| Clone Name | bags13f19 |
|---|---|
| Clone Library Name | barley_pub |
>gb|BT009337.1| Triticum aestivum clone wlm4.pk0012.g12:fis, full insert mRNA sequence Length = 1412 Score = 492 bits (248), Expect = e-136 Identities = 297/315 (94%) Strand = Plus / Plus Query: 70 agatcatttgtatactcagttgctagggactgtgataatggcaaagttgatcgcaaggat 129 |||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| Sbjct: 9 agatcatttgtatactcagttgctagggactgtgataatggcaaagttgaccgtaaggat 68 Query: 130 tgngcaggagtaatnctctttgctgctgaaagggcaacacaagttgcacttgaggcaatc 189 || |||||||| || ||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 69 tgtgcaggagtgatcctctttgctgctgaaagggcaacacaagttgcacttgaggcaatc 128 Query: 190 cagngtcttggtggcaatggatacataaatgagtacccaactgggcgtctactganagat 249 ||| |||||||||||||||||||||||||||||||||||||||| ||||| |||| ||| Sbjct: 129 cagtgtcttggtggcaatggatacataaatgagtacccaactggccgtctcctgagggat 188 Query: 250 gcaaaactgttcgagattggggctggtactagtgagatcagaanaatgataattggccgt 309 ||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| Sbjct: 189 gcaaaactgttcgagattggggcgggtactagtgagatcagaagaatgataattggccgt 248 Query: 310 gagctgttcaaagaggactgaaattattcttctggaagccatcttatcagtgcatattct 369 |||||||| |||||||||||| ||||||||||||||||||| ||| ||||||||| |||| Sbjct: 249 gagctgtttaaagaggactgagattattcttctggaagccagcttgtcagtgcatgttct 308 Query: 370 aactggaggaggtga 384 |||| |||||||||| Sbjct: 309 aacttgaggaggtga 323
>gb|BT016848.1| Zea mays clone Contig681 mRNA sequence Length = 855 Score = 446 bits (225), Expect = e-122 Identities = 304/332 (91%) Strand = Plus / Minus Query: 1 cgtccgattggtgaatttcagttcttacaggggaaaatggcagacatgtacacctccttg 60 ||||| |||||||||||||||||| |||||||||||||||| || ||||||||||| ||| Sbjct: 494 cgtccaattggtgaatttcagttcatacaggggaaaatggccgatatgtacacctcgttg 435 Query: 61 caatcatcaagatcatttgtatactcagttgctagggactgtgataatggcaaagttgat 120 || || |||||||||||||||||||| |||||||||||||| |||||||||||||||||| Sbjct: 434 cagtcgtcaagatcatttgtatactcggttgctagggactgcgataatggcaaagttgat 375 Query: 121 cgcaaggattgngcaggagtaatnctctttgctgctgaaagggcaacacaagttgcactt 180 ||||||||||| ||||||||||| |||||||||||||||| ||||| |||||||||||| Sbjct: 374 cgcaaggattgtgcaggagtaattctctttgctgctgaaaatgcaacccaagttgcactt 315 Query: 181 gaggcaatccagngtcttggtggcaatggatacataaatgagtacccaactgggcgtcta 240 ||||||||||| |||||||||| ||||| ||||||||||||||||||||||| ||||| Sbjct: 314 caggcaatccagtgtcttggtggaaatgggtacataaatgagtacccaactggtcgtctc 255 Query: 241 ctganagatgcaaaactgttcgagattggggctggtactagtgagatcagaanaatgata 300 |||| |||||||||| |||| |||||||| ||||||||||||||| | |||| ||||||| Sbjct: 254 ctgagagatgcaaaattgtttgagattggtgctggtactagtgaggtaagaagaatgata 195 Query: 301 attggccgtgagctgttcaaagaggactgaaa 332 |||||||||||||| ||||||||||||||||| Sbjct: 194 attggccgtgagctcttcaaagaggactgaaa 163
>gb|AY107381.1| Zea mays PCO061330 mRNA sequence Length = 1531 Score = 416 bits (210), Expect = e-113 Identities = 292/321 (90%) Strand = Plus / Plus Query: 12 tgaatttcagttcttacaggggaaaatggcagacatgtacacctccttgcaatcatcaag 71 ||||||||||||| |||||||||||||||| || |||||||| || ||||| || ||||| Sbjct: 1000 tgaatttcagttcatacaggggaaaatggctgatatgtacacttcgttgcagtcgtcaag 1059 Query: 72 atcatttgtatactcagttgctagggactgtgataatggcaaagttgatcgcaaggattg 131 ||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 1060 atcatttgtgtactcagttgctagggactgcgataatggcaaagttgatcgcaaggattg 1119 Query: 132 ngcaggagtaatnctctttgctgctgaaagggcaacacaagttgcacttgaggcaatcca 191 ||||||||||| |||||||||||||||| ||||| |||||||||||| |||||||||| Sbjct: 1120 tgcaggagtaattctctttgctgctgaaaatgcaacccaagttgcacttcaggcaatcca 1179 Query: 192 gngtcttggtggcaatggatacataaatgagtacccaactgggcgtctactganagatgc 251 | |||||||||| ||||| ||||||||||||||||||||||| ||||| |||| |||||| Sbjct: 1180 gtgtcttggtggaaatgggtacataaatgagtacccaactggtcgtctcctgagagatgc 1239 Query: 252 aaaactgttcgagattggggctggtactagtgagatcagaanaatgataattggccgtga 311 |||| |||| |||||||| || |||||||||||| | |||| |||||||||||||||||| Sbjct: 1240 aaaattgtttgagattggtgccggtactagtgaggtaagaagaatgataattggccgtga 1299 Query: 312 gctgttcaaagaggactgaaa 332 ||| ||||||||||||||||| Sbjct: 1300 gctcttcaaagaggactgaaa 1320
>dbj|AK071923.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013072N03, full insert sequence Length = 1663 Score = 402 bits (203), Expect = e-109 Identities = 312/350 (89%) Strand = Plus / Plus Query: 1 cgtccgattggtgaatttcagttcttacaggggaaaatggcagacatgtacacctccttg 60 ||||| |||||||||||||||||| ||||||||||| ||||||| ||||||||||||||| Sbjct: 1164 cgtccaattggtgaatttcagttcatacaggggaaattggcagatatgtacacctccttg 1223 Query: 61 caatcatcaagatcatttgtatactcagttgctagggactgtgataatggcaaagttgat 120 || |||||||| |||||||| ||||| ||||||||||||||||| ||||| |||||||| Sbjct: 1224 cagtcatcaaggtcatttgtttactcggttgctagggactgtgacaatggtaaagttgac 1283 Query: 121 cgcaaggattgngcaggagtaatnctctttgctgctgaaagggcaacacaagttgcactt 180 ||||||||||| || || || || ||||||||||||||||||||||| || ||||||||| Sbjct: 1284 cgcaaggattgtgctggtgtgattctctttgctgctgaaagggcaacccaggttgcactt 1343 Query: 181 gaggcaatccagngtcttggtggcaatggatacataaatgagtacccaactgggcgtcta 240 ||||||| ||| ||||||||||||| |||||||||||||||||||||||||| || | Sbjct: 1344 caggcaatacagtgtcttggtggcaacggatacataaatgagtacccaactggccgattg 1403 Query: 241 ctganagatgcaaaactgttcgagattggggctggtactagtgagatcagaanaatgata 300 |||| ||||||||||||||| |||||||| || |||||||||||||| |||| ||||||| Sbjct: 1404 ctgagagatgcaaaactgtttgagattggagccggtactagtgagataagaagaatgata 1463 Query: 301 attggccgtgagctgttcaaagaggactgaaattattcttctggaagcca 350 |||||||| ||||| ||||||||||| ||||| |||| || ||||||||| Sbjct: 1464 attggccgcgagctcttcaaagaggagtgaaactattattttggaagcca 1513
>dbj|AK066314.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013064C04, full insert sequence Length = 1500 Score = 402 bits (203), Expect = e-109 Identities = 312/350 (89%) Strand = Plus / Plus Query: 1 cgtccgattggtgaatttcagttcttacaggggaaaatggcagacatgtacacctccttg 60 ||||| |||||||||||||||||| ||||||||||| ||||||| ||||||||||||||| Sbjct: 1001 cgtccaattggtgaatttcagttcatacaggggaaattggcagatatgtacacctccttg 1060 Query: 61 caatcatcaagatcatttgtatactcagttgctagggactgtgataatggcaaagttgat 120 || |||||||| |||||||| ||||| ||||||||||||||||| ||||| |||||||| Sbjct: 1061 cagtcatcaaggtcatttgtttactcggttgctagggactgtgacaatggtaaagttgac 1120 Query: 121 cgcaaggattgngcaggagtaatnctctttgctgctgaaagggcaacacaagttgcactt 180 ||||||||||| || || || || ||||||||||||||||||||||| || ||||||||| Sbjct: 1121 cgcaaggattgtgctggtgtgattctctttgctgctgaaagggcaacccaggttgcactt 1180 Query: 181 gaggcaatccagngtcttggtggcaatggatacataaatgagtacccaactgggcgtcta 240 ||||||| ||| ||||||||||||| |||||||||||||||||||||||||| || | Sbjct: 1181 caggcaatacagtgtcttggtggcaacggatacataaatgagtacccaactggccgattg 1240 Query: 241 ctganagatgcaaaactgttcgagattggggctggtactagtgagatcagaanaatgata 300 |||| ||||||||||||||| |||||||| || |||||||||||||| |||| ||||||| Sbjct: 1241 ctgagagatgcaaaactgtttgagattggagccggtactagtgagataagaagaatgata 1300 Query: 301 attggccgtgagctgttcaaagaggactgaaattattcttctggaagcca 350 |||||||| ||||| ||||||||||| ||||| |||| || ||||||||| Sbjct: 1301 attggccgcgagctcttcaaagaggagtgaaactattattttggaagcca 1350
>ref|XM_475553.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1230 Score = 387 bits (195), Expect = e-104 Identities = 292/326 (89%) Strand = Plus / Plus Query: 1 cgtccgattggtgaatttcagttcttacaggggaaaatggcagacatgtacacctccttg 60 ||||| |||||||||||||||||| ||||||||||| ||||||| ||||||||||||||| Sbjct: 901 cgtccaattggtgaatttcagttcatacaggggaaattggcagatatgtacacctccttg 960 Query: 61 caatcatcaagatcatttgtatactcagttgctagggactgtgataatggcaaagttgat 120 || |||||||| |||||||| ||||| ||||||||||||||||| ||||| |||||||| Sbjct: 961 cagtcatcaaggtcatttgtttactcggttgctagggactgtgacaatggtaaagttgac 1020 Query: 121 cgcaaggattgngcaggagtaatnctctttgctgctgaaagggcaacacaagttgcactt 180 ||||||||||| || || || || ||||||||||||||||||||||| || ||||||||| Sbjct: 1021 cgcaaggattgtgctggtgtgattctctttgctgctgaaagggcaacccaggttgcactt 1080 Query: 181 gaggcaatccagngtcttggtggcaatggatacataaatgagtacccaactgggcgtcta 240 ||||||| ||| ||||||||||||| |||||||||||||||||||||||||| || | Sbjct: 1081 caggcaatacagtgtcttggtggcaacggatacataaatgagtacccaactggccgattg 1140 Query: 241 ctganagatgcaaaactgttcgagattggggctggtactagtgagatcagaanaatgata 300 |||| ||||||||||||||| |||||||| || |||||||||||||| |||| ||||||| Sbjct: 1141 ctgagagatgcaaaactgtttgagattggagccggtactagtgagataagaagaatgata 1200 Query: 301 attggccgtgagctgttcaaagagga 326 |||||||| ||||| ||||||||||| Sbjct: 1201 attggccgcgagctcttcaaagagga 1226
>gb|BT017728.1| Zea mays clone EL01N0447H09.c mRNA sequence Length = 942 Score = 353 bits (178), Expect = 3e-94 Identities = 294/333 (88%), Gaps = 1/333 (0%) Strand = Plus / Plus Query: 1 cgtccgattggtgaatttcagttcttacaggggaaaatggcagacatgtacacctccttg 60 ||||| |||||||||||||||||| |||||||||||||||| || ||||||||||| ||| Sbjct: 409 cgtccaattggtgaatttcagttcatacaggggaaaatggctgatatgtacacctcattg 468 Query: 61 caatcatcaagatcatttgtatactcagttgctagggactgtgataatggcaaagttgat 120 || ||||||||||||||||||||||| | |||||||||||| |||||||||||||||||| Sbjct: 469 cagtcatcaagatcatttgtatactcggctgctagggactgcgataatggcaaagttgat 528 Query: 121 cgcaaggattgngcaggagtaatnctctttgctgctgaaagggcaacacaagttgcactt 180 ||||||||||| ||||| ||||| |||||||||||||||| ||||| ||||| |||||| Sbjct: 529 cgcaaggattgtgcaggggtaattctctttgctgctgaaaatgcaacccaagtggcactt 588 Query: 181 gaggcaatccagngtcttggtggcaatggatacataaatgagtacccaactgggcgtcta 240 |||| ||||| |||||||||| ||||| |||||||||||||||||| |||| ||||| Sbjct: 589 caggcgatccactgtcttggtggaaatgggtacataaatgagtacccagctggtcgtctc 648 Query: 241 ctganagatgcaaaactgttcgagattggggctggtactagtgagatcaga-anaatgat 299 || | | |||||||| |||| ||||||||||||||| | || ||||| | | | |||||| Sbjct: 649 ctcaaaaatgcaaaattgtttgagattggggctggtccaagcgagataacacacaatgat 708 Query: 300 aattggccgtgagctgttcaaagaggactgaaa 332 ||||||||||||||| |||||| |||||||||| Sbjct: 709 aattggccgtgagctcttcaaaaaggactgaaa 741
>gb|AC134931.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0079L11, complete sequence Length = 124104 Score = 190 bits (96), Expect = 2e-45 Identities = 150/169 (88%) Strand = Plus / Minus Query: 182 aggcaatccagngtcttggtggcaatggatacataaatgagtacccaactgggcgtctac 241 ||||||| ||| ||||||||||||| |||||||||||||||||||||||||| || | | Sbjct: 71630 aggcaatacagtgtcttggtggcaacggatacataaatgagtacccaactggccgattgc 71571 Query: 242 tganagatgcaaaactgttcgagattggggctggtactagtgagatcagaanaatgataa 301 ||| ||||||||||||||| |||||||| || |||||||||||||| |||| |||||||| Sbjct: 71570 tgagagatgcaaaactgtttgagattggagccggtactagtgagataagaagaatgataa 71511 Query: 302 ttggccgtgagctgttcaaagaggactgaaattattcttctggaagcca 350 ||||||| ||||| ||||||||||| ||||| |||| || ||||||||| Sbjct: 71510 ttggccgcgagctcttcaaagaggagtgaaactattattttggaagcca 71462 Score = 69.9 bits (35), Expect = 6e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 73 tcatttgtatactcagttgctagggactgtgataatggcaaagttgatcgcaagg 127 |||||||| ||||| ||||||||||||||||| ||||| |||||||| ||||||| Sbjct: 72489 tcatttgtttactcggttgctagggactgtgacaatggtaaagttgaccgcaagg 72435 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 28 caggggaaaatggcagacatgtacacctccttgcaatcatcaag 71 ||||||||| ||||||| ||||||||||||||||| |||||||| Sbjct: 72607 caggggaaattggcagatatgtacacctccttgcagtcatcaag 72564 Score = 60.0 bits (30), Expect = 6e-06 Identities = 49/56 (87%) Strand = Plus / Minus Query: 125 aggattgngcaggagtaatnctctttgctgctgaaagggcaacacaagttgcactt 180 ||||||| || || || || ||||||||||||||||||||||| || ||||||||| Sbjct: 72024 aggattgtgctggtgtgattctctttgctgctgaaagggcaacccaggttgcactt 71969 Score = 46.1 bits (23), Expect = 0.083 Identities = 29/31 (93%) Strand = Plus / Minus Query: 1 cgtccgattggtgaatttcagttcttacagg 31 ||||| |||||||||||||||||| |||||| Sbjct: 72742 cgtccaattggtgaatttcagttcatacagg 72712
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 190 bits (96), Expect = 2e-45 Identities = 150/169 (88%) Strand = Plus / Minus Query: 182 aggcaatccagngtcttggtggcaatggatacataaatgagtacccaactgggcgtctac 241 ||||||| ||| ||||||||||||| |||||||||||||||||||||||||| || | | Sbjct: 1409968 aggcaatacagtgtcttggtggcaacggatacataaatgagtacccaactggccgattgc 1409909 Query: 242 tganagatgcaaaactgttcgagattggggctggtactagtgagatcagaanaatgataa 301 ||| ||||||||||||||| |||||||| || |||||||||||||| |||| |||||||| Sbjct: 1409908 tgagagatgcaaaactgtttgagattggagccggtactagtgagataagaagaatgataa 1409849 Query: 302 ttggccgtgagctgttcaaagaggactgaaattattcttctggaagcca 350 ||||||| ||||| ||||||||||| ||||| |||| || ||||||||| Sbjct: 1409848 ttggccgcgagctcttcaaagaggagtgaaactattattttggaagcca 1409800 Score = 69.9 bits (35), Expect = 6e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 73 tcatttgtatactcagttgctagggactgtgataatggcaaagttgatcgcaagg 127 |||||||| ||||| ||||||||||||||||| ||||| |||||||| ||||||| Sbjct: 1410827 tcatttgtttactcggttgctagggactgtgacaatggtaaagttgaccgcaagg 1410773 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 28 caggggaaaatggcagacatgtacacctccttgcaatcatcaag 71 ||||||||| ||||||| ||||||||||||||||| |||||||| Sbjct: 1410945 caggggaaattggcagatatgtacacctccttgcagtcatcaag 1410902 Score = 60.0 bits (30), Expect = 6e-06 Identities = 49/56 (87%) Strand = Plus / Minus Query: 125 aggattgngcaggagtaatnctctttgctgctgaaagggcaacacaagttgcactt 180 ||||||| || || || || ||||||||||||||||||||||| || ||||||||| Sbjct: 1410362 aggattgtgctggtgtgattctctttgctgctgaaagggcaacccaggttgcactt 1410307 Score = 46.1 bits (23), Expect = 0.083 Identities = 29/31 (93%) Strand = Plus / Minus Query: 1 cgtccgattggtgaatttcagttcttacagg 31 ||||| |||||||||||||||||| |||||| Sbjct: 1411080 cgtccaattggtgaatttcagttcatacagg 1411050
>gb|AC129720.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0683F12, complete sequence Length = 144455 Score = 190 bits (96), Expect = 2e-45 Identities = 150/169 (88%) Strand = Plus / Minus Query: 182 aggcaatccagngtcttggtggcaatggatacataaatgagtacccaactgggcgtctac 241 ||||||| ||| ||||||||||||| |||||||||||||||||||||||||| || | | Sbjct: 4048 aggcaatacagtgtcttggtggcaacggatacataaatgagtacccaactggccgattgc 3989 Query: 242 tganagatgcaaaactgttcgagattggggctggtactagtgagatcagaanaatgataa 301 ||| ||||||||||||||| |||||||| || |||||||||||||| |||| |||||||| Sbjct: 3988 tgagagatgcaaaactgtttgagattggagccggtactagtgagataagaagaatgataa 3929 Query: 302 ttggccgtgagctgttcaaagaggactgaaattattcttctggaagcca 350 ||||||| ||||| ||||||||||| ||||| |||| || ||||||||| Sbjct: 3928 ttggccgcgagctcttcaaagaggagtgaaactattattttggaagcca 3880 Score = 69.9 bits (35), Expect = 6e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 73 tcatttgtatactcagttgctagggactgtgataatggcaaagttgatcgcaagg 127 |||||||| ||||| ||||||||||||||||| ||||| |||||||| ||||||| Sbjct: 4907 tcatttgtttactcggttgctagggactgtgacaatggtaaagttgaccgcaagg 4853 Score = 63.9 bits (32), Expect = 4e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 28 caggggaaaatggcagacatgtacacctccttgcaatcatcaag 71 ||||||||| ||||||| ||||||||||||||||| |||||||| Sbjct: 5025 caggggaaattggcagatatgtacacctccttgcagtcatcaag 4982 Score = 60.0 bits (30), Expect = 6e-06 Identities = 49/56 (87%) Strand = Plus / Minus Query: 125 aggattgngcaggagtaatnctctttgctgctgaaagggcaacacaagttgcactt 180 ||||||| || || || || ||||||||||||||||||||||| || ||||||||| Sbjct: 4442 aggattgtgctggtgtgattctctttgctgctgaaagggcaacccaggttgcactt 4387 Score = 46.1 bits (23), Expect = 0.083 Identities = 29/31 (93%) Strand = Plus / Minus Query: 1 cgtccgattggtgaatttcagttcttacagg 31 ||||| |||||||||||||||||| |||||| Sbjct: 5160 cgtccaattggtgaatttcagttcatacagg 5130
>emb|AJ278988.1|STU278988 Solanum tuberosum partial mRNA for isovaleryl-CoA dehydrogenase (ivd2 gene) Length = 1415 Score = 105 bits (53), Expect = 1e-19 Identities = 243/308 (78%) Strand = Plus / Plus Query: 4 ccgattggtgaatttcagttcttacaggggaaaatggcagacatgtacacctccttgcaa 63 |||||||| |||||||| || ||||||| ||| |||| ||||||||||| || ||||| Sbjct: 880 ccgattggagaatttcaatttgtacagggaaaagtggctgacatgtacacatctatgcaa 939 Query: 64 tcatcaagatcatttgtatactcagttgctagggactgtgataatggcaaagttgatcgc 123 || |||||||| | | | || || || || ||||| ||||| | ||| | || || | Sbjct: 940 tcttcaagatcgtatctctattctgtcgcaagggaatgtgacagtgggacgattaatacc 999 Query: 124 aaggattgngcaggagtaatnctctttgctgctgaaagggcaacacaagttgcacttgag 183 |||||||| || || || || |||| |||||||||||| ||||| |||||||| ||| || Sbjct: 1000 aaggattgtgctggtgttatactctctgctgctgaaagagcaacccaagttgctcttcag 1059 Query: 184 gcaatccagngtcttggtggcaatggatacataaatgagtacccaactgggcgtctactg 243 || || ||| | || || |||||||| ||| | ||||||||||| ||||| ||| | || Sbjct: 1060 gctattcagtgcctcggaggcaatggctacgtgaatgagtacccgactggacgttttctc 1119 Query: 244 anagatgcaaaactgttcgagattggggctggtactagtgagatcagaanaatgataatt 303 |||||| ||||| | |||||||| || || || ||||||||||||| ||||||||| Sbjct: 1120 cgagatgccaaactatatgagattggtgcaggcacaagtgagatcagaagaatgataata 1179 Query: 304 ggccgtga 311 |||||||| Sbjct: 1180 ggccgtga 1187
>gb|DQ427127.1| Sorghum propinquum locus CDO0580 genomic sequence Length = 679 Score = 91.7 bits (46), Expect = 2e-15 Identities = 55/58 (94%) Strand = Plus / Plus Query: 70 agatcatttgtatactcagttgctagggactgtgataatggcaaagttgatcgcaagg 127 ||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||||| Sbjct: 264 agatcatttgtatactcggttgctagggactgcgataatggcaaagttgaccgcaagg 321 Score = 75.8 bits (38), Expect = 9e-11 Identities = 51/56 (91%) Strand = Plus / Plus Query: 125 aggattgngcaggagtaatnctctttgctgctgaaagggcaacacaagttgcactt 180 ||||||| ||||||||||| |||||||||||||||| ||||| |||||||||||| Sbjct: 480 aggattgtgcaggagtaattctctttgctgctgaaaatgcaacccaagttgcactt 535 Score = 48.1 bits (24), Expect = 0.021 Identities = 39/44 (88%) Strand = Plus / Plus Query: 28 caggggaaaatggcagacatgtacacctccttgcaatcatcaag 71 |||||||||||||| || ||||||||||| ||||| || ||||| Sbjct: 151 caggggaaaatggctgatatgtacacctcattgcagtcgtcaag 194 Score = 46.1 bits (23), Expect = 0.083 Identities = 29/31 (93%) Strand = Plus / Plus Query: 1 cgtccgattggtgaatttcagttcttacagg 31 ||||| |||||||||||||||||| |||||| Sbjct: 16 cgtccaattggtgaatttcagttcatacagg 46
>gb|DQ427126.1| Sorghum bicolor voucher PI585454 locus CDO0580 genomic sequence Length = 677 Score = 91.7 bits (46), Expect = 2e-15 Identities = 55/58 (94%) Strand = Plus / Plus Query: 70 agatcatttgtatactcagttgctagggactgtgataatggcaaagttgatcgcaagg 127 ||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||||| Sbjct: 264 agatcatttgtatactcggttgctagggactgcgataatggcaaagttgaccgcaagg 321 Score = 75.8 bits (38), Expect = 9e-11 Identities = 51/56 (91%) Strand = Plus / Plus Query: 125 aggattgngcaggagtaatnctctttgctgctgaaagggcaacacaagttgcactt 180 ||||||| ||||||||||| |||||||||||||||| ||||| |||||||||||| Sbjct: 478 aggattgtgcaggagtaattctctttgctgctgaaaatgcaacccaagttgcactt 533 Score = 48.1 bits (24), Expect = 0.021 Identities = 39/44 (88%) Strand = Plus / Plus Query: 28 caggggaaaatggcagacatgtacacctccttgcaatcatcaag 71 |||||||||||||| || ||||||||||| ||||| || ||||| Sbjct: 151 caggggaaaatggctgatatgtacacctcattgcagtcgtcaag 194 Score = 46.1 bits (23), Expect = 0.083 Identities = 29/31 (93%) Strand = Plus / Plus Query: 1 cgtccgattggtgaatttcagttcttacagg 31 ||||| |||||||||||||||||| |||||| Sbjct: 16 cgtccaattggtgaatttcagttcatacagg 46
>gb|DQ427125.1| Sorghum bicolor voucher PI267539 locus CDO0580 genomic sequence Length = 679 Score = 91.7 bits (46), Expect = 2e-15 Identities = 55/58 (94%) Strand = Plus / Plus Query: 70 agatcatttgtatactcagttgctagggactgtgataatggcaaagttgatcgcaagg 127 ||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||||| Sbjct: 264 agatcatttgtatactcggttgctagggactgcgataatggcaaagttgaccgcaagg 321 Score = 75.8 bits (38), Expect = 9e-11 Identities = 51/56 (91%) Strand = Plus / Plus Query: 125 aggattgngcaggagtaatnctctttgctgctgaaagggcaacacaagttgcactt 180 ||||||| ||||||||||| |||||||||||||||| ||||| |||||||||||| Sbjct: 480 aggattgtgcaggagtaattctctttgctgctgaaaatgcaacccaagttgcactt 535 Score = 48.1 bits (24), Expect = 0.021 Identities = 39/44 (88%) Strand = Plus / Plus Query: 28 caggggaaaatggcagacatgtacacctccttgcaatcatcaag 71 |||||||||||||| || ||||||||||| ||||| || ||||| Sbjct: 151 caggggaaaatggctgatatgtacacctcattgcagtcgtcaag 194 Score = 46.1 bits (23), Expect = 0.083 Identities = 29/31 (93%) Strand = Plus / Plus Query: 1 cgtccgattggtgaatttcagttcttacagg 31 ||||| |||||||||||||||||| |||||| Sbjct: 16 cgtccaattggtgaatttcagttcatacagg 46
>gb|DQ427124.1| Sorghum bicolor voucher PI267408 locus CDO0580 genomic sequence Length = 677 Score = 91.7 bits (46), Expect = 2e-15 Identities = 55/58 (94%) Strand = Plus / Plus Query: 70 agatcatttgtatactcagttgctagggactgtgataatggcaaagttgatcgcaagg 127 ||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||||| Sbjct: 264 agatcatttgtatactcggttgctagggactgcgataatggcaaagttgaccgcaagg 321 Score = 75.8 bits (38), Expect = 9e-11 Identities = 51/56 (91%) Strand = Plus / Plus Query: 125 aggattgngcaggagtaatnctctttgctgctgaaagggcaacacaagttgcactt 180 ||||||| ||||||||||| |||||||||||||||| ||||| |||||||||||| Sbjct: 478 aggattgtgcaggagtaattctctttgctgctgaaaatgcaacccaagttgcactt 533 Score = 48.1 bits (24), Expect = 0.021 Identities = 39/44 (88%) Strand = Plus / Plus Query: 28 caggggaaaatggcagacatgtacacctccttgcaatcatcaag 71 |||||||||||||| || ||||||||||| ||||| || ||||| Sbjct: 151 caggggaaaatggctgatatgtacacctcattgcagtcgtcaag 194 Score = 46.1 bits (23), Expect = 0.083 Identities = 29/31 (93%) Strand = Plus / Plus Query: 1 cgtccgattggtgaatttcagttcttacagg 31 ||||| |||||||||||||||||| |||||| Sbjct: 16 cgtccaattggtgaatttcagttcatacagg 46
>gb|DQ427123.1| Sorghum bicolor voucher PI221607 locus CDO0580 genomic sequence Length = 677 Score = 91.7 bits (46), Expect = 2e-15 Identities = 55/58 (94%) Strand = Plus / Plus Query: 70 agatcatttgtatactcagttgctagggactgtgataatggcaaagttgatcgcaagg 127 ||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||||| Sbjct: 264 agatcatttgtatactcggttgctagggactgcgataatggcaaagttgaccgcaagg 321 Score = 75.8 bits (38), Expect = 9e-11 Identities = 51/56 (91%) Strand = Plus / Plus Query: 125 aggattgngcaggagtaatnctctttgctgctgaaagggcaacacaagttgcactt 180 ||||||| ||||||||||| |||||||||||||||| ||||| |||||||||||| Sbjct: 478 aggattgtgcaggagtaattctctttgctgctgaaaatgcaacccaagttgcactt 533 Score = 48.1 bits (24), Expect = 0.021 Identities = 39/44 (88%) Strand = Plus / Plus Query: 28 caggggaaaatggcagacatgtacacctccttgcaatcatcaag 71 |||||||||||||| || ||||||||||| ||||| || ||||| Sbjct: 151 caggggaaaatggctgatatgtacacctcattgcagtcgtcaag 194 Score = 46.1 bits (23), Expect = 0.083 Identities = 29/31 (93%) Strand = Plus / Plus Query: 1 cgtccgattggtgaatttcagttcttacagg 31 ||||| |||||||||||||||||| |||||| Sbjct: 16 cgtccaattggtgaatttcagttcatacagg 46
>gb|DQ427122.1| Sorghum bicolor voucher PI152702 locus CDO0580 genomic sequence Length = 679 Score = 91.7 bits (46), Expect = 2e-15 Identities = 55/58 (94%) Strand = Plus / Plus Query: 70 agatcatttgtatactcagttgctagggactgtgataatggcaaagttgatcgcaagg 127 ||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||||| Sbjct: 264 agatcatttgtatactcggttgctagggactgcgataatggcaaagttgaccgcaagg 321 Score = 75.8 bits (38), Expect = 9e-11 Identities = 51/56 (91%) Strand = Plus / Plus Query: 125 aggattgngcaggagtaatnctctttgctgctgaaagggcaacacaagttgcactt 180 ||||||| ||||||||||| |||||||||||||||| ||||| |||||||||||| Sbjct: 480 aggattgtgcaggagtaattctctttgctgctgaaaatgcaacccaagttgcactt 535 Score = 48.1 bits (24), Expect = 0.021 Identities = 39/44 (88%) Strand = Plus / Plus Query: 28 caggggaaaatggcagacatgtacacctccttgcaatcatcaag 71 |||||||||||||| || ||||||||||| ||||| || ||||| Sbjct: 151 caggggaaaatggctgatatgtacacctcattgcagtcgtcaag 194 Score = 46.1 bits (23), Expect = 0.083 Identities = 29/31 (93%) Strand = Plus / Plus Query: 1 cgtccgattggtgaatttcagttcttacagg 31 ||||| |||||||||||||||||| |||||| Sbjct: 16 cgtccaattggtgaatttcagttcatacagg 46
>gb|DQ427121.1| Sorghum bicolor voucher NSL92371 locus CDO0580 genomic sequence Length = 679 Score = 91.7 bits (46), Expect = 2e-15 Identities = 55/58 (94%) Strand = Plus / Plus Query: 70 agatcatttgtatactcagttgctagggactgtgataatggcaaagttgatcgcaagg 127 ||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||||| Sbjct: 264 agatcatttgtatactcggttgctagggactgcgataatggcaaagttgaccgcaagg 321 Score = 75.8 bits (38), Expect = 9e-11 Identities = 51/56 (91%) Strand = Plus / Plus Query: 125 aggattgngcaggagtaatnctctttgctgctgaaagggcaacacaagttgcactt 180 ||||||| ||||||||||| |||||||||||||||| ||||| |||||||||||| Sbjct: 480 aggattgtgcaggagtaattctctttgctgctgaaaatgcaacccaagttgcactt 535 Score = 48.1 bits (24), Expect = 0.021 Identities = 39/44 (88%) Strand = Plus / Plus Query: 28 caggggaaaatggcagacatgtacacctccttgcaatcatcaag 71 |||||||||||||| || ||||||||||| ||||| || ||||| Sbjct: 151 caggggaaaatggctgatatgtacacctcattgcagtcgtcaag 194 Score = 46.1 bits (23), Expect = 0.083 Identities = 29/31 (93%) Strand = Plus / Plus Query: 1 cgtccgattggtgaatttcagttcttacagg 31 ||||| |||||||||||||||||| |||||| Sbjct: 16 cgtccaattggtgaatttcagttcatacagg 46
>gb|DQ427120.1| Sorghum bicolor voucher NSL87666 locus CDO0580 genomic sequence Length = 679 Score = 91.7 bits (46), Expect = 2e-15 Identities = 55/58 (94%) Strand = Plus / Plus Query: 70 agatcatttgtatactcagttgctagggactgtgataatggcaaagttgatcgcaagg 127 ||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||||| Sbjct: 264 agatcatttgtatactcggttgctagggactgcgataatggcaaagttgaccgcaagg 321 Score = 75.8 bits (38), Expect = 9e-11 Identities = 51/56 (91%) Strand = Plus / Plus Query: 125 aggattgngcaggagtaatnctctttgctgctgaaagggcaacacaagttgcactt 180 ||||||| ||||||||||| |||||||||||||||| ||||| |||||||||||| Sbjct: 480 aggattgtgcaggagtaattctctttgctgctgaaaatgcaacccaagttgcactt 535 Score = 48.1 bits (24), Expect = 0.021 Identities = 39/44 (88%) Strand = Plus / Plus Query: 28 caggggaaaatggcagacatgtacacctccttgcaatcatcaag 71 |||||||||||||| || ||||||||||| ||||| || ||||| Sbjct: 151 caggggaaaatggctgatatgtacacctcattgcagtcgtcaag 194 Score = 46.1 bits (23), Expect = 0.083 Identities = 29/31 (93%) Strand = Plus / Plus Query: 1 cgtccgattggtgaatttcagttcttacagg 31 ||||| |||||||||||||||||| |||||| Sbjct: 16 cgtccaattggtgaatttcagttcatacagg 46
>gb|DQ427119.1| Sorghum bicolor voucher NSL77217 locus CDO0580 genomic sequence Length = 679 Score = 91.7 bits (46), Expect = 2e-15 Identities = 55/58 (94%) Strand = Plus / Plus Query: 70 agatcatttgtatactcagttgctagggactgtgataatggcaaagttgatcgcaagg 127 ||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||||| Sbjct: 264 agatcatttgtatactcggttgctagggactgcgataatggcaaagttgaccgcaagg 321 Score = 75.8 bits (38), Expect = 9e-11 Identities = 51/56 (91%) Strand = Plus / Plus Query: 125 aggattgngcaggagtaatnctctttgctgctgaaagggcaacacaagttgcactt 180 ||||||| ||||||||||| |||||||||||||||| ||||| |||||||||||| Sbjct: 480 aggattgtgcaggagtaattctctttgctgctgaaaatgcaacccaagttgcactt 535 Score = 48.1 bits (24), Expect = 0.021 Identities = 39/44 (88%) Strand = Plus / Plus Query: 28 caggggaaaatggcagacatgtacacctccttgcaatcatcaag 71 |||||||||||||| || ||||||||||| ||||| || ||||| Sbjct: 151 caggggaaaatggctgatatgtacacctcattgcagtcgtcaag 194 Score = 46.1 bits (23), Expect = 0.083 Identities = 29/31 (93%) Strand = Plus / Plus Query: 1 cgtccgattggtgaatttcagttcttacagg 31 ||||| |||||||||||||||||| |||||| Sbjct: 16 cgtccaattggtgaatttcagttcatacagg 46
>gb|DQ427118.1| Sorghum bicolor voucher NSL77034 locus CDO0580 genomic sequence Length = 677 Score = 91.7 bits (46), Expect = 2e-15 Identities = 55/58 (94%) Strand = Plus / Plus Query: 70 agatcatttgtatactcagttgctagggactgtgataatggcaaagttgatcgcaagg 127 ||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||||| Sbjct: 264 agatcatttgtatactcggttgctagggactgcgataatggcaaagttgaccgcaagg 321 Score = 75.8 bits (38), Expect = 9e-11 Identities = 51/56 (91%) Strand = Plus / Plus Query: 125 aggattgngcaggagtaatnctctttgctgctgaaagggcaacacaagttgcactt 180 ||||||| ||||||||||| |||||||||||||||| ||||| |||||||||||| Sbjct: 478 aggattgtgcaggagtaattctctttgctgctgaaaatgcaacccaagttgcactt 533 Score = 48.1 bits (24), Expect = 0.021 Identities = 39/44 (88%) Strand = Plus / Plus Query: 28 caggggaaaatggcagacatgtacacctccttgcaatcatcaag 71 |||||||||||||| || ||||||||||| ||||| || ||||| Sbjct: 151 caggggaaaatggctgatatgtacacctcattgcagtcgtcaag 194 Score = 46.1 bits (23), Expect = 0.083 Identities = 29/31 (93%) Strand = Plus / Plus Query: 1 cgtccgattggtgaatttcagttcttacagg 31 ||||| |||||||||||||||||| |||||| Sbjct: 16 cgtccaattggtgaatttcagttcatacagg 46
>gb|DQ427117.1| Sorghum bicolor voucher NSL56174 locus CDO0580 genomic sequence Length = 677 Score = 91.7 bits (46), Expect = 2e-15 Identities = 55/58 (94%) Strand = Plus / Plus Query: 70 agatcatttgtatactcagttgctagggactgtgataatggcaaagttgatcgcaagg 127 ||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||||| Sbjct: 264 agatcatttgtatactcggttgctagggactgcgataatggcaaagttgaccgcaagg 321 Score = 75.8 bits (38), Expect = 9e-11 Identities = 51/56 (91%) Strand = Plus / Plus Query: 125 aggattgngcaggagtaatnctctttgctgctgaaagggcaacacaagttgcactt 180 ||||||| ||||||||||| |||||||||||||||| ||||| |||||||||||| Sbjct: 478 aggattgtgcaggagtaattctctttgctgctgaaaatgcaacccaagttgcactt 533 Score = 48.1 bits (24), Expect = 0.021 Identities = 39/44 (88%) Strand = Plus / Plus Query: 28 caggggaaaatggcagacatgtacacctccttgcaatcatcaag 71 |||||||||||||| || ||||||||||| ||||| || ||||| Sbjct: 151 caggggaaaatggctgatatgtacacctcattgcagtcgtcaag 194 Score = 46.1 bits (23), Expect = 0.083 Identities = 29/31 (93%) Strand = Plus / Plus Query: 1 cgtccgattggtgaatttcagttcttacagg 31 ||||| |||||||||||||||||| |||||| Sbjct: 16 cgtccaattggtgaatttcagttcatacagg 46
>gb|DQ427116.1| Sorghum bicolor voucher NSL56003 locus CDO0580 genomic sequence Length = 676 Score = 91.7 bits (46), Expect = 2e-15 Identities = 55/58 (94%) Strand = Plus / Plus Query: 70 agatcatttgtatactcagttgctagggactgtgataatggcaaagttgatcgcaagg 127 ||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||||| Sbjct: 264 agatcatttgtatactcggttgctagggactgcgataatggcaaagttgaccgcaagg 321 Score = 75.8 bits (38), Expect = 9e-11 Identities = 51/56 (91%) Strand = Plus / Plus Query: 125 aggattgngcaggagtaatnctctttgctgctgaaagggcaacacaagttgcactt 180 ||||||| ||||||||||| |||||||||||||||| ||||| |||||||||||| Sbjct: 478 aggattgtgcaggagtaattctctttgctgctgaaaatgcaacccaagttgcactt 533 Score = 48.1 bits (24), Expect = 0.021 Identities = 39/44 (88%) Strand = Plus / Plus Query: 28 caggggaaaatggcagacatgtacacctccttgcaatcatcaag 71 |||||||||||||| || ||||||||||| ||||| || ||||| Sbjct: 151 caggggaaaatggctgatatgtacacctcattgcagtcgtcaag 194 Score = 46.1 bits (23), Expect = 0.083 Identities = 29/31 (93%) Strand = Plus / Plus Query: 1 cgtccgattggtgaatttcagttcttacagg 31 ||||| |||||||||||||||||| |||||| Sbjct: 16 cgtccaattggtgaatttcagttcatacagg 46
>gb|DQ427115.1| Sorghum bicolor voucher NSL55243 locus CDO0580 genomic sequence Length = 677 Score = 91.7 bits (46), Expect = 2e-15 Identities = 55/58 (94%) Strand = Plus / Plus Query: 70 agatcatttgtatactcagttgctagggactgtgataatggcaaagttgatcgcaagg 127 ||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||||| Sbjct: 264 agatcatttgtatactcggttgctagggactgcgataatggcaaagttgaccgcaagg 321 Score = 75.8 bits (38), Expect = 9e-11 Identities = 51/56 (91%) Strand = Plus / Plus Query: 125 aggattgngcaggagtaatnctctttgctgctgaaagggcaacacaagttgcactt 180 ||||||| ||||||||||| |||||||||||||||| ||||| |||||||||||| Sbjct: 478 aggattgtgcaggagtaattctctttgctgctgaaaatgcaacccaagttgcactt 533 Score = 48.1 bits (24), Expect = 0.021 Identities = 39/44 (88%) Strand = Plus / Plus Query: 28 caggggaaaatggcagacatgtacacctccttgcaatcatcaag 71 |||||||||||||| || ||||||||||| ||||| || ||||| Sbjct: 151 caggggaaaatggctgatatgtacacctcattgcagtcgtcaag 194 Score = 46.1 bits (23), Expect = 0.083 Identities = 29/31 (93%) Strand = Plus / Plus Query: 1 cgtccgattggtgaatttcagttcttacagg 31 ||||| |||||||||||||||||| |||||| Sbjct: 16 cgtccaattggtgaatttcagttcatacagg 46
>gb|DQ427114.1| Sorghum bicolor voucher NSL51365 locus CDO0580 genomic sequence Length = 677 Score = 91.7 bits (46), Expect = 2e-15 Identities = 55/58 (94%) Strand = Plus / Plus Query: 70 agatcatttgtatactcagttgctagggactgtgataatggcaaagttgatcgcaagg 127 ||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||||| Sbjct: 264 agatcatttgtatactcggttgctagggactgcgataatggcaaagttgaccgcaagg 321 Score = 75.8 bits (38), Expect = 9e-11 Identities = 51/56 (91%) Strand = Plus / Plus Query: 125 aggattgngcaggagtaatnctctttgctgctgaaagggcaacacaagttgcactt 180 ||||||| ||||||||||| |||||||||||||||| ||||| |||||||||||| Sbjct: 478 aggattgtgcaggagtaattctctttgctgctgaaaatgcaacccaagttgcactt 533 Score = 48.1 bits (24), Expect = 0.021 Identities = 39/44 (88%) Strand = Plus / Plus Query: 28 caggggaaaatggcagacatgtacacctccttgcaatcatcaag 71 |||||||||||||| || ||||||||||| ||||| || ||||| Sbjct: 151 caggggaaaatggctgatatgtacacctcattgcagtcgtcaag 194 Score = 46.1 bits (23), Expect = 0.083 Identities = 29/31 (93%) Strand = Plus / Plus Query: 1 cgtccgattggtgaatttcagttcttacagg 31 ||||| |||||||||||||||||| |||||| Sbjct: 16 cgtccaattggtgaatttcagttcatacagg 46
>gb|DQ427113.1| Sorghum bicolor voucher NSL51030 locus CDO0580 genomic sequence Length = 677 Score = 91.7 bits (46), Expect = 2e-15 Identities = 55/58 (94%) Strand = Plus / Plus Query: 70 agatcatttgtatactcagttgctagggactgtgataatggcaaagttgatcgcaagg 127 ||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||||| Sbjct: 264 agatcatttgtatactcggttgctagggactgcgataatggcaaagttgaccgcaagg 321 Score = 75.8 bits (38), Expect = 9e-11 Identities = 51/56 (91%) Strand = Plus / Plus Query: 125 aggattgngcaggagtaatnctctttgctgctgaaagggcaacacaagttgcactt 180 ||||||| ||||||||||| |||||||||||||||| ||||| |||||||||||| Sbjct: 478 aggattgtgcaggagtaattctctttgctgctgaaaatgcaacccaagttgcactt 533 Score = 48.1 bits (24), Expect = 0.021 Identities = 39/44 (88%) Strand = Plus / Plus Query: 28 caggggaaaatggcagacatgtacacctccttgcaatcatcaag 71 |||||||||||||| || ||||||||||| ||||| || ||||| Sbjct: 151 caggggaaaatggctgatatgtacacctcattgcagtcgtcaag 194 Score = 46.1 bits (23), Expect = 0.083 Identities = 29/31 (93%) Strand = Plus / Plus Query: 1 cgtccgattggtgaatttcagttcttacagg 31 ||||| |||||||||||||||||| |||||| Sbjct: 16 cgtccaattggtgaatttcagttcatacagg 46
>gb|DQ427112.1| Sorghum bicolor voucher NSL50875 locus CDO0580 genomic sequence Length = 679 Score = 91.7 bits (46), Expect = 2e-15 Identities = 55/58 (94%) Strand = Plus / Plus Query: 70 agatcatttgtatactcagttgctagggactgtgataatggcaaagttgatcgcaagg 127 ||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||||| Sbjct: 264 agatcatttgtatactcggttgctagggactgcgataatggcaaagttgaccgcaagg 321 Score = 75.8 bits (38), Expect = 9e-11 Identities = 51/56 (91%) Strand = Plus / Plus Query: 125 aggattgngcaggagtaatnctctttgctgctgaaagggcaacacaagttgcactt 180 ||||||| ||||||||||| |||||||||||||||| ||||| |||||||||||| Sbjct: 480 aggattgtgcaggagtaattctctttgctgctgaaaatgcaacccaagttgcactt 535 Score = 48.1 bits (24), Expect = 0.021 Identities = 39/44 (88%) Strand = Plus / Plus Query: 28 caggggaaaatggcagacatgtacacctccttgcaatcatcaag 71 |||||||||||||| || ||||||||||| ||||| || ||||| Sbjct: 151 caggggaaaatggctgatatgtacacctcattgcagtcgtcaag 194 Score = 46.1 bits (23), Expect = 0.083 Identities = 29/31 (93%) Strand = Plus / Plus Query: 1 cgtccgattggtgaatttcagttcttacagg 31 ||||| |||||||||||||||||| |||||| Sbjct: 16 cgtccaattggtgaatttcagttcatacagg 46
>gb|DQ427111.1| Sorghum bicolor voucher BTx623 locus CDO0580 genomic sequence Length = 679 Score = 91.7 bits (46), Expect = 2e-15 Identities = 55/58 (94%) Strand = Plus / Plus Query: 70 agatcatttgtatactcagttgctagggactgtgataatggcaaagttgatcgcaagg 127 ||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||||| Sbjct: 264 agatcatttgtatactcggttgctagggactgcgataatggcaaagttgaccgcaagg 321 Score = 75.8 bits (38), Expect = 9e-11 Identities = 51/56 (91%) Strand = Plus / Plus Query: 125 aggattgngcaggagtaatnctctttgctgctgaaagggcaacacaagttgcactt 180 ||||||| ||||||||||| |||||||||||||||| ||||| |||||||||||| Sbjct: 480 aggattgtgcaggagtaattctctttgctgctgaaaatgcaacccaagttgcactt 535 Score = 48.1 bits (24), Expect = 0.021 Identities = 39/44 (88%) Strand = Plus / Plus Query: 28 caggggaaaatggcagacatgtacacctccttgcaatcatcaag 71 |||||||||||||| || ||||||||||| ||||| || ||||| Sbjct: 151 caggggaaaatggctgatatgtacacctcattgcagtcgtcaag 194 Score = 46.1 bits (23), Expect = 0.083 Identities = 29/31 (93%) Strand = Plus / Plus Query: 1 cgtccgattggtgaatttcagttcttacagg 31 ||||| |||||||||||||||||| |||||| Sbjct: 16 cgtccaattggtgaatttcagttcatacagg 46
>ref|NM_114399.3| Arabidopsis thaliana IVD (ISOVALERYL-COA-DEHYDROGENASE) AT3G45300 (IVD) mRNA, complete cds Length = 2014 Score = 56.0 bits (28), Expect = 9e-05 Identities = 91/112 (81%) Strand = Plus / Plus Query: 8 ttggtgaatttcagttcttacaggggaaaatggcagacatgtacacctccttgcaatcat 67 |||| ||||||||||| ||||||| ||| | || || |||||||| | || ||||| | Sbjct: 1108 ttggggaatttcagtttatacagggtaaagttgctgatatgtacactgcattacaatctt 1167 Query: 68 caagatcatttgtatactcagttgctagggactgtgataatggcaaagttga 119 |||| |||| || ||||| ||||| ||||||||||| ||||| |||||||| Sbjct: 1168 caaggtcatacgtttactctgttgcgagggactgtgacaatgggaaagttga 1219
>gb|AC152176.5| Medicago truncatula clone mth2-65c4, complete sequence Length = 161536 Score = 56.0 bits (28), Expect = 9e-05 Identities = 71/86 (82%) Strand = Plus / Minus Query: 220 gagtacccaactgggcgtctactganagatgcaaaactgttcgagattggggctggtact 279 ||||| ||||| || ||||| || | |||||| ||||| | |||||| ||||| || || Sbjct: 11955 gagtatccaaccggtcgtctccttagagatgcgaaactctacgagatcggggccggaaca 11896 Query: 280 agtgagatcagaanaatgataattgg 305 ||||||||||||| |||||| ||||| Sbjct: 11895 agtgagatcagaagaatgattattgg 11870
>emb|Y12695.1|ATISOVAL A.thaliana mRNA for isovaleryl-CoA dehydrogenase Length = 1321 Score = 56.0 bits (28), Expect = 9e-05 Identities = 91/112 (81%) Strand = Plus / Plus Query: 8 ttggtgaatttcagttcttacaggggaaaatggcagacatgtacacctccttgcaatcat 67 |||| ||||||||||| ||||||| ||| | || || |||||||| | || ||||| | Sbjct: 958 ttggggaatttcagtttatacagggtaaagttgctgatatgtacactgcattacaatctt 1017 Query: 68 caagatcatttgtatactcagttgctagggactgtgataatggcaaagttga 119 |||| |||| || ||||| ||||| ||||||||||| ||||| |||||||| Sbjct: 1018 caaggtcatacgtttactctgttgcgagggactgtgacaatgggaaagttga 1069
>gb|AY128799.1| Arabidopsis thaliana isovaleryl-CoA-dehydrogenase precursor IVD (At3g45300) mRNA, complete cds Length = 1416 Score = 56.0 bits (28), Expect = 9e-05 Identities = 91/112 (81%) Strand = Plus / Plus Query: 8 ttggtgaatttcagttcttacaggggaaaatggcagacatgtacacctccttgcaatcat 67 |||| ||||||||||| ||||||| ||| | || || |||||||| | || ||||| | Sbjct: 908 ttggggaatttcagtttatacagggtaaagttgctgatatgtacactgcattacaatctt 967 Query: 68 caagatcatttgtatactcagttgctagggactgtgataatggcaaagttga 119 |||| |||| || ||||| ||||| ||||||||||| ||||| |||||||| Sbjct: 968 caaggtcatacgtttactctgttgcgagggactgtgacaatgggaaagttga 1019
>gb|AY062567.1| Arabidopsis thaliana isovaleryl-CoA-dehydrogenase precursor (IVD) (F18N11.6) mRNA, complete cds Length = 1477 Score = 56.0 bits (28), Expect = 9e-05 Identities = 91/112 (81%) Strand = Plus / Plus Query: 8 ttggtgaatttcagttcttacaggggaaaatggcagacatgtacacctccttgcaatcat 67 |||| ||||||||||| ||||||| ||| | || || |||||||| | || ||||| | Sbjct: 938 ttggggaatttcagtttatacagggtaaagttgctgatatgtacactgcattacaatctt 997 Query: 68 caagatcatttgtatactcagttgctagggactgtgataatggcaaagttga 119 |||| |||| || ||||| ||||| ||||||||||| ||||| |||||||| Sbjct: 998 caaggtcatacgtttactctgttgcgagggactgtgacaatgggaaagttga 1049
>gb|AF160729.1|AF160729 Arabidopsis thaliana isovaleryl-CoA-dehydrogenase precursor (IVD) mRNA, complete cds; nuclear gene for mitochondrial product Length = 1547 Score = 56.0 bits (28), Expect = 9e-05 Identities = 91/112 (81%) Strand = Plus / Plus Query: 8 ttggtgaatttcagttcttacaggggaaaatggcagacatgtacacctccttgcaatcat 67 |||| ||||||||||| ||||||| ||| | || || |||||||| | || ||||| | Sbjct: 1120 ttggggaatttcagtttatacagggtaaagttgctgatatgtacactgcattacaatctt 1179 Query: 68 caagatcatttgtatactcagttgctagggactgtgataatggcaaagttga 119 |||| |||| || ||||| ||||| ||||||||||| ||||| |||||||| Sbjct: 1180 caaggtcatacgtttactctgttgcgagggactgtgacaatgggaaagttga 1231
>gb|AY087286.1| Arabidopsis thaliana clone 33674 mRNA, complete sequence Length = 1514 Score = 56.0 bits (28), Expect = 9e-05 Identities = 91/112 (81%) Strand = Plus / Plus Query: 8 ttggtgaatttcagttcttacaggggaaaatggcagacatgtacacctccttgcaatcat 67 |||| ||||||||||| ||||||| ||| | || || |||||||| | || ||||| | Sbjct: 1034 ttggggaatttcagtttatacagggtaaagttgctgatatgtacactgcattacaatctt 1093 Query: 68 caagatcatttgtatactcagttgctagggactgtgataatggcaaagttga 119 |||| |||| || ||||| ||||| ||||||||||| ||||| |||||||| Sbjct: 1094 caaggtcatacgtttactctgttgcgagggactgtgacaatgggaaagttga 1145
>emb|AJ010946.1|PSA010946 Pisum sativum abp44/ivdh gene for Isovaleryl-CoA dehydrogenase/auxin binding protein Length = 3572 Score = 48.1 bits (24), Expect = 0.021 Identities = 62/75 (82%) Strand = Plus / Plus Query: 246 agatgcaaaactgttcgagattggggctggtactagtgagatcagaanaatgataattgg 305 |||||| ||||| | |||||| || || || |||||||||||||||| |||||| || || Sbjct: 3260 agatgctaaactttacgagatcggagccggaactagtgagatcagaagaatgattatagg 3319 Query: 306 ccgtgagctgttcaa 320 || ||||| ||||| Sbjct: 3320 acgcgagctcttcaa 3334
>emb|AJ010945.1|PSA010945 Pisum sativum mRNA for Isovaleryl-CoA dehydrogenase/auxin binding protein (abp44/ivdh gene) Length = 1559 Score = 48.1 bits (24), Expect = 0.021 Identities = 62/75 (82%) Strand = Plus / Plus Query: 246 agatgcaaaactgttcgagattggggctggtactagtgagatcagaanaatgataattgg 305 |||||| ||||| | |||||| || || || |||||||||||||||| |||||| || || Sbjct: 1247 agatgctaaactttacgagatcggagccggaactagtgagatcagaagaatgattatagg 1306 Query: 306 ccgtgagctgttcaa 320 || ||||| ||||| Sbjct: 1307 acgcgagctcttcaa 1321 Score = 48.1 bits (24), Expect = 0.021 Identities = 67/82 (81%) Strand = Plus / Plus Query: 95 gggactgtgataatggcaaagttgatcgcaaggattgngcaggagtaatnctctttgctg 154 ||||||||||||| || |||||||| | |||||||| || ||||| || || | ||| | Sbjct: 1096 gggactgtgataacggaaaagttgacccgaaggattgtgctggagttatactttgtgcag 1155 Query: 155 ctgaaagggcaacacaagttgc 176 ||||||| ||||| || ||||| Sbjct: 1156 ctgaaagagcaacgcaggttgc 1177
>emb|CR847948.16| Zebrafish DNA sequence from clone CH211-252L12 in linkage group 13, complete sequence Length = 168946 Score = 44.1 bits (22), Expect = 0.33 Identities = 22/22 (100%) Strand = Plus / Minus Query: 2 gtccgattggtgaatttcagtt 23 |||||||||||||||||||||| Sbjct: 119988 gtccgattggtgaatttcagtt 119967
>emb|AL132953.2|ATF18N11 Arabidopsis thaliana DNA chromosome 3, BAC clone F18N11 Length = 91274 Score = 44.1 bits (22), Expect = 0.33 Identities = 34/38 (89%) Strand = Plus / Minus Query: 82 tactcagttgctagggactgtgataatggcaaagttga 119 ||||| ||||| ||||||||||| ||||| |||||||| Sbjct: 52873 tactctgttgcgagggactgtgacaatgggaaagttga 52836
>gb|AC110871.6| Homo sapiens 3 BAC RP11-639B4 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 97110 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 22 ttcttacaggggaaaatggca 42 ||||||||||||||||||||| Sbjct: 25326 ttcttacaggggaaaatggca 25346
>gb|AY917022.1| Taiwania cryptomerioides voucher NSYSU 62-3B clone 2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence Length = 1088 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 165 aacacaagttgcacttgaggc 185 ||||||||||||||||||||| Sbjct: 819 aacacaagttgcacttgaggc 839
>gb|AY917021.1| Taiwania cryptomerioides voucher NSYSU 62-3A clone 1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence Length = 1088 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 165 aacacaagttgcacttgaggc 185 ||||||||||||||||||||| Sbjct: 819 aacacaagttgcacttgaggc 839
>gb|AY917019.1| Taiwania cryptomerioides voucher NSYSU 62-2c clone 3 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence Length = 1089 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 165 aacacaagttgcacttgaggc 185 ||||||||||||||||||||| Sbjct: 820 aacacaagttgcacttgaggc 840
>gb|AY916981.1| Taiwania cryptomerioides voucher NSYSU 45-2A clone 1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence Length = 1087 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 165 aacacaagttgcacttgaggc 185 ||||||||||||||||||||| Sbjct: 818 aacacaagttgcacttgaggc 838
>gb|AY916952.1| Taiwania cryptomerioides voucher NSYSU 33-2B2 clone 2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence Length = 1088 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 165 aacacaagttgcacttgaggc 185 ||||||||||||||||||||| Sbjct: 819 aacacaagttgcacttgaggc 839
>gb|AY916950.1| Taiwania cryptomerioides voucher NSYSU 33-2a2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence Length = 1088 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 165 aacacaagttgcacttgaggc 185 ||||||||||||||||||||| Sbjct: 819 aacacaagttgcacttgaggc 839
>gb|AY916949.1| Taiwania cryptomerioides voucher NSYSU 33-2C2 clone 3 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence Length = 1088 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 165 aacacaagttgcacttgaggc 185 ||||||||||||||||||||| Sbjct: 819 aacacaagttgcacttgaggc 839
>gb|AY916903.1| Taiwania cryptomerioides voucher NSYSU 24-4C clone 3 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence Length = 1088 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 165 aacacaagttgcacttgaggc 185 ||||||||||||||||||||| Sbjct: 819 aacacaagttgcacttgaggc 839
>gb|AY916896.1| Taiwania cryptomerioides voucher NSYSU 24-2B clone 2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence Length = 1088 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 165 aacacaagttgcacttgaggc 185 ||||||||||||||||||||| Sbjct: 819 aacacaagttgcacttgaggc 839
>gb|AY916890.1| Taiwania cryptomerioides voucher NSYSU 23-3C clone 3 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence Length = 1087 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 165 aacacaagttgcacttgaggc 185 ||||||||||||||||||||| Sbjct: 818 aacacaagttgcacttgaggc 838
>gb|AY916875.1| Taiwania cryptomerioides voucher NSYSU 7-2C clone 3 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence Length = 1088 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 165 aacacaagttgcacttgaggc 185 ||||||||||||||||||||| Sbjct: 819 aacacaagttgcacttgaggc 839
>gb|AY916854.1| Taiwania cryptomerioides voucher NSYSU 19-3A clone 1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence Length = 1089 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 165 aacacaagttgcacttgaggc 185 ||||||||||||||||||||| Sbjct: 820 aacacaagttgcacttgaggc 840
>gb|AC154827.3| Mus musculus BAC clone RP24-546P18 from chromosome 14, complete sequence Length = 168432 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 330 aaattattcttctggaagccatct 353 ||||||||| |||||||||||||| Sbjct: 73404 aaattattcctctggaagccatct 73427
>gb|AC095247.5| Rattus norvegicus 4 BAC CH230-10C6 (Children's Hospital Oakland Research Institute) complete sequence Length = 238466 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 90 tgctagggactgtgataatg 109 |||||||||||||||||||| Sbjct: 158947 tgctagggactgtgataatg 158966
>gb|AC133092.4| Mus musculus BAC clone RP23-404G6 from chromosome 3, complete sequence Length = 190089 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gaaaatggcagacatgtaca 52 |||||||||||||||||||| Sbjct: 28788 gaaaatggcagacatgtaca 28769
>gb|AC087066.3| Rattus norvegicus strain Brown Norway clone RP31-194D8, complete sequence Length = 166751 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 90 tgctagggactgtgataatg 109 |||||||||||||||||||| Sbjct: 154511 tgctagggactgtgataatg 154530
>gb|AC101968.11| Mus musculus chromosome 3, clone RP24-257N17, complete sequence Length = 177613 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gaaaatggcagacatgtaca 52 |||||||||||||||||||| Sbjct: 22597 gaaaatggcagacatgtaca 22616
>gb|AC121216.4| Rattus norvegicus 4 CH230-220A21 (Children's Hospital Oakland Research Institute) complete sequence Length = 224326 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 90 tgctagggactgtgataatg 109 |||||||||||||||||||| Sbjct: 71456 tgctagggactgtgataatg 71475
>emb|CT030360.1| Xenopus tropicalis finished cDNA, clone TGas106c19 Length = 1862 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 gggaaaatggcagacatgtacacc 54 ||||||||||| |||||||||||| Sbjct: 974 gggaaaatggccgacatgtacacc 997
>emb|AJ012255.1|LMO012255 Listeria monocytogenes dlt operon Length = 5637 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 106 aatggcaaagttgatcgcaa 125 |||||||||||||||||||| Sbjct: 1987 aatggcaaagttgatcgcaa 2006
>gb|CP000087.1| Rickettsia bellii RML369-C, complete genome Length = 1522076 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 324 ggactgaaattattcttctg 343 |||||||||||||||||||| Sbjct: 141392 ggactgaaattattcttctg 141411
>gb|AC095351.5| Homo sapiens X BAC RP11-359C4 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 194296 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 327 ctgaaattattcttctggaa 346 |||||||||||||||||||| Sbjct: 9594 ctgaaattattcttctggaa 9613
>gb|AF078902.1| Sorghum bicolor centromere element pHind12, complete sequence Length = 2008 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 204 caatggatacataaatgagt 223 |||||||||||||||||||| Sbjct: 1510 caatggatacataaatgagt 1529
>gb|AF129108.2|AF129108 Homo sapiens chromosome 21 clone cosmid clone D75C1 map 21q22.2, complete sequence Length = 40874 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 87 agttgctagggactgtgataatgg 110 |||||||||||||||||| ||||| Sbjct: 9984 agttgctagggactgtgagaatgg 9961
>gb|DP000027.1| Rattus norvegicus target 1 genomic scaffold Length = 1888123 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 90 tgctagggactgtgataatg 109 |||||||||||||||||||| Sbjct: 982849 tgctagggactgtgataatg 982868
>ref|NM_001011380.1| Xenopus tropicalis hypothetical LOC496848 (LOC496848), mRNA Length = 1892 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 gggaaaatggcagacatgtacacc 54 ||||||||||| |||||||||||| Sbjct: 986 gggaaaatggccgacatgtacacc 1009
>emb|AJ229042.1|HS229042 Homo sapiens 959 kb contig between AML1 and CBR1 on chromosome 21q22, segment 2/3 Length = 348050 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 87 agttgctagggactgtgataatgg 110 |||||||||||||||||| ||||| Sbjct: 235301 agttgctagggactgtgagaatgg 235324
>emb|AL163267.2|HS21C067 Homo sapiens chromosome 21 segment HS21C067 Length = 340000 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 87 agttgctagggactgtgataatgg 110 |||||||||||||||||| ||||| Sbjct: 302776 agttgctagggactgtgagaatgg 302753
>gb|BC088561.1| Xenopus tropicalis hypothetical LOC496848, mRNA (cDNA clone MGC:97746 IMAGE:6987702), complete cds Length = 1892 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 gggaaaatggcagacatgtacacc 54 ||||||||||| |||||||||||| Sbjct: 986 gggaaaatggccgacatgtacacc 1009
>emb|CT025681.8| Mouse DNA sequence from clone RP24-325P17 on chromosome 14, complete sequence Length = 205581 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 330 aaattattcttctggaagccatct 353 ||||||||| |||||||||||||| Sbjct: 111195 aaattattcctctggaagccatct 111172 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,963,134 Number of Sequences: 3902068 Number of extensions: 2963134 Number of successful extensions: 49907 Number of sequences better than 10.0: 70 Number of HSP's better than 10.0 without gapping: 70 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 49730 Number of HSP's gapped (non-prelim): 176 length of query: 384 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 362 effective length of database: 17,147,199,772 effective search space: 6207286317464 effective search space used: 6207286317464 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)