ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags13g21
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|NM_190270.1| Oryza sativa (japonica cultivar-group), predic... 64 3e-08
2ref|NM_190269.1| Oryza sativa (japonica cultivar-group), predic... 64 3e-08
3emb|X64622.1|OS5SRRNMR O.sativa Rrl5 mRNA for 5S ribosomal RNA 64 3e-08
4dbj|AK104693.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 3e-08
5dbj|AK065268.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 3e-08
6ref|NM_113448.2| Arabidopsis thaliana ATL5 (A. THALIANA RIBOSOMA... 62 1e-07
7gb|BT000411.1| Arabidopsis thaliana putative ribosomal protein (... 62 1e-07
8gb|BT008705.1| Arabidopsis thaliana At3g25520 gene, complete cds 62 1e-07
9gb|AY136319.1| Arabidopsis thaliana putative ribosomal protein (... 62 1e-07
10gb|AY065103.1| Arabidopsis thaliana 60S ribosomal protein L5 (At... 62 1e-07
11gb|AY081701.1| Arabidopsis thaliana 60S ribosomal protein L5 (At... 62 1e-07
12gb|AY054161.1| Arabidopsis thaliana AT5g39740/MKM21_30 mRNA, com... 62 1e-07
13gb|AY186611.1| Arabidopsis thaliana ribosomal protein L5 mRNA, c... 62 1e-07
14emb|BX823967.1|CNS0A6W1 Arabidopsis thaliana Full-length cDNA Co... 62 1e-07
15gb|AY087197.1| Arabidopsis thaliana clone 32753 mRNA, complete s... 62 1e-07
16gb|BT002427.1| Arabidopsis thaliana ribosomal protein, putative ... 62 1e-07
17dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 58 2e-06
18dbj|AP003349.4| Oryza sativa (japonica cultivar-group) genomic D... 58 2e-06
19dbj|AP003316.4| Oryza sativa (japonica cultivar-group) genomic D... 58 2e-06
20gb|AY106024.1| Zea mays PCO063168 mRNA sequence 58 2e-06
21dbj|AB025639.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 54 3e-05
22gb|BT016492.1| Zea mays clone Contig325 mRNA sequence 50 5e-04
23gb|AY109375.1| Zea mays CL457_2 mRNA sequence 50 5e-04
24ref|NM_123336.3| Arabidopsis thaliana 5S rRNA binding / structur... 48 0.002
25gb|BT008706.1| Arabidopsis thaliana At5g39740 gene, complete cds 48 0.002
26gb|AY093123.1| Arabidopsis thaliana ribosomal protein L5 - like ... 48 0.002
27gb|AY079020.1| Arabidopsis thaliana AT5g39740/MKM21_30 mRNA, com... 48 0.002
28emb|BX831866.1|CNS09ZT2 Arabidopsis thaliana Full-length cDNA Co... 48 0.002
29dbj|AB016876.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 46 0.008
30dbj|AB049724.1| Pisum sativum ssa-15 mRNA for putative senescenc... 42 0.13
31gb|AY365248.1| Cucumis sativus 60S ribosomal protein L5 mRNA, co... 40 0.50
32ref|XM_684564.1| PREDICTED: Danio rerio similar to protein kinas... 38 2.0
33emb|BX832617.1|CNS09YMN Arabidopsis thaliana Full-length cDNA Co... 38 2.0
34emb|BX321885.11| Zebrafish DNA sequence from clone CH211-240L19 ... 38 2.0
35ref|XR_002966.1| PREDICTED: Mus musculus similar to 60S ribosoma... 36 7.7
36gb|AC089983.23| Homo sapiens 12 BAC RP11-818F20 (Roswell Park Ca... 36 7.7
37gb|AC007528.5| Homo sapiens 12 BAC RP11-473N11 (Roswell Park Can... 36 7.7
38gb|DQ157758.1| Homo sapiens thioredoxin reductase 1 (TXNRD1) gen... 36 7.7
39ref|XM_781433.1| PREDICTED: Strongylocentrotus purpuratus simila... 36 7.7
40emb|BX294026.1|NCB7H23 Neurospora crassa DNA linkage group V BAC... 36 7.7
41dbj|AP001855.4| Homo sapiens genomic DNA, chromosome 11q, clone:... 36 7.7
42gb|AC122448.3| Mus musculus BAC clone RP24-243B16 from 15, compl... 36 7.7 
>ref|NM_190270.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 906

 Score = 63.9 bits (32), Expect = 3e-08
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 1   gcccttaagggagctttggatggtggtcttgatnttccgcacagngacangag 53
           ||||| ||||||||||||||||||||||||||  |||| ||||| |||| |||
Sbjct: 475 gccctcaagggagctttggatggtggtcttgacattcctcacagtgacaagag 527
to top
>ref|NM_190269.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 915

 Score = 63.9 bits (32), Expect = 3e-08
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 1   gcccttaagggagctttggatggtggtcttgatnttccgcacagngacangag 53
           ||||| ||||||||||||||||||||||||||  |||| ||||| |||| |||
Sbjct: 484 gccctcaagggagctttggatggtggtcttgacattcctcacagtgacaagag 536
to top
>emb|X64622.1|OS5SRRNMR O.sativa Rrl5 mRNA for 5S ribosomal RNA
          Length = 1114

 Score = 63.9 bits (32), Expect = 3e-08
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 1   gcccttaagggagctttggatggtggtcttgatnttccgcacagngacangag 53
           ||||| ||||||||||||||||||||||||||  |||| ||||| |||| |||
Sbjct: 484 gccctcaagggagctttggatggtggtcttgacattcctcacagtgacaagag 536
to top
>dbj|AK104693.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-036-H05, full
           insert sequence
          Length = 1219

 Score = 63.9 bits (32), Expect = 3e-08
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 1   gcccttaagggagctttggatggtggtcttgatnttccgcacagngacangag 53
           ||||| ||||||||||||||||||||||||||  |||| ||||| |||| |||
Sbjct: 571 gccctcaagggagctttggatggtggtcttgacattcctcacagtgacaagag 623
to top
>dbj|AK065268.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002K21, full
           insert sequence
          Length = 1219

 Score = 63.9 bits (32), Expect = 3e-08
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 1   gcccttaagggagctttggatggtggtcttgatnttccgcacagngacangag 53
           ||||| ||||||||||||||||||||||||||  |||| ||||| |||| |||
Sbjct: 572 gccctcaagggagctttggatggtggtcttgacattcctcacagtgacaagag 624
to top
>ref|NM_113448.2| Arabidopsis thaliana ATL5 (A. THALIANA RIBOSOMAL PROTEIN L5);
           structural constituent of ribosome AT3G25520 (ATL5)
           mRNA, complete cds
          Length = 1254

 Score = 61.9 bits (31), Expect = 1e-07
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 4   cttaagggagctttggatggtggtcttgatnttccgcacagngacangagat 55
           |||||||| ||||||||||||||||||||| | || ||||| |||| |||||
Sbjct: 546 cttaagggtgctttggatggtggtcttgatatccctcacagtgacaagagat 597
to top
>gb|BT000411.1| Arabidopsis thaliana putative ribosomal protein (At3g25520) mRNA,
           complete cds
          Length = 969

 Score = 61.9 bits (31), Expect = 1e-07
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 4   cttaagggagctttggatggtggtcttgatnttccgcacagngacangagat 55
           |||||||| ||||||||||||||||||||| | || ||||| |||| |||||
Sbjct: 484 cttaagggtgctttggatggtggtcttgatatccctcacagtgacaagagat 535
to top
>gb|BT008705.1| Arabidopsis thaliana At3g25520 gene, complete cds
          Length = 906

 Score = 61.9 bits (31), Expect = 1e-07
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 4   cttaagggagctttggatggtggtcttgatnttccgcacagngacangagat 55
           |||||||| ||||||||||||||||||||| | || ||||| |||| |||||
Sbjct: 484 cttaagggtgctttggatggtggtcttgatatccctcacagtgacaagagat 535
to top
>gb|AY136319.1| Arabidopsis thaliana putative ribosomal protein (At3g25520) mRNA,
           complete cds
          Length = 1161

 Score = 61.9 bits (31), Expect = 1e-07
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 4   cttaagggagctttggatggtggtcttgatnttccgcacagngacangagat 55
           |||||||| ||||||||||||||||||||| | || ||||| |||| |||||
Sbjct: 543 cttaagggtgctttggatggtggtcttgatatccctcacagtgacaagagat 594
to top
>gb|AY065103.1| Arabidopsis thaliana 60S ribosomal protein L5 (At3g25550) mRNA,
           complete cds
          Length = 1151

 Score = 61.9 bits (31), Expect = 1e-07
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 4   cttaagggagctttggatggtggtcttgatnttccgcacagngacangagat 55
           |||||||| ||||||||||||||||||||| | || ||||| |||| |||||
Sbjct: 541 cttaagggtgctttggatggtggtcttgatatccctcacagtgacaagagat 592
to top
>gb|AY081701.1| Arabidopsis thaliana 60S ribosomal protein L5 (At3g25550) mRNA,
           complete cds
          Length = 925

 Score = 61.9 bits (31), Expect = 1e-07
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 4   cttaagggagctttggatggtggtcttgatnttccgcacagngacangagat 55
           |||||||| ||||||||||||||||||||| | || ||||| |||| |||||
Sbjct: 484 cttaagggtgctttggatggtggtcttgatatccctcacagtgacaagagat 535
to top
>gb|AY054161.1| Arabidopsis thaliana AT5g39740/MKM21_30 mRNA, complete cds
          Length = 1108

 Score = 61.9 bits (31), Expect = 1e-07
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 4   cttaagggagctttggatggtggtcttgatnttccgcacagngacangagat 55
           |||||||| ||||||||||||||||||||| | || ||||| |||| |||||
Sbjct: 531 cttaagggtgctttggatggtggtcttgatatccctcacagtgacaagagat 582
to top
>gb|AY186611.1| Arabidopsis thaliana ribosomal protein L5 mRNA, complete cds
          Length = 906

 Score = 61.9 bits (31), Expect = 1e-07
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 4   cttaagggagctttggatggtggtcttgatnttccgcacagngacangagat 55
           |||||||| ||||||||||||||||||||| | || ||||| |||| |||||
Sbjct: 484 cttaagggtgctttggatggtggtcttgatatccctcacagtgacaagagat 535
to top
>emb|BX823967.1|CNS0A6W1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH10ZG11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1076

 Score = 61.9 bits (31), Expect = 1e-07
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 4   cttaagggagctttggatggtggtcttgatnttccgcacagngacangagat 55
           |||||||| ||||||||||||||||||||| | || ||||| |||| |||||
Sbjct: 516 cttaagggtgctttggatggtggtcttgatatccctcacagtgacaagagat 567
to top
>gb|AY087197.1| Arabidopsis thaliana clone 32753 mRNA, complete sequence
          Length = 1248

 Score = 61.9 bits (31), Expect = 1e-07
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 4   cttaagggagctttggatggtggtcttgatnttccgcacagngacangagat 55
           |||||||| ||||||||||||||||||||| | || ||||| |||| |||||
Sbjct: 546 cttaagggtgctttggatggtggtcttgatatccctcacagtgacaagagat 597
to top
>gb|BT002427.1| Arabidopsis thaliana ribosomal protein, putative (At3g25520) mRNA,
           complete cds
          Length = 1117

 Score = 61.9 bits (31), Expect = 1e-07
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 4   cttaagggagctttggatggtggtcttgatnttccgcacagngacangagat 55
           |||||||| ||||||||||||||||||||| | || ||||| |||| |||||
Sbjct: 541 cttaagggtgctttggatggtggtcttgatatccctcacagtgacaagagat 592
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 58.0 bits (29), Expect = 2e-06
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                              
Query: 8        agggagctttggatggtggtcttgatnttccgcacagngacangag 53
                |||||||||||||||||||||||||  |||| ||||| |||| |||
Sbjct: 38968709 agggagctttggatggtggtcttgacattcctcacagtgacaagag 38968754



 Score = 58.0 bits (29), Expect = 2e-06
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                              
Query: 8        agggagctttggatggtggtcttgatnttccgcacagngacangag 53
                |||||||||||||||||||||||||  |||| ||||| |||| |||
Sbjct: 38963391 agggagctttggatggtggtcttgacattcctcacagtgacaagag 38963436
to top
>dbj|AP003349.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0674H09
          Length = 142955

 Score = 58.0 bits (29), Expect = 2e-06
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                           
Query: 8     agggagctttggatggtggtcttgatnttccgcacagngacangag 53
             |||||||||||||||||||||||||  |||| ||||| |||| |||
Sbjct: 42342 agggagctttggatggtggtcttgacattcctcacagtgacaagag 42387



 Score = 58.0 bits (29), Expect = 2e-06
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                           
Query: 8     agggagctttggatggtggtcttgatnttccgcacagngacangag 53
             |||||||||||||||||||||||||  |||| ||||| |||| |||
Sbjct: 37024 agggagctttggatggtggtcttgacattcctcacagtgacaagag 37069
to top
>dbj|AP003316.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0696G06
          Length = 142571

 Score = 58.0 bits (29), Expect = 2e-06
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                            
Query: 8      agggagctttggatggtggtcttgatnttccgcacagngacangag 53
              |||||||||||||||||||||||||  |||| ||||| |||| |||
Sbjct: 133495 agggagctttggatggtggtcttgacattcctcacagtgacaagag 133540



 Score = 58.0 bits (29), Expect = 2e-06
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                            
Query: 8      agggagctttggatggtggtcttgatnttccgcacagngacangag 53
              |||||||||||||||||||||||||  |||| ||||| |||| |||
Sbjct: 128177 agggagctttggatggtggtcttgacattcctcacagtgacaagag 128222
to top
>gb|AY106024.1| Zea mays PCO063168 mRNA sequence
          Length = 620

 Score = 58.0 bits (29), Expect = 2e-06
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 1   gcccttaagggagctttggatggtggtcttgatnttccgcacag 44
           ||||| ||||||||||||||||||||||| ||| |||| |||||
Sbjct: 382 gccctcaagggagctttggatggtggtctagatattcctcacag 425
to top
>dbj|AB025639.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MWL2
          Length = 84896

 Score = 54.0 bits (27), Expect = 3e-05
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                             
Query: 8     agggagctttggatggtggtcttgatnttccgcacagngacangagat 55
             |||| ||||||||||||||||||||| | || ||||| |||| |||||
Sbjct: 56848 agggtgctttggatggtggtcttgatatccctcacagtgacaagagat 56801
to top
>gb|BT016492.1| Zea mays clone Contig325 mRNA sequence
          Length = 1365

 Score = 50.1 bits (25), Expect = 5e-04
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 1   gcccttaagggagctttggatggtggtcttgatnttccgcacag 44
           ||||| |||||||||||||||||||| || ||| |||| |||||
Sbjct: 543 gccctcaagggagctttggatggtggcctggatattcctcacag 586
to top
>gb|AY109375.1| Zea mays CL457_2 mRNA sequence
          Length = 1397

 Score = 50.1 bits (25), Expect = 5e-04
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 1   gcccttaagggagctttggatggtggtcttgatnttccgcacag 44
           ||||| |||||||||||||||||||| || ||| |||| |||||
Sbjct: 559 gccctcaagggagctttggatggtggcctggatattcctcacag 602
to top
>ref|NM_123336.3| Arabidopsis thaliana 5S rRNA binding / structural constituent of
           ribosome AT5G39740 mRNA, complete cds
          Length = 1223

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 7   aagggagctttggatggtggtcttgatnttccgcacagngacangagat 55
           |||||||||||||| || ||||||||| | || ||||| |||| |||||
Sbjct: 529 aagggagctttggacggaggtcttgatatccctcacagtgacaagagat 577
to top
>gb|BT008706.1| Arabidopsis thaliana At5g39740 gene, complete cds
          Length = 906

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 7   aagggagctttggatggtggtcttgatnttccgcacagngacangagat 55
           |||||||||||||| || ||||||||| | || ||||| |||| |||||
Sbjct: 487 aagggagctttggacggaggtcttgatatccctcacagtgacaagagat 535
to top
>gb|AY093123.1| Arabidopsis thaliana ribosomal protein L5 - like (At5g39740) mRNA,
           complete cds
          Length = 1100

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 7   aagggagctttggatggtggtcttgatnttccgcacagngacangagat 55
           |||||||||||||| || ||||||||| | || ||||| |||| |||||
Sbjct: 517 aagggagctttggacggaggtcttgatatccctcacagtgacaagagat 565
to top
>gb|AY079020.1| Arabidopsis thaliana AT5g39740/MKM21_30 mRNA, complete cds
          Length = 1128

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 7   aagggagctttggatggtggtcttgatnttccgcacagngacangagat 55
           |||||||||||||| || ||||||||| | || ||||| |||| |||||
Sbjct: 529 aagggagctttggacggaggtcttgatatccctcacagtgacaagagat 577
to top
>emb|BX831866.1|CNS09ZT2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH35ZF09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1048

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 7   aagggagctttggatggtggtcttgatnttccgcacagngacangagat 55
           |||||||||||||| || ||||||||| | || ||||| |||| |||||
Sbjct: 506 aagggagctttggacggaggtcttgatatccctcacagtgacaagagat 554
to top
>dbj|AB016876.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MKM21
          Length = 44499

 Score = 46.1 bits (23), Expect = 0.008
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                            
Query: 8    agggagctttggatggtggtcttgatnttccgcacagngacangagat 55
            ||||||||||||| || ||||||||| | || ||||| |||| |||||
Sbjct: 8148 agggagctttggacggaggtcttgatatccctcacagtgacaagagat 8195
to top
>dbj|AB049724.1| Pisum sativum ssa-15 mRNA for putative senescence-associated
           protein, complete cds
          Length = 1100

 Score = 42.1 bits (21), Expect = 0.13
 Identities = 37/43 (86%)
 Strand = Plus / Plus

                                                      
Query: 7   aagggagctttggatggtggtcttgatnttccgcacagngaca 49
           ||||||||||||||||| ||| | ||| |||| ||||| ||||
Sbjct: 549 aagggagctttggatggaggtttggatattcctcacagtgaca 591
to top
>gb|AY365248.1| Cucumis sativus 60S ribosomal protein L5 mRNA, complete cds
          Length = 1171

 Score = 40.1 bits (20), Expect = 0.50
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 7   aagggagctttggatggtgg 26
           ||||||||||||||||||||
Sbjct: 508 aagggagctttggatggtgg 527
to top
>ref|XM_684564.1| PREDICTED: Danio rerio similar to protein kinase, lysine deficient 1
            (LOC561159), mRNA
          Length = 6165

 Score = 38.2 bits (19), Expect = 2.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 5    ttaagggagctttggatgg 23
            |||||||||||||||||||
Sbjct: 5164 ttaagggagctttggatgg 5146
to top
>emb|BX832617.1|CNS09YMN Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH85ZA07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1060

 Score = 38.2 bits (19), Expect = 2.0
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 7   aagggagctttggatggtggtcttgat 33
           |||||||||||||| || |||||||||
Sbjct: 514 aagggagctttggacggaggtcttgat 540
to top
>emb|BX321885.11| Zebrafish DNA sequence from clone CH211-240L19 in linkage group 4,
             complete sequence
          Length = 155649

 Score = 38.2 bits (19), Expect = 2.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 5     ttaagggagctttggatgg 23
             |||||||||||||||||||
Sbjct: 53124 ttaagggagctttggatgg 53106
to top
>ref|XR_002966.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L5
           (LOC382975), mRNA
          Length = 798

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                 
Query: 2   cccttaagggagctttggatgg 23
           |||||||||||||| |||||||
Sbjct: 551 cccttaagggagctatggatgg 572
to top
>gb|AC089983.23| Homo sapiens 12 BAC RP11-818F20 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 204505

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 2      cccttaagggagctttgg 19
              ||||||||||||||||||
Sbjct: 194699 cccttaagggagctttgg 194716
to top
>gb|AC007528.5| Homo sapiens 12 BAC RP11-473N11 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 188451

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 6     taagggagctttggatgg 23
             ||||||||||||||||||
Sbjct: 15781 taagggagctttggatgg 15764
to top
>gb|DQ157758.1| Homo sapiens thioredoxin reductase 1 (TXNRD1) gene, complete cds
          Length = 66886

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 2    cccttaagggagctttgg 19
            ||||||||||||||||||
Sbjct: 6720 cccttaagggagctttgg 6737
to top
>ref|XM_781433.1| PREDICTED: Strongylocentrotus purpuratus similar to Thiosulfate
           sulfurtransferase (Rhodanese) (LOC581437), mRNA
          Length = 4596

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 15  tttggatggtggtcttga 32
           ||||||||||||||||||
Sbjct: 366 tttggatggtggtcttga 383
to top
>emb|BX294026.1|NCB7H23 Neurospora crassa DNA linkage group V BAC contig B7H23
          Length = 114377

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 9     gggagctttggatggtgg 26
             ||||||||||||||||||
Sbjct: 31495 gggagctttggatggtgg 31512
to top
>dbj|AP001855.4| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-892C3, complete
             sequence
          Length = 72651

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 2     cccttaagggagctttggatgg 23
             |||| |||||||||||||||||
Sbjct: 42121 ccctgaagggagctttggatgg 42100
to top
>gb|AC122448.3| Mus musculus BAC clone RP24-243B16 from 15, complete sequence
          Length = 159923

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 2     cccttaagggagctttggatgg 23
             |||||||||||||| |||||||
Sbjct: 53246 cccttaagggagctatggatgg 53267


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 211,668
Number of Sequences: 3902068
Number of extensions: 211668
Number of successful extensions: 50613
Number of sequences better than 10.0: 42
Number of HSP's better than 10.0 without gapping: 42
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 50553
Number of HSP's gapped (non-prelim): 60
length of query: 55
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 35
effective length of database: 17,155,003,908
effective search space: 600425136780
effective search space used: 600425136780
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top