| Clone Name | bags12o21 |
|---|---|
| Clone Library Name | barley_pub |
| No. | Definition | Score (bits) |
E Value |
1 | ref|XM_360348.1| Magnaporthe grisea 70-15 hypothetical protein (... | 40 | 3.2 | 2 | gb|AE006144.1| Pasteurella multocida subsp. multocida str. Pm70 ... | 40 | 3.2 | 3 | emb|AL929014.28| Zebrafish DNA sequence from clone CH211-198B3 i... | 40 | 3.2 | 4 | gb|AF453394.1| Potato leafroll virus strain 14.2, complete genome | 40 | 3.2 |
|---|
>ref|XM_360348.1| Magnaporthe grisea 70-15 hypothetical protein (MG05722.4) partial mRNA Length = 1965 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 71 atcccagtggcccagttctt 90 |||||||||||||||||||| Sbjct: 879 atcccagtggcccagttctt 898
>gb|AE006144.1| Pasteurella multocida subsp. multocida str. Pm70 section 111 of 204 of the complete genome Length = 11505 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 aaatttgcccatgtggatgc 70 |||||||||||||||||||| Sbjct: 5782 aaatttgcccatgtggatgc 5801
>emb|AL929014.28| Zebrafish DNA sequence from clone CH211-198B3 in linkage group 20 Contains the gene for a novel protein similar to vertebrate fibronectin type III domain containing 1 (FNDC1), the 5' end of the gene for a novel protein similar to vertebrate otoferlin (OTOF), a novel gene and two CpG islands, complete sequence Length = 163523 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 72 tcccagtggcccagttcttg 91 |||||||||||||||||||| Sbjct: 29080 tcccagtggcccagttcttg 29061
>gb|AF453394.1| Potato leafroll virus strain 14.2, complete genome Length = 5865 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 80 gcccagttcttgccagcaag 99 |||||||||||||||||||| Sbjct: 1502 gcccagttcttgccagcaag 1483 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,439,600 Number of Sequences: 3902068 Number of extensions: 1439600 Number of successful extensions: 24593 Number of sequences better than 10.0: 4 Number of HSP's better than 10.0 without gapping: 4 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 24589 Number of HSP's gapped (non-prelim): 4 length of query: 245 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 223 effective length of database: 17,147,199,772 effective search space: 3823825549156 effective search space used: 3823825549156 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)