ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal9i16
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|X75089.1|TAPETFFE Triticum aestivum petF gene for ferredoxin 242 4e-61
2gb|AC129929.5| Homo sapiens chromosome 11, clone RP5-1075F20, co... 44 0.18
3gb|AC091012.8| Homo sapiens chromosome 11, clone RP11-113A6, com... 44 0.18
4gb|AC002536.1|AC002536 Human Chromosome 11 pac pDJ1075f20, compl... 44 0.18
5gb|AC022893.6| Homo sapiens chromosome 8, clone RP11-531A24, com... 42 0.71
6gb|AC137589.2| Oryza sativa (japonica cultivar-group) chromosome... 42 0.71
7gb|AC144558.1| Oryza sativa (japonica cultivar-group) chromosome... 42 0.71
8dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 42 0.71
9emb|AL954814.17| Zebrafish DNA sequence from clone DKEY-79I1 in ... 42 0.71
10gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 42 0.71
11gb|L31356.1|PIGS0352MR Pig microsatellite (S0352) 42 0.71
12gb|AC166238.7| Mus musculus chromosome 1, clone RP23-469H11, com... 40 2.8
13gb|AC091787.6| Oryza sativa (japonica cultivar-group) chromosome... 40 2.8
14gb|AC146430.4| Pan troglodytes BAC clone RP43-21F8 from 7, compl... 40 2.8
15gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 40 2.8
16gb|AC107207.9| Oryza sativa chromosome 3 BAC OSJNBb0106M04 genom... 40 2.8
17gb|AC122375.4| Mus musculus BAC clone RP23-469G18 from chromosom... 40 2.8
18gb|AC132272.3| Mus musculus BAC clone RP24-339P23 from chromosom... 40 2.8
19gb|AC073600.3| Genomic sequence for Mus musculus, clone RP23-119... 40 2.8
20gb|AC152503.5| Mus musculus BAC clone RP23-190G10 from chromosom... 40 2.8
21emb|CR931763.8| Zebrafish DNA sequence from clone DKEY-65B12 in ... 40 2.8
22gb|AC159199.3| Mus musculus BAC clone RP23-401H23 from chromosom... 40 2.8
23emb|CR628406.8| Zebrafish DNA sequence from clone CH211-146A2 in... 40 2.8
24emb|AL662790.21| Mouse DNA sequence from clone RP23-53E2 on chro... 40 2.8
25emb|AL645764.15| Mouse DNA sequence from clone RP23-290B5 on chr... 40 2.8
26emb|AL683802.5| Mouse DNA sequence from clone RP23-247G3 on chro... 40 2.8
27emb|CR848813.6| Zebrafish DNA sequence from clone DKEY-260J20 in... 40 2.8
28dbj|AB192510.1| Sus scrofa genomic DNA, chromosome 7, BAC clone:... 40 2.8
29gb|AC025905.3| Oryza sativa (japonica cultivar-group) chromosome... 40 2.8
30gb|AC034258.10| Oryza sativa chromosome 10 BAC OSJNBb0011A08 gen... 40 2.8
31gb|AC157950.2| Mus musculus BAC clone RP23-128A23 from chromosom... 40 2.8
32dbj|AK048500.1| Mus musculus 16 days embryo head cDNA, RIKEN ful... 40 2.8
33gb|AC158658.4| Mus musculus 6 BAC RP23-400L4 (Roswell Park Cance... 40 2.8
34gb|AC004863.5|AC004863 Homo sapiens PAC clone RP4-708P22 from 7,... 40 2.8
35dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 40 2.8
36dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 2.8
37dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 2.8
38dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 40 2.8
39gb|AF325196.1|AF325196 Triticum aestivum PST19 (Pst19), LRR19 (L... 40 2.8
40gb|AC140675.5| Mus musculus BAC clone RP23-44J10 from chromosome... 40 2.8
41gb|AC133645.5| Mus musculus BAC clone RP23-73O10 from chromosome... 40 2.8
42gb|AC149590.5| Mus musculus BAC clone RP23-348L9 from chromosome... 40 2.8
43dbj|AP005450.3| Oryza sativa (japonica cultivar-group) genomic D... 40 2.8
44emb|AL929254.12| Mouse DNA sequence from clone RP23-456I1 on chr... 40 2.8
45dbj|AP004708.3| Oryza sativa (japonica cultivar-group) genomic D... 40 2.8
46dbj|AP004183.3| Oryza sativa (japonica cultivar-group) genomic D... 40 2.8
47gb|AC140442.4| Mus musculus BAC clone RP24-106P1 from 12, comple... 40 2.8
48gb|AC107631.20| Mus musculus chromosome 5, clone RP23-5M20, comp... 40 2.8
49gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 40 2.8
50emb|AL603787.8| Mouse DNA sequence from clone RP23-169J19 on chr... 40 2.8
51gb|AC171896.2| Capitella capitata clone JGIBGZA-33J12, complete ... 40 2.8
52gb|AC132305.3| Mus musculus BAC clone RP24-286A19 from 6, comple... 40 2.8
53gb|AC150035.3| Mus musculus BAC clone RP23-348A6 from 16, comple... 40 2.8
54emb|AL844846.11| Mouse DNA sequence from clone RP23-358I19 on ch... 40 2.8
55emb|AL844893.9| Mouse DNA sequence from clone RP23-355H24 on chr... 40 2.8
56emb|AL807793.7| Mouse DNA sequence from clone RP23-33N15 on chro... 40 2.8
57emb|AL671173.12| Mouse DNA sequence from clone RP23-426N4 on chr... 40 2.8
58emb|AL732513.8| Mouse DNA sequence from clone RP23-344B24 on chr... 40 2.8
59gb|AC136284.1| Genomic sequence for Oryza sativa, Nipponbare str... 40 2.8 
>emb|X75089.1|TAPETFFE Triticum aestivum petF gene for ferredoxin
          Length = 2244

 Score =  242 bits (122), Expect = 4e-61
 Identities = 140/146 (95%)
 Strand = Plus / Minus

                                                                        
Query: 15   gtacacgctagtattacgacagtagtatatcttacggtacaaaaaggtagtaattcgaag 74
            |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 2183 gtacacgctagtattacggcagtagtatatcttacggtacaaaaaggtagtaattcgaag 2124

                                                                        
Query: 75   acattattactggagcaaaccatgcatcgagcaattcattcgagcacaaacaaatcggtg 134
            ||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 2123 acattattacttgagcaaaccatgcatcgagcaattcattcgagcacaaacaattcggtg 2064

                                      
Query: 135  tatctggcgatatccatgcatgcatg 160
            |||||||| || ||| ||||||||||
Sbjct: 2063 tatctggcaatgtccgtgcatgcatg 2038
to top
>gb|AC129929.5| Homo sapiens chromosome 11, clone RP5-1075F20, complete sequence
          Length = 141449

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 144   atatccatgcatgcatgcatga 165
             ||||||||||||||||||||||
Sbjct: 17917 atatccatgcatgcatgcatga 17896
to top
>gb|AC091012.8| Homo sapiens chromosome 11, clone RP11-113A6, complete sequence
          Length = 145042

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 144   atatccatgcatgcatgcatga 165
             ||||||||||||||||||||||
Sbjct: 84955 atatccatgcatgcatgcatga 84976
to top
>gb|AC002536.1|AC002536 Human Chromosome 11 pac pDJ1075f20, complete sequence
          Length = 140977

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 144    atatccatgcatgcatgcatga 165
              ||||||||||||||||||||||
Sbjct: 123057 atatccatgcatgcatgcatga 123078
to top
>gb|AC022893.6| Homo sapiens chromosome 8, clone RP11-531A24, complete sequence
          Length = 175229

 Score = 42.1 bits (21), Expect = 0.71
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 149    catgcatgcatgcatgatggg 169
              |||||||||||||||||||||
Sbjct: 101224 catgcatgcatgcatgatggg 101244
to top
>gb|AC137589.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone
             OSJNBa0072L08, complete sequence
          Length = 152272

 Score = 42.1 bits (21), Expect = 0.71
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 145   tatccatgcatgcatgcatga 165
             |||||||||||||||||||||
Sbjct: 45828 tatccatgcatgcatgcatga 45808
to top
>gb|AC144558.1| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone
             OSJNBa0072L08, sequencing in progress, complete sequence
          Length = 152272

 Score = 42.1 bits (21), Expect = 0.71
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 145   tatccatgcatgcatgcatga 165
             |||||||||||||||||||||
Sbjct: 45828 tatccatgcatgcatgcatga 45808
to top
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 42.1 bits (21), Expect = 0.71
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 145      tatccatgcatgcatgcatga 165
                |||||||||||||||||||||
Sbjct: 21043513 tatccatgcatgcatgcatga 21043493
to top
>emb|AL954814.17| Zebrafish DNA sequence from clone DKEY-79I1 in linkage group 14,
             complete sequence
          Length = 175477

 Score = 42.1 bits (21), Expect = 0.71
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 144   atatccatgcatgcatgcatg 164
             |||||||||||||||||||||
Sbjct: 84102 atatccatgcatgcatgcatg 84122
to top
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 42.1 bits (21), Expect = 0.71
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 145      tatccatgcatgcatgcatga 165
                |||||||||||||||||||||
Sbjct: 21353754 tatccatgcatgcatgcatga 21353734
to top
>gb|L31356.1|PIGS0352MR Pig microsatellite (S0352)
          Length = 530

 Score = 42.1 bits (21), Expect = 0.71
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 160 gcatgatgggagataatatga 180
           |||||||||||||||||||||
Sbjct: 341 gcatgatgggagataatatga 321
to top
>gb|AC166238.7| Mus musculus chromosome 1, clone RP23-469H11, complete sequence
          Length = 181980

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 145   tatccatgcatgcatgcatg 164
             ||||||||||||||||||||
Sbjct: 96719 tatccatgcatgcatgcatg 96738
to top
>gb|AC091787.6| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0087G11,
              complete sequence
          Length = 169728

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 149    catgcatgcatgcatgatgg 168
              ||||||||||||||||||||
Sbjct: 139643 catgcatgcatgcatgatgg 139624
to top
>gb|AC146430.4| Pan troglodytes BAC clone RP43-21F8 from 7, complete sequence
          Length = 179251

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 145    tatccatgcatgcatgcatg 164
              ||||||||||||||||||||
Sbjct: 175193 tatccatgcatgcatgcatg 175174



 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 145    tatccatgcatgcatgcatg 164
              ||||||||||||||||||||
Sbjct: 175145 tatccatgcatgcatgcatg 175126
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 148      ccatgcatgcatgcatgatg 167
                ||||||||||||||||||||
Sbjct: 31504118 ccatgcatgcatgcatgatg 31504099



 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 149      catgcatgcatgcatgatgg 168
                ||||||||||||||||||||
Sbjct: 15910774 catgcatgcatgcatgatgg 15910793



 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 145      tatccatgcatgcatgcatg 164
                ||||||||||||||||||||
Sbjct: 13291181 tatccatgcatgcatgcatg 13291200
to top
>gb|AC107207.9| Oryza sativa chromosome 3 BAC OSJNBb0106M04 genomic sequence, complete
             sequence
          Length = 133449

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 148   ccatgcatgcatgcatgatg 167
             ||||||||||||||||||||
Sbjct: 88478 ccatgcatgcatgcatgatg 88497
to top
>gb|AC122375.4| Mus musculus BAC clone RP23-469G18 from chromosome 16, complete
             sequence
          Length = 189557

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 145   tatccatgcatgcatgcatg 164
             ||||||||||||||||||||
Sbjct: 90155 tatccatgcatgcatgcatg 90174
to top
>gb|AC132272.3| Mus musculus BAC clone RP24-339P23 from chromosome 16, complete
             sequence
          Length = 147166

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 144   atatccatgcatgcatgcat 163
             ||||||||||||||||||||
Sbjct: 50869 atatccatgcatgcatgcat 50888
to top
>gb|AC073600.3| Genomic sequence for Mus musculus, clone RP23-119A19, complete sequence
          Length = 197456

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 145   tatccatgcatgcatgcatg 164
             ||||||||||||||||||||
Sbjct: 33271 tatccatgcatgcatgcatg 33290
to top
>gb|AC152503.5| Mus musculus BAC clone RP23-190G10 from chromosome 16, complete sequence
          Length = 204940

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 144    atatccatgcatgcatgcat 163
              ||||||||||||||||||||
Sbjct: 191143 atatccatgcatgcatgcat 191162
to top
>emb|CR931763.8| Zebrafish DNA sequence from clone DKEY-65B12 in linkage group 5, complete
              sequence
          Length = 186739

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 145    tatccatgcatgcatgcatg 164
              ||||||||||||||||||||
Sbjct: 149974 tatccatgcatgcatgcatg 149993
to top
>gb|AC159199.3| Mus musculus BAC clone RP23-401H23 from chromosome 16, complete
             sequence
          Length = 218059

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 144   atatccatgcatgcatgcat 163
             ||||||||||||||||||||
Sbjct: 25026 atatccatgcatgcatgcat 25045
to top
>emb|CR628406.8| Zebrafish DNA sequence from clone CH211-146A2 in linkage group 11,
             complete sequence
          Length = 145678

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 148   ccatgcatgcatgcatgatg 167
             ||||||||||||||||||||
Sbjct: 48689 ccatgcatgcatgcatgatg 48708
to top
>emb|AL662790.21| Mouse DNA sequence from clone RP23-53E2 on chromosome 11 Contains the
             5' end of a novel pseudogene (similar to hypothetical
             protein TR:Q8C517), 3 novel pseudogenes (similar to
             hypothetical protein TR:Q8C517) and the 5' end of the
             Col1a1 gene for pro-collagen type I alpha 1, complete
             sequence
          Length = 133405

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 143   gatatccatgcatgcatgca 162
             ||||||||||||||||||||
Sbjct: 54804 gatatccatgcatgcatgca 54785
to top
>emb|AL645764.15| Mouse DNA sequence from clone RP23-290B5 on chromosome 11 Contains the 5'
              end of the gene for a novel protein (9330163N21Rik), a
              ribosomal protein S2 (Rps2) pseudogene, the gene for a
              novel protein (E130018012Rik), the gene for a novel protein
              (6820428D13Rik), the Mrpl27 gene for mitochondrial
              ribosomal protein L27, the Xylt2 gene for
              xylosyltransferase II, a novel gene (5330426M11Rik), the
              gene for a novel protein (C230057C09Rik), the gene for a
              novel protein similar to Cdc34 and two pseudogenes similar
              to hypothetical protein Tr:Q8C517, complete sequence
          Length = 203262

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 143    gatatccatgcatgcatgca 162
              ||||||||||||||||||||
Sbjct: 203190 gatatccatgcatgcatgca 203171
to top
>emb|AL683802.5| Mouse DNA sequence from clone RP23-247G3 on chromosome 11 Contains a
            novel pseudogene (similar to hypothetical protein
            TR:Q8C517) and the 3' end of a novel pseudogene (similar
            to hypothetical protein TR:Q8C517), complete sequence
          Length = 32978

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 143  gatatccatgcatgcatgca 162
            ||||||||||||||||||||
Sbjct: 1928 gatatccatgcatgcatgca 1909
to top
>emb|CR848813.6| Zebrafish DNA sequence from clone DKEY-260J20 in linkage group 5,
              complete sequence
          Length = 206722

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 145    tatccatgcatgcatgcatg 164
              ||||||||||||||||||||
Sbjct: 184486 tatccatgcatgcatgcatg 184467
to top
>dbj|AB192510.1| Sus scrofa genomic DNA, chromosome 7, BAC clone: L111D05, complete
             sequence
          Length = 150159

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 161   catgatgggagataatatga 180
             ||||||||||||||||||||
Sbjct: 74118 catgatgggagataatatga 74137
to top
>gb|AC025905.3| Oryza sativa (japonica cultivar-group) chromosome 10 clone nbxb0018F16,
              complete sequence
          Length = 179157

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 145    tatccatgcatgcatgcatg 164
              ||||||||||||||||||||
Sbjct: 169521 tatccatgcatgcatgcatg 169540
to top
>gb|AC034258.10| Oryza sativa chromosome 10 BAC OSJNBb0011A08 genomic sequence, complete
             sequence
          Length = 117157

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 145   tatccatgcatgcatgcatg 164
             ||||||||||||||||||||
Sbjct: 67450 tatccatgcatgcatgcatg 67431
to top
>gb|AC157950.2| Mus musculus BAC clone RP23-128A23 from chromosome 9, complete sequence
          Length = 202301

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 149   catgcatgcatgcatgatgg 168
             ||||||||||||||||||||
Sbjct: 36518 catgcatgcatgcatgatgg 36537
to top
>dbj|AK048500.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched
            library, clone:C130066J20 product:interleukin 10
            receptor, beta, full insert sequence
          Length = 4506

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 144  atatccatgcatgcatgcat 163
            ||||||||||||||||||||
Sbjct: 3326 atatccatgcatgcatgcat 3345
to top
>gb|AC158658.4| Mus musculus 6 BAC RP23-400L4 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 197909

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 149    catgcatgcatgcatgatgg 168
              ||||||||||||||||||||
Sbjct: 195137 catgcatgcatgcatgatgg 195118
to top
>gb|AC004863.5|AC004863 Homo sapiens PAC clone RP4-708P22 from 7, complete sequence
          Length = 133030

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 145   tatccatgcatgcatgcatg 164
             ||||||||||||||||||||
Sbjct: 77399 tatccatgcatgcatgcatg 77418



 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 145   tatccatgcatgcatgcatg 164
             ||||||||||||||||||||
Sbjct: 77169 tatccatgcatgcatgcatg 77188
to top
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 145      tatccatgcatgcatgcatg 164
                ||||||||||||||||||||
Sbjct: 16290632 tatccatgcatgcatgcatg 16290651
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 4        cgttgaattaagtacacgct 23
                ||||||||||||||||||||
Sbjct: 25685306 cgttgaattaagtacacgct 25685287



 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 145     tatccatgcatgcatgcatg 164
               ||||||||||||||||||||
Sbjct: 7747977 tatccatgcatgcatgcatg 7747996
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 145      tatccatgcatgcatgcatg 164
                ||||||||||||||||||||
Sbjct: 19328033 tatccatgcatgcatgcatg 19328014
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 148      ccatgcatgcatgcatgatg 167
                ||||||||||||||||||||
Sbjct: 31594634 ccatgcatgcatgcatgatg 31594615



 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 149      catgcatgcatgcatgatgg 168
                ||||||||||||||||||||
Sbjct: 15905308 catgcatgcatgcatgatgg 15905327



 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 145      tatccatgcatgcatgcatg 164
                ||||||||||||||||||||
Sbjct: 13287956 tatccatgcatgcatgcatg 13287975
to top
>gb|AF325196.1|AF325196 Triticum aestivum PST19 (Pst19), LRR19 (Lrr19), TAK19-1 (Tak19-1), and
             LRK19 (Lrk19) genes, complete cds
          Length = 35872

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 149   catgcatgcatgcatgatgg 168
             ||||||||||||||||||||
Sbjct: 33162 catgcatgcatgcatgatgg 33181
to top
>gb|AC140675.5| Mus musculus BAC clone RP23-44J10 from chromosome 5, complete sequence
          Length = 229269

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 146    atccatgcatgcatgcatga 165
              ||||||||||||||||||||
Sbjct: 217426 atccatgcatgcatgcatga 217445
to top
>gb|AC133645.5| Mus musculus BAC clone RP23-73O10 from chromosome 5, complete sequence
          Length = 207846

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 146   atccatgcatgcatgcatga 165
             ||||||||||||||||||||
Sbjct: 33420 atccatgcatgcatgcatga 33439
to top
>gb|AC149590.5| Mus musculus BAC clone RP23-348L9 from chromosome 5, complete sequence
          Length = 196662

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 145    tatccatgcatgcatgcatg 164
              ||||||||||||||||||||
Sbjct: 124182 tatccatgcatgcatgcatg 124163
to top
>dbj|AP005450.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0438E12
          Length = 146851

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 145   tatccatgcatgcatgcatg 164
             ||||||||||||||||||||
Sbjct: 32806 tatccatgcatgcatgcatg 32787
to top
>emb|AL929254.12| Mouse DNA sequence from clone RP23-456I1 on chromosome 2, complete
              sequence
          Length = 222104

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 145    tatccatgcatgcatgcatg 164
              ||||||||||||||||||||
Sbjct: 221045 tatccatgcatgcatgcatg 221026
to top
>dbj|AP004708.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0700D12
          Length = 145177

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 4     cgttgaattaagtacacgct 23
             ||||||||||||||||||||
Sbjct: 63054 cgttgaattaagtacacgct 63035
to top
>dbj|AP004183.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1221_H04
          Length = 129387

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 145   tatccatgcatgcatgcatg 164
             ||||||||||||||||||||
Sbjct: 88700 tatccatgcatgcatgcatg 88719
to top
>gb|AC140442.4| Mus musculus BAC clone RP24-106P1 from 12, complete sequence
          Length = 153574

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 145   tatccatgcatgcatgcatg 164
             ||||||||||||||||||||
Sbjct: 71095 tatccatgcatgcatgcatg 71114
to top
>gb|AC107631.20| Mus musculus chromosome 5, clone RP23-5M20, complete sequence
          Length = 225977

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 145    tatccatgcatgcatgcatg 164
              ||||||||||||||||||||
Sbjct: 189753 tatccatgcatgcatgcatg 189772
to top
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 145      tatccatgcatgcatgcatg 164
                ||||||||||||||||||||
Sbjct: 16298874 tatccatgcatgcatgcatg 16298893
to top
>emb|AL603787.8| Mouse DNA sequence from clone RP23-169J19 on chromosome 11 Contains the
             3' end of a novel gene, the gene for a novel protein
             similar to nascent polypeptide-associated complex alpha
             polypeptide Naca, the Tbrg4 gene for transforming growth
             factor beta regulated gene 4, the Wap gene for whey acidic
             protein, an ethanol induced 6 (Etohi6) pseudogene, two
             novel genes, the Ramp3 gene for receptor (calcitonin)
             activity modifying protein 3, a lactate dehydrogenase 1 A
             chain (Ldh1) pseudogene, a mitochondrial ribosomal protein
             L36 (Mrpl36) pseudogene, a retinoblastoma binding protein
             5 (Rbbp5) pseudogene, a ribosomal protein L7A (Rpl7a)
             pseudogene and two CpG islands, complete sequence
          Length = 225879

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 145   tatccatgcatgcatgcatg 164
             ||||||||||||||||||||
Sbjct: 67250 tatccatgcatgcatgcatg 67269
to top
>gb|AC171896.2| Capitella capitata clone JGIBGZA-33J12, complete sequence
          Length = 31338

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 145   tatccatgcatgcatgcatg 164
             ||||||||||||||||||||
Sbjct: 25853 tatccatgcatgcatgcatg 25834
to top
>gb|AC132305.3| Mus musculus BAC clone RP24-286A19 from 6, complete sequence
          Length = 187465

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 149   catgcatgcatgcatgatgg 168
             ||||||||||||||||||||
Sbjct: 73987 catgcatgcatgcatgatgg 74006
to top
>gb|AC150035.3| Mus musculus BAC clone RP23-348A6 from 16, complete sequence
          Length = 188444

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 144    atatccatgcatgcatgcat 163
              ||||||||||||||||||||
Sbjct: 104441 atatccatgcatgcatgcat 104460
to top
>emb|AL844846.11| Mouse DNA sequence from clone RP23-358I19 on chromosome 2, complete
             sequence
          Length = 209013

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 145   tatccatgcatgcatgcatg 164
             ||||||||||||||||||||
Sbjct: 72638 tatccatgcatgcatgcatg 72619
to top
>emb|AL844893.9| Mouse DNA sequence from clone RP23-355H24 on chromosome 2, complete
             sequence
          Length = 175570

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 144   atatccatgcatgcatgcat 163
             ||||||||||||||||||||
Sbjct: 30736 atatccatgcatgcatgcat 30755
to top
>emb|AL807793.7| Mouse DNA sequence from clone RP23-33N15 on chromosome 2, complete
             sequence
          Length = 221903

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 144   atatccatgcatgcatgcat 163
             ||||||||||||||||||||
Sbjct: 30538 atatccatgcatgcatgcat 30557
to top
>emb|AL671173.12| Mouse DNA sequence from clone RP23-426N4 on chromosome 4, complete
              sequence
          Length = 201741

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 145    tatccatgcatgcatgcatg 164
              ||||||||||||||||||||
Sbjct: 180309 tatccatgcatgcatgcatg 180328
to top
>emb|AL732513.8| Mouse DNA sequence from clone RP23-344B24 on chromosome 2, complete
             sequence
          Length = 209452

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 145   tatccatgcatgcatgcatg 164
             ||||||||||||||||||||
Sbjct: 91110 tatccatgcatgcatgcatg 91129
to top
>gb|AC136284.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OJ1739D07,
             from chromosome 3, complete sequence
          Length = 149539

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 145   tatccatgcatgcatgcatg 164
             ||||||||||||||||||||
Sbjct: 28660 tatccatgcatgcatgcatg 28641


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,591,408
Number of Sequences: 3902068
Number of extensions: 1591408
Number of successful extensions: 146401
Number of sequences better than 10.0: 59
Number of HSP's better than 10.0 without gapping: 64
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 144606
Number of HSP's gapped (non-prelim): 1789
length of query: 220
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 198
effective length of database: 17,147,199,772
effective search space: 3395145554856
effective search space used: 3395145554856
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top