>ref|XM_360348.1| Magnaporthe grisea 70-15 hypothetical protein (MG05722.4) partial
           mRNA
          Length = 1965

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 71  atcccagtggcccagttctt 90
           ||||||||||||||||||||
Sbjct: 879 atcccagtggcccagttctt 898

>gb|AE006144.1| Pasteurella multocida subsp. multocida str. Pm70 section 111 of 204
            of the complete genome
          Length = 11505

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 51   aaatttgcccatgtggatgc 70
            ||||||||||||||||||||
Sbjct: 5782 aaatttgcccatgtggatgc 5801

>emb|AL929014.28| Zebrafish DNA sequence from clone CH211-198B3 in linkage group 20
             Contains the gene for a novel protein similar to
             vertebrate fibronectin type III domain containing 1
             (FNDC1), the 5' end of the gene for a novel protein
             similar to vertebrate otoferlin (OTOF), a novel gene and
             two CpG islands, complete sequence
          Length = 163523

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 72    tcccagtggcccagttcttg 91
             ||||||||||||||||||||
Sbjct: 29080 tcccagtggcccagttcttg 29061

>gb|AF453394.1| Potato leafroll virus strain 14.2, complete genome
          Length = 5865

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 80   gcccagttcttgccagcaag 99
            ||||||||||||||||||||
Sbjct: 1502 gcccagttcttgccagcaag 1483


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,439,600
Number of Sequences: 3902068
Number of extensions: 1439600
Number of successful extensions: 24593
Number of sequences better than 10.0: 4
Number of HSP's better than 10.0 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 24589
Number of HSP's gapped (non-prelim): 4
length of query: 245
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 223
effective length of database: 17,147,199,772
effective search space: 3823825549156
effective search space used: 3823825549156
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)