ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags13c12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_549952.1| Oryza sativa (japonica cultivar-group), mRNA 52 0.002
2gb|AY603953.1| Oryza longistaminata isolate 101198 T8R-2 locus g... 52 0.002
3gb|AY603952.1| Oryza longistaminata isolate 81968 T8R-2 locus ge... 52 0.002
4gb|AY603951.1| Oryza glumipatula isolate 100971 T8R-2 locus geno... 52 0.002
5gb|AY603950.1| Oryza rufipogon isolate 104642 T8R-2 locus genomi... 52 0.002
6gb|AY603948.1| Oryza meridionalis isolate 105281 transposon T8R-... 52 0.002
7gb|AY603947.1| Oryza meridionalis isolate 101146 transposon T8R-... 52 0.002
8gb|AY603945.1| Oryza barthii isolate 101252 transposon T8R-2, co... 52 0.002
9gb|AY603943.1| Oryza nivara isolate 105703 transposon T8R-2, com... 52 0.002
10gb|AY603942.1| Oryza nivara isolate 101508 transposon T8R-2, com... 52 0.002
11gb|AY603941.1| Oryza sativa isolate 42576 transposon T8R-2, comp... 52 0.002
12gb|AY603940.1| Oryza sativa isolate 754 transposon T8R-2, comple... 52 0.002
13gb|AY603939.1| Oryza sativa isolate 244 transposon T8R-2, comple... 52 0.002
14gb|AY603938.1| Oryza sativa isolate 7288 transposon T8R-2, compl... 52 0.002
15emb|AJ437346.1|OSA437346 Oryza sativa mRNA translation initiatio... 52 0.002
16dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
17dbj|AP002868.1| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
18dbj|AP002487.1| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
19dbj|AK122166.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.002
20dbj|AK072604.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.002
21gb|AF235097.2| Homo sapiens chromosome X multiple clones map p11... 50 0.010
22ref|NM_033215.3| Homo sapiens protein phosphatase 1, regulatory ... 50 0.010
23dbj|AK056909.1| Homo sapiens cDNA FLJ32347 fis, clone PROST20069... 50 0.010
24gb|AY603954.1| Oryza longistaminata isolate 101205 T8R-2 locus g... 48 0.038
25gb|AY603949.1| Oryza meridionalis isolate 105283 transposon T8R-... 48 0.038
26gb|AY603946.1| Oryza barthii isolate 104286 transposon T8R-2, co... 48 0.038
27gb|AY603944.1| Oryza glaberrima isolate 104562 transposon T8R-2,... 48 0.038
28gb|AY810151.1| Schistosoma japonicum SJCHGC07130 protein mRNA, p... 48 0.038
29dbj|AK106560.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.038
30emb|AL158055.12| Human DNA sequence from clone RP11-348F1 on chr... 46 0.15
31dbj|AP001800.2| Oryza sativa (japonica cultivar-group) genomic D... 46 0.15
32ref|NM_193664.1| Oryza sativa (japonica cultivar-group), predic... 44 0.59
33gb|AC148990.6| Mus musculus BAC clone RP24-466N11 from chromosom... 44 0.59
34ref|XM_617555.2| PREDICTED: Bos taurus similar to nuclear recept... 44 0.59
35gb|BC064764.1| Mus musculus forkhead box P1, mRNA (cDNA clone MG... 44 0.59
36ref|XM_755880.1| Ustilago maydis 521 hypothetical protein (UM048... 44 0.59
37ref|XM_860376.1| PREDICTED: Canis familiaris similar to RNA-bind... 44 0.59
38ref|XM_860358.1| PREDICTED: Canis familiaris similar to RNA-bind... 44 0.59
39ref|XM_847210.1| PREDICTED: Canis familiaris similar to RNA-bind... 44 0.59
40ref|XM_746375.1| Aspergillus fumigatus Af293 hypothetical protei... 44 0.59
41gb|AC125137.3| Mus musculus BAC clone RP24-324K9 from chromosome... 44 0.59
42ref|NM_053202.1| Mus musculus forkhead box P1 (Foxp1), mRNA 44 0.59
43dbj|AP004611.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.59
44dbj|AK139831.1| Mus musculus 2 cells egg cDNA, RIKEN full-length... 44 0.59
45gb|AC151733.5| Mus musculus BAC clone RP23-89N20 from chromosome... 44 0.59
46dbj|AK077062.1| Mus musculus adult male testis cDNA, RIKEN full-... 44 0.59
47gb|AF339104.1|AF339104 Mus musculus forkhead-related transcripti... 44 0.59
48gb|AF339103.1|AF339103 Mus musculus forkhead-related transcripti... 44 0.59
49dbj|AK033368.1| Mus musculus 16 days embryo lung cDNA, RIKEN ful... 44 0.59
50gb|AC155839.4| Mus musculus 6 BAC RP24-96J4 (Roswell Park Cancer... 44 0.59
51dbj|AB221602.1| Mus musculus cDNA pooled tissues:(tissue_type=br... 44 0.59
52dbj|AB221601.1| Mus musculus cDNA pooled tissues:(tissue_type=br... 44 0.59
53dbj|AP003276.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.59
54ref|NM_129548.2| Arabidopsis thaliana zinc ion binding AT2G39900... 42 2.3
55gb|AC163689.3| Mus musculus BAC clone CH36-200G6 from chromosome... 42 2.3
56gb|AC102124.16| Mus musculus chromosome 18, clone RP23-188D1, co... 42 2.3
57ref|XM_422955.1| PREDICTED: Gallus gallus similar to KIAA1609 pr... 42 2.3
58ref|XM_322125.1| Neurospora crassa OR74A hypothetical protein (N... 42 2.3
59gb|AC147021.3| Pan troglodytes BAC clone RP43-85B14 from 7, comp... 42 2.3
60ref|XM_951058.1| Neurospora crassa OR74A hypothetical protein (N... 42 2.3
61ref|NM_145614.2| Mus musculus dihydrolipoamide S-acetyltransfera... 42 2.3
62gb|AC148920.1| Mus musculus BAC clone RP23-273O10 from chromosom... 42 2.3
63gb|AC110230.12| Mus musculus chromosome 6, clone RP23-54L18, com... 42 2.3
64gb|BC059275.1| Mus musculus protein phosphatase 1, regulatory (i... 42 2.3
65ref|XM_548997.2| PREDICTED: Canis familiaris similar to protein ... 42 2.3
66ref|XM_619554.3| PREDICTED: Mus musculus lipoxygenase homology d... 42 2.3
67ref|XM_973146.1| PREDICTED: Mus musculus lipoxygenase homology d... 42 2.3
68ref|XM_916184.2| PREDICTED: Mus musculus lipoxygenase homology d... 42 2.3
69gb|AC006317.3| Homo sapiens PAC clone RP4-715F13 from 7, complet... 42 2.3
70gb|AC118227.12| Mus musculus chromosome 15, clone RP23-379H6, co... 42 2.3
71emb|AJ578520.1|EGU578520 Elaeis guineensis microsatellite DNA, c... 42 2.3
72emb|BX901973.12| Zebrafish DNA sequence from clone DKEY-26L17 in... 42 2.3
73emb|Z79754.1|CEF25H2 Caenorhabditis elegans Cosmid F25H2, comple... 42 2.3
74ref|NM_001030575.1| Gallus gallus similar to KIAA1609 protein (L... 42 2.3
75gb|BC069862.1| Mus musculus dihydrolipoamide S-acetyltransferase... 42 2.3
76emb|AJ720309.1| Gallus gallus mRNA for hypothetical protein, clo... 42 2.3
77gb|AC153131.5| Mus musculus BAC clone RP24-356O12 from chromosom... 42 2.3
78gb|AY122901.1| Arabidopsis thaliana At2g39900/T28M21.6 mRNA, com... 42 2.3
79gb|AE012146.1| Xanthomonas campestris pv. campestris str. ATCC 3... 42 2.3
80gb|AY094448.1| Arabidopsis thaliana At2g39900/T28M21.6 mRNA, com... 42 2.3
81gb|AF002109.3| Arabidopsis thaliana chromosome 2 clone T28M21 ma... 42 2.3
82dbj|AK137960.1| Mus musculus 16 days neonate thymus cDNA, RIKEN ... 42 2.3
83gb|AY044265.1| Mus musculus dihydrolipoamide S-acetyltransferase... 42 2.3
84dbj|AK166090.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-... 42 2.3
85gb|AC154550.2| Mus musculus BAC clone RP23-444H18 from chromosom... 42 2.3
86dbj|AK032124.1| Mus musculus adult male medulla oblongata cDNA, ... 42 2.3
87gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 42 2.3
88ref|NM_060365.3| Caenorhabditis elegans F25H2.10 (deoxyribonucle... 42 2.3
89dbj|AK030047.1| Mus musculus adult male testis cDNA, RIKEN full-... 42 2.3
90dbj|AK043771.1| Mus musculus 10 days neonate cortex cDNA, RIKEN ... 42 2.3
91gb|AF229644.1|AF229644 Mus musculus DXImx48e protein (DXImx48e) ... 42 2.3
92gb|AC023545.16| Homo sapiens chromosome 15, clone RP11-665J16, c... 42 2.3
93emb|BX842049.1|CNS09Y98 Arabidopsis thaliana Full-length cDNA Co... 42 2.3
94gb|AC010931.17| Homo sapiens chromosome 15, clone RP11-247C2, co... 42 2.3
95gb|AF277994.1|AF277994 Mus musculus scurfin (Foxp3) gene, comple... 42 2.3
96gb|AC007100.3| Homo sapiens BAC clone RP11-462D13 from 2, comple... 42 2.3
97ref|NM_204237.1| Gallus gallus transducin-like enhancer of split... 42 2.3
98ref|NM_138605.1| Mus musculus protein phosphatase 1, regulatory ... 42 2.3
99ref|XM_343775.2| PREDICTED: Rattus norvegicus similar to DXImx48... 42 2.3
100gb|U82806.1|XMU82806 Xiphophorus maculatus melanoma receptor tyr... 42 2.3
101emb|AL928812.11| Mouse DNA sequence from clone RP23-321B23 on ch... 42 2.3
102gb|AC155259.1| Mus musculus BAC clone RP24-70C15 from 9, complet... 42 2.3
103gb|BC026680.1| Mus musculus dihydrolipoamide S-acetyltransferase... 42 2.3
104dbj|AB080584.1| Gallus gallus Grg4 mRNA for groucho-related gene... 42 2.3
105dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, comp... 42 2.3
106emb|AL731793.18| Mouse DNA sequence from clone RP23-135F22 on ch... 42 2.3
107gb|BC060320.1| Homo sapiens transducin (beta)-like 1X-linked rec... 40 9.2
108gb|AY304002.1| Ovis aries prion protein gene, partial cds 40 9.2
109gb|AY320375.1| Bos taurus prion protein gene, partial cds 40 9.2
110gb|AY320373.1| Bos taurus prion protein gene, partial cds 40 9.2
111gb|AY320372.1| Bos taurus prion protein gene, partial cds 40 9.2
112gb|AY320370.1| Bos taurus prion protein gene, partial cds 40 9.2
113gb|AY320369.1| Bos taurus prion protein gene, partial cds 40 9.2
114gb|AY320368.1| Bos taurus prion protein gene, partial cds 40 9.2
115gb|AY320367.1| Bos taurus prion protein gene, partial cds 40 9.2
116gb|AY320366.1| Bos taurus prion protein gene, partial cds 40 9.2
117gb|AY769958.1| Bison bison prion protein PrP (Prnp) gene, intron... 40 9.2
118gb|AY769957.1| Ovis canadensis canadensis prion protein PrP (Prn... 40 9.2
119gb|AY769955.1| Capreolus capreolus prion protein PrP (Prnp) gene... 40 9.2
120gb|DQ205538.1| Bos taurus prion protein (PRNP) and prion-like pr... 40 9.2
121ref|NM_128172.2| Arabidopsis thaliana FTSH4; ATP-dependent pepti... 40 9.2
122gb|AY769894.1| Bubalus bubalis prion protein (Prp) mRNA, partial... 40 9.2
123gb|AY423026.1| Danio rerio dystrobrevin, beta (DTNB) mRNA, compl... 40 9.2
124gb|AC168217.2| Mus musculus BAC clone RP24-498P8 from chromosome... 40 9.2
125ref|XM_520248.1| PREDICTED: Pan troglodytes similar to nuclear r... 40 9.2
126gb|AC154392.18| Mus musculus chromosome 1, clone RP23-413K6, com... 40 9.2
127ref|XM_526387.1| PREDICTED: Pan troglodytes similar to nuclear r... 40 9.2
128ref|NM_024665.3| Homo sapiens transducin (beta)-like 1X-linked r... 40 9.2
129gb|AY768534.1| Bubalus bubalis isolate JW42_2 prion protein (PRN... 40 9.2
130gb|AY768533.1| Bubalus bubalis isolate JW42_1 prion protein (PRN... 40 9.2
131gb|AY720706.1| Antilope cervicapra isolate BlackbuckhomoB prion ... 40 9.2
132gb|AY720705.1| Antilope cervicapra isolate BlackbuckhomoA prion ... 40 9.2
133gb|AY720704.1| Tragelaphus imberbis isolate Z14HomoB prion prote... 40 9.2
134gb|AY720703.1| Tragelaphus imberbis isolate Z14HomoA prion prote... 40 9.2
135gb|AY720698.1| Bos gaurus isolate GaurhomoB prion protein (PRNP)... 40 9.2
136gb|AY720697.1| Bos gaurus isolate GaurhomoA prion protein (PRNP)... 40 9.2
137gb|AY720696.1| Bison bison isolate CR227All1 prion protein (PRNP... 40 9.2
138gb|AY720695.1| Bison bison isolate CR227All2 prion protein (PRNP... 40 9.2
139gb|AY720694.1| Bos javanicus isolate TWBt2 prion protein (PRNP) ... 40 9.2
140gb|AY720693.1| Bos javanicus isolate TWBt6 prion protein (PRNP) ... 40 9.2
141gb|AY720692.1| Bos javanicus isolate Bt478-2 prion protein (PRNP... 40 9.2
142gb|AY720691.1| Bos javanicus isolate Bt478-1 prion protein (PRNP... 40 9.2
143gb|AY720690.1| Bubalus bubalis isolate JW41_2 prion protein (PRN... 40 9.2
144gb|AY720689.1| Bubalus bubalis isolate JW41_1 prion protein (PRN... 40 9.2
145gb|AY720688.1| Bubalus depressicornis isolate Ano2 prion protein... 40 9.2
146gb|AY720687.1| Bubalus depressicornis isolate Ano1 prion protein... 40 9.2
147gb|AY720686.1| Syncerus caffer caffer isolate Z17-7 prion protei... 40 9.2
148gb|AY720685.1| Syncerus caffer caffer isolate Z17-1 prion protei... 40 9.2
149gb|AY720684.1| Syncerus caffer nanus isolate Z18-2 prion protein... 40 9.2
150gb|AY720683.1| Syncerus caffer nanus isolate Z18-1 prion protein... 40 9.2
151gb|AY720682.1| Bos indicus isolate 24Brahman2 prion protein (PRN... 40 9.2
152gb|AY720681.1| Bos indicus isolate 27Brahmousin2 prion protein (... 40 9.2
153gb|AY720680.1| Bos indicus isolate 24Brahman1 prion protein (PRN... 40 9.2
154gb|AY720679.1| Bos indicus isolate 27Brahmousin1 prion protein (... 40 9.2
155gb|AY720678.1| Bos taurus isolate 52SalersB prion protein (PRNP)... 40 9.2
156gb|AY720677.1| Bos taurus isolate 52SalersA prion protein (PRNP)... 40 9.2
157gb|AY720676.1| Bos taurus isolate 56BelgianBlueB prion protein (... 40 9.2
158gb|AY720675.1| Bos taurus isolate 56BelgianBlueA prion protein (... 40 9.2
159gb|AY720674.1| Bos taurus isolate 40Brwnsws1 prion protein (PRNP... 40 9.2
160gb|AY720673.1| Bos taurus isolate Brownswiss41.7 prion protein (... 40 9.2
161gb|AY720672.1| Bos taurus isolate Brownswiss39.3 prion protein (... 40 9.2
162gb|AY720671.1| Bos taurus isolate 53SalersB prion protein (PRNP)... 40 9.2
163gb|AY720670.1| Bos taurus isolate 53SalersA prion protein (PRNP)... 40 9.2
164gb|AY720669.1| Bos taurus isolate Branvieh37.3 prion protein (PR... 40 9.2
165gb|AY720668.1| Bos taurus isolate Charolais45.7 prion protein (P... 40 9.2
166gb|AY720667.1| Bos taurus isolate 59GelbviehFB1 prion protein (P... 40 9.2
167gb|AY720666.1| Bos indicus isolate IndiaNelore12B prion protein ... 40 9.2
168gb|AY720665.1| Bos indicus isolate IndiaNelore12A prion protein ... 40 9.2
169gb|AY720664.1| Bos taurus isolate Braunvieh37.1 prion protein (P... 40 9.2
170gb|AY720663.1| Bos taurus isolate 58CorrienteB prion protein (PR... 40 9.2
171gb|AY720662.1| Bos taurus isolate 58CorrienteA prion protein (PR... 40 9.2
172gb|AY720661.1| Bos indicus isolate 19BrafordB prion protein (PRN... 40 9.2
173gb|AY720660.1| Bos indicus isolate 19BrafordA prion protein (PRN... 40 9.2
174gb|AY720659.1| Bos indicus isolate 98RomagnolaB prion protein (P... 40 9.2
175gb|AY720658.1| Bos indicus isolate 98RomagnolaA prion protein (P... 40 9.2
176gb|AY720657.1| Bos taurus isolate 84MaineAnjouB prion protein (P... 40 9.2
177gb|AY720656.1| Bos taurus isolate 84MaineAnjouA prion protein (P... 40 9.2
178gb|AY720655.1| Bos taurus isolate 71GelbviehB prion protein (PRN... 40 9.2
179gb|AY720654.1| Bos taurus isolate 71GelbviehA prion protein (PRN... 40 9.2
180gb|AY720653.1| Bos taurus isolate 70GelbviehB prion protein (PRN... 40 9.2
181gb|AY720652.1| Bos taurus isolate 70GelbviehA prion protein (PRN... 40 9.2
182gb|AY720651.1| Bos taurus isolate 57BlondDAqtnB prion protein (P... 40 9.2
183gb|AY720650.1| Bos taurus isolate 57BlondDAqtnA prion protein (P... 40 9.2
184gb|AY720649.1| Bos taurus isolate 50LonghornB prion protein (PRN... 40 9.2
185gb|AY720648.1| Bos taurus isolate 50LonghornA prion protein (PRN... 40 9.2
186gb|AY720647.1| Bos indicus isolate 11BeefmasterB prion protein (... 40 9.2
187gb|AY720646.1| Bos indicus isolate 11BeefmasterA prion protein (... 40 9.2
188gb|AY720645.1| Bos taurus isolate 117SimmentalBKB prion protein ... 40 9.2
189gb|AY720644.1| Bos taurus isolate 117SimmentalBKA prion protein ... 40 9.2
190gb|AY720643.1| Bos taurus isolate 114SimmentalRDB prion protein ... 40 9.2
191gb|AY720642.1| Bos taurus isolate 114SimmentalRDA prion protein ... 40 9.2
192gb|AY720641.1| Bos taurus isolate 80Limousin2 prion protein (PRN... 40 9.2
193gb|AY720640.1| Bos taurus isolate 80Limousin1 prion protein (PRN... 40 9.2
194gb|AY720639.1| Bos indicus isolate 112SimbrahB prion protein (PR... 40 9.2
195gb|AY720638.1| Bos indicus isolate 112SimbrahA prion protein (PR... 40 9.2
196gb|AY720637.1| Bos taurus isolate 113SimmentalRDB prion protein ... 40 9.2
197gb|AY720636.1| Bos taurus isolate 113SimmentalRDA prion protein ... 40 9.2
198gb|AY720635.1| Bos taurus isolate 116SimmentalRDB prion protein ... 40 9.2
199gb|AY720634.1| Bos taurus isolate 116SimmentalRDA prion protein ... 40 9.2
200gb|AY720633.1| Bos taurus isolate 118SimmentalBKB prion protein ... 40 9.2
201gb|AY720632.1| Bos taurus isolate 118SimmentalBKA prion protein ... 40 9.2
202gb|AY720631.1| Bos taurus isolate 119SimmentalBKB prion protein ... 40 9.2
203gb|AY720630.1| Bos taurus isolate 119SimmentalBKA prion protein ... 40 9.2
204gb|AY720629.1| Bos taurus isolate 120SimmentalBKB prion protein ... 40 9.2
205gb|AY720628.1| Bos taurus isolate 120SimmentalBKA prion protein ... 40 9.2
206gb|AY720627.1| Bos taurus isolate 126A3XCrossB prion protein (PR... 40 9.2
207gb|AY720626.1| Bos taurus isolate 126A3XCrossA prion protein (PR... 40 9.2
208gb|AY720625.1| Bos taurus isolate 13BelgianBlueB prion protein (... 40 9.2
209gb|AY720624.1| Bos taurus isolate 13BelgianBlueA prion protein (... 40 9.2
210gb|AY720623.1| Bos taurus isolate 14BelgianBlueB prion protein (... 40 9.2
211gb|AY720622.1| Bos taurus isolate 14BelgianBlueA prion protein (... 40 9.2
212gb|AY720621.1| Bos indicus isolate 21BrafordB prion protein (PRN... 40 9.2
213gb|AY720620.1| Bos indicus isolate 21BrafordA prion protein (PRN... 40 9.2
214gb|AY720619.1| Bos indicus isolate 22BrafordB prion protein (PRN... 40 9.2
215gb|AY720618.1| Bos indicus isolate 22BrafordA prion protein (PRN... 40 9.2
216gb|AY720617.1| Bos indicus isolate 25BrahmanB prion protein (PRN... 40 9.2
217gb|AY720616.1| Bos indicus isolate 25BrahmanA prion protein (PRN... 40 9.2
218gb|AY720615.1| Bos indicus isolate 32BrangusB prion protein (PRN... 40 9.2
219gb|AY720614.1| Bos indicus isolate 32BrangusA prion protein (PRN... 40 9.2
220gb|AY720613.1| Bos taurus isolate 47CharolaisB prion protein (PR... 40 9.2
221gb|AY720612.1| Bos taurus isolate 47CharolaisA prion protein (PR... 40 9.2
222gb|AY720611.1| Bos taurus isolate 55TarentaiseB prion protein (P... 40 9.2
223gb|AY720610.1| Bos taurus isolate 55TarentaiseA prion protein (P... 40 9.2
224gb|AY720609.1| Bos taurus isolate 5AngusB prion protein (PRNP) g... 40 9.2
225gb|AY720608.1| Bos taurus isolate 5AngusA prion protein (PRNP) g... 40 9.2
226gb|AY720607.1| Bos taurus isolate 60MurrayGreyB prion protein (P... 40 9.2
227gb|AY720606.1| Bos taurus isolate 60MurrayGreyA prion protein (P... 40 9.2
228gb|AY720605.1| Bos taurus isolate 66ChianinaChiaB prion protein ... 40 9.2
229gb|AY720604.1| Bos taurus isolate 66ChianinaChiaA prion protein ... 40 9.2
230gb|AY720603.1| Bos taurus isolate 67ChianinaChiaB prion protein ... 40 9.2
231gb|AY720602.1| Bos taurus isolate 67ChianinaChiaA prion protein ... 40 9.2
232gb|AY720601.1| Bos taurus isolate 69GelbviehB prion protein (PRN... 40 9.2
233gb|AY720600.1| Bos taurus isolate 69GelbviehA prion protein (PRN... 40 9.2
234gb|AY720599.1| Bos taurus X Bison bison isolate 6BeefaloB prion ... 40 9.2
235gb|AY720598.1| Bos taurus X Bison bison isolate 6BeefaloA prion ... 40 9.2
236gb|AY720597.1| Bos taurus isolate 73HolsteinB prion protein (PRN... 40 9.2
237gb|AY720596.1| Bos taurus isolate 73HolsteinA prion protein (PRN... 40 9.2
238gb|AY720595.1| Bos taurus isolate 76HolsteinB prion protein (PRN... 40 9.2
239gb|AY720594.1| Bos taurus isolate 76HolsteinA prion protein (PRN... 40 9.2
240gb|AY720593.1| Bos indicus isolate 7BeefmasterB prion protein (P... 40 9.2
241gb|AY720592.1| Bos indicus isolate 7BeefmasterA prion protein (P... 40 9.2
242gb|AY720591.1| Bos taurus isolate 83MneAnjou1 prion protein (PRN... 40 9.2
243gb|AY720590.1| Bos indicus isolate 88PiedmonteseB prion protein ... 40 9.2
244gb|AY720589.1| Bos indicus isolate 88PiedmonteseA prion protein ... 40 9.2
245gb|AY720588.1| Bos taurus isolate Brownswiss39.2 prion protein (... 40 9.2
246gb|AY720587.1| Bos indicus isolate 86USNeloreB prion protein (PR... 40 9.2
247gb|AY720586.1| Bos indicus isolate 86USNeloreA prion protein (PR... 40 9.2
248gb|AY720584.1| Bos taurus isolate 62ScottishHighldB prion protei... 40 9.2
249gb|AY720583.1| Bos taurus isolate 62ScottishHighldA prion protei... 40 9.2
250gb|AY720582.1| Bos taurus isolate 108ShorthornB prion protein (P... 40 9.2
251gb|AY720581.1| Bos taurus isolate 108ShorthornA prion protein (P... 40 9.2
252gb|AY720580.1| Bos indicus isolate 9BeefmasterB prion protein (P... 40 9.2
253gb|AY720579.1| Bos indicus isolate 9BeefmasterA prion protein (P... 40 9.2
254gb|AY720578.1| Bos indicus isolate 99SantaGertrudB prion protein... 40 9.2
255gb|AY720577.1| Bos indicus isolate 99SantaGertrudA prion protein... 40 9.2
256gb|AY720576.1| Bos indicus isolate 95RedBrangusB prion protein (... 40 9.2
257gb|AY720575.1| Bos indicus isolate 95RedBrangusA prion protein (... 40 9.2
258gb|AY720574.1| Bos taurus isolate 92RedAngusB prion protein (PRN... 40 9.2
259gb|AY720573.1| Bos taurus isolate 92RedAngusA prion protein (PRN... 40 9.2
260gb|AY720572.1| Bos taurus isolate 68ChianinaChiaB prion protein ... 40 9.2
261gb|AY720571.1| Bos taurus isolate 68ChianinaChiaA prion protein ... 40 9.2
262gb|AY720570.1| Bos taurus isolate 51MurrayGreyB prion protein (P... 40 9.2
263gb|AY720569.1| Bos taurus isolate 51MurrayGreyA prion protein (P... 40 9.2
264gb|AY720568.1| Bos taurus isolate 4AngusB prion protein (PRNP) g... 40 9.2
265gb|AY720567.1| Bos taurus isolate 4AngusA prion protein (PRNP) g... 40 9.2
266gb|AY720566.1| Bos taurus isolate 44CharolaisB prion protein (PR... 40 9.2
267gb|AY720565.1| Bos taurus isolate 44CharolaisA prion protein (PR... 40 9.2
268gb|AY720564.1| Bos taurus isolate 125A3XCrossB prion protein (PR... 40 9.2
269gb|AY720563.1| Bos taurus isolate 125A3XCrossA prion protein (PR... 40 9.2
270gb|AY720562.1| Bos taurus isolate 115SimmentalRDB prion protein ... 40 9.2
271gb|AY720561.1| Bos taurus isolate 115SimmentalRDA prion protein ... 40 9.2
272gb|AY720560.1| Bos taurus isolate 109ShorthornB prion protein (P... 40 9.2
273gb|AY720559.1| Bos taurus isolate 109ShorthornA prion protein (P... 40 9.2
274gb|AY720558.1| Bos taurus isolate 107ShorthornB prion protein (P... 40 9.2
275gb|AY720557.1| Bos taurus isolate 107ShorthornA prion protein (P... 40 9.2
276gb|AY720556.1| Bos taurus isolate 105ShorthornB prion protein (P... 40 9.2
277gb|AY720555.1| Bos taurus isolate 105ShorthornA prion protein (P... 40 9.2
278gb|AY720554.1| Bos taurus isolate 91RedAngusB prion protein (PRN... 40 9.2
279gb|AY720553.1| Bos taurus isolate 91RedAngusA prion protein (PRN... 40 9.2
280gb|AY720552.1| Bos taurus isolate 90RedAngusB prion protein (PRN... 40 9.2
281gb|AY720551.1| Bos taurus isolate 90RedAngusA prion protein (PRN... 40 9.2
282gb|AY720550.1| Bos taurus isolate 83MneAnjou2 prion protein (PRN... 40 9.2
283gb|AY720549.1| Bos taurus isolate 82MaineAnjouB prion protein (P... 40 9.2
284gb|AY720548.1| Bos taurus isolate 82MaineAnjouA prion protein (P... 40 9.2
285gb|AY720547.1| Bos taurus isolate 2AngusB prion protein (PRNP) g... 40 9.2
286gb|AY720546.1| Bos taurus isolate 2AngusA prion protein (PRNP) g... 40 9.2
287gb|AY720545.1| Bos taurus isolate 106ShorthornB prion protein (P... 40 9.2
288gb|AY720544.1| Bos taurus isolate 106ShorthornA prion protein (P... 40 9.2
289gb|AY720543.1| Bos indicus isolate 100SantaGertrudB prion protei... 40 9.2
290gb|AY720542.1| Bos indicus isolate 100SantaGertrudA prion protei... 40 9.2
291gb|AY720541.1| Bos taurus isolate 38BraunviehB prion protein (PR... 40 9.2
292gb|AY720540.1| Bos taurus isolate 38BraunviehA prion protein (PR... 40 9.2
293gb|AY720539.1| Bos indicus isolate 8BeefmasterB prion protein (P... 40 9.2
294gb|AY720538.1| Bos indicus isolate 8BeefmasterA prion protein (P... 40 9.2
295gb|AY720537.1| Bos indicus isolate 87PiedmonteseB prion protein ... 40 9.2
296gb|AY720536.1| Bos indicus isolate 87PiedmonteseA prion protein ... 40 9.2
297gb|AY720535.1| Bos taurus isolate 81MaineAnjouB prion protein (P... 40 9.2
298gb|AY720534.1| Bos taurus isolate 81MaineAnjouA prion protein (P... 40 9.2
299gb|AY720533.1| Bos taurus isolate 78LimousinB prion protein (PRN... 40 9.2
300gb|AY720532.1| Bos taurus isolate 78LimousinA prion protein (PRN... 40 9.2
301gb|AY720531.1| Bos taurus isolate 43CharolaisB prion protein (PR... 40 9.2
302gb|AY720530.1| Bos taurus isolate 43CharolaisA prion protein (PR... 40 9.2
303gb|AY720529.1| Bos indicus isolate 20BrafordB prion protein (PRN... 40 9.2
304gb|AY720528.1| Bos indicus isolate 20BrafordA prion protein (PRN... 40 9.2
305gb|AY720527.1| Bos indicus isolate 111SimbrahB prion protein (PR... 40 9.2
306gb|AY720526.1| Bos indicus isolate 111SimbrahA prion protein (PR... 40 9.2
307gb|AY720525.1| Bos taurus isolate 15BlondD1 prion protein (PRNP)... 40 9.2
308gb|AY720524.1| Bos indicus isolate 14IndiaB prion protein (PRNP)... 40 9.2
309gb|AY720523.1| Bos indicus isolate 14IndiaA prion protein (PRNP)... 40 9.2
310gb|AY720522.1| Bos indicus isolate 13IndiaB prion protein (PRNP)... 40 9.2
311gb|AY720521.1| Bos indicus isolate 13IndiaA prion protein (PRNP)... 40 9.2
312gb|AY720520.1| Bos indicus isolate 11IndiaB prion protein (PRNP)... 40 9.2
313gb|AY720519.1| Bos indicus isolate 11IndiaA prion protein (PRNP)... 40 9.2
314gb|AY720518.1| Bos indicus isolate 10IndiaB prion protein (PRNP)... 40 9.2
315gb|AY720517.1| Bos indicus isolate 10IndiaA prion protein (PRNP)... 40 9.2
316gb|AY720516.1| Bos indicus isolate 9India2 prion protein (PRNP) ... 40 9.2
317gb|AY720515.1| Bos indicus isolate 9India1 prion protein (PRNP) ... 40 9.2
318gb|AY720514.1| Bos taurus isolate 36BraunviehB prion protein (PR... 40 9.2
319gb|AY720513.1| Bos taurus isolate 36BraunviehA prion protein (PR... 40 9.2
320gb|AY720512.1| Bos taurus isolate 93RedAngusB prion protein (PRN... 40 9.2
321gb|AY720511.1| Bos taurus isolate 93RedAngusA prion protein (PRN... 40 9.2
322gb|AY720510.1| Bos taurus isolate 79LimousinB prion protein (PRN... 40 9.2
323gb|AY720509.1| Bos taurus isolate 79LimousinA prion protein (PRN... 40 9.2
324gb|AY720508.1| Bos taurus isolate 3AngusB prion protein (PRNP) g... 40 9.2
325gb|AY720507.1| Bos taurus isolate 3AngusA prion protein (PRNP) g... 40 9.2
326gb|AY720506.1| Bos taurus isolate 35BraunviehB prion protein (PR... 40 9.2
327gb|AY720505.1| Bos taurus isolate 35BraunviehA prion protein (PR... 40 9.2
328gb|AY720504.1| Bos taurus isolate 34BraunviehB prion protein (PR... 40 9.2
329gb|AY720503.1| Bos taurus isolate 34BraunviehA prion protein (PR... 40 9.2
330gb|AY720502.1| Bos indicus isolate 33BrangusB prion protein (PRN... 40 9.2
331gb|AY720501.1| Bos indicus isolate 33BrangusA prion protein (PRN... 40 9.2
332gb|AY720500.1| Bos indicus isolate 28BrahmousinB prion protein (... 40 9.2
333gb|AY720499.1| Bos indicus isolate 28BrahmousinA prion protein (... 40 9.2
334gb|AY720498.1| Bos taurus isolate 17BlondDAqtnB prion protein (P... 40 9.2
335gb|AY720497.1| Bos taurus isolate 17BlondDAqtnA prion protein (P... 40 9.2
336gb|AY720496.1| Bos taurus isolate 16BlondDAqtnB prion protein (P... 40 9.2
337gb|AY720495.1| Bos taurus isolate 16BlondDAqtnA prion protein (P... 40 9.2
338gb|AY720494.1| Bos taurus isolate 103SenepolB prion protein (PRN... 40 9.2
339gb|AY720493.1| Bos taurus isolate 103SenepolA prion protein (PRN... 40 9.2
340gb|AY720492.1| Bos taurus isolate Brownswiss41.8 prion protein (... 40 9.2
341gb|AY720491.1| Bos indicus isolate 97RomagnolaB prion protein (P... 40 9.2
342gb|AY720490.1| Bos indicus isolate 97RomagnolaA prion protein (P... 40 9.2
343gb|AY720489.1| Bos taurus isolate 96RedPollB prion protein (PRNP... 40 9.2
344gb|AY720488.1| Bos taurus isolate 96RedPollA prion protein (PRNP... 40 9.2
345gb|AY720487.1| Bos indicus isolate 85USNelore1 prion protein (PR... 40 9.2
346gb|AY720486.1| Bos taurus isolate 75HolsteinB prion protein (PRN... 40 9.2
347gb|AY720485.1| Bos taurus isolate 75HolsteinA prion protein (PRN... 40 9.2
348gb|AY720484.1| Bos taurus isolate 74HolsteinB prion protein (PRN... 40 9.2
349gb|AY720483.1| Bos taurus isolate 74HolsteinA prion protein (PRN... 40 9.2
350gb|AY720482.1| Bos taurus isolate 72HerefordB prion protein (PRN... 40 9.2
351gb|AY720481.1| Bos taurus isolate 72HerefordA prion protein (PRN... 40 9.2
352gb|AY720480.1| Bos taurus isolate 65ChianinaChiaB prion protein ... 40 9.2
353gb|AY720479.1| Bos taurus isolate 65ChianinaChiaA prion protein ... 40 9.2
354gb|AY720478.1| Bos taurus isolate 64ChianinaChiaB prion protein ... 40 9.2
355gb|AY720477.1| Bos taurus isolate 64ChianinaChiaA prion protein ... 40 9.2
356gb|AY720476.1| Bos taurus isolate 63WhiteparkB prion protein (PR... 40 9.2
357gb|AY720475.1| Bos taurus isolate 63WhiteparkA prion protein (PR... 40 9.2
358gb|AY720474.1| Bos taurus isolate 61NormandeB prion protein (PRN... 40 9.2
359gb|AY720473.1| Bos taurus isolate 61NormandeA prion protein (PRN... 40 9.2
360gb|AY720472.1| Bos taurus isolate 54SalersB prion protein (PRNP)... 40 9.2
361gb|AY720471.1| Bos taurus isolate 54SalersA prion protein (PRNP)... 40 9.2
362gb|AY720470.1| Bos taurus isolate 49HerefordB prion protein (PRN... 40 9.2
363gb|AY720469.1| Bos taurus isolate 49HerefordA prion protein (PRN... 40 9.2
364gb|AY720468.1| Bos taurus isolate 48HerefordB prion protein (PRN... 40 9.2
365gb|AY720467.1| Bos taurus isolate 48HerefordA prion protein (PRN... 40 9.2
366gb|AY720466.1| Bos taurus isolate 46CharolaisB prion protein (PR... 40 9.2
367gb|AY720465.1| Bos taurus isolate 46CharolaisA prion protein (PR... 40 9.2
368gb|AY720464.1| Bos taurus isolate 18BlondDAqtnB prion protein (P... 40 9.2
369gb|AY720463.1| Bos taurus isolate 18BlondDAqtnA prion protein (P... 40 9.2
370gb|AY720462.1| Bos taurus isolate 15BlondD2 prion protein (PRNP)... 40 9.2
371gb|AY720461.1| Bos taurus isolate 12BelgianBlueB prion protein (... 40 9.2
372gb|AY720460.1| Bos taurus isolate 12BelgianBlueA prion protein (... 40 9.2
373gb|AY720459.1| Bos taurus isolate 122TXLonghornB prion protein (... 40 9.2
374gb|AY720458.1| Bos taurus isolate 122TXLonghornA prion protein (... 40 9.2
375gb|AY720457.1| Bos indicus isolate 110SimbrahB prion protein (PR... 40 9.2
376gb|AY720456.1| Bos indicus isolate 110SimbrahA prion protein (PR... 40 9.2
377gb|AY720455.1| Bos taurus isolate Charolais45.6 prion protein (P... 40 9.2
378gb|AY720454.1| Bos taurus isolate 40Brwnsws2 prion protein (PRNP... 40 9.2
379gb|AY720453.1| Bos taurus isolate 123TXLonghornB prion protein (... 40 9.2
380gb|AY720452.1| Bos taurus isolate 123TXLonghornA prion protein (... 40 9.2
381gb|AY720451.1| Bos taurus isolate 121TXLonghornB prion protein (... 40 9.2
382gb|AY720450.1| Bos taurus isolate 121TXLonghornA prion protein (... 40 9.2
383gb|AY720449.1| Bos taurus isolate 104SenepolB prion protein (PRN... 40 9.2
384gb|AY720448.1| Bos taurus isolate 104SenepolA prion protein (PRN... 40 9.2
385gb|AY720447.1| Bos indicus isolate 85USNelore2 prion protein (PR... 40 9.2
386gb|AY720446.1| Bos taurus isolate 42BrownswissB prion protein (P... 40 9.2
387gb|AY720445.1| Bos taurus isolate 42BrownswissA prion protein (P... 40 9.2
388gb|AY748456.1| Cervus elaphus elaphus prion protein (PrP) gene, ... 40 9.2
389gb|AY748455.1| Cervus elaphus elaphus prion protein (PrP) gene, ... 40 9.2
390gb|AY748454.1| Cervus elaphus elaphus prion protein (PrP) gene, ... 40 9.2
391gb|U67922.1|OAPRP Ovis aries prion protein gene, complete cds 40 9.2
392gb|AC145322.2| Oryza sativa (japonica cultivar-group) chromosome... 40 9.2
393gb|AY735496.1| Rupicapra rupicapra prion protein (Prnp) gene, co... 40 9.2
394gb|AC099695.15| Mus musculus chromosome 10, clone RP23-234P12, c... 40 9.2
395gb|AY571622.1| Eimeria tenella RAPD-SCAR marker Tn-A09-1383 geno... 40 9.2
396gb|AY723292.1| Capra hircus clone SY200303 prion protein (PrP) g... 40 9.2
397gb|AY723291.1| Capra hircus clone SY200302 prion protein (PrP) g... 40 9.2
398gb|AY723290.1| Capra hircus clone SY200301 prion protein (PrP) g... 40 9.2
399gb|AY723289.1| Ovis aries clone MY200303 prion protein (PrP) gen... 40 9.2
400gb|AY723288.1| Ovis aries clone MY200302 prion protein (PrP) gen... 40 9.2
401gb|AY723287.1| Ovis aries clone MY200301 prion protein (PrP) gen... 40 9.2
402gb|AY723286.1| Moschus chrysogaster clone MS200301 prion protein... 40 9.2
403gb|AY723283.1| Camelus bactrianus clone LT200302 prion protein (... 40 9.2
404gb|AY723282.1| Camelus bactrianus clone LT200301 prion protein (... 40 9.2
405gb|BC078644.1| Mus musculus dachshund 1 (Drosophila), mRNA (cDNA... 40 9.2
406gb|AY679697.1| Cervus elaphus prion protein (PrP) gene, partial cds 40 9.2
407gb|AC136710.8| Mus musculus chromosome 19, clone RP23-35B13, com... 40 9.2
408ref|XM_601010.2| PREDICTED: Bos taurus similar to bassoon (LOC52... 40 9.2
409ref|XM_425745.1| PREDICTED: Gallus gallus similar to Carbonic an... 40 9.2
410ref|XM_581903.2| PREDICTED: Bos taurus similar to CG7810-PA (LOC... 40 9.2
411gb|AY639096.1| Capreolus capreolus prion protein (Prnp) gene, co... 40 9.2
412gb|AY639095.1| Alces alces alces prion protein (Prnp) gene, comp... 40 9.2
413gb|AY639094.1| Cervus dama prion protein (Prnp) gene, complete cds 40 9.2
414gb|DQ013244.1| Capra hircus prion protein variant 222K/240S (PrP... 40 9.2
415gb|AY655756.1| Cervus nippon prion protein PRNP gene, complete cds 40 9.2
416ref|XM_595770.2| PREDICTED: Bos taurus similar to X Kell blood g... 40 9.2
417gb|AY327450.1| Bos grunniens prion protein mRNA, complete cds 40 9.2
418gb|AY327449.1| Ailuropoda melanoleuca prion protein mRNA, comple... 40 9.2
419gb|AY944236.1| Bos taurus prion preproprotein (PRNP) and prion-l... 40 9.2
420ref|NM_007826.2| Mus musculus dachshund 1 (Drosophila) (Dach1), ... 40 9.2
421ref|NM_001038610.1| Mus musculus dachshund 1 (Drosophila) (Dach1... 40 9.2
422gb|AC135636.4| Mus musculus BAC clone RP23-268G16 from chromosom... 40 9.2
423gb|DQ077504.1| Ovis aries OARPRNP prion protein precursor PrP (P... 40 9.2
424gb|AY585240.1| Ovis aries prion protein (PRNP) mRNA, partial cds 40 9.2
425gb|AY585239.1| Bos taurus prion protein (PRNP) mRNA, partial cds 40 9.2
426ref|NM_144612.4| Homo sapiens lipoxygenase homology domains 1 (L... 40 9.2
427gb|AY446894.1| Human herpesvirus 5 strain Merlin, complete genome 40 9.2
428gb|AY350275.1| Ovis aries clone 19BWDTamu prion protein (PRNP) g... 40 9.2
429gb|AY350274.1| Ovis aries clone 14B prion protein (PRNP) gene, P... 40 9.2
430gb|AY350273.1| Ovis aries clone 8B prion protein (PRNP) gene, PR... 40 9.2
431gb|AY350272.1| Ovis aries clone 23B prion protein (PRNP) gene, P... 40 9.2
432gb|AY350271.1| Ovis aries clone 17BTamu prion protein (PRNP) gen... 40 9.2
433gb|AY350270.1| Ovis aries clone 4BTamu prion protein (PRNP) gene... 40 9.2
434gb|AY350269.1| Ovis aries clone 6BTamu prion protein (PRNP) gene... 40 9.2
435gb|AY350268.1| Ovis aries clone 5ATamu prion protein (PRNP) gene... 40 9.2
436gb|AY350267.1| Ovis aries clone 2BTamu prion protein (PRNP) gene... 40 9.2
437gb|AY350266.1| Ovis aries clone 20BTamu prion protein (PRNP) gen... 40 9.2
438gb|AY350265.1| Ovis aries clone 18BTamu prion protein (PRNP) gen... 40 9.2
439gb|AY350264.1| Ovis aries clone 9ATamu prion protein (PRNP) gene... 40 9.2
440gb|AY350263.1| Ovis aries clone 8ATamu prion protein (PRNP) gene... 40 9.2
441gb|AY350262.1| Ovis aries clone 7ATamu prion protein (PRNP) gene... 40 9.2
442gb|AY350261.1| Ovis aries clone 6ATamu prion protein (PRNP) gene... 40 9.2
443gb|AY350260.1| Ovis aries clone 1ATamu prion protein (PRNP) gene... 40 9.2
444gb|AY350259.1| Ovis aries clone 16BTamu prion protein (PRNP) gen... 40 9.2
445gb|AY350258.1| Ovis aries clone 13BTamu prion protein (PRNP) gen... 40 9.2
446gb|AY350257.1| Ovis aries clone 1BTamu prion protein (PRNP) gene... 40 9.2
447gb|AY350256.1| Ovis aries clone 15BTamu prion protein (PRNP) gen... 40 9.2
448gb|AY350255.1| Ovis aries clone 3BTamu prion protein (PRNP) gene... 40 9.2
449gb|AY350254.1| Ovis aries clone 7BTamu prion protein (PRNP) gene... 40 9.2
450gb|AY350253.1| Ovis aries clone 10BTamu prion protein (PRNP) gen... 40 9.2
451gb|AY350252.1| Ovis aries clone 9BTamu prion protein (PRNP) gene... 40 9.2
452gb|AY350251.1| Ovis aries clone 24BTamu prion protein (PRNP) gen... 40 9.2
453gb|AY350250.1| Ovis aries clone 12BTamu prion protein (PRNP) gen... 40 9.2
454gb|AY350249.1| Ovis aries clone 5BTamu prion protein (PRNP) gene... 40 9.2
455gb|AY350248.1| Ovis aries clone 21BTamu prion protein (PRNP) gen... 40 9.2
456gb|AY350247.1| Ovis aries clone 3A3Tamu prion protein (PRNP) gen... 40 9.2
457gb|AY350246.1| Ovis aries clone 3A1Tamu prion protein (PRNP) gen... 40 9.2
458gb|AY350245.1| Ovis aries clone 4A.3Tamu prion protein (PRNP) ge... 40 9.2
459gb|AY350244.1| Ovis aries clone 11B.2Tamu prion protein (PRNP) g... 40 9.2
460gb|AY350243.1| Ovis aries clone 11B.1Tamu prion protein (PRNP) g... 40 9.2
461gb|AY350242.1| Ovis aries clone 2ATamu prion protein (PRNP) gene... 40 9.2
462gb|AY350241.1| Ovis aries clone 10ATamu prion protein (PRNP) gen... 40 9.2
463gb|AF040659.1| Caenorhabditis elegans cosmid ZK484, complete seq... 40 9.2
464gb|DQ150096.1| Panthera tigris altaica prion protein gene, parti... 40 9.2
465gb|AC158616.8| Mus musculus 10 BAC RP23-227E23 (Roswell Park Can... 40 9.2
466gb|AY486473.1|AY486470S04 Human herpesvirus 5 strain Toledo geno... 40 9.2
467emb|AJ012166.1|CFA012166 Canis familiaris TCTA gene, AMT gene, N... 40 9.2
468ref|XM_544912.2| PREDICTED: Canis familiaris similar to Serine/t... 40 9.2
469gb|AY335912.1| Bos taurus BTAPRNPS1 prion protein precursor PrP ... 40 9.2
470ref|XR_002861.1| PREDICTED: Mus musculus similar to 60S ribosoma... 40 9.2
471ref|XM_543571.2| PREDICTED: Canis familiaris similar to RIM bind... 40 9.2
472gb|AC140320.2| Mus musculus BAC clone RP23-401C13 from chromosom... 40 9.2
473gb|AY488862.1| Ovis aries PrP protein (prp) gene, prp-VRR allele... 40 9.2
474gb|AY488861.1| Ovis aries PrP protein (prp) gene, prp-AHR allele... 40 9.2
475gb|AY488860.1| Ovis aries PrP protein (prp) gene, prp-ARQ allele... 40 9.2
476gb|AY488859.1| Ovis aries PrP protein (prp) gene, prp-ARR allele... 40 9.2
477gb|AY488858.1| Ovis aries PrP protein (prp) gene, prp-VRQ allele... 40 9.2
478gb|AY485346.1| Ovis aries prion protein (prp) gene, prp-AHQ alle... 40 9.2
479emb|CT025527.7| Mouse DNA sequence from clone RP23-279J20 on chr... 40 9.2
480emb|Y13199.1|CFPDEAI2 Canis familiaris PDEA gene, partial intron 40 9.2
481ref|XM_539651.2| PREDICTED: Canis familiaris similar to Cell div... 40 9.2
482gb|AY292293.1| Sus scrofa myocardin mRNA, complete cds 40 9.2
483gb|BC059215.1| Mus musculus transcriptional regulating factor 1,... 40 9.2
484gb|AC146999.1| Human Herpesvirus 5 AD169-BAC isolate, complete s... 40 9.2
485gb|AC146907.1| Human Herpesvirus 5 FIX-BAC isolate, complete seq... 40 9.2
486gb|AC146906.1| Human Herpesvirus 5 TR-BAC isolate, complete sequ... 40 9.2
487gb|AC146905.1| Human Herpesvirus 5 Toledo-BAC isolate, complete ... 40 9.2
488gb|AC146904.1| Human Herpesvirus 5 PH-BAC isolate, complete sequ... 40 9.2
489gb|AC146851.1| Human Herpesvirus 5 Towne-BAC isolate, complete s... 40 9.2
490gb|AY315197.1| Human herpesvirus 5 strain Towne, complete genome 40 9.2
491ref|XM_846937.1| PREDICTED: Canis familiaris similar to nuclear ... 40 9.2
492gb|AC099315.3| Papio anubis clone RP41-403I2, complete sequence 40 9.2
493gb|AC126264.3| Mus musculus BAC clone RP23-376F13 from chromosom... 40 9.2
494ref|XM_797522.1| Trypanosoma cruzi strain CL Brener hypothetical... 40 9.2
495ref|XM_800215.1| Trypanosoma cruzi strain CL Brener hypothetical... 40 9.2
496gb|AC122847.4| Mus musculus BAC clone RP23-163F2 from 6, complet... 40 9.2
497gb|DQ462280.1| Human herpesvirus 5 strain AD169 UL49 mRNA, compl... 40 9.2
498ref|XM_546992.2| PREDICTED: Canis familiaris similar to Zinc fin... 40 9.2
499emb|CR695516.2|CNS0FZM0 Tetraodon nigroviridis full-length cDNA 40 9.2
500emb|CR694540.1|CNS0FYUW Tetraodon nigroviridis full-length cDNA 40 9.2

>ref|XM_549952.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 3419

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 70/84 (83%), Gaps = 3/84 (3%)
 Strand = Plus / Plus

                                                                        
Query: 77   aagcttgacgcaatcgcagctaagcagctgcagagggagagggagttggaag---agagg 133
            ||||| || ||||| ||||| |||||||||||||| ||||||||  | ||||   ||| |
Sbjct: 2675 aagctggatgcaattgcagccaagcagctgcagagagagagggaactagaagagaagaag 2734

                                    
Query: 134  gaaaaacagagaagggaggctctc 157
            ||||||||||||| ||| ||||||
Sbjct: 2735 gaaaaacagagaatggaagctctc 2758



to top

>gb|AY603953.1| Oryza longistaminata isolate 101198 T8R-2 locus genomic sequence
          Length = 539

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 70/84 (83%), Gaps = 3/84 (3%)
 Strand = Plus / Minus

                                                                       
Query: 77  aagcttgacgcaatcgcagctaagcagctgcagagggagagggagttggaag---agagg 133
           ||||| || ||||| ||||| |||||||||||||| ||||||||  | ||||   ||| |
Sbjct: 96  aagctggatgcaattgcagccaagcagctgcagagagagagggaactagaagagaagaag 37

                                   
Query: 134 gaaaaacagagaagggaggctctc 157
           ||||||||||||| ||| ||||||
Sbjct: 36  gaaaaacagagaatggaagctctc 13



to top

>gb|AY603952.1| Oryza longistaminata isolate 81968 T8R-2 locus genomic sequence
          Length = 541

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 70/84 (83%), Gaps = 3/84 (3%)
 Strand = Plus / Minus

                                                                       
Query: 77  aagcttgacgcaatcgcagctaagcagctgcagagggagagggagttggaag---agagg 133
           ||||| || ||||| ||||| |||||||||||||| ||||||||  | ||||   ||| |
Sbjct: 96  aagctggatgcaattgcagccaagcagctgcagagagagagggaactagaagagaagaag 37

                                   
Query: 134 gaaaaacagagaagggaggctctc 157
           ||||||||||||| ||| ||||||
Sbjct: 36  gaaaaacagagaatggaagctctc 13



to top

>gb|AY603951.1| Oryza glumipatula isolate 100971 T8R-2 locus genomic sequence
          Length = 538

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 70/84 (83%), Gaps = 3/84 (3%)
 Strand = Plus / Minus

                                                                       
Query: 77  aagcttgacgcaatcgcagctaagcagctgcagagggagagggagttggaag---agagg 133
           ||||| || ||||| ||||| |||||||||||||| ||||||||  | ||||   ||| |
Sbjct: 96  aagctggatgcaattgcagccaagcagctgcagagagagagggaactagaagagaagaag 37

                                   
Query: 134 gaaaaacagagaagggaggctctc 157
           ||||||||||||| ||| ||||||
Sbjct: 36  gaaaaacagagaatggaagctctc 13



to top

>gb|AY603950.1| Oryza rufipogon isolate 104642 T8R-2 locus genomic sequence
          Length = 538

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 70/84 (83%), Gaps = 3/84 (3%)
 Strand = Plus / Minus

                                                                       
Query: 77  aagcttgacgcaatcgcagctaagcagctgcagagggagagggagttggaag---agagg 133
           ||||| || ||||| ||||| |||||||||||||| ||||||||  | ||||   ||| |
Sbjct: 96  aagctggatgcaattgcagccaagcagctgcagagagagagggaactagaagagaagaag 37

                                   
Query: 134 gaaaaacagagaagggaggctctc 157
           ||||||||||||| ||| ||||||
Sbjct: 36  gaaaaacagagaatggaagctctc 13



to top

>gb|AY603948.1| Oryza meridionalis isolate 105281 transposon T8R-2, complete
           sequence
          Length = 737

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 70/84 (83%), Gaps = 3/84 (3%)
 Strand = Plus / Minus

                                                                       
Query: 77  aagcttgacgcaatcgcagctaagcagctgcagagggagagggagttggaag---agagg 133
           ||||| || ||||| ||||| |||||||||||||| ||||||||  | ||||   ||| |
Sbjct: 96  aagctggatgcaattgcagccaagcagctgcagagagagagggaactagaagagaagaag 37

                                   
Query: 134 gaaaaacagagaagggaggctctc 157
           ||||||||||||| ||| ||||||
Sbjct: 36  gaaaaacagagaatggaagctctc 13



to top

>gb|AY603947.1| Oryza meridionalis isolate 101146 transposon T8R-2, complete
           sequence
          Length = 738

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 70/84 (83%), Gaps = 3/84 (3%)
 Strand = Plus / Minus

                                                                       
Query: 77  aagcttgacgcaatcgcagctaagcagctgcagagggagagggagttggaag---agagg 133
           ||||| || ||||| ||||| |||||||||||||| ||||||||  | ||||   ||| |
Sbjct: 96  aagctggatgcaattgcagccaagcagctgcagagagagagggaactagaagagaagaag 37

                                   
Query: 134 gaaaaacagagaagggaggctctc 157
           ||||||||||||| ||| ||||||
Sbjct: 36  gaaaaacagagaatggaagctctc 13



to top

>gb|AY603945.1| Oryza barthii isolate 101252 transposon T8R-2, complete sequence
          Length = 735

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 70/84 (83%), Gaps = 3/84 (3%)
 Strand = Plus / Minus

                                                                       
Query: 77  aagcttgacgcaatcgcagctaagcagctgcagagggagagggagttggaag---agagg 133
           ||||| || ||||| ||||| |||||||||||||| ||||||||  | ||||   ||| |
Sbjct: 96  aagctggatgcaattgcagccaagcagctgcagagagagagggaactagaagagaagaag 37

                                   
Query: 134 gaaaaacagagaagggaggctctc 157
           ||||||||||||| ||| ||||||
Sbjct: 36  gaaaaacagagaatggaagctctc 13



to top

>gb|AY603943.1| Oryza nivara isolate 105703 transposon T8R-2, complete sequence
          Length = 736

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 70/84 (83%), Gaps = 3/84 (3%)
 Strand = Plus / Minus

                                                                       
Query: 77  aagcttgacgcaatcgcagctaagcagctgcagagggagagggagttggaag---agagg 133
           ||||| || ||||| ||||| |||||||||||||| ||||||||  | ||||   ||| |
Sbjct: 96  aagctggatgcaattgcagccaagcagctgcagagagagagggaactagaagagaagaag 37

                                   
Query: 134 gaaaaacagagaagggaggctctc 157
           ||||||||||||| ||| ||||||
Sbjct: 36  gaaaaacagagaatggaagctctc 13



to top

>gb|AY603942.1| Oryza nivara isolate 101508 transposon T8R-2, complete sequence
          Length = 736

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 70/84 (83%), Gaps = 3/84 (3%)
 Strand = Plus / Minus

                                                                       
Query: 77  aagcttgacgcaatcgcagctaagcagctgcagagggagagggagttggaag---agagg 133
           ||||| || ||||| ||||| |||||||||||||| ||||||||  | ||||   ||| |
Sbjct: 96  aagctggatgcaattgcagccaagcagctgcagagagagagggaactagaagagaagaag 37

                                   
Query: 134 gaaaaacagagaagggaggctctc 157
           ||||||||||||| ||| ||||||
Sbjct: 36  gaaaaacagagaatggaagctctc 13



to top

>gb|AY603941.1| Oryza sativa isolate 42576 transposon T8R-2, complete sequence
          Length = 731

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 70/84 (83%), Gaps = 3/84 (3%)
 Strand = Plus / Minus

                                                                       
Query: 77  aagcttgacgcaatcgcagctaagcagctgcagagggagagggagttggaag---agagg 133
           ||||| || ||||| ||||| |||||||||||||| ||||||||  | ||||   ||| |
Sbjct: 96  aagctggatgcaattgcagccaagcagctgcagagagagagggaactagaagagaagaag 37

                                   
Query: 134 gaaaaacagagaagggaggctctc 157
           ||||||||||||| ||| ||||||
Sbjct: 36  gaaaaacagagaatggaagctctc 13



to top

>gb|AY603940.1| Oryza sativa isolate 754 transposon T8R-2, complete sequence
          Length = 727

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 70/84 (83%), Gaps = 3/84 (3%)
 Strand = Plus / Minus

                                                                       
Query: 77  aagcttgacgcaatcgcagctaagcagctgcagagggagagggagttggaag---agagg 133
           ||||| || ||||| ||||| |||||||||||||| ||||||||  | ||||   ||| |
Sbjct: 93  aagctggatgcaattgcagccaagcagctgcagagagagagggaactagaagagaagaag 34

                                   
Query: 134 gaaaaacagagaagggaggctctc 157
           ||||||||||||| ||| ||||||
Sbjct: 33  gaaaaacagagaatggaagctctc 10



to top

>gb|AY603939.1| Oryza sativa isolate 244 transposon T8R-2, complete sequence
          Length = 731

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 70/84 (83%), Gaps = 3/84 (3%)
 Strand = Plus / Minus

                                                                       
Query: 77  aagcttgacgcaatcgcagctaagcagctgcagagggagagggagttggaag---agagg 133
           ||||| || ||||| ||||| |||||||||||||| ||||||||  | ||||   ||| |
Sbjct: 96  aagctggatgcaattgcagccaagcagctgcagagagagagggaactagaagagaagaag 37

                                   
Query: 134 gaaaaacagagaagggaggctctc 157
           ||||||||||||| ||| ||||||
Sbjct: 36  gaaaaacagagaatggaagctctc 13



to top

>gb|AY603938.1| Oryza sativa isolate 7288 transposon T8R-2, complete sequence
          Length = 730

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 70/84 (83%), Gaps = 3/84 (3%)
 Strand = Plus / Minus

                                                                       
Query: 77  aagcttgacgcaatcgcagctaagcagctgcagagggagagggagttggaag---agagg 133
           ||||| || ||||| ||||| |||||||||||||| ||||||||  | ||||   ||| |
Sbjct: 96  aagctggatgcaattgcagccaagcagctgcagagagagagggaactagaagagaagaag 37

                                   
Query: 134 gaaaaacagagaagggaggctctc 157
           ||||||||||||| ||| ||||||
Sbjct: 36  gaaaaacagagaatggaagctctc 13



to top

>emb|AJ437346.1|OSA437346 Oryza sativa mRNA translation initiation factor 3 large subunit
            (eIF3a gene)
          Length = 3445

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 70/84 (83%), Gaps = 3/84 (3%)
 Strand = Plus / Plus

                                                                        
Query: 77   aagcttgacgcaatcgcagctaagcagctgcagagggagagggagttggaag---agagg 133
            ||||| || ||||| ||||| |||||||||||||| ||||||||  | ||||   ||| |
Sbjct: 2578 aagctggatgcaattgcagccaagcagctgcagagagagagggaactagaagagaagaag 2637

                                    
Query: 134  gaaaaacagagaagggaggctctc 157
            ||||||||||||| ||| ||||||
Sbjct: 2638 gaaaaacagagaatggaagctctc 2661



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 70/84 (83%), Gaps = 3/84 (3%)
 Strand = Plus / Minus

                                                                           
Query: 77      aagcttgacgcaatcgcagctaagcagctgcagagggagagggagttggaag---agagg 133
               ||||| || ||||| ||||| |||||||||||||| ||||||||  | ||||   ||| |
Sbjct: 1171646 aagctggatgcaattgcagccaagcagctgcagagagagagggaactagaagagaagaag 1171587

                                       
Query: 134     gaaaaacagagaagggaggctctc 157
               ||||||||||||| ||| ||||||
Sbjct: 1171586 gaaaaacagagaatggaagctctc 1171563



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                          
Query: 243     ctccagctgcagcagctgccgcagctg 269
               |||||||||||||||||||||| ||||
Sbjct: 6682948 ctccagctgcagcagctgccgccgctg 6682974



 Score = 44.1 bits (22), Expect = 0.59
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 109      gagggagagggagttggaagag 130
                ||||||||||||||||||||||
Sbjct: 18619500 gagggagagggagttggaagag 18619521



to top

>dbj|AP002868.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0698A04
          Length = 141079

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 70/84 (83%), Gaps = 3/84 (3%)
 Strand = Plus / Minus

                                                                          
Query: 77     aagcttgacgcaatcgcagctaagcagctgcagagggagagggagttggaag---agagg 133
              ||||| || ||||| ||||| |||||||||||||| ||||||||  | ||||   ||| |
Sbjct: 140960 aagctggatgcaattgcagccaagcagctgcagagagagagggaactagaagagaagaag 140901

                                      
Query: 134    gaaaaacagagaagggaggctctc 157
              ||||||||||||| ||| ||||||
Sbjct: 140900 gaaaaacagagaatggaagctctc 140877



to top

>dbj|AP002487.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0684C01
          Length = 78600

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 70/84 (83%), Gaps = 3/84 (3%)
 Strand = Plus / Minus

                                                                         
Query: 77    aagcttgacgcaatcgcagctaagcagctgcagagggagagggagttggaag---agagg 133
             ||||| || ||||| ||||| |||||||||||||| ||||||||  | ||||   ||| |
Sbjct: 25949 aagctggatgcaattgcagccaagcagctgcagagagagagggaactagaagagaagaag 25890

                                     
Query: 134   gaaaaacagagaagggaggctctc 157
             ||||||||||||| ||| ||||||
Sbjct: 25889 gaaaaacagagaatggaagctctc 25866



to top

>dbj|AK122166.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033147M02, full
            insert sequence
          Length = 3419

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 70/84 (83%), Gaps = 3/84 (3%)
 Strand = Plus / Plus

                                                                        
Query: 77   aagcttgacgcaatcgcagctaagcagctgcagagggagagggagttggaag---agagg 133
            ||||| || ||||| ||||| |||||||||||||| ||||||||  | ||||   ||| |
Sbjct: 2675 aagctggatgcaattgcagccaagcagctgcagagagagagggaactagaagagaagaag 2734

                                    
Query: 134  gaaaaacagagaagggaggctctc 157
            ||||||||||||| ||| ||||||
Sbjct: 2735 gaaaaacagagaatggaagctctc 2758



to top

>dbj|AK072604.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023125H08, full
           insert sequence
          Length = 1136

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 70/84 (83%), Gaps = 3/84 (3%)
 Strand = Plus / Plus

                                                                       
Query: 77  aagcttgacgcaatcgcagctaagcagctgcagagggagagggagttggaag---agagg 133
           ||||| || ||||| ||||| |||||||||||||| ||||||||  | ||||   ||| |
Sbjct: 403 aagctggatgcaattgcagccaagcagctgcagagagagagggaactagaagagaagaag 462

                                   
Query: 134 gaaaaacagagaagggaggctctc 157
           ||||||||||||| ||| ||||||
Sbjct: 463 gaaaaacagagaatggaagctctc 486



to top

>gb|AF235097.2| Homo sapiens chromosome X multiple clones map p11.23, complete sequence
          Length = 140335

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                              
Query: 238   ggctgctccagctgcagcagctgccgcagctgg 270
             |||||| ||||| ||||||||||||||||||||
Sbjct: 77723 ggctgccccagcagcagcagctgccgcagctgg 77755



to top

>ref|NM_033215.3| Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit
           3F (PPP1R3F), mRNA
          Length = 2941

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 238 ggctgctccagctgcagcagctgccgcagctgg 270
           |||||| ||||| ||||||||||||||||||||
Sbjct: 909 ggctgccccagcagcagcagctgccgcagctgg 941



to top

>dbj|AK056909.1| Homo sapiens cDNA FLJ32347 fis, clone PROST2006988, moderately
           similar to Mus musculus DXImx48e protein (DXImx48e) mRNA
          Length = 2680

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 238 ggctgctccagctgcagcagctgccgcagctgg 270
           |||||| ||||| ||||||||||||||||||||
Sbjct: 745 ggctgccccagcagcagcagctgccgcagctgg 777



to top

>gb|AY603954.1| Oryza longistaminata isolate 101205 T8R-2 locus genomic sequence
          Length = 538

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 65/78 (83%), Gaps = 3/78 (3%)
 Strand = Plus / Minus

                                                                       
Query: 77  aagcttgacgcaatcgcagctaagcagctgcagagggagagggagttggaagagagg--- 133
           ||||| || ||||| ||||| |||||||||||||| ||||||||  | ||||||| |   
Sbjct: 95  aagctggatgcaattgcagccaagcagctgcagagagagagggaactagaagagaagaag 36

                             
Query: 134 gaaaaacagagaagggag 151
           ||||||||||||| ||||
Sbjct: 35  gaaaaacagagaatggag 18



to top

>gb|AY603949.1| Oryza meridionalis isolate 105283 transposon T8R-2, complete
           sequence
          Length = 738

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 68/82 (82%), Gaps = 3/82 (3%)
 Strand = Plus / Minus

                                                                       
Query: 77  aagcttgacgcaatcgcagctaagcagctgcagagggagagggagttggaagagagg--- 133
           ||||| || ||||| ||||| |||||||||||||| ||||||||  | ||||||| |   
Sbjct: 97  aagctggatgcaattgcagccaagcagctgcagagagagagggaactagaagagaagaag 38

                                 
Query: 134 gaaaaacagagaagggaggctc 155
           ||||||||||||| ||| ||||
Sbjct: 37  gaaaaacagagaatggaagctc 16



to top

>gb|AY603946.1| Oryza barthii isolate 104286 transposon T8R-2, complete sequence
          Length = 737

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 68/82 (82%), Gaps = 3/82 (3%)
 Strand = Plus / Minus

                                                                       
Query: 77  aagcttgacgcaatcgcagctaagcagctgcagagggagagggagttggaagagagg--- 133
           ||||| || ||||| ||||| |||||||||||||| ||||||||  | ||||||| |   
Sbjct: 97  aagctggatgcaattgcagccaagcagctgcagagagagagggaactagaagagaagaag 38

                                 
Query: 134 gaaaaacagagaagggaggctc 155
           ||||||||||||| ||| ||||
Sbjct: 37  gaaaaacagagaatggaagctc 16



to top

>gb|AY603944.1| Oryza glaberrima isolate 104562 transposon T8R-2, complete sequence
          Length = 737

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 77  aagcttgacgcaatcgcagctaagcagctgcagagggagaggga 120
           ||||| || ||||| ||||| |||||||||||||| ||||||||
Sbjct: 98  aagctggatgcaattgcagccaagcagctgcagagagagaggga 55



to top

>gb|AY810151.1| Schistosoma japonicum SJCHGC07130 protein mRNA, partial cds
          Length = 549

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 246 cagctgcagcagctgccgcagctg 269
           ||||||||||||||||||||||||
Sbjct: 335 cagctgcagcagctgccgcagctg 358



to top

>dbj|AK106560.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-110-B08, full
            insert sequence
          Length = 2691

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 77   aagcttgacgcaatcgcagctaagcagctgcagagggagaggga 120
            ||||| || ||||| ||||| |||||||||||||| ||||||||
Sbjct: 2645 aagctggatgcaattgcagccaagcagctgcagagagagaggga 2688



to top

>emb|AL158055.12| Human DNA sequence from clone RP11-348F1 on chromosome Xp11.1-11.22
             Contains the NUDT11 gene for nudix (nucleoside diphosphate
             linked moiety X)-type motif 11, two novel genes, the
             NUDT10 gene for nudix (nucleoside diphosphate linked
             moiety X)-type motif 10 and three CpG islands, complete
             sequence
          Length = 184873

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 126   aagagagggaaaaacagagaagggagg 152
             |||||||||||||| ||||||||||||
Sbjct: 60061 aagagagggaaaaagagagaagggagg 60035



to top

>dbj|AP001800.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0443E05
          Length = 176935

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 243   ctccagctgcagcagctgccgcagctg 269
             |||||||||||||||||||||| ||||
Sbjct: 35100 ctccagctgcagcagctgccgccgctg 35126



to top

>ref|NM_193664.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 966

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 109 gagggagagggagttggaagag 130
           ||||||||||||||||||||||
Sbjct: 916 gagggagagggagttggaagag 937



to top

>gb|AC148990.6| Mus musculus BAC clone RP24-466N11 from chromosome 7, complete sequence
          Length = 198504

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 101    cagctgcagagggagagggagt 122
              ||||||||||||||||||||||
Sbjct: 162884 cagctgcagagggagagggagt 162905



to top

>ref|XM_617555.2| PREDICTED: Bos taurus similar to nuclear receptor
           co-repressor/HDAC3 complex subunit (LOC537393), partial
           mRNA
          Length = 1285

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 246 cagctgcagcagctgccgcagctggtgctt 275
           |||||||||||||||| ||||||| |||||
Sbjct: 512 cagctgcagcagctgcagcagctgctgctt 483



to top

>gb|BC064764.1| Mus musculus forkhead box P1, mRNA (cDNA clone MGC:76591
           IMAGE:30430449), complete cds
          Length = 2348

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 230 ccagcagcggctgctccagctgcagcagctgccgcagc 267
           |||||||| ||| |||||| |||||||||||| |||||
Sbjct: 772 ccagcagcagcttctccagatgcagcagctgcagcagc 809



to top

>ref|XM_755880.1| Ustilago maydis 521 hypothetical protein (UM04826.1) partial mRNA
          Length = 2331

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 239 gctgctccagctgcagcagctgccgc 264
           |||||| |||||||||||||||||||
Sbjct: 352 gctgctgcagctgcagcagctgccgc 377



to top

>ref|XM_860376.1| PREDICTED: Canis familiaris similar to RNA-binding protein 4
           (RNA-binding motif protein 4) (Lark homolog) (Hlark)
           (RNA-binding motif protein 4a), transcript variant 3
           (LOC610648), mRNA
          Length = 1476

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 231 cagcagcggctgctccagctgcagcagctg 260
           |||||||||||||| |||| ||||||||||
Sbjct: 972 cagcagcggctgctgcagcagcagcagctg 943



to top

>ref|XM_860358.1| PREDICTED: Canis familiaris similar to RNA-binding protein 4
            (RNA-binding motif protein 4) (Lark homolog) (Hlark)
            (RNA-binding motif protein 4a), transcript variant 2
            (LOC610648), mRNA
          Length = 2027

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 231  cagcagcggctgctccagctgcagcagctg 260
            |||||||||||||| |||| ||||||||||
Sbjct: 1086 cagcagcggctgctgcagcagcagcagctg 1057



to top

>ref|XM_847210.1| PREDICTED: Canis familiaris similar to RNA-binding protein 4
           (RNA-binding motif protein 4) (Lark homolog) (Hlark)
           (RNA-binding motif protein 4a), transcript variant 1
           (LOC610648), mRNA
          Length = 1913

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 231 cagcagcggctgctccagctgcagcagctg 260
           |||||||||||||| |||| ||||||||||
Sbjct: 972 cagcagcggctgctgcagcagcagcagctg 943



to top

>ref|XM_746375.1| Aspergillus fumigatus Af293 hypothetical protein (Afu4g13630)
           partial mRNA
          Length = 3564

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 248 gctgcagcagctgccgcagctggtgcttct 277
           |||||||||||||| ||||||| |||||||
Sbjct: 758 gctgcagcagctgctgcagctgctgcttct 729



to top

>gb|AC125137.3| Mus musculus BAC clone RP24-324K9 from chromosome 6, complete sequence
          Length = 170336

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                    
Query: 230    ccagcagcggctgctccagctgcagcagctgccgcagc 267
              |||||||| ||| |||||| |||||||||||| |||||
Sbjct: 146585 ccagcagcagcttctccagatgcagcagctgcagcagc 146548



to top

>ref|NM_053202.1| Mus musculus forkhead box P1 (Foxp1), mRNA
          Length = 2118

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 230 ccagcagcggctgctccagctgcagcagctgccgcagc 267
           |||||||| ||| |||||| |||||||||||| |||||
Sbjct: 627 ccagcagcagcttctccagatgcagcagctgcagcagc 664



to top

>dbj|AP004611.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
            clone:OJ1005_B10
          Length = 142680

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 109  gagggagagggagttggaagag 130
            ||||||||||||||||||||||
Sbjct: 6946 gagggagagggagttggaagag 6967



to top

>dbj|AK139831.1| Mus musculus 2 cells egg cDNA, RIKEN full-length enriched library,
           clone:B020023N10 product:forkhead box P1, full insert
           sequence
          Length = 2831

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 230 ccagcagcggctgctccagctgcagcagctgccgcagc 267
           |||||||| ||| |||||| |||||||||||| |||||
Sbjct: 279 ccagcagcagcttctccagatgcagcagctgcagcagc 316



to top

>gb|AC151733.5| Mus musculus BAC clone RP23-89N20 from chromosome 7, complete sequence
          Length = 204775

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 101   cagctgcagagggagagggagt 122
             ||||||||||||||||||||||
Sbjct: 18519 cagctgcagagggagagggagt 18540



to top

>dbj|AK077062.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4932443N09 product:forkhead box P1, full
           insert sequence
          Length = 2405

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 230 ccagcagcggctgctccagctgcagcagctgccgcagc 267
           |||||||| ||| |||||| |||||||||||| |||||
Sbjct: 288 ccagcagcagcttctccagatgcagcagctgcagcagc 325



to top

>gb|AF339104.1|AF339104 Mus musculus forkhead-related transcription factor 1B (Foxp1b)
           mRNA, complete cds
          Length = 1926

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 230 ccagcagcggctgctccagctgcagcagctgccgcagc 267
           |||||||| ||| |||||| |||||||||||| |||||
Sbjct: 627 ccagcagcagcttctccagatgcagcagctgcagcagc 664



to top

>gb|AF339103.1|AF339103 Mus musculus forkhead-related transcription factor 1A (Foxp1a)
           mRNA, complete cds
          Length = 2118

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 230 ccagcagcggctgctccagctgcagcagctgccgcagc 267
           |||||||| ||| |||||| |||||||||||| |||||
Sbjct: 627 ccagcagcagcttctccagatgcagcagctgcagcagc 664



to top

>dbj|AK033368.1| Mus musculus 16 days embryo lung cDNA, RIKEN full-length enriched
           library, clone:8430407G20 product:forkhead box P1, full
           insert sequence
          Length = 2415

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 230 ccagcagcggctgctccagctgcagcagctgccgcagc 267
           |||||||| ||| |||||| |||||||||||| |||||
Sbjct: 103 ccagcagcagcttctccagatgcagcagctgcagcagc 140



to top

>gb|AC155839.4| Mus musculus 6 BAC RP24-96J4 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 173368

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                   
Query: 230   ccagcagcggctgctccagctgcagcagctgccgcagc 267
             |||||||| ||| |||||| |||||||||||| |||||
Sbjct: 35187 ccagcagcagcttctccagatgcagcagctgcagcagc 35150



to top

>dbj|AB221602.1| Mus musculus cDNA pooled tissues:(tissue_type=brain,dev_stage=8-12
           days
           neonate,strain=BALB/c),(tissue_type=testis,
           dev_stage=adult, strain=C57BL/6J), clone:V01X014A15
          Length = 2122

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 230 ccagcagcggctgctccagctgcagcagctgccgcagc 267
           |||||||| ||| |||||| |||||||||||| |||||
Sbjct: 631 ccagcagcagcttctccagatgcagcagctgcagcagc 668



to top

>dbj|AB221601.1| Mus musculus cDNA pooled tissues:(tissue_type=brain,dev_stage=8-12
           days
           neonate,strain=BALB/c),(tissue_type=testis,
           dev_stage=adult, strain=C57BL/6J), clone:V01X014A13
          Length = 2120

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 230 ccagcagcggctgctccagctgcagcagctgccgcagc 267
           |||||||| ||| |||||| |||||||||||| |||||
Sbjct: 633 ccagcagcagcttctccagatgcagcagctgcagcagc 670



to top

>dbj|AP003276.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0516D04
          Length = 140491

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 109   gagggagagggagttggaagag 130
             ||||||||||||||||||||||
Sbjct: 42773 gagggagagggagttggaagag 42794



to top

>ref|NM_129548.2| Arabidopsis thaliana zinc ion binding AT2G39900 mRNA, complete cds
          Length = 948

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 237 cggctgctccagctgcagcagctgc 261
           |||||||| ||||||||||||||||
Sbjct: 764 cggctgctacagctgcagcagctgc 740



to top

>gb|AC163689.3| Mus musculus BAC clone CH36-200G6 from chromosome 13, complete sequence
          Length = 188084

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 103   gctgcagagggagagggagttggaa 127
             |||| ||||||||||||||||||||
Sbjct: 79534 gctggagagggagagggagttggaa 79510



to top

>gb|AC102124.16| Mus musculus chromosome 18, clone RP23-188D1, complete sequence
          Length = 222450

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 252   cagcagctgccgcagctggtgcttctcct 280
             ||||||||||||||||| || ||||||||
Sbjct: 60587 cagcagctgccgcagcttgtccttctcct 60615



to top

>ref|XM_422955.1| PREDICTED: Gallus gallus similar to KIAA1609 protein (LOC425167),
           mRNA
          Length = 968

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 126 aagagagggaaaaacagagaa 146
           |||||||||||||||||||||
Sbjct: 737 aagagagggaaaaacagagaa 717



to top

>ref|XM_322125.1| Neurospora crassa OR74A hypothetical protein (NCU00040.1) partial
            mRNA
          Length = 3180

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                             
Query: 282  gcaagtatgtccccaagtggaaacgtgagggtg 314
            ||||||| || |||||||||| |||||||||||
Sbjct: 3143 gcaagtacgttcccaagtggagacgtgagggtg 3175



to top

>gb|AC147021.3| Pan troglodytes BAC clone RP43-85B14 from 7, complete sequence
          Length = 159960

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 190   tgcaccagctgctgctgctgt 210
             |||||||||||||||||||||
Sbjct: 38377 tgcaccagctgctgctgctgt 38397



to top

>ref|XM_951058.1| Neurospora crassa OR74A hypothetical protein (NCU00040.1) partial
            mRNA
          Length = 3180

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                             
Query: 282  gcaagtatgtccccaagtggaaacgtgagggtg 314
            ||||||| || |||||||||| |||||||||||
Sbjct: 3143 gcaagtacgttcccaagtggagacgtgagggtg 3175



to top

>ref|NM_145614.2| Mus musculus dihydrolipoamide S-acetyltransferase (E2 component of
            pyruvate dehydrogenase complex) (Dlat), mRNA
          Length = 4034

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 238  ggctgctccagctgcagcagctgcc 262
            ||||||||| |||||||||||||||
Sbjct: 1488 ggctgctcctgctgcagcagctgcc 1512



to top

>gb|AC148920.1| Mus musculus BAC clone RP23-273O10 from chromosome 19, complete sequence
          Length = 224526

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 570    ctaggacctctgcaaattctt 590
              |||||||||||||||||||||
Sbjct: 184919 ctaggacctctgcaaattctt 184899



to top

>gb|AC110230.12| Mus musculus chromosome 6, clone RP23-54L18, complete sequence
          Length = 216521

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 108   agagggagagggagttggaagagag 132
             |||||||||||||||||| ||||||
Sbjct: 80380 agagggagagggagttgggagagag 80356



to top

>gb|BC059275.1| Mus musculus protein phosphatase 1, regulatory (inhibitor) subunit
           3F, mRNA (cDNA clone IMAGE:3602251), partial cds
          Length = 3403

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 238 ggctgctccagctgcagcagctgccgcagctgg 270
           |||||| ||||| ||||||||||| ||||||||
Sbjct: 857 ggctgccccagcagcagcagctgcagcagctgg 889



to top

>ref|XM_548997.2| PREDICTED: Canis familiaris similar to protein phosphatase 1,
           regulatory (inhibitor) subunit 3F (LOC491877), mRNA
          Length = 2911

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 238 ggctgctccagctgcagcagctgccgcagctgg 270
           |||||| ||||| ||||||||||| ||||||||
Sbjct: 906 ggctgccccagcagcagcagctgcagcagctgg 938



to top

>ref|XM_619554.3| PREDICTED: Mus musculus lipoxygenase homology domains 1 (Loxhd1),
            mRNA
          Length = 3814

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 252  cagcagctgccgcagctggtgcttctcct 280
            ||||||||||||||||| || ||||||||
Sbjct: 2616 cagcagctgccgcagcttgtccttctcct 2588



to top

>ref|XM_973146.1| PREDICTED: Mus musculus lipoxygenase homology domains 1 (Loxhd1),
            mRNA
          Length = 7225

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 252  cagcagctgccgcagctggtgcttctcct 280
            ||||||||||||||||| || ||||||||
Sbjct: 3021 cagcagctgccgcagcttgtccttctcct 2993



to top

>ref|XM_916184.2| PREDICTED: Mus musculus lipoxygenase homology domains 1 (Loxhd1),
            mRNA
          Length = 7537

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 252  cagcagctgccgcagctggtgcttctcct 280
            ||||||||||||||||| || ||||||||
Sbjct: 3021 cagcagctgccgcagcttgtccttctcct 2993



to top

>gb|AC006317.3| Homo sapiens PAC clone RP4-715F13 from 7, complete sequence
          Length = 145878

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 190    tgcaccagctgctgctgctgt 210
              |||||||||||||||||||||
Sbjct: 141255 tgcaccagctgctgctgctgt 141235



to top

>gb|AC118227.12| Mus musculus chromosome 15, clone RP23-379H6, complete sequence
          Length = 200663

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 246    cagctgcagcagctgccgcag 266
              |||||||||||||||||||||
Sbjct: 134301 cagctgcagcagctgccgcag 134321



to top

>emb|AJ578520.1|EGU578520 Elaeis guineensis microsatellite DNA, clone mEgCIR0409
          Length = 887

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 77  aagcttgacgcaatcgcagctaagcagctgcagagggagagggagttggaaga 129
           |||||||| ||||| ||||  | ||||  ||||||||||||||| ||||||||
Sbjct: 182 aagcttgatgcaattgcagaaaggcagaggcagagggagagggaattggaaga 234



to top

>emb|BX901973.12| Zebrafish DNA sequence from clone DKEY-26L17 in linkage group 3, complete
              sequence
          Length = 226081

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 397    ggaagctcctcctctgcgtga 417
              |||||||||||||||||||||
Sbjct: 213582 ggaagctcctcctctgcgtga 213562



to top

>emb|Z79754.1|CEF25H2 Caenorhabditis elegans Cosmid F25H2, complete sequence
          Length = 42366

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                      
Query: 239   gctgctccagctgcagcagctgccgcagctggtgcttctcc 279
             |||||||||||||| || |||||| |||||| |||| ||||
Sbjct: 34949 gctgctccagctgccgccgctgccccagctgctgctgctcc 34989



to top

>ref|NM_001030575.1| Gallus gallus similar to KIAA1609 protein (LOC415815), mRNA
          Length = 3768

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 126  aagagagggaaaaacagagaa 146
            |||||||||||||||||||||
Sbjct: 1076 aagagagggaaaaacagagaa 1056



to top

>gb|BC069862.1| Mus musculus dihydrolipoamide S-acetyltransferase (E2 component of
            pyruvate dehydrogenase complex), mRNA (cDNA clone
            MGC:78049 IMAGE:5388446), complete cds
          Length = 2084

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 238  ggctgctccagctgcagcagctgcc 262
            ||||||||| |||||||||||||||
Sbjct: 1230 ggctgctcctgctgcagcagctgcc 1254



to top

>emb|AJ720309.1| Gallus gallus mRNA for hypothetical protein, clone 14k7
          Length = 3768

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 126  aagagagggaaaaacagagaa 146
            |||||||||||||||||||||
Sbjct: 1076 aagagagggaaaaacagagaa 1056



to top

>gb|AC153131.5| Mus musculus BAC clone RP24-356O12 from chromosome 19, complete
             sequence
          Length = 184864

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 570   ctaggacctctgcaaattctt 590
             |||||||||||||||||||||
Sbjct: 78418 ctaggacctctgcaaattctt 78398



to top

>gb|AY122901.1| Arabidopsis thaliana At2g39900/T28M21.6 mRNA, complete cds
          Length = 603

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 237 cggctgctccagctgcagcagctgc 261
           |||||||| ||||||||||||||||
Sbjct: 589 cggctgctacagctgcagcagctgc 565



to top

>gb|AE012146.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 54 of
            460 of the complete genome
          Length = 12022

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 254  gcagctgccgcagctggtgct 274
            |||||||||||||||||||||
Sbjct: 5952 gcagctgccgcagctggtgct 5932



to top

>gb|AY094448.1| Arabidopsis thaliana At2g39900/T28M21.6 mRNA, complete cds
          Length = 948

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 237 cggctgctccagctgcagcagctgc 261
           |||||||| ||||||||||||||||
Sbjct: 764 cggctgctacagctgcagcagctgc 740



to top

>gb|AF002109.3| Arabidopsis thaliana chromosome 2 clone T28M21 map CIC10A06, complete
             sequence
          Length = 108847

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 237   cggctgctccagctgcagcagctgc 261
             |||||||| ||||||||||||||||
Sbjct: 28914 cggctgctacagctgcagcagctgc 28890



to top

>dbj|AK137960.1| Mus musculus 16 days neonate thymus cDNA, RIKEN full-length enriched
            library, clone:A130047L23 product:unclassifiable, full
            insert sequence
          Length = 2899

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 103  gctgcagagggagagggagttggaa 127
            |||| ||||||||||||||||||||
Sbjct: 2258 gctggagagggagagggagttggaa 2282



to top

>gb|AY044265.1| Mus musculus dihydrolipoamide S-acetyltransferase precursor, mRNA,
           partial cds
          Length = 1700

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 238 ggctgctccagctgcagcagctgcc 262
           ||||||||| |||||||||||||||
Sbjct: 924 ggctgctcctgctgcagcagctgcc 948



to top

>dbj|AK166090.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-length enriched
            library, clone:G730037G16 product:dihydrolipoamide
            S-acetyltransferase (E2 component of pyruvate
            dehydrogenase complex), full insert sequence
          Length = 2530

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 238  ggctgctccagctgcagcagctgcc 262
            ||||||||| |||||||||||||||
Sbjct: 1257 ggctgctcctgctgcagcagctgcc 1281



to top

>gb|AC154550.2| Mus musculus BAC clone RP23-444H18 from chromosome 13, complete
             sequence
          Length = 190647

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 103   gctgcagagggagagggagttggaa 127
             |||| ||||||||||||||||||||
Sbjct: 32821 gctggagagggagagggagttggaa 32845



to top

>dbj|AK032124.1| Mus musculus adult male medulla oblongata cDNA, RIKEN full-length
            enriched library, clone:6332404G05
            product:DIHYDROLIPOAMIDE ACETYLTRANSFERASE PRECURSOR (EC
            2.3.1.12) homolog [Sus scrofa], full insert sequence
          Length = 4034

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 238  ggctgctccagctgcagcagctgcc 262
            ||||||||| |||||||||||||||
Sbjct: 1488 ggctgctcctgctgcagcagctgcc 1512



to top

>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome
          Length = 5148708

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 254    gcagctgccgcagctggtgct 274
              |||||||||||||||||||||
Sbjct: 593808 gcagctgccgcagctggtgct 593788



to top

>ref|NM_060365.3| Caenorhabditis elegans F25H2.10 (deoxyribonuclease) mRNA, complete
           cds
          Length = 1030

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 239 gctgctccagctgcagcagctgccgcagctggtgcttctcc 279
           |||||||||||||| || |||||| |||||| |||| ||||
Sbjct: 877 gctgctccagctgccgccgctgccccagctgctgctgctcc 917



to top

>dbj|AK030047.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
            library, clone:4932417K07 product:HYPOTHETICAL 76.6 KDA
            PROTEIN homolog [Macaca fascicularis], full insert
            sequence
          Length = 3814

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 252  cagcagctgccgcagctggtgcttctcct 280
            ||||||||||||||||| || ||||||||
Sbjct: 2616 cagcagctgccgcagcttgtccttctcct 2588



to top

>dbj|AK043771.1| Mus musculus 10 days neonate cortex cDNA, RIKEN full-length enriched
            library, clone:A830030N02 product:DIHYDROLIPOAMIDE
            S-ACETYLTRANSFERASE (FRAGMENT) homolog [Mus musculus],
            full insert sequence
          Length = 3555

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 238  ggctgctccagctgcagcagctgcc 262
            ||||||||| |||||||||||||||
Sbjct: 1176 ggctgctcctgctgcagcagctgcc 1200



to top

>gb|AF229644.1|AF229644 Mus musculus DXImx48e protein (DXImx48e) mRNA, complete cds
          Length = 2968

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 238 ggctgctccagctgcagcagctgccgcagctgg 270
           |||||| ||||| ||||||||||| ||||||||
Sbjct: 762 ggctgccccagcagcagcagctgcagcagctgg 794



to top

>gb|AC023545.16| Homo sapiens chromosome 15, clone RP11-665J16, complete sequence
          Length = 108173

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 126   aagagagggaaaaacagagaa 146
             |||||||||||||||||||||
Sbjct: 62109 aagagagggaaaaacagagaa 62089



to top

>emb|BX842049.1|CNS09Y98 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL12ZB11 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 904

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 237 cggctgctccagctgcagcagctgc 261
           |||||||| ||||||||||||||||
Sbjct: 719 cggctgctacagctgcagcagctgc 695



to top

>gb|AC010931.17| Homo sapiens chromosome 15, clone RP11-247C2, complete sequence
          Length = 93600

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 126  aagagagggaaaaacagagaa 146
            |||||||||||||||||||||
Sbjct: 2090 aagagagggaaaaacagagaa 2110



to top

>gb|AF277994.1|AF277994 Mus musculus scurfin (Foxp3) gene, complete cds
          Length = 30858

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                             
Query: 238  ggctgctccagctgcagcagctgccgcagctgg 270
            |||||| ||||| ||||||||||| ||||||||
Sbjct: 6194 ggctgccccagcagcagcagctgcagcagctgg 6162



to top

>gb|AC007100.3| Homo sapiens BAC clone RP11-462D13 from 2, complete sequence
          Length = 210344

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 108   agagggagagggagttggaagagag 132
             |||||||||||||| ||||||||||
Sbjct: 80775 agagggagagggagatggaagagag 80799



to top

>ref|NM_204237.1| Gallus gallus transducin-like enhancer of split 4 (E(sp1) homolog,
            Drosophila) (TLE4), mRNA
          Length = 2781

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 233  gcagcggctgctccagctgcagcagctgc 261
            |||||||||||  ||||||||||||||||
Sbjct: 1213 gcagcggctgcagcagctgcagcagctgc 1241



to top

>ref|NM_138605.1| Mus musculus protein phosphatase 1, regulatory (inhibitor) subunit
           3F (Ppp1r3f), mRNA
          Length = 2968

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 238 ggctgctccagctgcagcagctgccgcagctgg 270
           |||||| ||||| ||||||||||| ||||||||
Sbjct: 762 ggctgccccagcagcagcagctgcagcagctgg 794



to top

>ref|XM_343775.2| PREDICTED: Rattus norvegicus similar to DXImx48e protein
           (LOC363453), mRNA
          Length = 1731

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 238 ggctgctccagctgcagcagctgccgcagctgg 270
           |||||| ||||| ||||||||||| ||||||||
Sbjct: 371 ggctgccccagcagcagcagctgcagcagctgg 403



to top

>gb|U82806.1|XMU82806 Xiphophorus maculatus melanoma receptor tyrosine kinase gene,
           partial cds
          Length = 90

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 231 cagcagcggctgctccagctgcagcagctgccgcagc 267
           ||||||| || ||| |||||||||||||||| |||||
Sbjct: 63  cagcagcagcagctgcagctgcagcagctgcagcagc 27



to top

>emb|AL928812.11| Mouse DNA sequence from clone RP23-321B23 on chromosome 2, complete
             sequence
          Length = 199019

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 132   gggaaaaacagagaagggagg 152
             |||||||||||||||||||||
Sbjct: 19369 gggaaaaacagagaagggagg 19349



to top

>gb|AC155259.1| Mus musculus BAC clone RP24-70C15 from 9, complete sequence
          Length = 222729

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 307    tgagggtgacagtagcagtca 327
              |||||||||||||||||||||
Sbjct: 119009 tgagggtgacagtagcagtca 119029



to top

>gb|BC026680.1| Mus musculus dihydrolipoamide S-acetyltransferase (E2 component of
            pyruvate dehydrogenase complex), mRNA (cDNA clone
            MGC:37696 IMAGE:5059786), complete cds
          Length = 2101

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 238  ggctgctccagctgcagcagctgcc 262
            ||||||||| |||||||||||||||
Sbjct: 1235 ggctgctcctgctgcagcagctgcc 1259



to top

>dbj|AB080584.1| Gallus gallus Grg4 mRNA for groucho-related gene 4, complete cds
          Length = 2781

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 233  gcagcggctgctccagctgcagcagctgc 261
            |||||||||||  ||||||||||||||||
Sbjct: 1213 gcagcggctgcagcagctgcagcagctgc 1241



to top

>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome
          Length = 3566135

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 243     ctccagctgcagcagctgccg 263
               |||||||||||||||||||||
Sbjct: 1000054 ctccagctgcagcagctgccg 1000074



to top

>emb|AL731793.18| Mouse DNA sequence from clone RP23-135F22 on chromosome X, complete
              sequence
          Length = 149465

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                               
Query: 238    ggctgctccagctgcagcagctgccgcagctgg 270
              |||||| ||||| ||||||||||| ||||||||
Sbjct: 137580 ggctgccccagcagcagcagctgcagcagctgg 137548



to top

>gb|BC060320.1| Homo sapiens transducin (beta)-like 1X-linked receptor 1, mRNA
           (cDNA clone IMAGE:4358996), partial cds
          Length = 566

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 246 cagctgcagcagctgccgcagctg 269
           ||||||| ||||||||||||||||
Sbjct: 506 cagctgctgcagctgccgcagctg 529



to top

>gb|AY304002.1| Ovis aries prion protein gene, partial cds
          Length = 99

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 91  ctgctccagctgcagcagct 72



to top

>gb|AY320375.1| Bos taurus prion protein gene, partial cds
          Length = 396

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 322 ctgctccagctgcagcagct 303



to top

>gb|AY320373.1| Bos taurus prion protein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 244 ctgctccagctgcagcagct 225



to top

>gb|AY320372.1| Bos taurus prion protein gene, partial cds
          Length = 312

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 307 ctgctccagctgcagcagct 288



to top

>gb|AY320370.1| Bos taurus prion protein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 304 ctgctccagctgcagcagct 285



to top

>gb|AY320369.1| Bos taurus prion protein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 304 ctgctccagctgcagcagct 285



to top

>gb|AY320368.1| Bos taurus prion protein gene, partial cds
          Length = 360

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 304 ctgctccagctgcagcagct 285



to top

>gb|AY320367.1| Bos taurus prion protein gene, partial cds
          Length = 399

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 307 ctgctccagctgcagcagct 288



to top

>gb|AY320366.1| Bos taurus prion protein gene, partial cds
          Length = 399

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 307 ctgctccagctgcagcagct 288



to top

>gb|AY769958.1| Bison bison prion protein PrP (Prnp) gene, intron 2 and complete cds
          Length = 1422

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 240  ctgctccagctgcagcagct 259
            ||||||||||||||||||||
Sbjct: 1019 ctgctccagctgcagcagct 1000



to top

>gb|AY769957.1| Ovis canadensis canadensis prion protein PrP (Prnp) gene, intron 2
            and complete cds
          Length = 1405

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 240  ctgctccagctgcagcagct 259
            ||||||||||||||||||||
Sbjct: 1002 ctgctccagctgcagcagct 983



to top

>gb|AY769955.1| Capreolus capreolus prion protein PrP (Prnp) gene, intron 2 and
            complete cds
          Length = 1498

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 240  ctgctccagctgcagcagct 259
            ||||||||||||||||||||
Sbjct: 1006 ctgctccagctgcagcagct 987



to top

>gb|DQ205538.1| Bos taurus prion protein (PRNP) and prion-like protein doppel (PRND)
             genes, complete cds; PRNT (PRNT) gene, exons 1 and 2; and
             putative protein gene, complete cds
          Length = 104027

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 240   ctgctccagctgcagcagct 259
             ||||||||||||||||||||
Sbjct: 65970 ctgctccagctgcagcagct 65951



to top

>ref|NM_128172.2| Arabidopsis thaliana FTSH4; ATP-dependent peptidase/ ATPase/
            metallopeptidase AT2G26140 (FTSH4) mRNA, complete cds
          Length = 2713

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 246  cagctgcagcagctgccgcagctg 269
            |||| |||||||||||||||||||
Sbjct: 2261 cagccgcagcagctgccgcagctg 2284



to top

>gb|AY769894.1| Bubalus bubalis prion protein (Prp) mRNA, partial cds
          Length = 630

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 298 ctgctccagctgcagcagct 279



to top

>gb|AY423026.1| Danio rerio dystrobrevin, beta (DTNB) mRNA, complete cds
          Length = 3069

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 615 ggaggcgctgaagcttcctg 634
           ||||||||||||||||||||
Sbjct: 462 ggaggcgctgaagcttcctg 481



to top

>gb|AC168217.2| Mus musculus BAC clone RP24-498P8 from chromosome 9, complete sequence
          Length = 171426

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 242    gctccagctgcagcagctgc 261
              ||||||||||||||||||||
Sbjct: 163785 gctccagctgcagcagctgc 163766



to top

>ref|XM_520248.1| PREDICTED: Pan troglodytes similar to nuclear receptor subfamily 5,
           group A, member 1; fushi tarazu factor (Drosophila)
           homolog 1; steroidogenic factor-1 (LOC464724), mRNA
          Length = 1401

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 242 gctccagctgcagcagctgc 261
           ||||||||||||||||||||
Sbjct: 766 gctccagctgcagcagctgc 747



to top

>gb|AC154392.18| Mus musculus chromosome 1, clone RP23-413K6, complete sequence
          Length = 205076

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 108  agagggagagggagttggaagagaggga 135
            ||||||||||||||  ||||||||||||
Sbjct: 7338 agagggagagggagagggaagagaggga 7311



to top

>ref|XM_526387.1| PREDICTED: Pan troglodytes similar to nuclear receptor
           co-repressor/HDAC3 complex subunit; TBL1-related protein
           1 (LOC471003), mRNA
          Length = 1635

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 246 cagctgcagcagctgccgcagctg 269
           ||||||| ||||||||||||||||
Sbjct: 419 cagctgctgcagctgccgcagctg 442



to top

>ref|NM_024665.3| Homo sapiens transducin (beta)-like 1X-linked receptor 1 (TBL1XR1),
           mRNA
          Length = 5911

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 246 cagctgcagcagctgccgcagctg 269
           ||||||| ||||||||||||||||
Sbjct: 579 cagctgctgcagctgccgcagctg 602



to top

>gb|AY768534.1| Bubalus bubalis isolate JW42_2 prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY768533.1| Bubalus bubalis isolate JW42_1 prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720706.1| Antilope cervicapra isolate BlackbuckhomoB prion protein (PRNP)
           gene, exon 3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720705.1| Antilope cervicapra isolate BlackbuckhomoA prion protein (PRNP)
           gene, exon 3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720704.1| Tragelaphus imberbis isolate Z14HomoB prion protein (PRNP) gene,
           exon 3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720703.1| Tragelaphus imberbis isolate Z14HomoA prion protein (PRNP) gene,
           exon 3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720698.1| Bos gaurus isolate GaurhomoB prion protein (PRNP) gene, exon 3 and
           complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720697.1| Bos gaurus isolate GaurhomoA prion protein (PRNP) gene, exon 3 and
           complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720696.1| Bison bison isolate CR227All1 prion protein (PRNP) gene, exon 3 and
           complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720695.1| Bison bison isolate CR227All2 prion protein (PRNP) gene, exon 3 and
           complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720694.1| Bos javanicus isolate TWBt2 prion protein (PRNP) gene, exon 3 and
           complete cds
          Length = 771

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 370 ctgctccagctgcagcagct 351



to top

>gb|AY720693.1| Bos javanicus isolate TWBt6 prion protein (PRNP) gene, exon 3 and
           complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720692.1| Bos javanicus isolate Bt478-2 prion protein (PRNP) gene, exon 3 and
           complete cds
          Length = 771

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 370 ctgctccagctgcagcagct 351



to top

>gb|AY720691.1| Bos javanicus isolate Bt478-1 prion protein (PRNP) gene, exon 3 and
           complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720690.1| Bubalus bubalis isolate JW41_2 prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720689.1| Bubalus bubalis isolate JW41_1 prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720688.1| Bubalus depressicornis isolate Ano2 prion protein (PRNP) gene, exon
           3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720687.1| Bubalus depressicornis isolate Ano1 prion protein (PRNP) gene, exon
           3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720686.1| Syncerus caffer caffer isolate Z17-7 prion protein (PRNP) gene,
           exon 3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720685.1| Syncerus caffer caffer isolate Z17-1 prion protein (PRNP) gene,
           exon 3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720684.1| Syncerus caffer nanus isolate Z18-2 prion protein (PRNP) gene, exon
           3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720683.1| Syncerus caffer nanus isolate Z18-1 prion protein (PRNP) gene, exon
           3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720682.1| Bos indicus isolate 24Brahman2 prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720681.1| Bos indicus isolate 27Brahmousin2 prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720680.1| Bos indicus isolate 24Brahman1 prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720679.1| Bos indicus isolate 27Brahmousin1 prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720678.1| Bos taurus isolate 52SalersB prion protein (PRNP) gene, exon 3 and
           complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720677.1| Bos taurus isolate 52SalersA prion protein (PRNP) gene, exon 3 and
           complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720676.1| Bos taurus isolate 56BelgianBlueB prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720675.1| Bos taurus isolate 56BelgianBlueA prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720674.1| Bos taurus isolate 40Brwnsws1 prion protein (PRNP) gene, exon 3 and
           complete cds
          Length = 819

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 418 ctgctccagctgcagcagct 399



to top

>gb|AY720673.1| Bos taurus isolate Brownswiss41.7 prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 819

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 418 ctgctccagctgcagcagct 399



to top

>gb|AY720672.1| Bos taurus isolate Brownswiss39.3 prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 747

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 346 ctgctccagctgcagcagct 327



to top

>gb|AY720671.1| Bos taurus isolate 53SalersB prion protein (PRNP) gene, exon 3 and
           complete cds
          Length = 771

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 370 ctgctccagctgcagcagct 351



to top

>gb|AY720670.1| Bos taurus isolate 53SalersA prion protein (PRNP) gene, exon 3 and
           complete cds
          Length = 771

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 370 ctgctccagctgcagcagct 351



to top

>gb|AY720669.1| Bos taurus isolate Branvieh37.3 prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 771

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 370 ctgctccagctgcagcagct 351



to top

>gb|AY720668.1| Bos taurus isolate Charolais45.7 prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 771

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 370 ctgctccagctgcagcagct 351



to top

>gb|AY720667.1| Bos taurus isolate 59GelbviehFB1 prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 771

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 370 ctgctccagctgcagcagct 351



to top

>gb|AY720666.1| Bos indicus isolate IndiaNelore12B prion protein (PRNP) gene, exon
           3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720665.1| Bos indicus isolate IndiaNelore12A prion protein (PRNP) gene, exon
           3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720664.1| Bos taurus isolate Braunvieh37.1 prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720663.1| Bos taurus isolate 58CorrienteB prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720662.1| Bos taurus isolate 58CorrienteA prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720661.1| Bos indicus isolate 19BrafordB prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720660.1| Bos indicus isolate 19BrafordA prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720659.1| Bos indicus isolate 98RomagnolaB prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720658.1| Bos indicus isolate 98RomagnolaA prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720657.1| Bos taurus isolate 84MaineAnjouB prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720656.1| Bos taurus isolate 84MaineAnjouA prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720655.1| Bos taurus isolate 71GelbviehB prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720654.1| Bos taurus isolate 71GelbviehA prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720653.1| Bos taurus isolate 70GelbviehB prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720652.1| Bos taurus isolate 70GelbviehA prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720651.1| Bos taurus isolate 57BlondDAqtnB prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720650.1| Bos taurus isolate 57BlondDAqtnA prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720649.1| Bos taurus isolate 50LonghornB prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720648.1| Bos taurus isolate 50LonghornA prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720647.1| Bos indicus isolate 11BeefmasterB prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720646.1| Bos indicus isolate 11BeefmasterA prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720645.1| Bos taurus isolate 117SimmentalBKB prion protein (PRNP) gene, exon
           3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720644.1| Bos taurus isolate 117SimmentalBKA prion protein (PRNP) gene, exon
           3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720643.1| Bos taurus isolate 114SimmentalRDB prion protein (PRNP) gene, exon
           3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720642.1| Bos taurus isolate 114SimmentalRDA prion protein (PRNP) gene, exon
           3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720641.1| Bos taurus isolate 80Limousin2 prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 771

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 370 ctgctccagctgcagcagct 351



to top

>gb|AY720640.1| Bos taurus isolate 80Limousin1 prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720639.1| Bos indicus isolate 112SimbrahB prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720638.1| Bos indicus isolate 112SimbrahA prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720637.1| Bos taurus isolate 113SimmentalRDB prion protein (PRNP) gene, exon
           3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720636.1| Bos taurus isolate 113SimmentalRDA prion protein (PRNP) gene, exon
           3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720635.1| Bos taurus isolate 116SimmentalRDB prion protein (PRNP) gene, exon
           3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720634.1| Bos taurus isolate 116SimmentalRDA prion protein (PRNP) gene, exon
           3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720633.1| Bos taurus isolate 118SimmentalBKB prion protein (PRNP) gene, exon
           3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720632.1| Bos taurus isolate 118SimmentalBKA prion protein (PRNP) gene, exon
           3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720631.1| Bos taurus isolate 119SimmentalBKB prion protein (PRNP) gene, exon
           3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720630.1| Bos taurus isolate 119SimmentalBKA prion protein (PRNP) gene, exon
           3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720629.1| Bos taurus isolate 120SimmentalBKB prion protein (PRNP) gene, exon
           3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720628.1| Bos taurus isolate 120SimmentalBKA prion protein (PRNP) gene, exon
           3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720627.1| Bos taurus isolate 126A3XCrossB prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720626.1| Bos taurus isolate 126A3XCrossA prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720625.1| Bos taurus isolate 13BelgianBlueB prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720624.1| Bos taurus isolate 13BelgianBlueA prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720623.1| Bos taurus isolate 14BelgianBlueB prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720622.1| Bos taurus isolate 14BelgianBlueA prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720621.1| Bos indicus isolate 21BrafordB prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720620.1| Bos indicus isolate 21BrafordA prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720619.1| Bos indicus isolate 22BrafordB prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720618.1| Bos indicus isolate 22BrafordA prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720617.1| Bos indicus isolate 25BrahmanB prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720616.1| Bos indicus isolate 25BrahmanA prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720615.1| Bos indicus isolate 32BrangusB prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720614.1| Bos indicus isolate 32BrangusA prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720613.1| Bos taurus isolate 47CharolaisB prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720612.1| Bos taurus isolate 47CharolaisA prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720611.1| Bos taurus isolate 55TarentaiseB prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720610.1| Bos taurus isolate 55TarentaiseA prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720609.1| Bos taurus isolate 5AngusB prion protein (PRNP) gene, exon 3 and
           complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720608.1| Bos taurus isolate 5AngusA prion protein (PRNP) gene, exon 3 and
           complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720607.1| Bos taurus isolate 60MurrayGreyB prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720606.1| Bos taurus isolate 60MurrayGreyA prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720605.1| Bos taurus isolate 66ChianinaChiaB prion protein (PRNP) gene, exon
           3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720604.1| Bos taurus isolate 66ChianinaChiaA prion protein (PRNP) gene, exon
           3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720603.1| Bos taurus isolate 67ChianinaChiaB prion protein (PRNP) gene, exon
           3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720602.1| Bos taurus isolate 67ChianinaChiaA prion protein (PRNP) gene, exon
           3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720601.1| Bos taurus isolate 69GelbviehB prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720600.1| Bos taurus isolate 69GelbviehA prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720599.1| Bos taurus X Bison bison isolate 6BeefaloB prion protein (PRNP)
           gene, exon 3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720598.1| Bos taurus X Bison bison isolate 6BeefaloA prion protein (PRNP)
           gene, exon 3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720597.1| Bos taurus isolate 73HolsteinB prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720596.1| Bos taurus isolate 73HolsteinA prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720595.1| Bos taurus isolate 76HolsteinB prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720594.1| Bos taurus isolate 76HolsteinA prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720593.1| Bos indicus isolate 7BeefmasterB prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720592.1| Bos indicus isolate 7BeefmasterA prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720591.1| Bos taurus isolate 83MneAnjou1 prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720590.1| Bos indicus isolate 88PiedmonteseB prion protein (PRNP) gene, exon
           3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720589.1| Bos indicus isolate 88PiedmonteseA prion protein (PRNP) gene, exon
           3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720588.1| Bos taurus isolate Brownswiss39.2 prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720587.1| Bos indicus isolate 86USNeloreB prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720586.1| Bos indicus isolate 86USNeloreA prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720584.1| Bos taurus isolate 62ScottishHighldB prion protein (PRNP) gene,
           exon 3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720583.1| Bos taurus isolate 62ScottishHighldA prion protein (PRNP) gene,
           exon 3 and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375



to top

>gb|AY720582.1| Bos taurus isolate 108ShorthornB prion protein (PRNP) gene, exon 3
           and complete cds
          Length = 795

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 ctgctccagctgcagcagct 259
           ||||||||||||||||||||
Sbjct: 394 ctgctccagctgcagcagct 375


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,600,644
Number of Sequences: 3902068
Number of extensions: 6600644
Number of successful extensions: 276968
Number of sequences better than 10.0: 757
Number of HSP's better than 10.0 without gapping: 759
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 274192
Number of HSP's gapped (non-prelim): 2739
length of query: 675
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 652
effective length of database: 17,143,297,704
effective search space: 11177430103008
effective search space used: 11177430103008
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top