase (cat3) mRNA, complete cds
          Length = 1715

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 251/319 (78%)
 Strand = Plus / Plus

                                                                        
Query: 261  ttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaac 320
            ||||||||||||| |||||||| || ||||||||||| |||||| |  | || || || |
Sbjct: 850  ttgactttgacccccttgatgtaactaagacctggcctgaggacgttttgcccctccagc 909

                                                                        
Query: 321  cagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagc 380
            | ||||| || |||||  |||| ||||||||||| || ||||| || || || ||||| |
Sbjct: 910  ctgttggccgcatggtcttgaataagaacattgataacttctttgccgagaacgaacaac 969

                                                                        
Query: 381  ttgctttctgcccagcagtcactgtccctggaatccactactctgatgataagctgctcc 440
            |||| || ||||| ||| | | ||| |||||  |  ||||||| || |||||  |||| |
Sbjct: 970  ttgcattttgccctgcaattattgtacctggtgtatactactccgacgataaattgcttc 1029

                                                                        
Query: 441  agacaaggatcttctcatatgctgatacccaaaggcaccgtcttggtccaaactacttga 500
            ||||  | || ||||| ||||||||||||||||| ||| | ||||| ||||| ||  || 
Sbjct: 1030 agactcgcatattctcctatgctgatacccaaagacacagacttgggccaaattatctgc 1089

                                                                        
Query: 501  tgctccccgtgaatgccccgaaatgtgctcaccacaacaaccatcatgatggcttaatga 560
             ||| || |  ||| |||| || ||||| || |||||||| || |||||||| || ||||
Sbjct: 1090 agcttcctgctaattcccccaagtgtgcccatcacaacaatcaccatgatggtttcatga 1149

                               
Query: 561  atttcattcacagggatga 579
            ||||||| |||||||||||
Sbjct: 1150 atttcatgcacagggatga 1168



to top

>emb|AJ299450.1|PPI299450 Pinus pinea partial mRNA for catalase 1 (cat1 gene)
          Length = 890

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 252/321 (78%)
 Strand = Plus / Plus

                                                                       
Query: 184 tgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgc 243
           ||||||||| ||||| || || || || |||||||| ||||| |||||||| || ||| |
Sbjct: 562 tgattctatagcagcaggcaactatcctgaatggaaactttttatccagacaatggatcc 621

                                                                       
Query: 244 tgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 303
           |    | ||||||| || ||||||||| ||| | ||||| || || || ||||| |||||
Sbjct: 622 tcgggatgaggataaatatgactttgatcctttagatgttacgaaaacttggcccgagga 681

                                                                       
Query: 304 catcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttctt 363
            ||| | || || ||||| || ||||| |||||  |||||||||| ||||||||||||||
Sbjct: 682 tatctttcctcttcaacctgtaggacgcatggtcttgaacaagaatattgacaatttctt 741

                                                                       
Query: 364 cgcggaaaatgaacagcttgctttctgcccagcagtcactgtccctggaatccactactc 423
            || ||||| || |||||||| || || || ||  |   ||| |||||  || | ||| |
Sbjct: 742 tgctgaaaacgagcagcttgcattttgtcctgctcttgttgttcctggtgtctattacac 801

                                                                       
Query: 424 tgatgataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgtct 483
           ||| |||||||| ||||| |||||| | |||||||  || ||||| |||||||| |||||
Sbjct: 802 tgaagataagctactccaaacaagggtattctcattcgcagatacacaaaggcatcgtct 861

                                
Query: 484 tggtccaaactacttgatgct 504
           ||| || ||||| ||||||||
Sbjct: 862 tggacccaactatttgatgct 882



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 83  aagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaagc 135
           ||||| |||||||  ||||| ||||| || ||||| || ||||||||||||||
Sbjct: 461 aagtttcattggaggcctacttgtggagttaagtgtctattggatgatgaagc 513



to top

>dbj|AB109090.1| Acacia ampliceps cat mRNA for catalase, complete cds
          Length = 1833

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 162/201 (80%)
 Strand = Plus / Plus

                                                                        
Query: 184  tgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgc 243
            |||||| |||||||| || || || || || ||||| || | |||||| ||||||||| |
Sbjct: 834  tgattcaattgcagccggaaactatcctgagtggaaactctacatccaaaccattgatcc 893

                                                                        
Query: 244  tgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 303
            ||||   || || ||||||||||||||||| |||||||  ||||||||||||||||||||
Sbjct: 894  tgattttgaagacagatttgactttgacccacttgatggaaccaagacctggccagagga 953

                                                                        
Query: 304  catcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttctt 363
            | || | || || ||||||||||| ||  ||||  |||| | |||||| ||||| |||||
Sbjct: 954  cctcgtacctctccaaccagttggtcgcttggtcttgaataggaacatcgacaacttctt 1013

                                 
Query: 364  cgcggaaaatgaacagcttgc 384
             || || ||||| || |||||
Sbjct: 1014 tgctgagaatgagcaacttgc 1034



to top

>emb|X60169.1|PSCATAL Pisum sativum mRNA for catalase
          Length = 1738

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 107/128 (83%)
 Strand = Plus / Plus

                                                                        
Query: 257  agatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactg 316
            |||||||| |||||||| |||||||| || ||||| ||||| ||||||||||| || || 
Sbjct: 897  agatttgagtttgacccacttgatgtaactaagacttggcccgaggacatcatacccctt 956

                                                                        
Query: 317  caaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaa 376
            || || || || || |||||  ||||||||||||| || |||||||| || || ||||||
Sbjct: 957  cagcccgtaggtcgcatggtcttgaacaagaacatagataatttctttgctgagaatgaa 1016

                    
Query: 377  cagcttgc 384
            ||||||||
Sbjct: 1017 cagcttgc 1024



 Score = 48.1 bits (24), Expect = 0.032
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                
Query: 528  ctcaccacaacaaccatcatgatggcttaatgaatttcattcacagggatga 579
            ||||||||||||| || ||||| || || ||||||  |||||||||||||||
Sbjct: 1168 ctcaccacaacaatcaccatgagggtttcatgaatgccattcacagggatga 1219



to top

>gb|DQ226689.1| Boechera divaricarpa isolate SLW-348-443-G06 mRNA sequence
          Length = 719

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 130/159 (81%)
 Strand = Plus / Plus

                                                                       
Query: 206 tacccagaatggaagcttttcatccagaccattgatgctgatcacgaggatagatttgac 265
           ||||| || ||||| |||||||||||||| || ||| |||   | ||||| |  ||||| 
Sbjct: 285 taccccgagtggaaacttttcatccagacgatggatcctgcggatgaggacaagtttgat 344

                                                                       
Query: 266 tttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagtt 325
           |||||||| |||||||| ||||||| |||||| ||||| ||| | || ||||||||||||
Sbjct: 345 tttgacccgcttgatgtgaccaagatctggcctgaggatatcttgcctctgcaaccagtt 404

                                                  
Query: 326 ggacggatggtactgaacaagaacattgacaatttcttc 364
           || ||  |||| ||||||| || ||||||||| ||||||
Sbjct: 405 ggtcgcttggttctgaacaggaccattgacaacttcttc 443



to top

>emb|Z12021.1|GMCATALG G.max gene for catalase
          Length = 4687

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 250/319 (78%)
 Strand = Plus / Plus

                                                                        
Query: 261  ttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaac 320
            ||||||||||||| |||||||| || ||||||||||| |||||| |  | || || || |
Sbjct: 2870 ttgactttgacccccttgatgttactaagacctggcccgaggacgttttgcccctccagc 2929

                                                                        
Query: 321  cagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagc 380
            | ||||| || |||||  |||| ||||||||||| || ||||| || || |||||||| |
Sbjct: 2930 ctgttggccgcatggtcttgaataagaacattgataacttctttgccgagaatgaacaac 2989

                                                                        
Query: 381  ttgctttctgcccagcagtcactgtccctggaatccactactctgatgataagctgctcc 440
            |||| || ||||| ||  | | ||| |||||  |  ||||||| ||||||||  |||| |
Sbjct: 2990 ttgcattttgccctgccattattgtacctggtgtatactactccgatgataaattgcttc 3049

                                                                        
Query: 441  agacaaggatcttctcatatgctgatacccaaaggcaccgtcttggtccaaactacttga 500
            | ||  |  | ||||| |||||||||||||| || ||| | ||||| ||||| ||  || 
Sbjct: 3050 aaactcgcgtattctcctatgctgatacccagagacacagacttggaccaaattatctgc 3109

                                                                        
Query: 501  tgctccccgtgaatgccccgaaatgtgctcaccacaacaaccatcatgatggcttaatga 560
             ||| || |  |||||||| || ||||| || |||||||| || |||||||| || ||||
Sbjct: 3110 agcttcctgctaatgcccctaagtgtgcccatcacaacaatcaccatgatggtttcatga 3169

                               
Query: 561  atttcattcacagggatga 579
            ||||||| |||||||||||
Sbjct: 3170 atttcatgcacagggatga 3188



to top

>gb|DQ124022.1| Coffea arabica clone MN-SSH2-H06 mRNA sequence
          Length = 525

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 109/131 (83%)
 Strand = Plus / Plus

                                                                       
Query: 194 gcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcacgag 253
           |||||||| || ||||| || |||||||||||||||||||| |||||| ||||| | || 
Sbjct: 196 gcagctggaaactaccctgagtggaagcttttcatccagacaattgatcctgattatgaa 255

                                                                       
Query: 254 gatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatccca 313
           || | || |||||||||||| |||||||| || ||||| ||||| ||||| ||| | || 
Sbjct: 256 gacaaatatgactttgacccacttgatgtgactaagacttggcctgaggatatcttgccc 315

                      
Query: 314 ctgcaaccagt 324
           ||||| |||||
Sbjct: 316 ctgcagccagt 326



to top

>gb|AF035253.1|AF035253 Glycine max catalase (cat2) mRNA, complete cds
          Length = 1831

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 250/319 (78%)
 Strand = Plus / Plus

                                                                        
Query: 261  ttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaac 320
            ||||||||||||| |||||||| || ||||||||||| |||||| |  | || || || |
Sbjct: 882  ttgactttgacccccttgatgttactaagacctggcccgaggacgttttgcccctccagc 941

                                                                        
Query: 321  cagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagc 380
            | ||||| || |||||  |||| ||||||||||| || ||||| || || |||||||| |
Sbjct: 942  ctgttggccgcatggtcttgaataagaacattgataacttctttgccgagaatgaacaac 1001

                                                                        
Query: 381  ttgctttctgcccagcagtcactgtccctggaatccactactctgatgataagctgctcc 440
            |||| || ||||| ||  | | ||| |||||  |  ||||||| ||||||||  |||| |
Sbjct: 1002 ttgcattttgccctgccattattgtacctggtgtatactactccgatgataaattgcttc 1061

                                                                        
Query: 441  agacaaggatcttctcatatgctgatacccaaaggcaccgtcttggtccaaactacttga 500
            | ||  |  | ||||| |||||||||||||| || ||| | ||||| ||||| ||  || 
Sbjct: 1062 aaactcgcgtattctcctatgctgatacccagagacacagacttggaccaaattatctgc 1121

                                                                        
Query: 501  tgctccccgtgaatgccccgaaatgtgctcaccacaacaaccatcatgatggcttaatga 560
             ||| || |  |||||||| || ||||| || |||||||| || |||||||| || ||||
Sbjct: 1122 agcttcctgctaatgcccctaagtgtgcccatcacaacaatcaccatgatggtttcatga 1181

                               
Query: 561  atttcattcacagggatga 579
            ||||||| |||||||||||
Sbjct: 1182 atttcatgcacagggatga 1200



to top

>gb|AF035252.1|AF035252 Glycine max catalase (cat1) mRNA, complete cds
          Length = 1733

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 250/319 (78%)
 Strand = Plus / Plus

                                                                        
Query: 261  ttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaac 320
            ||||||||||||| |||||||| || ||||||||||| |||||| |  | || || || |
Sbjct: 897  ttgactttgacccccttgatgttactaagacctggcccgaggacgttttgcccctccagc 956

                                                                        
Query: 321  cagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagc 380
            | ||||| || |||||  |||| ||||||||||| || ||||| || || |||||||| |
Sbjct: 957  ctgttggccgcatggtcttgaataagaacattgataacttctttgccgagaatgaacaac 1016

                                                                        
Query: 381  ttgctttctgcccagcagtcactgtccctggaatccactactctgatgataagctgctcc 440
            |||| || ||||| ||  | | ||| |||||  |  ||||||| ||||||||  |||| |
Sbjct: 1017 ttgcattttgccctgccattattgtacctggtgtatactactccgatgataaattgcttc 1076

                                                                        
Query: 441  agacaaggatcttctcatatgctgatacccaaaggcaccgtcttggtccaaactacttga 500
            | ||  |  | ||||| |||||||||||||| || ||| | ||||| ||||| ||  || 
Sbjct: 1077 aaactcgcgtattctcctatgctgatacccagagacacagacttggaccaaattatctgc 1136

                                                                        
Query: 501  tgctccccgtgaatgccccgaaatgtgctcaccacaacaaccatcatgatggcttaatga 560
             ||| || |  |||||||| || ||||| || |||||||| || |||||||| || ||||
Sbjct: 1137 agcttcctgctaatgcccctaagtgtgcccatcacaacaatcaccatgatggtttcatga 1196

                               
Query: 561  atttcattcacagggatga 579
            ||||||| |||||||||||
Sbjct: 1197 atttcatgcacagggatga 1215



to top

>gb|AF390210.2| Suaeda maritima subsp. salsa catalase (CAT1) mRNA, complete cds
          Length = 1791

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 383/497 (77%)
 Strand = Plus / Plus

                                                                        
Query: 83   aagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaagccgttact 142
            |||||||| |||||||| |||||||| |||||| |||| ||||| ||||| ||| |||  
Sbjct: 722  aagttccactggaaaccaacatgtggggtgaagagcctgttggaggatgaggccattaaa 781

                                                                        
Query: 143  gttggaggcacctgccacacccatgccacaaaggacttgactgattctattgcagctggg 202
            ||||||||  |   ||||| |||||| ||  ||||| |   ||| || ||||||  ||||
Sbjct: 782  gttggaggagctaaccacagccatgctacgcaggacctctatgactcaattgcaagtggg 841

                                                                        
Query: 203  aattacccagaatggaagcttttcatccagaccattgatgctgatcacgaggatagattt 262
            || || || || |||||||||||||||||||| || ||  | | | | || |||| ||||
Sbjct: 842  aactatcctgagtggaagcttttcatccagacaatagacccagctgatgaagataaattt 901

                                                                        
Query: 263  gactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaacca 322
            ||||||||||| || ||||| || || || ||||| ||||| ||  | || || || |||
Sbjct: 902  gactttgaccccctagatgttacaaaaacatggcctgaggatattttgcccctacagcca 961

                                                                        
Query: 323  gttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagctt 382
            || || ||  | ||  ||||||||||||||||||| ||||| || ||||| || || || 
Sbjct: 962  gtgggtcgtttagtgttgaacaagaacattgacaacttctttgcagaaaacgagcaactg 1021

                                                                        
Query: 383  gctttctgcccagcagtcactgtccctggaatccactactctgatgataagctgctccag 442
            || || |||||  |  |   ||| |||||  |||||||||| ||||| |||||||| || 
Sbjct: 1022 gcattttgcccttctattgttgttcctggggtccactactcagatgacaagctgcttcaa 1081

                                                                        
Query: 443  acaaggatcttctcatatgctgatacccaaaggcaccgtcttggtccaaactacttgatg 502
            ||  | || ||||| ||  ||||||| ||||| ||||||||||| || |||||| ||   
Sbjct: 1082 actcgaattttctcgtactctgatactcaaagacaccgtcttggccccaactacctgcaa 1141

                                                                        
Query: 503  ctccccgtgaatgccccgaaatgtgctcaccacaacaaccatcatgatggcttaatgaat 562
            || || ||||||||||| || ||| |||| |||||||| ||  ||||||| || ||||| 
Sbjct: 1142 cttcctgtgaatgcccccaagtgttctcatcacaacaatcactatgatggttttatgaac 1201

                             
Query: 563  ttcattcacagggatga 579
            ||||| ||||| |||||
Sbjct: 1202 ttcatgcacagagatga 1218



to top

>gb|AF236127.1| Vitis vinifera catalase (GCat) mRNA, complete cds
          Length = 1779

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 122/149 (81%)
 Strand = Plus / Plus

                                                                       
Query: 215 tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 274
           |||||||||||||||||||| || ||| |||| || || || |  ||||||||||| || 
Sbjct: 835 tggaagcttttcatccagacgatggatcctgaacatgaagacaagtttgactttgatcca 894

                                                                       
Query: 275 cttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatg 334
           |||||||| |||||||| ||||| ||||| ||| | ||  |||| ||||| || ||| ||
Sbjct: 895 cttgatgttaccaagacttggcctgaggatatcttgcccttgcagccagtgggccggttg 954

                                        
Query: 335 gtactgaacaagaacattgacaatttctt 363
           ||| | ||||||||||| || ||||||||
Sbjct: 955 gtattaaacaagaacatagataatttctt 983



to top

>gb|AY128694.1| Capsicum annuum catalase 2 (CAT2) mRNA, partial cds
          Length = 1680

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 188 tctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgat 247
           |||||||||||||| ||||| || ||||||||||||||||| |||||||| ||| | | |
Sbjct: 749 tctattgcagctggaaattatcctgaatggaagcttttcattcagaccatggatccagct 808

                                                                   
Query: 248 cacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 303
           || || || |||||||| ||||| || || ||||| || || || |||||||||||
Sbjct: 809 catgaagacagatttgattttgatccactcgatgtgacaaaaacttggccagagga 864



 Score = 48.1 bits (24), Expect = 0.032
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                    
Query: 524  tgtgctcaccacaacaaccatcatgatggcttaatgaatttcattcacagggatga 579
            |||||||| |||||||| ||  |||||||||  |||||||| || |||||||||||
Sbjct: 1085 tgtgctcatcacaacaatcactatgatggctctatgaattttatgcacagggatga 1140



to top

>gb|AY442179.2| Solanum tuberosum catalase mRNA, partial cds
          Length = 1648

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 135/167 (80%)
 Strand = Plus / Plus

                                                                       
Query: 188 tctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgat 247
           |||||||||||||| ||||| || ||||||||||| ||||| ||||  || ||| | |||
Sbjct: 721 tctattgcagctggaaattatcctgaatggaagctcttcattcagattatggatccagat 780

                                                                       
Query: 248 cacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatc 307
           || || || | |||||||||||| || |||||||| || || || ||||||||||| |||
Sbjct: 781 catgaagacaaatttgactttgatccacttgatgtgacaaaaacttggccagaggatatc 840

                                                          
Query: 308 atcccactgcaaccagttggacggatggtactgaacaagaacattga 354
            | ||  |||| || || ||| |  |||| |||||||||||||||||
Sbjct: 841 ttgcctttgcagccggtgggaagattggttctgaacaagaacattga 887



 Score = 48.1 bits (24), Expect = 0.032
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                    
Query: 524  tgtgctcaccacaacaaccatcatgatggcttaatgaatttcattcacagggatga 579
            |||||||| |||||||| ||  |||||||||  |||||||| || |||||||||||
Sbjct: 1057 tgtgctcatcacaacaatcactatgatggctctatgaattttatgcacagggatga 1112



to top

>ref|XM_470174.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1626

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 191/242 (78%)
 Strand = Plus / Plus

                                                                        
Query: 215  tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 274
            |||||||| |||||||||||||| ||  | || ||||||||  | || ||||| ||||| 
Sbjct: 799  tggaagctgttcatccagaccatcgaccccgaccacgaggaccgcttcgacttcgacccg 858

                                                                        
Query: 275  cttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatg 334
            || || ||||||||||| ||||| ||||||||| |||| ||||| || || ||  |||||
Sbjct: 859  ctcgacgtcaccaagacgtggcccgaggacatcgtcccgctgcagcccgtggggaggatg 918

                                                                        
Query: 335  gtactgaacaagaacattgacaatttcttcgcggaaaatgaacagcttgctttctgccca 394
            || || |||   ||||| ||||| |||||| |||| || || ||||| || |||||||| 
Sbjct: 919  gtgctcaaccgcaacatcgacaacttcttctcggagaacgagcagctggcgttctgcccc 978

                                                                        
Query: 395  gcagtcactgtccctggaatccactactctgatgataagctgctccagacaaggatcttc 454
            |   |||  || || || ||| ||||||| || || |||||||| ||||| |||||||||
Sbjct: 979  gggatcatcgtgccggggatctactactccgacgacaagctgctgcagacgaggatcttc 1038

              
Query: 455  tc 456
            ||
Sbjct: 1039 tc 1040



to top

>gb|BT012965.1| Lycopersicon esculentum clone 114156F, mRNA sequence
          Length = 1794

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 164/206 (79%)
 Strand = Plus / Plus

                                                                        
Query: 188  tctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgat 247
            |||||||||||||| ||||| || ||||||||||| ||||| ||||  || ||| | || 
Sbjct: 864  tctattgcagctggaaattatcctgaatggaagctcttcattcagattatggatccagaa 923

                                                                        
Query: 248  cacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatc 307
            || || || | |||||||||||| || |||||||| || || || |||||||||||||||
Sbjct: 924  catgaagacaaatttgactttgatccacttgatgtgacaaaaacttggccagaggacatc 983

                                                                        
Query: 308  atcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcg 367
             | ||  |||| || || ||| |  | || ||||||||||||||||| || |||||    
Sbjct: 984  ttgcctttgcagccggtgggaagattagttctgaacaagaacattgataacttctttaat 1043

                                      
Query: 368  gaaaatgaacagcttgctttctgccc 393
            || ||||| ||||| |||||||||||
Sbjct: 1044 gagaatgagcagctagctttctgccc 1069



 Score = 48.1 bits (24), Expect = 0.032
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                    
Query: 524  tgtgctcaccacaacaaccatcatgatggcttaatgaatttcattcacagggatga 579
            |||||||| |||||||| ||  |||||||||  |||||||| || |||||||||||
Sbjct: 1200 tgtgctcatcacaacaatcactatgatggctctatgaattttatgcacagggatga 1255



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 191/242 (78%)
 Strand = Plus / Minus

                                                                           
Query: 215     tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 274
               |||||||| |||||||||||||| ||  | || ||||||||  | || ||||| ||||| 
Sbjct: 1768901 tggaagctgttcatccagaccatcgaccccgaccacgaggaccgcttcgacttcgacccg 1768842

                                                                           
Query: 275     cttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatg 334
               || || ||||||||||| ||||| ||||||||| |||| ||||| || || ||  |||||
Sbjct: 1768841 ctcgacgtcaccaagacgtggcccgaggacatcgtcccgctgcagcccgtggggaggatg 1768782

                                                                           
Query: 335     gtactgaacaagaacattgacaatttcttcgcggaaaatgaacagcttgctttctgccca 394
               || || |||   ||||| ||||| |||||| |||| || || ||||| || |||||||| 
Sbjct: 1768781 gtgctcaaccgcaacatcgacaacttcttctcggagaacgagcagctggcgttctgcccc 1768722

                                                                           
Query: 395     gcagtcactgtccctggaatccactactctgatgataagctgctccagacaaggatcttc 454
               |   |||  || || || ||| ||||||| || || |||||||| ||||| |||||||||
Sbjct: 1768721 gggatcatcgtgccggggatctactactccgacgacaagctgctgcagacgaggatcttc 1768662

                 
Query: 455     tc 456
               ||
Sbjct: 1768661 tc 1768660



to top

>gb|AY339372.1| Oryza sativa (japonica cultivar-group) catalase mRNA, complete cds
          Length = 1861

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 191/242 (78%)
 Strand = Plus / Plus

                                                                        
Query: 215  tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 274
            |||||||| |||||||||||||| ||  | || ||||||||  | || ||||| ||||| 
Sbjct: 882  tggaagctgttcatccagaccatcgaccccgaccacgaggaccgcttcgacttcgacccg 941

                                                                        
Query: 275  cttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatg 334
            || || ||||||||||| ||||| ||||||||| |||| ||||| || || ||  |||||
Sbjct: 942  ctcgacgtcaccaagacgtggcccgaggacatcgtcccgctgcagcccgtggggaggatg 1001

                                                                        
Query: 335  gtactgaacaagaacattgacaatttcttcgcggaaaatgaacagcttgctttctgccca 394
            || || |||   ||||| ||||| |||||| |||| || || ||||| || |||||||| 
Sbjct: 1002 gtgctcaaccgcaacatcgacaacttcttctcggagaacgagcagctggcgttctgcccc 1061

                                                                        
Query: 395  gcagtcactgtccctggaatccactactctgatgataagctgctccagacaaggatcttc 454
            |   |||  || || || ||| ||||||| || || |||||||| ||||| |||||||||
Sbjct: 1062 gggatcatcgtgccggggatctactactccgacgacaagctgctgcagacgaggatcttc 1121

              
Query: 455  tc 456
            ||
Sbjct: 1122 tc 1123



to top

>gb|AC098693.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1004C08,
             complete sequence
          Length = 133090

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 191/242 (78%)
 Strand = Plus / Plus

                                                                         
Query: 215   tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 274
             |||||||| |||||||||||||| ||  | || ||||||||  | || ||||| ||||| 
Sbjct: 65461 tggaagctgttcatccagaccatcgaccccgaccacgaggaccgcttcgacttcgacccg 65520

                                                                         
Query: 275   cttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatg 334
             || || ||||||||||| ||||| ||||||||| |||| ||||| || || ||  |||||
Sbjct: 65521 ctcgacgtcaccaagacgtggcccgaggacatcgtcccgctgcagcccgtggggaggatg 65580

                                                                         
Query: 335   gtactgaacaagaacattgacaatttcttcgcggaaaatgaacagcttgctttctgccca 394
             || || |||   ||||| ||||| |||||| |||| || || ||||| || |||||||| 
Sbjct: 65581 gtgctcaaccgcaacatcgacaacttcttctcggagaacgagcagctggcgttctgcccc 65640

                                                                         
Query: 395   gcagtcactgtccctggaatccactactctgatgataagctgctccagacaaggatcttc 454
             |   |||  || || || ||| ||||||| || || |||||||| ||||| |||||||||
Sbjct: 65641 gggatcatcgtgccggggatctactactccgacgacaagctgctgcagacgaggatcttc 65700

               
Query: 455   tc 456
             ||
Sbjct: 65701 tc 65702



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 191/242 (78%)
 Strand = Plus / Minus

                                                                           
Query: 215     tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 274
               |||||||| |||||||||||||| ||  | || ||||||||  | || ||||| ||||| 
Sbjct: 1768899 tggaagctgttcatccagaccatcgaccccgaccacgaggaccgcttcgacttcgacccg 1768840

                                                                           
Query: 275     cttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatg 334
               || || ||||||||||| ||||| ||||||||| |||| ||||| || || ||  |||||
Sbjct: 1768839 ctcgacgtcaccaagacgtggcccgaggacatcgtcccgctgcagcccgtggggaggatg 1768780

                                                                           
Query: 335     gtactgaacaagaacattgacaatttcttcgcggaaaatgaacagcttgctttctgccca 394
               || || |||   ||||| ||||| |||||| |||| || || ||||| || |||||||| 
Sbjct: 1768779 gtgctcaaccgcaacatcgacaacttcttctcggagaacgagcagctggcgttctgcccc 1768720

                                                                           
Query: 395     gcagtcactgtccctggaatccactactctgatgataagctgctccagacaaggatcttc 454
               |   |||  || || || ||| ||||||| || || |||||||| ||||| |||||||||
Sbjct: 1768719 gggatcatcgtgccggggatctactactccgacgacaagctgctgcagacgaggatcttc 1768660

                 
Query: 455     tc 456
               ||
Sbjct: 1768659 tc 1768658



to top

>dbj|AK066378.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013060B21, full
            insert sequence
          Length = 1945

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 191/242 (78%)
 Strand = Plus / Plus

                                                                        
Query: 215  tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 274
            |||||||| |||||||||||||| ||  | || ||||||||  | || ||||| ||||| 
Sbjct: 1008 tggaagctgttcatccagaccatcgaccccgaccacgaggaccgcttcgacttcgacccg 1067

                                                                        
Query: 275  cttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatg 334
            || || ||||||||||| ||||| ||||||||| |||| ||||| || || ||  |||||
Sbjct: 1068 ctcgacgtcaccaagacgtggcccgaggacatcgtcccgctgcagcccgtggggaggatg 1127

                                                                        
Query: 335  gtactgaacaagaacattgacaatttcttcgcggaaaatgaacagcttgctttctgccca 394
            || || |||   ||||| ||||| |||||| |||| || || ||||| || |||||||| 
Sbjct: 1128 gtgctcaaccgcaacatcgacaacttcttctcggagaacgagcagctggcgttctgcccc 1187

                                                                        
Query: 395  gcagtcactgtccctggaatccactactctgatgataagctgctccagacaaggatcttc 454
            |   |||  || || || ||| ||||||| || || |||||||| ||||| |||||||||
Sbjct: 1188 gggatcatcgtgccggggatctactactccgacgacaagctgctgcagacgaggatcttc 1247

              
Query: 455  tc 456
            ||
Sbjct: 1248 tc 1249



to top

>dbj|AK062174.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-C11, full
            insert sequence
          Length = 1763

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 191/242 (78%)
 Strand = Plus / Plus

                                                                        
Query: 215  tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 274
            |||||||| |||||||||||||| ||  | || ||||||||  | || ||||| ||||| 
Sbjct: 860  tggaagctgttcatccagaccatcgaccccgaccacgaggaccgcttcgacttcgacccg 919

                                                                        
Query: 275  cttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatg 334
            || || ||||||||||| ||||| ||||||||| |||| ||||| || || ||  |||||
Sbjct: 920  ctcgacgtcaccaagacgtggcccgaggacatcgtcccgctgcagcccgtggggaggatg 979

                                                                        
Query: 335  gtactgaacaagaacattgacaatttcttcgcggaaaatgaacagcttgctttctgccca 394
            || || |||   ||||| ||||| |||||| |||| || || ||||| || |||||||| 
Sbjct: 980  gtgctcaaccgcaacatcgacaacttcttctcggagaacgagcagctggcgttctgcccc 1039

                                                                        
Query: 395  gcagtcactgtccctggaatccactactctgatgataagctgctccagacaaggatcttc 454
            |   |||  || || || ||| ||||||| || || |||||||| ||||| |||||||||
Sbjct: 1040 gggatcatcgtgccggggatctactactccgacgacaagctgctgcagacgaggatcttc 1099

              
Query: 455  tc 456
            ||
Sbjct: 1100 tc 1101



to top

>dbj|AB020502.1| Oryza sativa mRNA for catalase, complete cds
          Length = 1778

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 192/242 (79%), Gaps = 1/242 (0%)
 Strand = Plus / Plus

                                                                        
Query: 215  tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 274
            |||||||| |||||||||||||| ||  | || ||||||||  | || ||||| ||||| 
Sbjct: 833  tggaagctgttcatccagaccatcgaccccgaccacgaggaccgcttcgacttcgacccg 892

                                                                        
Query: 275  cttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatg 334
            || || ||||||||||| ||||| ||||||||| |||| ||||| || || ||  |||||
Sbjct: 893  ctcgacgtcaccaagacgtggcccgaggacatcgtcccgctgcagcccgtggggaggatg 952

                                                                        
Query: 335  gtactgaacaagaacattgacaatttcttcgcggaaaatgaacagcttgctttctgccca 394
            || || |||   ||||| ||||| |||||| |||| || || ||||| || |||||||| 
Sbjct: 953  gtgctcaaccgcaacatcgacaacttcttctcggagaacgagcagctggcgttctgcccg 1012

                                                                        
Query: 395  gcagtcactgtccctggaatccactactctgatgataagctgctccagacaaggatcttc 454
            | | |||  || || || ||| ||||||| || || |||||||| ||||| |||||||||
Sbjct: 1013 gga-tcatcgtgccggggatctactactccgacgacaagctgctgcagacgaggatcttc 1071

              
Query: 455  tc 456
            ||
Sbjct: 1072 tc 1073



to top

>dbj|D86611.1| Oryza sativa (japonica cultivar-group) CatC gene for catalase,
            complete cds
          Length = 4167

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 191/242 (78%)
 Strand = Plus / Plus

                                                                        
Query: 215  tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 274
            |||||||| |||||||||||||| ||  | || ||||||||  | || ||||| ||||| 
Sbjct: 2594 tggaagctgttcatccagaccatcgaccccgaccacgaggaccgcttcgacttcgacccg 2653

                                                                        
Query: 275  cttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatg 334
            || || ||||||||||| ||||| ||||||||| |||| ||||| || || ||  |||||
Sbjct: 2654 ctcgacgtcaccaagacgtggcccgaggacatcgtcccgctgcagcccgtggggaggatg 2713

                                                                        
Query: 335  gtactgaacaagaacattgacaatttcttcgcggaaaatgaacagcttgctttctgccca 394
            || || |||   ||||| ||||| |||||| |||| || || ||||| || |||||||| 
Sbjct: 2714 gtgctcaaccgcaacatcgacaacttcttctcggagaacgagcagctggcgttctgcccc 2773

                                                                        
Query: 395  gcagtcactgtccctggaatccactactctgatgataagctgctccagacaaggatcttc 454
            |   |||  || || || ||| ||||||| || || |||||||| ||||| |||||||||
Sbjct: 2774 gggatcatcgtgccggggatctactactccgacgacaagctgctgcagacgaggatcttc 2833

              
Query: 455  tc 456
            ||
Sbjct: 2834 tc 2835



to top

>gb|AY726007.1| Petunia x hybrida catalase gene, partial cds
          Length = 465

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 191 attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 250
           ||||||||||| ||||| || |||||||| || || || ||||| || ||| ||| ||||
Sbjct: 145 attgcagctggaaattatcctgaatggaaactctttattcagactatggatcctgctcac 204

                                                                
Query: 251 gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 303
           || ||||| ||||| ||||| || |||||||| || ||||| |||||||||||
Sbjct: 205 gaagatagttttgattttgatccacttgatgtgacgaagacttggccagagga 257



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 83  aagttccattggaaacctacatgtggtgtgaagt 116
           |||||||||||||| |||||||||||||| ||||
Sbjct: 37  aagttccattggaagcctacatgtggtgtcaagt 70



to top

>emb|AJ973128.1| Andrographis paniculata partial cat gene for putative catalase,
           exons 1-2
          Length = 941

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 166/209 (79%)
 Strand = Plus / Plus

                                                                       
Query: 185 gattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgct 244
           ||||| |||||||| || || || |||||||||||||| ||||||||||| || ||| ||
Sbjct: 615 gattcaattgcagcaggaaactatccagaatggaagctgttcatccagactatagatcct 674

                                                                       
Query: 245 gatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggac 304
           |  || ||||| || || ||||| || || || ||||| |||||||| ||||| ||||| 
Sbjct: 675 gtccatgaggacaggttcgacttcgatccgctggatgtaaccaagacttggcctgaggat 734

                                                                       
Query: 305 atcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 364
           ||  | || ||||| || || ||  | |||||  ||||||||||||| ||||| || || 
Sbjct: 735 atattgcccctgcagccggtggggagaatggtgttgaacaagaacatcgacaactttttt 794

                                        
Query: 365 gcggaaaatgaacagcttgctttctgccc 393
           || || ||||| |||||||| ||||||||
Sbjct: 795 gcagagaatgagcagcttgcattctgccc 823



to top

>gb|DQ123920.1| Coffea arabica x Coffea canephora clone HT-SSH1-A01 mRNA sequence
          Length = 509

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 121/149 (81%)
 Strand = Plus / Plus

                                                                       
Query: 431 aagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgtcttggtcca 490
           ||||||||||||||  | || ||| |||||| |||||||||  | ||||||||||| |||
Sbjct: 28  aagctgctccagactcgtatattcgcatatggtgatacccagcgacaccgtcttggccca 87

                                                                       
Query: 491 aactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaaccatcatgat 550
           |||||  ||  ||| || || |||||||| || |||||||| |||||||| ||  |||||
Sbjct: 88  aactatatgcagcttccagtaaatgcccccaagtgtgctcatcacaacaatcactatgat 147

                                        
Query: 551 ggcttaatgaatttcattcacagggatga 579
           || || ||||| ||||| ||| |||||||
Sbjct: 148 ggtttcatgaacttcatgcaccgggatga 176



to top

>gb|AF139538.2|AF139538 Raphanus sativus catalase 2 (cat2) mRNA, complete cds
          Length = 1824

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 163/205 (79%)
 Strand = Plus / Plus

                                                                        
Query: 184  tgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgc 243
            |||| ||||| || |||| || ||||| || |||||||||||||||||||| || ||| |
Sbjct: 810  tgatgctatttcatctggtaactaccctgagtggaagcttttcatccagacgatggatcc 869

                                                                        
Query: 244  tgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 303
            || | | |||||||  ||||| || ||||| |||||||| ||||||| |||||| |||||
Sbjct: 870  tgctgatgaggataagtttgatttcgacccgcttgatgtgaccaagatctggcctgagga 929

                                                                        
Query: 304  catcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttctt 363
             ||  | ||  ||||||||||||| ||  |||| || |||| || |||||| || |||||
Sbjct: 930  tattctgcctttgcaaccagttggtcgcttggttctcaacaggaccattgataacttctt 989

                                     
Query: 364  cgcggaaaatgaacagcttgctttc 388
                |||| ||| ||||||||||||
Sbjct: 990  taatgaaactgagcagcttgctttc 1014



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 129/161 (80%)
 Strand = Plus / Plus

                                                                        
Query: 407  cctggaatccactactctgatgataagctgctccagacaaggatcttctcatatgctgat 466
            ||||| ||| ||||||| |||||||||||||| |||   ||||||||  | |||| ||| 
Sbjct: 1033 cctgggatctactactcggatgataagctgcttcagtgtaggatctttgcgtatggtgac 1092

                                                                        
Query: 467  acccaaaggcaccgtcttggtccaaactacttgatgctccccgtgaatgccccgaaatgt 526
            || || || || |||||||| || |||||  ||  ||| || |||||||| || ||||||
Sbjct: 1093 actcagagacatcgtcttggacctaactatctgcagctaccggtgaatgctccaaaatgt 1152

                                                     
Query: 527  gctcaccacaacaaccatcatgatggcttaatgaatttcat 567
            |||||||||||||| || ||||| || || ||||| |||||
Sbjct: 1153 gctcaccacaacaatcaccatgaaggttttatgaacttcat 1193



to top

>emb|Z36975.1|NPCAT1MR N.plumbaginifolia mRNA for catalase (cat1 gene)
          Length = 1693

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 96/116 (82%)
 Strand = Plus / Plus

                                                                       
Query: 188 tctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgat 247
           |||||||| ||||| ||||| || ||||||||||| ||||| ||||| || ||| | |||
Sbjct: 752 tctattgctgctggaaattatcctgaatggaagctcttcattcagactatggatccagat 811

                                                                   
Query: 248 cacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 303
           || || || |||||||| ||||| || |||||||| || || || |||||||||||
Sbjct: 812 catgaagacagatttgattttgatccacttgatgtgacaaaaacttggccagagga 867



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 56/68 (82%)
 Strand = Plus / Plus

                                                                        
Query: 512  aatgccccgaaatgtgctcaccacaacaaccatcatgatggcttaatgaatttcattcac 571
            ||||| || ||||| ||||| |||||||| ||  | |||||||  |||||||| || |||
Sbjct: 1076 aatgctccaaaatgcgctcatcacaacaatcactacgatggctccatgaattttatgcac 1135

                    
Query: 572  agggatga 579
            ||||||||
Sbjct: 1136 agggatga 1143



to top

>gb|U93244.1|NTU93244 Nicotiana tabacum catalase 1 (cat1) mRNA, complete cds
          Length = 1756

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 96/116 (82%)
 Strand = Plus / Plus

                                                                       
Query: 188 tctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgat 247
           |||||||| ||||| ||||| || ||||||||||| ||||| ||||| || ||| | |||
Sbjct: 824 tctattgccgctggaaattatcctgaatggaagctcttcattcagactatggatccagat 883

                                                                   
Query: 248 cacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 303
           || || || |||||||| ||||| || |||||||| || || || |||||||||||
Sbjct: 884 catgaagacagatttgattttgatccacttgatgttacaaaaacttggccagagga 939



to top

>gb|AF170272.1|AF170272 Manihot esculenta catalase CAT1 mRNA, complete cds
          Length = 1792

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 102/124 (82%)
 Strand = Plus / Plus

                                                                        
Query: 456  catatgctgatacccaaaggcaccgtcttggtccaaactacttgatgctccccgtgaatg 515
            |||||||||| || || ||||||||||| || || |||||   ||||||||| || ||||
Sbjct: 1061 catatgctgacactcagaggcaccgtctcggacccaactataagatgctccctgttaatg 1120

                                                                        
Query: 516  ccccgaaatgtgctcaccacaacaaccatcatgatggcttaatgaatttcattcacaggg 575
            | || || |||||| | |||||||| ||| | ||||| || ||||||||||| |||||||
Sbjct: 1121 ctcccaagtgtgcttatcacaacaatcattacgatggtttcatgaatttcatgcacaggg 1180

                
Query: 576  atga 579
            ||||
Sbjct: 1181 atga 1184



to top

>emb|Z99633.1|SACATALAS Soldanella alpina mRNA for catalase (cat1 gene)
          Length = 1772

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                       
Query: 428  gataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgtcttgg 486
            |||||||||||||| ||  |||| || || |||||||||||||||||||||||||||||
Sbjct: 1055 gataagctgctccaaactcggatattttcttatgctgatacccaaaggcaccgtcttgg 1113



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                              
Query: 80  gttaagttccattggaaacctacatgtggtgtgaa 114
           ||||||||||||||||||||||||||||| |||||
Sbjct: 707 gttaagttccattggaaacctacatgtggagtgaa 741



to top

>gb|AY500290.1| Solanum tuberosum catalase (CAT2) mRNA, complete cds
          Length = 1761

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 97/118 (82%)
 Strand = Plus / Plus

                                                                        
Query: 428  gataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgtcttggt 487
            |||||||| |||||||| ||||| ||| | ||||||||||| || ||||||||| |||| 
Sbjct: 1012 gataagcttctccagactaggatattcgcgtatgctgatactcagaggcaccgtattgga 1071

                                                                      
Query: 488  ccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaaccatc 545
            ||||||||  ||  |||||| || ||||| || || |||| ||| |||||||| ||||
Sbjct: 1072 ccaaactatatgcagctcccagttaatgctcccaagtgtggtcatcacaacaatcatc 1129



to top

>gb|AY450630.1| Solanum tuberosum clone plbr1 catalase mRNA, partial cds
          Length = 313

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 97/118 (82%)
 Strand = Plus / Plus

                                                                       
Query: 428 gataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgtcttggt 487
           |||||||| |||||||| ||||| ||| | ||||||||||| || ||||||||| |||| 
Sbjct: 111 gataagcttctccagactaggatattcgcgtatgctgatactcagaggcaccgtattgga 170

                                                                     
Query: 488 ccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaaccatc 545
           ||||||||  ||  |||||| || ||||| || || |||| ||| |||||||| ||||
Sbjct: 171 ccaaactatatgcagctcccagttaatgctcccaagtgtggtcatcacaacaatcatc 228



to top

>emb|Z37106.1|STCATGP S.tuberosum cat gene encoding catalase (partial)
          Length = 4272

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 97/118 (82%)
 Strand = Plus / Plus

                                                                        
Query: 428  gataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgtcttggt 487
            |||||||| |||||||| ||||| ||| | ||||||||||| || ||||||||| |||| 
Sbjct: 2642 gataagcttctccagactaggatattcgcgtatgctgatactcagaggcaccgtattgga 2701

                                                                      
Query: 488  ccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaaccatc 545
            ||||||||  ||  |||||| || ||||| || || |||| ||| |||||||| ||||
Sbjct: 2702 ccaaactatatgcagctcccagttaatgctcccaagtgtggtcatcacaacaatcatc 2759



to top

>gb|AF006067.1|AF006067 Nicotiana glutinosa catalase-1 mRNA, complete cds
          Length = 1744

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 163/206 (79%)
 Strand = Plus / Plus

                                                                        
Query: 188  tctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgat 247
            |||||||||||||| ||||| || ||||||||||| ||||| ||||| || ||| |   |
Sbjct: 812  tctattgcagctggaaattatcctgaatggaagctcttcattcagactatggatccaagt 871

                                                                        
Query: 248  cacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatc 307
            || || || |||||||| || || || |||||||| || || || ||||||||||| |||
Sbjct: 872  catgaagacagatttgatttcgatccgcttgatgtgactaaaacttggccagaggatatc 931

                                                                        
Query: 308  atcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcg 367
             | ||  |||| || || ||| |  | || ||||||||||||||||| || |||||    
Sbjct: 932  ttgcctttgcagccggtgggaagattagttctgaacaagaacattgataacttctttaat 991

                                      
Query: 368  gaaaatgaacagcttgctttctgccc 393
            |||||||| ||||| |||||||||||
Sbjct: 992  gaaaatgagcagctagctttctgccc 1017



to top

>gb|AF537135.1| Phaseolus vulgaris cultivar Negro Jamapa catalase-1 (cat-1) mRNA,
           partial cds
          Length = 358

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 129/161 (80%)
 Strand = Plus / Plus

                                                                       
Query: 419 tactctgatgataagctgctccagacaaggatcttctcatatgctgatacccaaaggcac 478
           ||||| ||||||||| |||| || || ||||| ||||| ||||| ||| | || ||||||
Sbjct: 73  tactcagatgataagatgcttcaaaccaggatattctcttatgccgattcacagaggcac 132

                                                                       
Query: 479 cgtcttggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaac 538
            | ||||| ||||||||  ||   || || |  ||||| || || |||||||||||||||
Sbjct: 133 aggcttggaccaaactatctgcaacttcctgccaatgctcccaagtgtgctcaccacaac 192

                                                    
Query: 539 aaccatcatgatggcttaatgaatttcattcacagggatga 579
           || || ||||| || || ||||||||||| |||||||||||
Sbjct: 193 aatcaccatgaaggtttcatgaatttcatgcacagggatga 233



to top

>gb|AF096252.1|AF096252 Lycopersicon esculentum ethylene-responsive catalase (ER60) mRNA,
           partial cds
          Length = 270

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 93/113 (82%)
 Strand = Plus / Plus

                                                                       
Query: 188 tctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgat 247
           |||| ||||||||| ||||| || ||||||||| | ||||| ||||| || ||| | |||
Sbjct: 133 tctactgcagctggaaattatcctgaatggaagatcttcattcagactatggatccggat 192

                                                                
Query: 248 cacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccaga 300
           || || || |||||||||||||| || |||||||| || || || ||||||||
Sbjct: 193 catgaagacagatttgactttgatccacttgatgtgacaaaaacttggccaga 245



to top

>dbj|AP006107.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT29P11, TM0193,
             complete sequence
          Length = 102354

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 129/161 (80%)
 Strand = Plus / Minus

                                                                         
Query: 419   tactctgatgataagctgctccagacaaggatcttctcatatgctgatacccaaaggcac 478
             ||||| ||||||||| |||| || || ||||| ||||| ||||||||| | || ||||||
Sbjct: 65958 tactcagatgataagatgcttcaaaccaggattttctcttatgctgattcacagaggcac 65899

                                                                         
Query: 479   cgtcttggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaac 538
              | ||||| ||||| ||  ||   || || |  ||||| || || |||||||||||||||
Sbjct: 65898 agacttggaccaaattatctgcaacttcctgccaatgctcccaagtgtgctcaccacaac 65839

                                                      
Query: 539   aaccatcatgatggcttaatgaatttcattcacagggatga 579
             || || ||||| || || ||||||||||| |||||||||||
Sbjct: 65838 aatcaccatgagggtttcatgaatttcatgcacagggatga 65798



to top

>emb|Z36976.1|NPCAT2MR N.plumbaginifolia mRNA for catalase (cat2 gene)
          Length = 1716

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                        
Query: 428  gataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgtcttggt 487
            |||||||| |||||||||||||| ||| | ||||||||||| || || |||||| |||| 
Sbjct: 1057 gataagcttctccagacaaggatattcgcgtatgctgatactcagagacaccgtattgga 1116

                    
Query: 488  ccaaacta 495
            ||||||||
Sbjct: 1117 ccaaacta 1124



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 257 agatttgactttgaccctcttgatgtcaccaagacctggccagagga 303
           ||||| |||||||| ||||||||||| ||||||| |||||| |||||
Sbjct: 886 agattcgactttgatcctcttgatgtaaccaagatctggcctgagga 932



to top

>gb|DQ118681.1| Oryza sativa (indica cultivar-group) catalase-C mRNA, complete cds
          Length = 1503

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 86/104 (82%)
 Strand = Plus / Plus

                                                                       
Query: 215 tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 274
           |||||||| |||||||||||||| ||  | || ||||||||  | || ||||| ||||| 
Sbjct: 796 tggaagctgttcatccagaccatcgaccccgaccacgaggaccgcttcgacttcgacccg 855

                                                       
Query: 275 cttgatgtcaccaagacctggccagaggacatcatcccactgca 318
           || || ||||||||||| ||||| ||||||||| |||| |||||
Sbjct: 856 ctcgacgtcaccaagacgtggcccgaggacatcgtcccgctgca 899



to top

>gb|AY272049.1| Avicennia marina catalase (Cat1) gene, complete cds
          Length = 2036

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 86/104 (82%)
 Strand = Plus / Plus

                                                                        
Query: 473  aggcaccgtcttggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcac 532
            ||||||||||| || ||||||||| || |||| || || ||||| |||||||| ||  ||
Sbjct: 1067 aggcaccgtctcgggccaaactacctgctgcttccagttaatgcaccgaaatgcgcctac 1126

                                                        
Query: 533  cacaacaaccatcatgatggcttaatgaatttcattcacaggga 576
            |||||||| ||| | || || || ||||||||||| ||||||||
Sbjct: 1127 cacaacaatcattacgacggtttcatgaatttcatgcacaggga 1170



to top

>gb|AF328861.1|AF328861 Avicennia marina catalase mRNA, complete cds
          Length = 1754

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 86/104 (82%)
 Strand = Plus / Plus

                                                                        
Query: 473  aggcaccgtcttggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcac 532
            ||||||||||| || ||||||||| || |||| || || ||||| |||||||| ||  ||
Sbjct: 1077 aggcaccgtctcgggccaaactacctgctgcttccagttaatgcaccgaaatgcgcctac 1136

                                                        
Query: 533  cacaacaaccatcatgatggcttaatgaatttcattcacaggga 576
            |||||||| ||| | || || || ||||||||||| ||||||||
Sbjct: 1137 cacaacaatcattacgacggtttcatgaatttcatgcacaggga 1180



to top

>gb|U68219.2|BNU68219 Brassica napus catalase (LSC650) mRNA, partial cds
          Length = 1728

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 125/156 (80%)
 Strand = Plus / Plus

                                                                       
Query: 189 ctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatc 248
           |||||||  |||| || ||||| || ||||||||||| || ||||| || ||| |||   
Sbjct: 813 ctattgcgtctggtaactaccctgagtggaagctttttattcagacaatggatcctgcgg 872

                                                                       
Query: 249 acgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatca 308
           | |||||||  |||||||| ||||| |||||||| ||||||| |||||| ||||| ||| 
Sbjct: 873 atgaggataagtttgacttcgacccgcttgatgtgaccaagatctggcctgaggatatct 932

                                               
Query: 309 tcccactgcaaccagttggacggatggtactgaaca 344
           | || ||||| || ||||| ||| |||| |||||||
Sbjct: 933 tgcctctgcagcctgttggtcggttggttctgaaca 968



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 137/173 (79%)
 Strand = Plus / Plus

                                                                        
Query: 407  cctggaatccactactctgatgataagctgctccagacaaggatcttctcatatgctgat 466
            ||||| ||| ||||||| ||||| |||||||| |||   ||||||||  | |||| ||| 
Sbjct: 1031 cctgggatctactactcggatgacaagctgcttcagtgtaggatctttgcgtatggtgac 1090

                                                                        
Query: 467  acccaaaggcaccgtcttggtccaaactacttgatgctccccgtgaatgccccgaaatgt 526
            || || || || |||||||| || |||||  ||  ||| || || ||||| || ||||||
Sbjct: 1091 actcagagacatcgtcttggaccgaactatctgcagcttccggttaatgctcccaaatgt 1150

                                                                 
Query: 527  gctcaccacaacaaccatcatgatggcttaatgaatttcattcacagggatga 579
            |||||||||||||| || ||||| || || ||||| ||||| ||||| |||||
Sbjct: 1151 gctcaccacaacaatcaccatgaagggtttatgaacttcatgcacagagatga 1203



to top

>gb|DQ255945.1| Avicennia marina truncated catalase 2 mRNA, complete cds,
            alternatively spliced
          Length = 2254

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 86/104 (82%)
 Strand = Plus / Plus

                                                                        
Query: 473  aggcaccgtcttggtccaaactacttgatgctccccgtgaatgccccgaaatgtgctcac 532
            ||||||||||| || ||||||||| || |||| || || ||||| |||||||| ||  ||
Sbjct: 1108 aggcaccgtctcgggccaaactacctgctgcttccagttaatgcaccgaaatgcgcctac 1167

                                                        
Query: 533  cacaacaaccatcatgatggcttaatgaatttcattcacaggga 576
            |||||||| ||| | || || || ||||||||||| ||||||||
Sbjct: 1168 cacaacaatcattacgacggtttcatgaatttcatgcacaggga 1211



to top

>gb|M93719.1|TOMCAT1A Lycopersicon esculentum catalase (cat1) mRNA, complete cds
          Length = 1804

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 115/143 (80%)
 Strand = Plus / Plus

                                                                        
Query: 403  tgtccctggaatccactactctgatgataagctgctccagacaaggatcttctcatatgc 462
            ||||||||| ||  |||| || || |||||||| |||||||| ||||| ||| | |||||
Sbjct: 1019 tgtccctggtatttactattccgaggataagcttctccagactaggatattcgcgtatgc 1078

                                                                        
Query: 463  tgatacccaaaggcaccgtcttggtccaaactacttgatgctccccgtgaatgccccgaa 522
            |||||| || || |||||| |||| ||||||||  ||  |||||| || ||||| || ||
Sbjct: 1079 tgatactcagagacaccgtattggaccaaactatatgcagctcccagttaatgctcccaa 1138

                                   
Query: 523  atgtgctcaccacaacaaccatc 545
             |||| ||| |||||||| ||||
Sbjct: 1139 gtgtggtcatcacaacaatcatc 1161



to top

>emb|X71653.1|SMCATSM S.melongena CATSM mRNA for catalase
          Length = 1691

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 96/118 (81%)
 Strand = Plus / Plus

                                                                        
Query: 428  gataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgtcttggt 487
            |||||||| || ||||| ||||| ||  ||||||||||||| || || |||||| |||| 
Sbjct: 1031 gataagcttcttcagactaggatatttgcatatgctgatactcagagacaccgtattggg 1090

                                                                      
Query: 488  ccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaaccatc 545
            ||||||||  ||  |||||| || ||||| || || |||||||| |||||||| ||||
Sbjct: 1091 ccaaactatatgcagctcccagttaatgctcccaagtgtgctcatcacaacaatcatc 1148



to top

>emb|X54819.1|ZMCAT2R Maize mRNA for catalase 2
          Length = 1778

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 90/110 (81%)
 Strand = Plus / Plus

                                                                        
Query: 347  aacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtc 406
            ||||| ||||| ||||||||||| || || ||||| || |||||||| |   |||  |||
Sbjct: 967  aacatcgacaacttcttcgcggagaacgagcagctggccttctgcccgggcctcatcgtc 1026

                                                              
Query: 407  cctggaatccactactctgatgataagctgctccagacaaggatcttctc 456
            ||||| ||| ||||||| || || |||||||| ||||| |||||||||||
Sbjct: 1027 cctggtatctactactccgacgacaagctgctgcagaccaggatcttctc 1076



to top

>emb|AJ616025.1| Homogyne alpina mRNA for catalase (cat1 gene)
          Length = 1779

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 117/146 (80%)
 Strand = Plus / Plus

                                                                        
Query: 236  attgatgctgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctgg 295
            |||||| ||||||| || ||| |  ||||||||||||| |||||||  || | ||| |||
Sbjct: 874  attgatcctgatcatgaagatcggcttgactttgacccgcttgatgggacaatgacatgg 933

                                                                        
Query: 296  ccagaggacatcatcccactgcaaccagttggacggatggtactgaacaagaacattgac 355
            || || |||||||| ||  |||| || |||||| |||||||  |||| ||||| || |||
Sbjct: 934  cctgatgacatcattcctttgcagcctgttggaaggatggttttgaataagaatatcgac 993

                                      
Query: 356  aatttcttcgcggaaaatgaacagct 381
            || ||||| || || |||||||||||
Sbjct: 994  aacttctttgctgagaatgaacagct 1019



to top

>emb|Z54358.1|ZMCAT2GN Z.mays cat2 gene
          Length = 3662

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 90/110 (81%)
 Strand = Plus / Plus

                                                                        
Query: 347  aacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtc 406
            ||||| ||||| ||||||||||| || || ||||| || |||||||| |   |||  |||
Sbjct: 2814 aacatcgacaacttcttcgcggagaacgagcagctggccttctgcccgggcctcatcgtc 2873

                                                              
Query: 407  cctggaatccactactctgatgataagctgctccagacaaggatcttctc 456
            ||||| ||| ||||||| || || |||||||| ||||| |||||||||||
Sbjct: 2874 cctggtatctactactccgacgacaagctgctgcagaccaggatcttctc 2923



to top

>gb|AY110648.1| Zea mays CL1739_1 mRNA sequence
          Length = 1813

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 90/110 (81%)
 Strand = Plus / Plus

                                                                        
Query: 347  aacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtc 406
            ||||| ||||| ||||||||||| || || ||||| || |||||||| |   |||  |||
Sbjct: 981  aacatcgacaacttcttcgcggagaacgagcagctggccttctgcccgggcctcatcgtc 1040

                                                              
Query: 407  cctggaatccactactctgatgataagctgctccagacaaggatcttctc 456
            ||||| ||| ||||||| || || |||||||| ||||| |||||||||||
Sbjct: 1041 cctggtatctactactccgacgacaagctgctgcagaccaggatcttctc 1090



to top

>gb|AY107763.1| Zea mays PCO104975 mRNA sequence
          Length = 1200

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 90/110 (81%)
 Strand = Plus / Plus

                                                                       
Query: 347 aacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtc 406
           ||||| ||||| ||||||||||| || || ||||| || |||||||| |   |||  |||
Sbjct: 183 aacatcgacaacttcttcgcggagaacgagcagctggccttctgcccgggcctcatcgtc 242

                                                             
Query: 407 cctggaatccactactctgatgataagctgctccagacaaggatcttctc 456
           ||||| ||| ||||||| || || |||||||| ||||| |||||||||||
Sbjct: 243 cctggtatctactactccgacgacaagctgctgcagaccaggatcttctc 292



to top

>emb|AJ874264.1| Populus deltoides cat2 gene for catalase, exons 1-8
          Length = 3147

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 72/86 (83%)
 Strand = Plus / Plus

                                                                        
Query: 407  cctggaatccactactctgatgataagctgctccagacaaggatcttctcatatgctgat 466
            ||||| ||| |||| || ||||||||| |||| || || || |||||||| |||||||||
Sbjct: 1830 cctggtatctactattcggatgataagttgctgcaaactagaatcttctcgtatgctgat 1889

                                      
Query: 467  acccaaaggcaccgtcttggtccaaa 492
            || || |||||||| ||||| |||||
Sbjct: 1890 actcagaggcaccgccttgggccaaa 1915



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                            
Query: 260  tttgactttgaccctcttgatgtcaccaagacctggccagaggacatc 307
            |||||||||||||| |||||||| |||||||| ||||| || ||||||
Sbjct: 1683 tttgactttgacccacttgatgtaaccaagacttggcctgaagacatc 1730



to top

>gb|U03473.1|NTU03473 Nicotiana tabacum SR1 salicylic acid binding catalase mRNA, partial
           cds
          Length = 1860

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                       
Query: 263 gactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaacca 322
           |||||||| ||||||||||| |||||||||||||| ||||| ||| | ||| ||   |||
Sbjct: 839 gactttgatcctcttgatgtaaccaagacctggcctgaggatatcttgccattgatgcca 898

                                 
Query: 323 gttggacggatggtactgaaca 344
           ||||||||  ||||||| ||||
Sbjct: 899 gttggacgattggtacttaaca 920



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                        
Query: 431  aagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgtcttggtcca 490
            ||||| |||||||| ||||| ||| | ||||||||||| || || |||||| |||| |||
Sbjct: 1007 aagcttctccagactaggatattcgcgtatgctgatactcagagacaccgtattggacca 1066

                 
Query: 491  aacta 495
            |||||
Sbjct: 1067 aacta 1071



to top

>gb|DQ294281.1| Solanum tuberosum clone 048E08 catalase isozyme 1-like protein mRNA,
            complete cds
          Length = 1746

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 96/118 (81%)
 Strand = Plus / Plus

                                                                        
Query: 428  gataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgtcttggt 487
            |||||||| |||||||| ||||| ||| | ||||||||||| || || |||||| |||| 
Sbjct: 1052 gataagcttctccagactaggatattcgcgtatgctgatactcagagacaccgtattgga 1111

                                                                      
Query: 488  ccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaaccatc 545
            ||||||||  ||  |||||| || ||||| || || |||| ||| |||||||| ||||
Sbjct: 1112 ccaaactatatgcagctcccagttaatgctcccaagtgtggtcatcacaacaatcatc 1169



to top

>gb|DQ268837.1| Solanum tuberosum clone 120C07 catalase isozyme 1-like protein mRNA,
            complete cds
          Length = 1525

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 96/118 (81%)
 Strand = Plus / Plus

                                                                        
Query: 428  gataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgtcttggt 487
            |||||||| |||||||| ||||| ||| | ||||||||||| || || |||||| |||| 
Sbjct: 1055 gataagcttctccagactaggatattcgcgtatgctgatactcagagacaccgtattgga 1114

                                                                      
Query: 488  ccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaaccatc 545
            ||||||||  ||  |||||| || ||||| || || |||| ||| |||||||| ||||
Sbjct: 1115 ccaaactatatgcagctcccagttaatgctcccaagtgtggtcatcacaacaatcatc 1172



to top

>gb|U27082.1|STU27082 Solanum tuberosum catalase (CAT1) mRNA, complete cds
          Length = 1772

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 96/118 (81%)
 Strand = Plus / Plus

                                                                        
Query: 428  gataagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgtcttggt 487
            |||||||| |||||||| ||||| ||| | ||||||||||| || || |||||| |||| 
Sbjct: 1014 gataagcttctccagactaggatattcgcgtatgctgatactcagagacaccgtattgga 1073

                                                                      
Query: 488  ccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaaccatc 545
            ||||||||  ||  |||||| || ||||| || || |||| ||| |||||||| ||||
Sbjct: 1074 ccaaactatatgcagctcccagttaatgctcccaagtgtggtcatcacaacaatcatc 1131



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 185 gattctattgcagctgggaattacccagaatggaagcttttcatcca 231
           ||||| ||||||||||| || || || || |||||||||||||||||
Sbjct: 771 gattcaattgcagctggaaactatcctgagtggaagcttttcatcca 817



to top

>gb|L41694.1|PS300032E Eucalyptus globulus bicostata symbiont (F00059) mRNA, ESTun032
          Length = 242

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 506 cccgtgaatgccccgaaatgtgctcaccacaacaaccatcatgatggcttaatgaatttc 565
           ||||| ||||| || || || ||||| ||||||||||| |||||||| || |||||| ||
Sbjct: 58  cccgttaatgctcccaagtgcgctcatcacaacaaccaccatgatggtttcatgaatatc 117

                         
Query: 566 attcacagggatga 579
           || |||||||||||
Sbjct: 118 atgcacagggatga 131



to top

>gb|U07627.1|NTU07627 Nicotiana tabacum Petit Havana SR1 catalase (CAT-1) mRNA, complete
           cds
          Length = 1897

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                       
Query: 263 gactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaacca 322
           |||||||| ||||||||||| |||||||||||||| ||||| ||| | ||| ||   |||
Sbjct: 875 gactttgatcctcttgatgtaaccaagacctggcctgaggatatcttgccattgatgcca 934

                                 
Query: 323 gttggacggatggtactgaaca 344
           ||||||||  ||||||| ||||
Sbjct: 935 gttggacgattggtacttaaca 956



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                        
Query: 431  aagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgtcttggtcca 490
            ||||| |||||||| ||||| ||| | ||||||||||| || || |||||| |||| |||
Sbjct: 1043 aagcttctccagactaggatattcgcgtatgctgatactcagagacaccgtattggacca 1102

                 
Query: 491  aacta 495
            |||||
Sbjct: 1103 aacta 1107



to top

>gb|U07626.1|NSU07626 Nicotiana sylvestris catalase (CAT-1) mRNA, partial cds
          Length = 1416

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                       
Query: 263 gactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaacca 322
           |||||||| ||||||||||| |||||||||||||| ||||| ||| | ||| ||   |||
Sbjct: 520 gactttgatcctcttgatgtaaccaagacctggcctgaggatatcttgccattgatgcca 579

                                 
Query: 323 gttggacggatggtactgaaca 344
           ||||||||  ||||||| ||||
Sbjct: 580 gttggacgattggtacttaaca 601



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 431 aagctgctccagacaaggatcttctcatatgctgatacccaaaggcaccgtcttggtcca 490
           ||||| |||||||| ||||| ||| | ||||||||||| || || |||||| |||| |||
Sbjct: 688 aagcttctccagactaggatattcgcgtatgctgatactcagagacaccgtattggacca 747

                
Query: 491 aacta 495
           |||||
Sbjct: 748 aacta 752



to top

>gb|J02976.1|MZECAT2 Maize catalase (Cat2) mRNA, 3' end
          Length = 1793

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 90/110 (81%)
 Strand = Plus / Plus

                                                                        
Query: 347  aacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtc 406
            ||||| ||||| ||||||||||| || || ||||| || |||||||| |   |||  |||
Sbjct: 979  aacatcgacaacttcttcgcggagaacgagcagctggccttctgcccgggcctcatcgtc 1038

                                                              
Query: 407  cctggaatccactactctgatgataagctgctccagacaaggatcttctc 456
            ||||| ||| ||||||| || || |||||||| ||||| |||||||||||
Sbjct: 1039 cctggtatctactactccgacgacaagctgctgcagaccaggatcttctc 1088



to top

>gb|AF227952.1|AF227952 Capsicum annuum catalase (CAT) mRNA, complete cds
          Length = 1837

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 77/93 (82%)
 Strand = Plus / Plus

                                                                        
Query: 403  tgtccctggaatccactactctgatgataagctgctccagacaaggatcttctcatatgc 462
            |||||||||  || |||| || || |||||||| |||||||| ||||| ||  |||||||
Sbjct: 1032 tgtccctggtgtctactattcggaggataagcttctccagactaggatatttgcatatgc 1091

                                             
Query: 463  tgatacccaaaggcaccgtcttggtccaaacta 495
            |||||| || || |||||| |||| ||||||||
Sbjct: 1092 tgatactcagagacaccgtattggaccaaacta 1124



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 263 gactttgaccctcttgatgtcaccaagacctggccagagga 303
           ||||||||||||||||| || |||||||||||||| |||||
Sbjct: 892 gactttgaccctcttgacgtaaccaagacctggcctgagga 932



to top

>emb|AJ131046.1|CAR131046 Cicer arietinum mRNA for catalase
          Length = 596

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 524 tgtgctcaccacaacaaccatcatgatggcttaatgaatttcattcacagggatga 579
           ||||||||||| ||||| || ||||| || || ||||||||||| |||||||||||
Sbjct: 7   tgtgctcaccataacaatcaccatgagggtttcatgaatttcatccacagggatga 62



to top

>gb|DQ004737.1| Phaseolus lunatus catalase (CAT1) mRNA, partial cds
          Length = 627

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                       
Query: 512 aatgccccgaaatgtgctcaccacaacaaccatcatgatggcttaatgaatttcattcac 571
           ||||| || |||||||| || ||||||||||| ||||| || || ||||||||||| |||
Sbjct: 559 aatgcacccaaatgtgcccatcacaacaaccaccatgaaggtttcatgaatttcatgcac 618

                   
Query: 572 agggatga 579
           || |||||
Sbjct: 619 agagatga 626



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 259 atttgactttgaccctcttgatgtcaccaagacctggccagagga 303
           ||||||||||||||| |||||||| || |||| |||||| |||||
Sbjct: 306 atttgactttgacccacttgatgtaactaagatctggcctgagga 350



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 42/47 (89%), Gaps = 1/47 (2%)
 Strand = Plus / Plus

                                                          
Query: 13  aggcacatggnacggttttggtgtcaacacctacaccttaatcagca 59
           |||||||||| | ||||||||||||||||| |||||| | |||||||
Sbjct: 61  aggcacatgg-atggttttggtgtcaacacttacaccctcatcagca 106



to top

>gb|AF069320.1|AF069320 Mesembryanthemum crystallinum root catalase mRNA, complete cds
          Length = 1847

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 132/167 (79%)
 Strand = Plus / Plus

                                                                        
Query: 191  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 250
            |||||||||||||||||||| || |||| | | ||||| || || || ||| |||   | 
Sbjct: 875  attgcagctgggaattaccctgagtggaggttgttcattcaaacaatggatcctgcagat 934

                                                                        
Query: 251  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 310
            || |||| ||| |||||||||||  | ||| | |||||||| ||||||||||||||  | 
Sbjct: 935  gaagataaattcgactttgacccgttagatattaccaagacatggccagaggacattctg 994

                                                           
Query: 311  ccactgcaaccagttggacggatggtactgaacaagaacattgacaa 357
            || ||||| ||||| || ||  ||||  ||||||||||||| |||||
Sbjct: 995  cccctgcagccagtgggtcgtttggtgttgaacaagaacatcgacaa 1041



to top

>emb|Y13220.1|CRCATALAS Chlamydomonas reinhardtii mRNA for catalase
          Length = 1934

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                  
Query: 260  tttgactttgaccctcttgatgtcaccaagacctggcc 297
            ||||||||||||||||| || || ||||||||||||||
Sbjct: 1020 tttgactttgaccctctggacgtgaccaagacctggcc 1057



to top

>gb|AY973614.1| Manihot esculenta catalase CAT2 mRNA, partial cds
          Length = 1001

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 98/122 (80%)
 Strand = Plus / Plus

                                                                       
Query: 458 tatgctgatacccaaaggcaccgtcttggtccaaactacttgatgctccccgtgaatgcc 517
           ||||||||||| || ||||||||||| || || ||||||  |||||| || || ||||| 
Sbjct: 377 tatgctgatactcagaggcaccgtctcggacccaactacaagatgctgcctgttaatgct 436

                                                                       
Query: 518 ccgaaatgtgctcaccacaacaaccatcatgatggcttaatgaatttcattcacagggat 577
           || || |||  | | |||||||| ||  ||||||| || ||||||||||| ||||| |||
Sbjct: 437 cccaagtgtaattatcacaacaatcactatgatggtttcatgaatttcatgcacagagat 496

             
Query: 578 ga 579
           ||
Sbjct: 497 ga 498



to top

>gb|AF016902.1|AF016902 Chlamydomonas reinhardtii catalase (CAT) mRNA, complete cds
          Length = 1835

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 260 tttgactttgaccctcttgatgtcaccaagacctggcc 297
           ||||||||||||||||| || || ||||||||||||||
Sbjct: 915 tttgactttgaccctctggacgtgaccaagacctggcc 952



to top

>emb|AJ849640.1| Secale cereale mRNA for catalase (cat1b gene)
          Length = 1781

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 260 tttgactttgaccctcttgatgtcaccaagacctggccagaggac 304
           |||||||||||||| || |||| ||||||||| ||||| ||||||
Sbjct: 923 tttgactttgacccgctggatgacaccaagacgtggcccgaggac 967



to top

>gb|AF443179.1|AF443179 Nicotiana tabacum catalase mRNA, partial cds
          Length = 683

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                       
Query: 188 tctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgat 247
           |||||||| ||||| ||||| || ||||||||||| ||||| ||||| || ||| | |||
Sbjct: 604 tctattgccgctggaaattatcctgaatggaagctcttcattcagactatggatccagat 663

                            
Query: 248 cacgaggatagatttga 264
           || || || ||||||||
Sbjct: 664 catgaagacagatttga 680



to top

>gb|AF243519.1|AF243519 Helianthus annuus catalase 4 (CATA4) mRNA, complete cds
          Length = 1871

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 97/121 (80%)
 Strand = Plus / Plus

                                                                        
Query: 261  ttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaac 320
            ||||||||||||| || |||| ||||| ||||||||| |||||  | || || ||||| |
Sbjct: 882  ttgactttgacccgctcgatggcaccatgacctggcctgaggatgtgataccgctgcagc 941

                                                                        
Query: 321  cagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagc 380
            | || || || |||||  |||| ||||| ||||| || ||||| || || ||||||||||
Sbjct: 942  ctgtcgggcgtatggtgttgaataagaatattgataacttctttgctgagaatgaacagc 1001

             
Query: 381  t 381
            |
Sbjct: 1002 t 1002



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                             
Query: 447  ggatcttctcatatgctgatacccaaaggcaccgtcttggtccaaacta 495
            |||||||| | ||| ||||||| || |||||||||||||| || |||||
Sbjct: 1068 ggatcttcgcgtattctgatacgcagaggcaccgtcttggaccgaacta 1116



to top

>gb|AF112368.1|AF112368 Lycopersicon esculentum catalase 2 mRNA, complete cds
          Length = 1725

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 259 atttgactttgaccctcttgatgtcaccaagacctggccagaggacatc 307
           |||||||||||| || |||||||| || || || |||||||||||||||
Sbjct: 865 atttgactttgatccacttgatgtgacaaaaacttggccagaggacatc 913



 Score = 48.1 bits (24), Expect = 0.032
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                    
Query: 524  tgtgctcaccacaacaaccatcatgatggcttaatgaatttcattcacagggatga 579
            |||||||| |||||||| ||  |||||||||  |||||||| || |||||||||||
Sbjct: 1130 tgtgctcatcacaacaatcactatgatggctctatgaattttatgcacagggatga 1185



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 188 tctattgcagctgggaattacccagaatggaa 219
           |||||||||||||| ||||| || ||||||||
Sbjct: 794 tctattgcagctggaaattatcctgaatggaa 825



to top

>ref|XM_365841.1| Magnaporthe grisea 70-15 hypothetical protein (MG10061.4) partial
           mRNA
          Length = 2232

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 26  ggttttggtgtcaacacctacacc 49
           ||||||||||||||||||||||||
Sbjct: 706 ggttttggtgtcaacacctacacc 729



to top

>gb|AY987854.1| Euphorbia characias catalase mRNA, complete cds
          Length = 1761

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 191 attgcagctgggaattacccagaatggaagcttttcatccagac 234
           ||||||||||| || || ||||||||||| |||||||| |||||
Sbjct: 849 attgcagctggaaactatccagaatggaaacttttcattcagac 892



to top

>gb|AF149283.1|AF149283 Phaseolus vulgaris catalase 1 (CAT1) mRNA, partial cds
          Length = 1286

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 512 aatgccccgaaatgtgctcaccacaacaaccatcatgatggcttaatgaatttcattcac 571
           ||||| || |||||||| || |||||||| || ||||| || || ||||||||||| |||
Sbjct: 920 aatgcacccaaatgtgcccatcacaacaatcaccatgaaggtttcatgaatttcatgcac 979

                   
Query: 572 agggatga 579
           || |||||
Sbjct: 980 agagatga 987



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 42/47 (89%), Gaps = 1/47 (2%)
 Strand = Plus / Plus

                                                          
Query: 13  aggcacatggnacggttttggtgtcaacacctacaccttaatcagca 59
           |||||||||| | ||||||||||||||||| |||||| | |||||||
Sbjct: 422 aggcacatgg-atggttttggtgtcaacacatacaccctcatcagca 467



to top

>dbj|D86327.1| Triticum aestivum mRNA for catalase, complete cds
          Length = 1573

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                    
Query: 417  actactctgatgataagctgctccagacaaggatcttctc 456
            ||||||| || || |||||||| |||||||||||||||||
Sbjct: 1023 actactcggacgacaagctgctgcagacaaggatcttctc 1062



to top

>gb|AF332973.2| Zantedeschia aethiopica catalase 2 (Cat2) mRNA, complete cds
          Length = 1854

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 83/103 (80%)
 Strand = Plus / Plus

                                                                        
Query: 262  tgactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaacc 321
            |||||| ||||| || || | ||||||||||||||| |||||| |  |||| ||||| ||
Sbjct: 899  tgacttcgacccactggacgacaccaagacctggccggaggacctgctccccctgcagcc 958

                                                       
Query: 322  agttggacggatggtactgaacaagaacattgacaatttcttc 364
            ||| || ||  |||| || |||| |||||| ||||| ||||||
Sbjct: 959  agtgggccgcctggttctcaacaggaacatcgacaacttcttc 1001



to top

>dbj|D21162.1|RCCCATALAB Ricinus communis gene for catalase CAT2, complete cds (exon 1-7)
          Length = 3518

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 533  cacaacaaccatcatgatggcttaatgaatttcattcacagggatga 579
            |||||||| ||| ||||||| || ||||||||||| ||||| |||||
Sbjct: 2658 cacaacaatcattatgatggtttcatgaatttcatgcacagagatga 2704



to top

>gb|AY159321.1| Simian immunodeficiency virus isolate SIVdrl1FAO, complete genome
          Length = 9732

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 58   cagggatggaaaggctcacctg 79
            ||||||||||||||||||||||
Sbjct: 2567 cagggatggaaaggctcacctg 2588



to top

>gb|U64156.1|HIVU64156 HIV-1 isolate MM351 from Australia, reverse transcriptase (pol)
           gene, partial cds
          Length = 726

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 58  cagggatggaaaggctcacctg 79
           ||||||||||||||||||||||
Sbjct: 428 cagggatggaaaggctcacctg 449



to top

>gb|AC091333.6| Mus musculus chromosome 7, clone RP23-325M1, complete sequence
          Length = 192111

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 430   taagctgctccagacaaggat 450
             |||||||||||||||||||||
Sbjct: 80132 taagctgctccagacaaggat 80152



to top

>gb|AC138549.3| Mus musculus BAC clone RP23-173C1 from chromosome 7, complete sequence
          Length = 203651

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 430   taagctgctccagacaaggat 450
             |||||||||||||||||||||
Sbjct: 79976 taagctgctccagacaaggat 79996



to top

>gb|AY802593.1| HIV-1 isolate CA10424 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 780

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 57  gcagggatggaaaggctcacc 77
           |||||||||||||||||||||
Sbjct: 450 gcagggatggaaaggctcacc 470



to top

>gb|AY802587.1| HIV-1 isolate CA4230 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 771

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 57  gcagggatggaaaggctcacc 77
           |||||||||||||||||||||
Sbjct: 450 gcagggatggaaaggctcacc 470



to top

>gb|DQ024058.1| HIV-1 isolate mA142 from Martinique reverse transcriptase (pol)
           gene, partial cds
          Length = 577

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 57  gcagggatggaaaggctcacc 77
           |||||||||||||||||||||
Sbjct: 329 gcagggatggaaaggctcacc 349



to top

>gb|AF260737.1|AF260737 Cucurbita pepo catalase mRNA, partial cds
          Length = 492

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 339 tgaacaagaacattgacaatttctt 363
           ||||||||||||| |||||||||||
Sbjct: 253 tgaacaagaacatagacaatttctt 277



to top

>gb|AY170463.1| Morus alba catalase (CAT1) mRNA, partial cds
          Length = 585

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 64  tggaaaggctcacctggttaagttccattggaaacctacatgtggtgtgaagt 116
           |||||||||||||   || || |||||||||||||| || |||||||| ||||
Sbjct: 432 tggaaaggctcactatgtgaaattccattggaaacccacctgtggtgtcaagt 484



to top

>gb|AY365745.1| HIV-1 isolate 106239 from Argentina pol protein (pol) gene, partial
           cds
          Length = 1497

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 57  gcagggatggaaaggctcacc 77
           |||||||||||||||||||||
Sbjct: 747 gcagggatggaaaggctcacc 767



to top

>dbj|D55647.1|CUCCAT3 Pumpkin mRNA for catalase (cat3), complete cds
          Length = 1804

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                 
Query: 339  tgaacaagaacattgacaatttcttcgcggaaaatga 375
            ||||||||||||| || |||||||| ||||| |||||
Sbjct: 964  tgaacaagaacatagataatttctttgcggagaatga 1000



to top

>gb|DQ025189.1| HIV-1 isolate pE90394 from Puerto Rico reverse transcriptase (pol)
           gene, partial cds
          Length = 577

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 330 cagggatggaaaggctcacc 349



to top

>gb|DQ025104.1| HIV-1 isolate pE85105 from Puerto Rico reverse transcriptase (pol)
           gene, partial cds
          Length = 577

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 330 cagggatggaaaggctcacc 349



to top

>gb|CP000148.1| Geobacter metallireducens GS-15, complete genome
          Length = 3997420

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 436    gctccagacaaggatcttct 455
              ||||||||||||||||||||
Sbjct: 973721 gctccagacaaggatcttct 973740



to top

>ref|XM_507430.1| PREDICTED Oryza sativa (japonica cultivar-group), P0036E06.27-1 mRNA
          Length = 1874

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                    
Query: 488  ccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaacca 543
            ||||||||| ||||||| || ||||| || || || || || ||||||||||||||
Sbjct: 1144 ccaaactacctgatgctgccggtgaacgcgcccaagtgcgcccaccacaacaacca 1199



to top

>ref|XM_463869.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1874

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                    
Query: 488  ccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaacca 543
            ||||||||| ||||||| || ||||| || || || || || ||||||||||||||
Sbjct: 1144 ccaaactacctgatgctgccggtgaacgcgcccaagtgcgcccaccacaacaacca 1199



to top

>ref|XM_506682.2| PREDICTED Oryza sativa (japonica cultivar-group), P0036E06.27-1 mRNA
          Length = 1876

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                    
Query: 488  ccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaacca 543
            ||||||||| ||||||| || ||||| || || || || || ||||||||||||||
Sbjct: 1146 ccaaactacctgatgctgccggtgaacgcgcccaagtgcgcccaccacaacaacca 1201



to top

>ref|XM_463870.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 977

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                   
Query: 488 ccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaacca 543
           ||||||||| ||||||| || ||||| || || || || || ||||||||||||||
Sbjct: 284 ccaaactacctgatgctgccggtgaacgcgcccaagtgcgcccaccacaacaacca 339



to top

>gb|AY701391.1| HIV-1 isolate RW0550 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 632

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 342 cagggatggaaaggctcacc 361



to top

>gb|AY388831.1| HIV-1 from USA isolate P00046 nonfunctional pol protein (pol) gene,
           partial sequence
          Length = 1529

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 930 cagggatggaaaggctcacc 949



to top

>gb|AY388830.1| HIV-1 from USA isolate P00046 nonfunctional pol protein (pol) gene,
           partial sequence
          Length = 1529

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 930 cagggatggaaaggctcacc 949



to top

>gb|AY388829.1| HIV-1 from USA isolate P00046 nonfunctional pol protein (pol) gene,
           partial sequence
          Length = 1529

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 930 cagggatggaaaggctcacc 949



to top

>gb|AY362104.1| HIV-1 isolate 111925 from United Kingdom pol protein (pol) gene,
           partial cds
          Length = 969

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 748 cagggatggaaaggctcacc 767



to top

>gb|AY362101.1| HIV-1 isolate 134795 from United Kingdom pol protein (pol) gene,
           partial cds
          Length = 969

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 748 cagggatggaaaggctcacc 767



to top

>gb|AY362100.1| HIV-1 isolate 134284 from United Kingdom pol protein (pol) gene,
           partial cds
          Length = 969

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 748 cagggatggaaaggctcacc 767



to top

>gb|AY316083.1| HIV-1 from Spain isolate 67.00 pol protein (pol) gene, partial cds
          Length = 1971

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 748 cagggatggaaaggctcacc 767



to top

>gb|AY471869.1| HIV-1 isolate 206140 from USA pol protein (pol) gene, partial cds
          Length = 1022

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 751 cagggatggaaaggctcacc 770



to top

>gb|AY528204.1| HIV-1 isolate A0387 from USA pol protein (pol) gene, partial cds
          Length = 1020

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 739 cagggatggaaaggctcacc 758



to top

>gb|AY528203.1| HIV-1 isolate A0386 from USA pol protein (pol) gene, partial cds
          Length = 1020

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 739 cagggatggaaaggctcacc 758



to top

>gb|AY528202.1| HIV-1 isolate A0385 from USA pol protein (pol) gene, partial cds
          Length = 1020

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 739 cagggatggaaaggctcacc 758



to top

>gb|AY527896.1| HIV-1 isolate A0079 from USA pol protein (pol) gene, partial cds
          Length = 1020

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 739 cagggatggaaaggctcacc 758



to top

>gb|AY527895.1| HIV-1 isolate A0078 from USA pol protein (pol) gene, partial cds
          Length = 1020

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 739 cagggatggaaaggctcacc 758



to top

>gb|AY149565.1| HIV-1 isolate DK.IM.123-f.RT reverse transcriptase (pol) gene,
           partial cds
          Length = 630

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 340 cagggatggaaaggctcacc 359



to top

>gb|AY275769.1| HIV-1 isolate 128PR_RT from Brazil pol protein (pol) gene, partial
           cds
          Length = 972

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 748 cagggatggaaaggctcacc 767



to top

>gb|AY815698.1| Schistosoma japonicum SJCHGC08499 protein mRNA, complete cds
          Length = 724

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 236 attgatgctgatcacgagga 255
           ||||||||||||||||||||
Sbjct: 535 attgatgctgatcacgagga 554



to top

>gb|AY334713.1| HIV-1 isolate 51581.f from Puerto Rico pol protein (pol) gene,
           partial cds
          Length = 620

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 340 cagggatggaaaggctcacc 359



to top

>gb|AY665713.1| Equine herpesvirus 1 strain Ab4, complete genome
          Length = 150224

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 419   tactctgatgataagctgctccag 442
             ||||||||||| ||||||||||||
Sbjct: 23287 tactctgatgacaagctgctccag 23310



to top

>gb|AY714472.1| HIV-1 isolate F56706_RT from USA reverse transcriptase (Pol) gene,
           partial cds
          Length = 1002

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470



to top

>gb|AY714470.1| HIV-1 from USA reverse transcriptase (Pol) gene, partial cds
          Length = 1002

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470



to top

>gb|AY714434.1| HIV-1 isolate F74928_RT from USA reverse transcriptase (Pol) gene,
           partial cds
          Length = 1002

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470



to top

>gb|AY165273.1| HIV-1 isolate 01SE-22264 from Sweden gag-pol fusion polyprotein
           gene, partial cds
          Length = 1475

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 903 cagggatggaaaggctcacc 922



to top

>gb|AY338958.1| Cucumis sativus catalase-like (cat) mRNA, partial sequence
          Length = 275

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 33/36 (91%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 13  aggcacatggnacggttttggtgtcaacacctacac 48
           |||||||||| ||||||  |||||||||||||||||
Sbjct: 108 aggcacatgg-acggttcaggtgtcaacacctacac 142



to top

>gb|DQ157817.1| HIV-1 isolate PE.5895 from Peru protease (pol) gene, partial cds
          Length = 1024

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 869 cagggatggaaaggctcacc 888



to top

>emb|AL606504.14| Human DNA sequence from clone RP11-358K2 on chromosome 10, complete
             sequence
          Length = 81147

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 291   cctggccagaggacatcatcccactgca 318
             |||||||||||||| ||| |||||||||
Sbjct: 67121 cctggccagaggacctcaccccactgca 67148



to top

>gb|AF454535.1| HIV-1 isolate 66936VI from Czech Republic reverse transcriptase
           (pol) gene, partial cds
          Length = 543

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 334 cagggatggaaaggctcacc 353



to top

>gb|AY213503.1| HIV-1 isolate BRP2177RT from Brazil reverse transcriptase (pol)
           gene, partial cds
          Length = 571

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 346 cagggatggaaaggctcacc 365



to top

>gb|AY213272.1| HIV-1 isolate BRRJ917RT from Brazil reverse transcriptase (pol)
           gene, partial cds
          Length = 571

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 346 cagggatggaaaggctcacc 365



to top

>gb|AY260398.1| HIV-1 isolate 213 from France reverse transcriptase (pol) gene,
           partial cds
          Length = 596

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 337 cagggatggaaaggctcacc 356



to top

>gb|AY260380.1| HIV-1 isolate 195 from France reverse transcriptase (pol) gene,
           partial cds
          Length = 596

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 337 cagggatggaaaggctcacc 356



to top

>gb|AY464052.1| Equine herpesvirus 1 strain V592, complete genome
          Length = 149430

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 419   tactctgatgataagctgctccag 442
             ||||||||||| ||||||||||||
Sbjct: 23279 tactctgatgacaagctgctccag 23302



to top

>gb|AY075969.1| HIV-1 isolate 91USG191814pc2 from USA pol polyprotein (pol) gene,
           partial cds
          Length = 997

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 757 cagggatggaaaggctcacc 776



to top

>emb|X61626.1|OSCATAL O.sativa mRNA for catalase
          Length = 1865

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                    
Query: 488  ccaaactacttgatgctccccgtgaatgccccgaaatgtgctcaccacaacaacca 543
            ||||||||| ||||||| || ||||| || || || || || ||||||||||||||
Sbjct: 1103 ccaaactacctgatgctgccggtgaacgcgcccaagtgcgcccaccacaacaacca 1158



to top

>gb|DQ087444.1| Cerebratulus lacteus catalase mRNA, partial cds
          Length = 792

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 373 tgaacagcttgctttctgcccagc 396
           ||||||| ||||||||||||||||
Sbjct: 720 tgaacagattgctttctgcccagc 743



to top

>gb|AY877247.1| HIV-1 isolate BR02SP167 from Brazil reverse transcriptase (pol)
           gene, partial cds
          Length = 623

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 382 cagggatggaaaggctcacc 401



to top

>gb|AY877199.1| HIV-1 isolate BR02SP183 from Brazil reverse transcriptase (pol)
           gene, partial cds
          Length = 1005

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470



to top

>emb|AL596129.27| Mouse DNA sequence from clone RP23-294E23 on chromosome 11 Contains the
             3' end of the Myh3 gene for embryonic skeletal muscle
             myosin heavy polypeptide 3, four novel genes
             (2310065F04Rik), the Myh2 gene for adult skeletal muscle
             myosin heavy polypeptide 2, the Myh1 gene for adult
             skeletal muscle myosin heavy polypeptide 1, the Myh4 gene
             for skeletal muscle  myosin heavy polypeptide 4 and the
             Myh8 gene for perinatal skeletal muscle myosin heavy
             polypeptide 8 (4832426G23Rik), complete sequence
          Length = 221384

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 54    tcagcagggatggaaaggct 73
             ||||||||||||||||||||
Sbjct: 64019 tcagcagggatggaaaggct 64038



to top

>emb|AL138642.1|ATF21F14 Arabidopsis thaliana DNA chromosome 3, BAC clone F21F14
          Length = 142001

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 531   accacaacaaccatcatgat 550
             ||||||||||||||||||||
Sbjct: 88795 accacaacaaccatcatgat 88814



to top

>gb|DQ059651.1| HIV-1 isolate TV811 from Canada reverse transcriptase (pol) gene,
           partial cds
          Length = 522

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 402 cagggatggaaaggctcacc 421



to top

>emb|AJ419504.1|HIM419504 Human immunodeficiency virus type 1 partial polyprotein gene for
           protease and reverse transcriptase precursor, genomic
           RNA, patient 296
          Length = 1269

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 748 cagggatggaaaggctcacc 767



to top

>emb|AJ419503.1|HIM419503 Human immunodeficiency virus type 1 partial polyprotein gene for
           protease and reverse transcriptase precursor, genomic
           RNA, patient 295
          Length = 1323

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 748 cagggatggaaaggctcacc 767



to top

>gb|AY801196.1| HIV-1 isolate CA34461 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 903

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470



to top

>gb|AY801175.1| HIV-1 isolate CA48112 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 1053

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470



to top

>gb|AY801006.1| HIV-1 isolate CA9339 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 660

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470



to top

>gb|AY800826.1| HIV-1 isolate CA38923 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 903

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470



to top

>gb|AY800825.1| HIV-1 isolate CA23866 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 903

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470



to top

>gb|AY802331.1| HIV-1 isolate CA34658 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 903

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470



to top

>gb|AY802716.1| HIV-1 isolate CA34319 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 903

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470



to top

>gb|AY802695.1| HIV-1 isolate CA38099 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 897

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470



to top

>gb|AY802638.1| HIV-1 isolate CA9908 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 792

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470



to top

>gb|AY802637.1| HIV-1 isolate CA9945 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 909

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470



to top

>gb|AY802261.1| HIV-1 isolate CA42734 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 900

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470



to top

>gb|AY802088.1| HIV-1 isolate CA41281 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 900

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470



to top

>gb|AY802087.1| HIV-1 isolate CA23850 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 900

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470



to top

>gb|AY802072.1| HIV-1 isolate CA48146 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 1095

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470



to top

>gb|AY802071.1| HIV-1 isolate CA37957 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 900

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470



to top

>gb|AY802070.1| HIV-1 isolate CA37955 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 900

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470



to top

>gb|AY802069.1| HIV-1 isolate CA48556 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 900

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470



to top

>gb|AY802068.1| HIV-1 isolate CA34970 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 903

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470



to top

>gb|AY802067.1| HIV-1 isolate CA23736 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 900

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470



to top

>gb|AY802028.1| HIV-1 isolate CA48162 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 900

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470



to top

>gb|AY802027.1| HIV-1 isolate CA38013 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 900

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470



to top

>gb|AY802026.1| HIV-1 isolate CA34332 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 903

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470



to top

>gb|AY802025.1| HIV-1 isolate CA21221 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 900

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470



to top

>gb|AY801890.1| HIV-1 isolate CA37850 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 900

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470



to top

>gb|AY801889.1| HIV-1 isolate CA35213 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 897

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470



to top

>gb|AY801888.1| HIV-1 isolate CA20096 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 894

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470



to top

>gb|AY801797.1| HIV-1 isolate CA19882 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 909

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470



to top

>gb|AY801674.1| HIV-1 isolate CA21206 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 900

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470



to top

>gb|AY800715.1| HIV-1 isolate CA1437 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 774

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470



to top

>gb|AF459197.1| HIV-1 isolate patient AD-110 from USA pol protein (pol) gene,
           partial cds
          Length = 965

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 748 cagggatggaaaggctcacc 767



to top

>gb|AF517515.1| HIV-1 from Italy patient 30, off-therapy group, pre-treatment
           sample pol polyprotein (pol) gene, partial cds
          Length = 987

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 748 cagggatggaaaggctcacc 767



to top

>gb|AF517488.1| HIV-1 from Italy patient 30, off-therapy group, pre-treatment
           sample pol polyprotein (pol) gene, partial cds
          Length = 987

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 748 cagggatggaaaggctcacc 767



to top

>gb|AF347403.1| HIV-1 isolate 986192 from Germany truncated pol protein (pol) gene,
           partial cds
          Length = 991

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 748 cagggatggaaaggctcacc 767



to top

>gb|AF347367.1| HIV-1 isolate 984898 from Germany pol protein (pol) gene, partial
           cds
          Length = 1013

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 718 cagggatggaaaggctcacc 737



to top

>gb|AF347305.1| HIV-1 isolate 974412 from Germany pol protein (pol) gene, partial
           cds
          Length = 1169

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 748 cagggatggaaaggctcacc 767



to top

>gb|AF347298.1| HIV-1 isolate 970850 from Germany pol protein (pol) gene, partial
           cds
          Length = 1140

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 721 cagggatggaaaggctcacc 740



to top

>gb|AF347279.1| HIV-1 isolate 5483 from Germany pol protein (pol) gene, partial cds
          Length = 958

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 682 cagggatggaaaggctcacc 701



to top

>gb|AF347208.1| HIV-1 isolate 2570 from Germany truncated pol protein (pol) gene,
           partial cds
          Length = 1185

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  cagggatggaaaggctcacc 77
           ||||||||||||||||||||
Sbjct: 748 cagggatggaaaggctcacc 767


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,932,897
Number of Sequences: 3902068
Number of extensions: 4932897
Number of successful extensions: 123776
Number of sequences better than 10.0: 425
Number of HSP's better than 10.0 without gapping: 423
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 122893
Number of HSP's gapped (non-prelim): 809
length of query: 579
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 556
effective length of database: 17,143,297,704
effective search space: 9531673523424
effective search space used: 9531673523424
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top