>ref|XM_759973.1| Theileria parva strain Muguga phosphate transporter (TP02_0500)
            partial mRNA
          Length = 2241

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 236  ctcctcgtcgatgccgtcat 255
            ||||||||||||||||||||
Sbjct: 1587 ctcctcgtcgatgccgtcat 1568

>emb|CR522870.1| Desulfotalea psychrophila LSv54 chromosome
          Length = 3523383

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 197    gcaagataagatcatctttc 216
              ||||||||||||||||||||
Sbjct: 190135 gcaagataagatcatctttc 190116

>gb|AC091154.3| Homo sapiens chromosome 17, clone RP11-750B16, complete sequence
          Length = 175783

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 9      aagtacagaagaagatgcca 28
              ||||||||||||||||||||
Sbjct: 153439 aagtacagaagaagatgcca 153420

>gb|AC091952.3| Homo sapiens chromosome 5 clone RP11-412P18, complete sequence
          Length = 150244

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 36    gtttaatatgctgaggaact 55
             ||||||||||||||||||||
Sbjct: 73140 gtttaatatgctgaggaact 73159

>gb|AC015974.10| Homo sapiens BAC clone RP11-467A18 from 2, complete sequence
          Length = 196544

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 10     agtacagaagaagatgccat 29
              ||||||||||||||||||||
Sbjct: 195850 agtacagaagaagatgccat 195869

>gb|AC067961.8| Homo sapiens BAC clone RP11-59F3 from 2, complete sequence
          Length = 105884

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 10   agtacagaagaagatgccat 29
            ||||||||||||||||||||
Sbjct: 1306 agtacagaagaagatgccat 1325

>gb|AC009716.22| Homo sapiens chromosome 18, clone RP11-504I13, complete sequence
          Length = 211981

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 64     ggtgtgatttattatttcaa 83
              ||||||||||||||||||||
Sbjct: 160842 ggtgtgatttattatttcaa 160823

>gb|AC118620.10| Mus musculus chromosome 3, clone RP24-571H24, complete sequence
          Length = 182926

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 117   ctgtggttttgctttggctg 136
             ||||||||||||||||||||
Sbjct: 31641 ctgtggttttgctttggctg 31660

>gb|AC004606.1|AC004606 Homo sapiens chromosome 17, clone hRPC.1043_H_15, complete sequence
          Length = 99512

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 9     aagtacagaagaagatgcca 28
             ||||||||||||||||||||
Sbjct: 80675 aagtacagaagaagatgcca 80694


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,294,591
Number of Sequences: 3902068
Number of extensions: 2294591
Number of successful extensions: 41731
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 41709
Number of HSP's gapped (non-prelim): 22
length of query: 261
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 239
effective length of database: 17,147,199,772
effective search space: 4098180745508
effective search space used: 4098180745508
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)