| Clone Name | bags13c10 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY107115.1| Zea mays PCO107270 mRNA sequence Length = 1658 Score = 690 bits (348), Expect = 0.0 Identities = 593/675 (87%) Strand = Plus / Plus Query: 1 caccgtgcggngattagcatttacttcgtcaaaggaggatgttctcgggcgtcatgatgc 60 |||||||||| | || | ||||| ||||| ||||| |||||| | ||||| ||||||| Sbjct: 512 caccgtgcggaggttggtatttagctcgtccaaggaagatgttttggggcggcatgatgg 571 Query: 61 tccagttcgttgtgtggagtactcttatgctgcaggacaagtcatcactggcagctggga 120 ||| |||||||| ||||| ||||||||||||||||| ||||||||||| ||||||||||| Sbjct: 572 tccggttcgttgcgtggaatactcttatgctgcaggtcaagtcatcaccggcagctggga 631 Query: 121 taagacaattaaatgctgggatcccagaggagttagcggaccagagcggacacttgttgg 180 ||| || | |||||||||||||| ||||||||||| ||||||||||| || |||||||| Sbjct: 632 taaaactgtaaaatgctgggatccaagaggagttagtggaccagagcgcacccttgttgg 691 Query: 181 gacatatgctcaaccagagcgtgtatattctatgtcactggtgggaaataggttggttgt 240 ||||||||||||||| || |||||||||||| | || | || ||||||||||||||||| Sbjct: 692 gacatatgctcaacctgaacgtgtatattctctttcgttagtaggaaataggttggttgt 751 Query: 241 ggcaacagcaggaagacatgtcagtatttatgatttgcgcaatatgtctcaacctgagca 300 |||||||| ||||||||||| | |||||||||| ||||||||||||||||||||||||| Sbjct: 752 tgcaacagctggaagacatgtaaatatttatgatctgcgcaatatgtctcaacctgagca 811 Query: 301 aaaaagggaatcctctttgaaatatcaaacacgctgtgttcgatgtttccccaacggaac 360 |||||| || || |||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 812 aaaaagagactcttctttgaaatatcaaacacgatgtgttcgatgttttcccaacggaac 871 Query: 361 agggtatgctctaagttctgtggagggacgagtgtctatggagttctttgacctttctga 420 ||| |||||||| |||||||| || || ||||| |||||||| |||||||| || ||||| Sbjct: 872 aggatatgctcttagttctgttgaagggcgagtttctatggaattctttgatctatctga 931 Query: 421 gtcggcacaatctaaaaagtatgctttcaagtgtcaccggaaatctgagtctggcaggga 480 ||| || ||||||||||||||||||||||||||||| ||||| |||||| | |||||||| Sbjct: 932 gtctgctcaatctaaaaagtatgctttcaagtgtcatcggaagtctgaggccggcaggga 991 Query: 481 cactgtttatcctgtcaatgccattgcattccatccaatatacggcacatttgccactgg 540 ||| ||||||||||||||||| ||||| |||||||| ||||| || ||||||||||| || Sbjct: 992 caccgtttatcctgtcaatgcaattgctttccatcccatatatggaacatttgccaccgg 1051 Query: 541 aggccatgatggatttgtgaacgtgtgggatggcacgaacaagaagagattgtatcagta 600 ||| ||||||||||||||| ||||||||||||| |||||||| ||| | |||||||| Sbjct: 1052 agggtgtgatggatttgtgaatgtgtgggatggcattaacaagaaaagactatatcagta 1111 Query: 601 ctcaaagtacgcgtcaagcattgcctctctgtcgttcagtaaggatgggcatctgcttgc 660 ||| |||||||| |||||||| || |||| || |||||||||||||||||||||||||| Sbjct: 1112 ctcgaagtacgcatcaagcatcgctgctctatcattcagtaaggatgggcatctgcttgc 1171 Query: 661 tgtggcatcaagcta 675 ||||||||| ||||| Sbjct: 1172 tgtggcatccagcta 1186
>ref|XM_468891.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1354 Score = 672 bits (339), Expect = 0.0 Identities = 552/623 (88%) Strand = Plus / Plus Query: 53 catgatgctccagttcgttgtgtggagtactcttatgctgcaggacaagtcatcactggc 112 ||||||||||| ||||| || ||||||||||||||||||||||| ||||||||||||||| Sbjct: 418 catgatgctcctgttcgctgcgtggagtactcttatgctgcaggtcaagtcatcactggc 477 Query: 113 agctgggataagacaattaaatgctgggatcccagaggagttagcggaccagagcggaca 172 |||||||||||||| || || || |||||||| ||||| || || ||||||||||| || Sbjct: 478 agctgggataagactatcaagtgttgggatccaagaggtgtaagtggaccagagcgtacg 537 Query: 173 cttgttgggacatatgctcaaccagagcgtgtatattctatgtcactggtgggaaatagg 232 ||||||||||||||||||||||| ||||||||||||||| |||| | ||||| |||||| Sbjct: 538 cttgttgggacatatgctcaacctgagcgtgtatattctctgtcgttagtggggaatagg 597 Query: 233 ttggttgtggcaacagcaggaagacatgtcagtatttatgatttgcgcaatatgtctcaa 292 |||||||| |||||||||||||||||||||| |||||||||| |||| |||||||||||| Sbjct: 598 ttggttgttgcaacagcaggaagacatgtcaatatttatgatctgcgtaatatgtctcaa 657 Query: 293 cctgagcaaaaaagggaatcctctttgaaatatcaaacacgctgtgttcgatgtttcccc 352 | ||||||||||||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 658 catgagcaaaaaagggactcttctttgaaatatcaaacacgttgtgttcgatgtttcccc 717 Query: 353 aacggaacagggtatgctctaagttctgtggagggacgagtgtctatggagttctttgac 412 || |||||||| ||||| ||||||||||| || |||||||| |||||||| |||||||| Sbjct: 718 aatggaacaggatatgccctaagttctgttgaaggacgagtttctatggaattctttgat 777 Query: 413 ctttctgagtcggcacaatctaaaaagtatgctttcaagtgtcaccggaaatctgagtct 472 || |||||||| || ||||||||||||||||||||||||||||| |||||||| || || Sbjct: 778 ctatctgagtctgctcaatctaaaaagtatgctttcaagtgtcatcggaaatcagaagct 837 Query: 473 ggcagggacactgtttatcctgtcaatgccattgcattccatccaatatacggcacattt 532 ||| ||||||| ||||||||||||||||| |||||||||||||||||||| || |||||| Sbjct: 838 ggccgggacaccgtttatcctgtcaatgcaattgcattccatccaatatatggtacattt 897 Query: 533 gccactggaggccatgatggatttgtgaacgtgtgggatggcacgaacaagaagagattg 592 |||||||| || ||| ||||||||||| || |||||||||| |||||||| ||| | Sbjct: 898 gccactggtgggtgtgacggatttgtgaatgtatgggatggcattaacaagaaaagacta 957 Query: 593 tatcagtactcaaagtacgcgtcaagcattgcctctctgtcgttcagtaaggatgggcat 652 |||||||| |||||||| ||||||||||| || || |||| || |||||||||||||| Sbjct: 958 tatcagtattcaaagtatgcgtcaagcatagctgctttgtcatttagtaaggatgggcac 1017 Query: 653 ctgcttgctgtggcatcaagcta 675 ||||| ||||||||||| ||||| Sbjct: 1018 ctgctcgctgtggcatccagcta 1040
>dbj|AK111867.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033045C11, full insert sequence Length = 1355 Score = 672 bits (339), Expect = 0.0 Identities = 552/623 (88%) Strand = Plus / Plus Query: 53 catgatgctccagttcgttgtgtggagtactcttatgctgcaggacaagtcatcactggc 112 ||||||||||| ||||| || ||||||||||||||||||||||| ||||||||||||||| Sbjct: 419 catgatgctcctgttcgctgcgtggagtactcttatgctgcaggtcaagtcatcactggc 478 Query: 113 agctgggataagacaattaaatgctgggatcccagaggagttagcggaccagagcggaca 172 |||||||||||||| || || || |||||||| ||||| || || ||||||||||| || Sbjct: 479 agctgggataagactatcaagtgttgggatccaagaggtgtaagtggaccagagcgtacg 538 Query: 173 cttgttgggacatatgctcaaccagagcgtgtatattctatgtcactggtgggaaatagg 232 ||||||||||||||||||||||| ||||||||||||||| |||| | ||||| |||||| Sbjct: 539 cttgttgggacatatgctcaacctgagcgtgtatattctctgtcgttagtggggaatagg 598 Query: 233 ttggttgtggcaacagcaggaagacatgtcagtatttatgatttgcgcaatatgtctcaa 292 |||||||| |||||||||||||||||||||| |||||||||| |||| |||||||||||| Sbjct: 599 ttggttgttgcaacagcaggaagacatgtcaatatttatgatctgcgtaatatgtctcaa 658 Query: 293 cctgagcaaaaaagggaatcctctttgaaatatcaaacacgctgtgttcgatgtttcccc 352 | ||||||||||||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 659 catgagcaaaaaagggactcttctttgaaatatcaaacacgttgtgttcgatgtttcccc 718 Query: 353 aacggaacagggtatgctctaagttctgtggagggacgagtgtctatggagttctttgac 412 || |||||||| ||||| ||||||||||| || |||||||| |||||||| |||||||| Sbjct: 719 aatggaacaggatatgccctaagttctgttgaaggacgagtttctatggaattctttgat 778 Query: 413 ctttctgagtcggcacaatctaaaaagtatgctttcaagtgtcaccggaaatctgagtct 472 || |||||||| || ||||||||||||||||||||||||||||| |||||||| || || Sbjct: 779 ctatctgagtctgctcaatctaaaaagtatgctttcaagtgtcatcggaaatcagaagct 838 Query: 473 ggcagggacactgtttatcctgtcaatgccattgcattccatccaatatacggcacattt 532 ||| ||||||| ||||||||||||||||| |||||||||||||||||||| || |||||| Sbjct: 839 ggccgggacaccgtttatcctgtcaatgcaattgcattccatccaatatatggtacattt 898 Query: 533 gccactggaggccatgatggatttgtgaacgtgtgggatggcacgaacaagaagagattg 592 |||||||| || ||| ||||||||||| || |||||||||| |||||||| ||| | Sbjct: 899 gccactggtgggtgtgacggatttgtgaatgtatgggatggcattaacaagaaaagacta 958 Query: 593 tatcagtactcaaagtacgcgtcaagcattgcctctctgtcgttcagtaaggatgggcat 652 |||||||| |||||||| ||||||||||| || || |||| || |||||||||||||| Sbjct: 959 tatcagtattcaaagtatgcgtcaagcatagctgctttgtcatttagtaaggatgggcac 1018 Query: 653 ctgcttgctgtggcatcaagcta 675 ||||| ||||||||||| ||||| Sbjct: 1019 ctgctcgctgtggcatccagcta 1041
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 335 bits (169), Expect = 1e-88 Identities = 247/273 (90%) Strand = Plus / Minus Query: 91 tgcaggacaagtcatcactggcagctgggataagacaattaaatgctgggatcccagagg 150 |||||| ||||||||||||||||||||||||||||| || || || |||||||| ||||| Sbjct: 19001210 tgcaggtcaagtcatcactggcagctgggataagactatcaagtgttgggatccaagagg 19001151 Query: 151 agttagcggaccagagcggacacttgttgggacatatgctcaaccagagcgtgtatattc 210 || || ||||||||||| || ||||||||||||||||||||||| |||||||||||||| Sbjct: 19001150 tgtaagtggaccagagcgtacgcttgttgggacatatgctcaacctgagcgtgtatattc 19001091 Query: 211 tatgtcactggtgggaaataggttggttgtggcaacagcaggaagacatgtcagtattta 270 | |||| | ||||| |||||||||||||| |||||||||||||||||||||| |||||| Sbjct: 19001090 tctgtcgttagtggggaataggttggttgttgcaacagcaggaagacatgtcaatattta 19001031 Query: 271 tgatttgcgcaatatgtctcaacctgagcaaaaaagggaatcctctttgaaatatcaaac 330 |||| |||| ||||||||||||| ||||||||||||||| || ||||||||||||||||| Sbjct: 19001030 tgatctgcgtaatatgtctcaacatgagcaaaaaagggactcttctttgaaatatcaaac 19000971 Query: 331 acgctgtgttcgatgtttccccaacggaacagg 363 ||| |||||||||||||||||||| |||||||| Sbjct: 19000970 acgttgtgttcgatgtttccccaatggaacagg 19000938 Score = 105 bits (53), Expect = 2e-19 Identities = 74/81 (91%) Strand = Plus / Minus Query: 439 gtatgctttcaagtgtcaccggaaatctgagtctggcagggacactgtttatcctgtcaa 498 |||||||||||||||||| |||||||| || ||||| ||||||| |||||||||||||| Sbjct: 18996827 gtatgctttcaagtgtcatcggaaatcagaagctggccgggacaccgtttatcctgtcaa 18996768 Query: 499 tgccattgcattccatccaat 519 ||| ||||||||||||||||| Sbjct: 18996767 tgcaattgcattccatccaat 18996747 Score = 89.7 bits (45), Expect = 1e-14 Identities = 78/89 (87%) Strand = Plus / Minus Query: 360 cagggtatgctctaagttctgtggagggacgagtgtctatggagttctttgacctttctg 419 |||| ||||| ||||||||||| || |||||||| |||||||| |||||||| || |||| Sbjct: 19000208 caggatatgccctaagttctgttgaaggacgagtttctatggaattctttgatctatctg 19000149 Query: 420 agtcggcacaatctaaaaagtatgctttc 448 |||| || |||||||||||||||| |||| Sbjct: 19000148 agtctgctcaatctaaaaagtatgttttc 19000120 Score = 71.9 bits (36), Expect = 3e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 596 cagtactcaaagtacgcgtcaagcattgcctctctgtcgttcagtaaggatgggcatctg 655 ||||| |||||||| ||||||||||| || || |||| || |||||||||||||| ||| Sbjct: 18996514 cagtattcaaagtatgcgtcaagcatagctgctttgtcatttagtaaggatgggcacctg 18996455 Query: 656 cttgctgtggcatcaagcta 675 || ||||||||||| ||||| Sbjct: 18996454 ctcgctgtggcatccagcta 18996435 Score = 63.9 bits (32), Expect = 6e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 53 catgatgctccagttcgttgtgtggagtactcttatgctgcagg 96 ||||||||||| ||||| || ||||||||||||||||||||||| Sbjct: 19001995 catgatgctcctgttcgctgcgtggagtactcttatgctgcagg 19001952 Score = 48.1 bits (24), Expect = 0.038 Identities = 60/72 (83%) Strand = Plus / Minus Query: 527 acatttgccactggaggccatgatggatttgtgaacgtgtgggatggcacgaacaagaag 586 |||||||||||||| || ||| ||||||||||| || |||||||||| |||||||| Sbjct: 18996654 acatttgccactggtgggtgtgacggatttgtgaatgtatgggatggcattaacaagaaa 18996595 Query: 587 agattgtatcag 598 ||| | |||||| Sbjct: 18996594 agactatatcag 18996583
>gb|AC135597.5| Oryza sativa chromosome 3 BAC OSJNBa0034E08 genomic sequence, complete sequence Length = 171437 Score = 335 bits (169), Expect = 1e-88 Identities = 247/273 (90%) Strand = Plus / Plus Query: 91 tgcaggacaagtcatcactggcagctgggataagacaattaaatgctgggatcccagagg 150 |||||| ||||||||||||||||||||||||||||| || || || |||||||| ||||| Sbjct: 156367 tgcaggtcaagtcatcactggcagctgggataagactatcaagtgttgggatccaagagg 156426 Query: 151 agttagcggaccagagcggacacttgttgggacatatgctcaaccagagcgtgtatattc 210 || || ||||||||||| || ||||||||||||||||||||||| |||||||||||||| Sbjct: 156427 tgtaagtggaccagagcgtacgcttgttgggacatatgctcaacctgagcgtgtatattc 156486 Query: 211 tatgtcactggtgggaaataggttggttgtggcaacagcaggaagacatgtcagtattta 270 | |||| | ||||| |||||||||||||| |||||||||||||||||||||| |||||| Sbjct: 156487 tctgtcgttagtggggaataggttggttgttgcaacagcaggaagacatgtcaatattta 156546 Query: 271 tgatttgcgcaatatgtctcaacctgagcaaaaaagggaatcctctttgaaatatcaaac 330 |||| |||| ||||||||||||| ||||||||||||||| || ||||||||||||||||| Sbjct: 156547 tgatctgcgtaatatgtctcaacatgagcaaaaaagggactcttctttgaaatatcaaac 156606 Query: 331 acgctgtgttcgatgtttccccaacggaacagg 363 ||| |||||||||||||||||||| |||||||| Sbjct: 156607 acgttgtgttcgatgtttccccaatggaacagg 156639 Score = 105 bits (53), Expect = 2e-19 Identities = 74/81 (91%) Strand = Plus / Plus Query: 439 gtatgctttcaagtgtcaccggaaatctgagtctggcagggacactgtttatcctgtcaa 498 |||||||||||||||||| |||||||| || ||||| ||||||| |||||||||||||| Sbjct: 160750 gtatgctttcaagtgtcatcggaaatcagaagctggccgggacaccgtttatcctgtcaa 160809 Query: 499 tgccattgcattccatccaat 519 ||| ||||||||||||||||| Sbjct: 160810 tgcaattgcattccatccaat 160830 Score = 89.7 bits (45), Expect = 1e-14 Identities = 78/89 (87%) Strand = Plus / Plus Query: 360 cagggtatgctctaagttctgtggagggacgagtgtctatggagttctttgacctttctg 419 |||| ||||| ||||||||||| || |||||||| |||||||| |||||||| || |||| Sbjct: 157369 caggatatgccctaagttctgttgaaggacgagtttctatggaattctttgatctatctg 157428 Query: 420 agtcggcacaatctaaaaagtatgctttc 448 |||| || |||||||||||||||| |||| Sbjct: 157429 agtctgctcaatctaaaaagtatgttttc 157457 Score = 71.9 bits (36), Expect = 3e-09 Identities = 69/80 (86%) Strand = Plus / Plus Query: 596 cagtactcaaagtacgcgtcaagcattgcctctctgtcgttcagtaaggatgggcatctg 655 ||||| |||||||| ||||||||||| || || |||| || |||||||||||||| ||| Sbjct: 161063 cagtattcaaagtatgcgtcaagcatagctgctttgtcatttagtaaggatgggcacctg 161122 Query: 656 cttgctgtggcatcaagcta 675 || ||||||||||| ||||| Sbjct: 161123 ctcgctgtggcatccagcta 161142 Score = 63.9 bits (32), Expect = 6e-07 Identities = 41/44 (93%) Strand = Plus / Plus Query: 53 catgatgctccagttcgttgtgtggagtactcttatgctgcagg 96 ||||||||||| ||||| || ||||||||||||||||||||||| Sbjct: 155582 catgatgctcctgttcgctgcgtggagtactcttatgctgcagg 155625 Score = 48.1 bits (24), Expect = 0.038 Identities = 60/72 (83%) Strand = Plus / Plus Query: 527 acatttgccactggaggccatgatggatttgtgaacgtgtgggatggcacgaacaagaag 586 |||||||||||||| || ||| ||||||||||| || |||||||||| |||||||| Sbjct: 160923 acatttgccactggtgggtgtgacggatttgtgaatgtatgggatggcattaacaagaaa 160982 Query: 587 agattgtatcag 598 ||| | |||||| Sbjct: 160983 agactatatcag 160994
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 335 bits (169), Expect = 1e-88 Identities = 247/273 (90%) Strand = Plus / Minus Query: 91 tgcaggacaagtcatcactggcagctgggataagacaattaaatgctgggatcccagagg 150 |||||| ||||||||||||||||||||||||||||| || || || |||||||| ||||| Sbjct: 18995251 tgcaggtcaagtcatcactggcagctgggataagactatcaagtgttgggatccaagagg 18995192 Query: 151 agttagcggaccagagcggacacttgttgggacatatgctcaaccagagcgtgtatattc 210 || || ||||||||||| || ||||||||||||||||||||||| |||||||||||||| Sbjct: 18995191 tgtaagtggaccagagcgtacgcttgttgggacatatgctcaacctgagcgtgtatattc 18995132 Query: 211 tatgtcactggtgggaaataggttggttgtggcaacagcaggaagacatgtcagtattta 270 | |||| | ||||| |||||||||||||| |||||||||||||||||||||| |||||| Sbjct: 18995131 tctgtcgttagtggggaataggttggttgttgcaacagcaggaagacatgtcaatattta 18995072 Query: 271 tgatttgcgcaatatgtctcaacctgagcaaaaaagggaatcctctttgaaatatcaaac 330 |||| |||| ||||||||||||| ||||||||||||||| || ||||||||||||||||| Sbjct: 18995071 tgatctgcgtaatatgtctcaacatgagcaaaaaagggactcttctttgaaatatcaaac 18995012 Query: 331 acgctgtgttcgatgtttccccaacggaacagg 363 ||| |||||||||||||||||||| |||||||| Sbjct: 18995011 acgttgtgttcgatgtttccccaatggaacagg 18994979 Score = 105 bits (53), Expect = 2e-19 Identities = 74/81 (91%) Strand = Plus / Minus Query: 439 gtatgctttcaagtgtcaccggaaatctgagtctggcagggacactgtttatcctgtcaa 498 |||||||||||||||||| |||||||| || ||||| ||||||| |||||||||||||| Sbjct: 18990868 gtatgctttcaagtgtcatcggaaatcagaagctggccgggacaccgtttatcctgtcaa 18990809 Query: 499 tgccattgcattccatccaat 519 ||| ||||||||||||||||| Sbjct: 18990808 tgcaattgcattccatccaat 18990788 Score = 89.7 bits (45), Expect = 1e-14 Identities = 78/89 (87%) Strand = Plus / Minus Query: 360 cagggtatgctctaagttctgtggagggacgagtgtctatggagttctttgacctttctg 419 |||| ||||| ||||||||||| || |||||||| |||||||| |||||||| || |||| Sbjct: 18994249 caggatatgccctaagttctgttgaaggacgagtttctatggaattctttgatctatctg 18994190 Query: 420 agtcggcacaatctaaaaagtatgctttc 448 |||| || |||||||||||||||| |||| Sbjct: 18994189 agtctgctcaatctaaaaagtatgttttc 18994161 Score = 71.9 bits (36), Expect = 3e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 596 cagtactcaaagtacgcgtcaagcattgcctctctgtcgttcagtaaggatgggcatctg 655 ||||| |||||||| ||||||||||| || || |||| || |||||||||||||| ||| Sbjct: 18990555 cagtattcaaagtatgcgtcaagcatagctgctttgtcatttagtaaggatgggcacctg 18990496 Query: 656 cttgctgtggcatcaagcta 675 || ||||||||||| ||||| Sbjct: 18990495 ctcgctgtggcatccagcta 18990476 Score = 63.9 bits (32), Expect = 6e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 53 catgatgctccagttcgttgtgtggagtactcttatgctgcagg 96 ||||||||||| ||||| || ||||||||||||||||||||||| Sbjct: 18996036 catgatgctcctgttcgctgcgtggagtactcttatgctgcagg 18995993 Score = 48.1 bits (24), Expect = 0.038 Identities = 60/72 (83%) Strand = Plus / Minus Query: 527 acatttgccactggaggccatgatggatttgtgaacgtgtgggatggcacgaacaagaag 586 |||||||||||||| || ||| ||||||||||| || |||||||||| |||||||| Sbjct: 18990695 acatttgccactggtgggtgtgacggatttgtgaatgtatgggatggcattaacaagaaa 18990636 Query: 587 agattgtatcag 598 ||| | |||||| Sbjct: 18990635 agactatatcag 18990624
>ref|NM_112849.3| Arabidopsis thaliana nucleotide binding AT3G19590 mRNA, complete cds Length = 1395 Score = 188 bits (95), Expect = 2e-44 Identities = 428/539 (79%) Strand = Plus / Plus Query: 71 tgtgtggagtactcttatgctgcaggacaagtcatcactggcagctgggataagacaatt 130 ||||| ||||| ||||| ||||| |||||||| |||||||| |||||||| ||| || Sbjct: 460 tgtgttgagtattcttacgctgcgggacaagtgatcactggatcttgggataaaacagtt 519 Query: 131 aaatgctgggatcccagaggagttagcggaccagagcggacacttgttgggacatatgct 190 ||||| |||||||| ||||| | ||| || || || || || | || || |||||| Sbjct: 520 aaatgttgggatccaagaggcgctagtgggcctgaacgcacccaagtgggaacatatttg 579 Query: 191 caaccagagcgtgtatattctatgtcactggtgggaaataggttggttgtggcaacagca 250 |||||||| ||||| || |||||||| || || ||| || | ||||| ||||| |||||| Sbjct: 580 caaccagaacgtgtttactctatgtctcttgttggacatcgtttggtagtggctacagca 639 Query: 251 ggaagacatgtcagtatttatgatttgcgcaatatgtctcaacctgagcaaaaaagggaa 310 ||||| ||||| | || |||||| | | ||||||||||| |||||||||| |||||| Sbjct: 640 ggaaggcatgtaaacatctatgatctcagaaatatgtctcagcctgagcaaagaagggag 699 Query: 311 tcctctttgaaatatcaaacacgctgtgttcgatgtttccccaacggaacagggtatgct 370 || || ||||||| || || | ||||| || |||| || || |||||||| |||||| Sbjct: 700 tcttcactgaaataccagacgagatgtgtgcgttgttatcctaatggaacaggctatgct 759 Query: 371 ctaagttctgtggagggacgagtgtctatggagttctttgacctttctgagtcggcacaa 430 || || ||||| || ||| | || | |||||||| ||||| || || ||| | || ||| Sbjct: 760 cttagctctgttgaaggaagggttgcaatggagttttttgatctgtcagaggctgctcaa 819 Query: 431 tctaaaaagtatgctttcaagtgtcaccggaaatctgagtctggcagggacactgtttat 490 ||||||| ||||||||||| ||||| |||||||| ||| |||| ||||||| |||||| Sbjct: 820 gctaaaaaatatgctttcaaatgtcatcggaaatcagaggctggaagggacattgtttac 879 Query: 491 cctgtcaatgccattgcattccatccaatatacggcacatttgccactggaggccatgat 550 ||||| ||| ||||||| ||||||||||| || ||||| ||||| ||||||||| |||| Sbjct: 880 cctgtaaattccattgccttccatccaatctatggcacctttgcaactggaggctgtgat 939 Query: 551 ggatttgtgaacgtgtgggatggcacgaacaagaagagattgtatcagtactcaaagta 609 || || || ||| | |||||||| | ||||||||||| | ||||||||||||||||| Sbjct: 940 ggtttcgtcaacatttgggatggtaacaacaagaagaggctatatcagtactcaaagta 998
>gb|BT006152.1| Arabidopsis thaliana clone U50094 putative mitotic checkpoint protein (At3g19590) mRNA, complete cds Length = 1053 Score = 188 bits (95), Expect = 2e-44 Identities = 428/539 (79%) Strand = Plus / Plus Query: 71 tgtgtggagtactcttatgctgcaggacaagtcatcactggcagctgggataagacaatt 130 ||||| ||||| ||||| ||||| |||||||| |||||||| |||||||| ||| || Sbjct: 307 tgtgttgagtattcttacgctgcgggacaagtgatcactggatcttgggataaaacagtt 366 Query: 131 aaatgctgggatcccagaggagttagcggaccagagcggacacttgttgggacatatgct 190 ||||| |||||||| ||||| | ||| || || || || || | || || |||||| Sbjct: 367 aaatgttgggatccaagaggcgctagtgggcctgaacgcacccaagtgggaacatatttg 426 Query: 191 caaccagagcgtgtatattctatgtcactggtgggaaataggttggttgtggcaacagca 250 |||||||| ||||| || |||||||| || || ||| || | ||||| ||||| |||||| Sbjct: 427 caaccagaacgtgtttactctatgtctcttgttggacatcgtttggtagtggctacagca 486 Query: 251 ggaagacatgtcagtatttatgatttgcgcaatatgtctcaacctgagcaaaaaagggaa 310 ||||| ||||| | || |||||| | | ||||||||||| |||||||||| |||||| Sbjct: 487 ggaaggcatgtaaacatctatgatctcagaaatatgtctcagcctgagcaaagaagggag 546 Query: 311 tcctctttgaaatatcaaacacgctgtgttcgatgtttccccaacggaacagggtatgct 370 || || ||||||| || || | ||||| || |||| || || |||||||| |||||| Sbjct: 547 tcttcactgaaataccagacgagatgtgtgcgttgttatcctaatggaacaggctatgct 606 Query: 371 ctaagttctgtggagggacgagtgtctatggagttctttgacctttctgagtcggcacaa 430 || || ||||| || ||| | || | |||||||| ||||| || || ||| | || ||| Sbjct: 607 cttagctctgttgaaggaagggttgcaatggagttttttgatctgtcagaggctgctcaa 666 Query: 431 tctaaaaagtatgctttcaagtgtcaccggaaatctgagtctggcagggacactgtttat 490 ||||||| ||||||||||| ||||| |||||||| ||| |||| ||||||| |||||| Sbjct: 667 gctaaaaaatatgctttcaaatgtcatcggaaatcagaggctggaagggacattgtttac 726 Query: 491 cctgtcaatgccattgcattccatccaatatacggcacatttgccactggaggccatgat 550 ||||| ||| ||||||| ||||||||||| || ||||| ||||| ||||||||| |||| Sbjct: 727 cctgtaaattccattgccttccatccaatctatggcacctttgcaactggaggctgtgat 786 Query: 551 ggatttgtgaacgtgtgggatggcacgaacaagaagagattgtatcagtactcaaagta 609 || || || ||| | |||||||| | ||||||||||| | ||||||||||||||||| Sbjct: 787 ggtttcgtcaacatttgggatggtaacaacaagaagaggctatatcagtactcaaagta 845
>emb|BX822966.1|CNS0A4RG Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB77ZE03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1332 Score = 188 bits (95), Expect = 2e-44 Identities = 428/539 (79%) Strand = Plus / Plus Query: 71 tgtgtggagtactcttatgctgcaggacaagtcatcactggcagctgggataagacaatt 130 ||||| ||||| ||||| ||||| |||||||| |||||||| |||||||| ||| || Sbjct: 462 tgtgttgagtattcttacgctgcgggacaagtgatcactggatcttgggataaaacagtt 521 Query: 131 aaatgctgggatcccagaggagttagcggaccagagcggacacttgttgggacatatgct 190 ||||| |||||||| ||||| | ||| || || || || || | || || |||||| Sbjct: 522 aaatgttgggatccaagaggcgctagtgggcctgaacgcacccaagtgggaacatatttg 581 Query: 191 caaccagagcgtgtatattctatgtcactggtgggaaataggttggttgtggcaacagca 250 |||||||| ||||| || |||||||| || || ||| || | ||||| ||||| |||||| Sbjct: 582 caaccagaacgtgtttactctatgtctcttgttggacatcgtttggtagtggctacagca 641 Query: 251 ggaagacatgtcagtatttatgatttgcgcaatatgtctcaacctgagcaaaaaagggaa 310 ||||| ||||| | || |||||| | | ||||||||||| |||||||||| |||||| Sbjct: 642 ggaaggcatgtaaacatctatgatctcagaaatatgtctcagcctgagcaaagaagggag 701 Query: 311 tcctctttgaaatatcaaacacgctgtgttcgatgtttccccaacggaacagggtatgct 370 || || ||||||| || || | ||||| || |||| || || |||||||| |||||| Sbjct: 702 tcttcactgaaataccagacgagatgtgtgcgttgttatcctaatggaacaggctatgct 761 Query: 371 ctaagttctgtggagggacgagtgtctatggagttctttgacctttctgagtcggcacaa 430 || || ||||| || ||| | || | |||||||| ||||| || || ||| | || ||| Sbjct: 762 cttagctctgttgaaggaagggttgcaatggagttttttgatctgtcagaggctgctcaa 821 Query: 431 tctaaaaagtatgctttcaagtgtcaccggaaatctgagtctggcagggacactgtttat 490 ||||||| ||||||||||| ||||| |||||||| ||| |||| ||||||| |||||| Sbjct: 822 gctaaaaaatatgctttcaaatgtcatcggaaatcagaggctggaagggacattgtttac 881 Query: 491 cctgtcaatgccattgcattccatccaatatacggcacatttgccactggaggccatgat 550 ||||| ||| ||||||| ||||||||||| || ||||| ||||| ||||||||| |||| Sbjct: 882 cctgtaaattccattgccttccatccaatctatggcacctttgcaactggaggctgtgat 941 Query: 551 ggatttgtgaacgtgtgggatggcacgaacaagaagagattgtatcagtactcaaagta 609 || || || ||| | |||||||| | ||||||||||| | ||||||||||||||||| Sbjct: 942 ggtttcgtcaacatttgggatggtaacaacaagaagaggctatatcagtactcaaagta 1000
>gb|BT004273.1| Arabidopsis thaliana clone RAFL15-46-M01 (R50094) putative mitotic checkpoint protein (At3g19590) mRNA, complete cds Length = 1288 Score = 188 bits (95), Expect = 2e-44 Identities = 428/539 (79%) Strand = Plus / Plus Query: 71 tgtgtggagtactcttatgctgcaggacaagtcatcactggcagctgggataagacaatt 130 ||||| ||||| ||||| ||||| |||||||| |||||||| |||||||| ||| || Sbjct: 411 tgtgttgagtattcttacgctgcgggacaagtgatcactggatcttgggataaaacagtt 470 Query: 131 aaatgctgggatcccagaggagttagcggaccagagcggacacttgttgggacatatgct 190 ||||| |||||||| ||||| | ||| || || || || || | || || |||||| Sbjct: 471 aaatgttgggatccaagaggcgctagtgggcctgaacgcacccaagtgggaacatatttg 530 Query: 191 caaccagagcgtgtatattctatgtcactggtgggaaataggttggttgtggcaacagca 250 |||||||| ||||| || |||||||| || || ||| || | ||||| ||||| |||||| Sbjct: 531 caaccagaacgtgtttactctatgtctcttgttggacatcgtttggtagtggctacagca 590 Query: 251 ggaagacatgtcagtatttatgatttgcgcaatatgtctcaacctgagcaaaaaagggaa 310 ||||| ||||| | || |||||| | | ||||||||||| |||||||||| |||||| Sbjct: 591 ggaaggcatgtaaacatctatgatctcagaaatatgtctcagcctgagcaaagaagggag 650 Query: 311 tcctctttgaaatatcaaacacgctgtgttcgatgtttccccaacggaacagggtatgct 370 || || ||||||| || || | ||||| || |||| || || |||||||| |||||| Sbjct: 651 tcttcactgaaataccagacgagatgtgtgcgttgttatcctaatggaacaggctatgct 710 Query: 371 ctaagttctgtggagggacgagtgtctatggagttctttgacctttctgagtcggcacaa 430 || || ||||| || ||| | || | |||||||| ||||| || || ||| | || ||| Sbjct: 711 cttagctctgttgaaggaagggttgcaatggagttttttgatctgtcagaggctgctcaa 770 Query: 431 tctaaaaagtatgctttcaagtgtcaccggaaatctgagtctggcagggacactgtttat 490 ||||||| ||||||||||| ||||| |||||||| ||| |||| ||||||| |||||| Sbjct: 771 gctaaaaaatatgctttcaaatgtcatcggaaatcagaggctggaagggacattgtttac 830 Query: 491 cctgtcaatgccattgcattccatccaatatacggcacatttgccactggaggccatgat 550 ||||| ||| ||||||| ||||||||||| || ||||| ||||| ||||||||| |||| Sbjct: 831 cctgtaaattccattgccttccatccaatctatggcacctttgcaactggaggctgtgat 890 Query: 551 ggatttgtgaacgtgtgggatggcacgaacaagaagagattgtatcagtactcaaagta 609 || || || ||| | |||||||| | ||||||||||| | ||||||||||||||||| Sbjct: 891 ggtttcgtcaacatttgggatggtaacaacaagaagaggctatatcagtactcaaagta 949
>gb|AY087404.1| Arabidopsis thaliana clone 35031 mRNA, complete sequence Length = 1318 Score = 188 bits (95), Expect = 2e-44 Identities = 428/539 (79%) Strand = Plus / Plus Query: 71 tgtgtggagtactcttatgctgcaggacaagtcatcactggcagctgggataagacaatt 130 ||||| ||||| ||||| ||||| |||||||| |||||||| |||||||| ||| || Sbjct: 408 tgtgttgagtattcttacgctgcgggacaagtgatcactggatcttgggataaaacagtt 467 Query: 131 aaatgctgggatcccagaggagttagcggaccagagcggacacttgttgggacatatgct 190 ||||| |||||||| ||||| | ||| || || || || || | || || |||||| Sbjct: 468 aaatgttgggatccaagaggcgctagtgggcctgaacgcacccaagtgggaacatatttg 527 Query: 191 caaccagagcgtgtatattctatgtcactggtgggaaataggttggttgtggcaacagca 250 |||||||| ||||| || |||||||| || || ||| || | ||||| ||||| |||||| Sbjct: 528 caaccagaacgtgtttactctatgtctcttgttggacatcgtttggtagtggctacagca 587 Query: 251 ggaagacatgtcagtatttatgatttgcgcaatatgtctcaacctgagcaaaaaagggaa 310 ||||| ||||| | || |||||| | | ||||||||||| |||||||||| |||||| Sbjct: 588 ggaaggcatgtaaacatctatgatctcagaaatatgtctcagcctgagcaaagaagggag 647 Query: 311 tcctctttgaaatatcaaacacgctgtgttcgatgtttccccaacggaacagggtatgct 370 || || ||||||| || || | ||||| || |||| || || |||||||| |||||| Sbjct: 648 tcttcactgaaataccagacgagatgtgtgcgttgttatcctaatggaacaggctatgct 707 Query: 371 ctaagttctgtggagggacgagtgtctatggagttctttgacctttctgagtcggcacaa 430 || || ||||| || ||| | || | |||||||| ||||| || || ||| | || ||| Sbjct: 708 cttagctctgttgaaggaagggttgcaatggagttttttgatctgtcagaggctgctcaa 767 Query: 431 tctaaaaagtatgctttcaagtgtcaccggaaatctgagtctggcagggacactgtttat 490 ||||||| ||||||||||| ||||| |||||||| ||| |||| ||||||| |||||| Sbjct: 768 gctaaaaaatatgctttcaaatgtcatcggaaatcagaggctggaagggacattgtttac 827 Query: 491 cctgtcaatgccattgcattccatccaatatacggcacatttgccactggaggccatgat 550 ||||| ||| ||||||| ||||||||||| || ||||| ||||| ||||||||| |||| Sbjct: 828 cctgtaaattccattgccttccatccaatctatggcacctttgcaactggaggctgtgat 887 Query: 551 ggatttgtgaacgtgtgggatggcacgaacaagaagagattgtatcagtactcaaagta 609 || || || ||| | |||||||| | ||||||||||| | ||||||||||||||||| Sbjct: 888 ggtttcgtcaacatttgggatggtaacaacaagaagaggctatatcagtactcaaagta 946
>ref|NM_103878.1| Arabidopsis thaliana nucleotide binding AT1G49910 mRNA, complete cds Length = 1224 Score = 123 bits (62), Expect = 8e-25 Identities = 305/386 (79%) Strand = Plus / Plus Query: 224 ggaaataggttggttgtggcaacagcaggaagacatgtcagtatttatgatttgcgcaat 283 |||||| | ||||| ||||||||||||||||| ||||||| ||||||||| | | ||| Sbjct: 457 ggaaatcgtttggtagtggcaacagcaggaaggcatgtcaacatttatgatcttagaaat 516 Query: 284 atgtctcaacctgagcaaaaaagggaatcctctttgaaatatcaaacacgctgtgttcga 343 ||||| || |||||||||| ||| || ||||| | ||||| || ||| | ||||| || Sbjct: 517 atgtcccagcctgagcaaagaagagagtcctcacttaaataccagacaagatgtgtacgt 576 Query: 344 tgtttccccaacggaacagggtatgctctaagttctgtggagggacgagtgtctatggag 403 |||| |||||||||||||| ||||| || || ||||| || || | || || |||||| Sbjct: 577 tgttatcccaacggaacaggatatgcccttagctctgttgaagggagggtttcaatggag 636 Query: 404 ttctttgacctttctgagtcggcacaatctaaaaagtatgctttcaagtgtcaccggaaa 463 || ||||| || || || | || || ||||||| ||||||||||| |||||||||||| Sbjct: 637 ttttttgatctatcagaagctgctcaggctaaaaaatatgctttcaaatgtcaccggaaa 696 Query: 464 tctgagtctggcagggacactgtttatcctgtcaatgccattgcattccatccaatatac 523 || ||| ||| ||||||| ||| || ||||| ||||| ||||| |||||||| || || Sbjct: 697 tcagaggatggaagggacattgtctaccctgtaaatgcaattgctttccatccgatttat 756 Query: 524 ggcacatttgccactggaggccatgatggatttgtgaacgtgtgggatggcacgaacaag 583 ||||| ||||| | |||||| |||||| ||||| ||| | ||||| || | || ||| Sbjct: 757 ggcacttttgcttccggaggctgtgatggttttgtcaacatttgggacggtaacaataag 816 Query: 584 aagagattgtatcagtactcaaagta 609 ||||| | ||||||||||| ||||| Sbjct: 817 aagaggctttatcagtactctaagta 842 Score = 89.7 bits (45), Expect = 1e-14 Identities = 78/89 (87%) Strand = Plus / Plus Query: 62 ccagttcgttgtgtggagtactcttatgctgcaggacaagtcatcactggcagctgggat 121 |||||||| ||||| ||||| |||||||||||||| ||||| |||||||| || |||||| Sbjct: 295 ccagttcgatgtgttgagtattcttatgctgcagggcaagtgatcactggaagttgggat 354 Query: 122 aagacaattaaatgctgggatcccagagg 150 || || |||||||| |||||||| ||||| Sbjct: 355 aaaacgattaaatgttgggatccaagagg 383
>gb|AC135560.4| Oryza sativa chromosome 3 BAC OSJNBa0031I04 genomic sequence, complete sequence Length = 168859 Score = 105 bits (53), Expect = 2e-19 Identities = 74/81 (91%) Strand = Plus / Plus Query: 439 gtatgctttcaagtgtcaccggaaatctgagtctggcagggacactgtttatcctgtcaa 498 |||||||||||||||||| |||||||| || ||||| ||||||| |||||||||||||| Sbjct: 2814 gtatgctttcaagtgtcatcggaaatcagaagctggccgggacaccgtttatcctgtcaa 2873 Query: 499 tgccattgcattccatccaat 519 ||| ||||||||||||||||| Sbjct: 2874 tgcaattgcattccatccaat 2894 Score = 71.9 bits (36), Expect = 3e-09 Identities = 69/80 (86%) Strand = Plus / Plus Query: 596 cagtactcaaagtacgcgtcaagcattgcctctctgtcgttcagtaaggatgggcatctg 655 ||||| |||||||| ||||||||||| || || |||| || |||||||||||||| ||| Sbjct: 3127 cagtattcaaagtatgcgtcaagcatagctgctttgtcatttagtaaggatgggcacctg 3186 Query: 656 cttgctgtggcatcaagcta 675 || ||||||||||| ||||| Sbjct: 3187 ctcgctgtggcatccagcta 3206 Score = 48.1 bits (24), Expect = 0.038 Identities = 60/72 (83%) Strand = Plus / Plus Query: 527 acatttgccactggaggccatgatggatttgtgaacgtgtgggatggcacgaacaagaag 586 |||||||||||||| || ||| ||||||||||| || |||||||||| |||||||| Sbjct: 2987 acatttgccactggtgggtgtgacggatttgtgaatgtatgggatggcattaacaagaaa 3046 Query: 587 agattgtatcag 598 ||| | |||||| Sbjct: 3047 agactatatcag 3058
>dbj|AP000417.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MMB12 Length = 73977 Score = 79.8 bits (40), Expect = 1e-11 Identities = 70/80 (87%) Strand = Plus / Plus Query: 440 tatgctttcaagtgtcaccggaaatctgagtctggcagggacactgtttatcctgtcaat 499 ||||||||||| ||||| |||||||| ||| |||| ||||||| |||||| ||||| ||| Sbjct: 13997 tatgctttcaaatgtcatcggaaatcagaggctggaagggacattgtttaccctgtaaat 14056 Query: 500 gccattgcattccatccaat 519 ||||||| ||||||||||| Sbjct: 14057 tccattgccttccatccaat 14076 Score = 65.9 bits (33), Expect = 2e-07 Identities = 171/217 (78%) Strand = Plus / Plus Query: 93 caggacaagtcatcactggcagctgggataagacaattaaatgctgggatcccagaggag 152 |||||||||| |||||||| |||||||| ||| ||||||| |||||||| ||||| | Sbjct: 13463 caggacaagtgatcactggatcttgggataaaacagttaaatgttgggatccaagaggcg 13522 Query: 153 ttagcggaccagagcggacacttgttgggacatatgctcaaccagagcgtgtatattcta 212 ||| || || || || || | || || |||||| |||||||| ||||| || |||| Sbjct: 13523 ctagtgggcctgaacgcacccaagtgggaacatatttgcaaccagaacgtgtttactcta 13582 Query: 213 tgtcactggtgggaaataggttggttgtggcaacagcaggaagacatgtcagtatttatg 272 |||| || || ||| || | ||||| ||||| ||||||||||| ||||| | || |||| Sbjct: 13583 tgtctcttgttggacatcgtttggtagtggctacagcaggaaggcatgtaaacatctatg 13642 Query: 273 atttgcgcaatatgtctcaacctgagcaaaaaaggga 309 || | | ||||||||||| |||||||||| |||||| Sbjct: 13643 atctcagaaatatgtctcagcctgagcaaagaaggga 13679
>ref|XM_478938.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1095 Score = 75.8 bits (38), Expect = 2e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 53 catgatgctccagttcgttgtgtggagtactcttatgctgcaggacaagtcatcactggc 112 |||||||| ||||| ||||||| |||||||| || || | |||||||| ||||||||| Sbjct: 337 catgatgccgcagttagttgtgtcgagtactcctactctactggacaagttatcactggc 396 Query: 113 agctgggataagacaattaaatgctgggatcccagagg 150 |||||||||||||| || | ||||||||||| ||||| Sbjct: 397 agctgggataagactataatgtgctgggatccaagagg 434 Score = 69.9 bits (35), Expect = 1e-08 Identities = 140/175 (80%) Strand = Plus / Plus Query: 233 ttggttgtggcaacagcaggaagacatgtcagtatttatgatttgcgcaatatgtctcaa 292 |||||||| |||||||||||||| ||||| | | ||||||||||||||| ||||||| Sbjct: 520 ttggttgtcgcaacagcaggaaggcatgtgaatgtttatgatttgcgcagtatgtctagg 579 Query: 293 cctgagcaaaaaagggaatcctctttgaaatatcaaacacgctgtgttcgatgtttcccc 352 ||||||||| | ||||| || | | | ||||||||||| ||||||| ||| | || Sbjct: 580 cctgagcaacagagggagtctccactaaggtatcaaacacggtgtgttcaatgctatccg 639 Query: 353 aacggaacagggtatgctctaagttctgtggagggacgagtgtctatggagttct 407 || ||||| || | |||| | |||||||||| |||||||| |||||||||||| Sbjct: 640 aatggaactggatttgctttgggttctgtggaaggacgagttgctatggagttct 694 Score = 61.9 bits (31), Expect = 3e-06 Identities = 73/87 (83%) Strand = Plus / Plus Query: 488 tatcctgtcaatgccattgcattccatccaatatacggcacatttgccactggaggccat 547 ||||||||||| || ||| | ||||| ||| || ||||||||||||||||||| || | Sbjct: 775 tatcctgtcaacgcaatttccttccacccagtacacggcacatttgccactggtggatgt 834 Query: 548 gatggatttgtgaacgtgtgggatggc 574 ||| ||||||||||| | ||||||||| Sbjct: 835 gatagatttgtgaacctttgggatggc 861 Score = 46.1 bits (23), Expect = 0.15 Identities = 38/43 (88%) Strand = Plus / Plus Query: 627 ctctgtcgttcagtaaggatgggcatctgcttgctgtggcatc 669 ||||||| ||||||| |||||| | |||||||||||| ||||| Sbjct: 914 ctctgtctttcagtagggatggccgtctgcttgctgttgcatc 956
>gb|AC074110.5|AC074110 Arabidopsis thaliana chromosome 1 BAC T18C15 genomic sequence, complete sequence Length = 20509 Score = 71.9 bits (36), Expect = 3e-09 Identities = 114/140 (81%) Strand = Plus / Minus Query: 224 ggaaataggttggttgtggcaacagcaggaagacatgtcagtatttatgatttgcgcaat 283 |||||| | ||||| ||||||||||||||||| ||||||| ||||||||| | | ||| Sbjct: 9114 ggaaatcgtttggtagtggcaacagcaggaaggcatgtcaacatttatgatcttagaaat 9055 Query: 284 atgtctcaacctgagcaaaaaagggaatcctctttgaaatatcaaacacgctgtgttcga 343 ||||| || |||||||||| ||| || ||||| | ||||| || ||| | ||||| || Sbjct: 9054 atgtcccagcctgagcaaagaagagagtcctcacttaaataccagacaagatgtgtacgt 8995 Query: 344 tgtttccccaacggaacagg 363 |||| |||||||||||||| Sbjct: 8994 tgttatcccaacggaacagg 8975 Score = 65.9 bits (33), Expect = 2e-07 Identities = 66/77 (85%) Strand = Plus / Minus Query: 440 tatgctttcaagtgtcaccggaaatctgagtctggcagggacactgtttatcctgtcaat 499 ||||||||||| |||||||||||||| ||| ||| ||||||| ||| || ||||| ||| Sbjct: 8610 tatgctttcaaatgtcaccggaaatcagaggatggaagggacattgtctaccctgtaaat 8551 Query: 500 gccattgcattccatcc 516 || ||||| |||||||| Sbjct: 8550 gcaattgctttccatcc 8534 Score = 46.1 bits (23), Expect = 0.15 Identities = 32/35 (91%) Strand = Plus / Minus Query: 62 ccagttcgttgtgtggagtactcttatgctgcagg 96 |||||||| ||||| ||||| |||||||||||||| Sbjct: 9369 ccagttcgatgtgttgagtattcttatgctgcagg 9335
>gb|AC079674.4|AC079674 Arabidopsis thaliana chromosome 1 BAC F10F5 genomic sequence, complete sequence Length = 48940 Score = 71.9 bits (36), Expect = 3e-09 Identities = 114/140 (81%) Strand = Plus / Plus Query: 224 ggaaataggttggttgtggcaacagcaggaagacatgtcagtatttatgatttgcgcaat 283 |||||| | ||||| ||||||||||||||||| ||||||| ||||||||| | | ||| Sbjct: 48149 ggaaatcgtttggtagtggcaacagcaggaaggcatgtcaacatttatgatcttagaaat 48208 Query: 284 atgtctcaacctgagcaaaaaagggaatcctctttgaaatatcaaacacgctgtgttcga 343 ||||| || |||||||||| ||| || ||||| | ||||| || ||| | ||||| || Sbjct: 48209 atgtcccagcctgagcaaagaagagagtcctcacttaaataccagacaagatgtgtacgt 48268 Query: 344 tgtttccccaacggaacagg 363 |||| |||||||||||||| Sbjct: 48269 tgttatcccaacggaacagg 48288 Score = 65.9 bits (33), Expect = 2e-07 Identities = 66/77 (85%) Strand = Plus / Plus Query: 440 tatgctttcaagtgtcaccggaaatctgagtctggcagggacactgtttatcctgtcaat 499 ||||||||||| |||||||||||||| ||| ||| ||||||| ||| || ||||| ||| Sbjct: 48653 tatgctttcaaatgtcaccggaaatcagaggatggaagggacattgtctaccctgtaaat 48712 Query: 500 gccattgcattccatcc 516 || ||||| |||||||| Sbjct: 48713 gcaattgctttccatcc 48729 Score = 46.1 bits (23), Expect = 0.15 Identities = 32/35 (91%) Strand = Plus / Plus Query: 62 ccagttcgttgtgtggagtactcttatgctgcagg 96 |||||||| ||||| ||||| |||||||||||||| Sbjct: 47894 ccagttcgatgtgttgagtattcttatgctgcagg 47928
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 67.9 bits (34), Expect = 4e-08 Identities = 52/58 (89%) Strand = Plus / Plus Query: 93 caggacaagtcatcactggcagctgggataagacaattaaatgctgggatcccagagg 150 |||||||||| ||||||||||||||||||||||| || | ||||||||||| ||||| Sbjct: 23914365 caggacaagttatcactggcagctgggataagactataatgtgctgggatccaagagg 23914422 Score = 65.9 bits (33), Expect = 2e-07 Identities = 51/57 (89%) Strand = Plus / Plus Query: 233 ttggttgtggcaacagcaggaagacatgtcagtatttatgatttgcgcaatatgtct 289 |||||||| |||||||||||||| ||||| | | ||||||||||||||| ||||||| Sbjct: 23914508 ttggttgtcgcaacagcaggaaggcatgtgaatgtttatgatttgcgcagtatgtct 23914564 Score = 50.1 bits (25), Expect = 0.010 Identities = 46/53 (86%) Strand = Plus / Plus Query: 522 acggcacatttgccactggaggccatgatggatttgtgaacgtgtgggatggc 574 ||||||||||||||||||| || |||| ||||||||||| | ||||||||| Sbjct: 23915990 acggcacatttgccactggtggatgtgatagatttgtgaacctttgggatggc 23916042 Score = 46.1 bits (23), Expect = 0.15 Identities = 38/43 (88%) Strand = Plus / Plus Query: 627 ctctgtcgttcagtaaggatgggcatctgcttgctgtggcatc 669 ||||||| ||||||| |||||| | |||||||||||| ||||| Sbjct: 23916202 ctctgtctttcagtagggatggccgtctgcttgctgttgcatc 23916244 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Plus Query: 375 gttctgtggagggacgagtgtctatggagttct 407 |||||||||| |||||||| |||||||||||| Sbjct: 23915615 gttctgtggaaggacgagttgctatggagttct 23915647
>dbj|AP005149.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBb0005G07 Length = 142850 Score = 67.9 bits (34), Expect = 4e-08 Identities = 52/58 (89%) Strand = Plus / Plus Query: 93 caggacaagtcatcactggcagctgggataagacaattaaatgctgggatcccagagg 150 |||||||||| ||||||||||||||||||||||| || | ||||||||||| ||||| Sbjct: 69292 caggacaagttatcactggcagctgggataagactataatgtgctgggatccaagagg 69349 Score = 65.9 bits (33), Expect = 2e-07 Identities = 51/57 (89%) Strand = Plus / Plus Query: 233 ttggttgtggcaacagcaggaagacatgtcagtatttatgatttgcgcaatatgtct 289 |||||||| |||||||||||||| ||||| | | ||||||||||||||| ||||||| Sbjct: 69435 ttggttgtcgcaacagcaggaaggcatgtgaatgtttatgatttgcgcagtatgtct 69491 Score = 50.1 bits (25), Expect = 0.010 Identities = 46/53 (86%) Strand = Plus / Plus Query: 522 acggcacatttgccactggaggccatgatggatttgtgaacgtgtgggatggc 574 ||||||||||||||||||| || |||| ||||||||||| | ||||||||| Sbjct: 70917 acggcacatttgccactggtggatgtgatagatttgtgaacctttgggatggc 70969 Score = 46.1 bits (23), Expect = 0.15 Identities = 38/43 (88%) Strand = Plus / Plus Query: 627 ctctgtcgttcagtaaggatgggcatctgcttgctgtggcatc 669 ||||||| ||||||| |||||| | |||||||||||| ||||| Sbjct: 71129 ctctgtctttcagtagggatggccgtctgcttgctgttgcatc 71171 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Plus Query: 375 gttctgtggagggacgagtgtctatggagttct 407 |||||||||| |||||||| |||||||||||| Sbjct: 70542 gttctgtggaaggacgagttgctatggagttct 70574
>emb|CR931730.1| Medicago truncatula chromosome 5 clone mth2-17o15, COMPLETE SEQUENCE Length = 89342 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 53 catgatgctccagttcgttgtgtggagtactcttatgctgcagg 96 ||||||||||| ||||||||||| ||||||||||| || ||||| Sbjct: 5898 catgatgctcctgttcgttgtgttgagtactcttacgccgcagg 5855 Score = 46.1 bits (23), Expect = 0.15 Identities = 59/71 (83%) Strand = Plus / Minus Query: 443 gctttcaagtgtcaccggaaatctgagtctggcagggacactgtttatcctgtcaatgcc 502 |||||||||||||| | |||||||| |||| ||||| | || |||||||| |||||| Sbjct: 4774 gctttcaagtgtcatagaaaatctgaagctggaagggatatcgtctatcctgtgaatgcc 4715 Query: 503 attgcattcca 513 || |||||||| Sbjct: 4714 atggcattcca 4704
>emb|AL358333.4|CNS05TE4 Human chromosome 14 DNA sequence BAC R-463J10 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 188549 Score = 44.1 bits (22), Expect = 0.59 Identities = 22/22 (100%) Strand = Plus / Plus Query: 302 aaaagggaatcctctttgaaat 323 |||||||||||||||||||||| Sbjct: 97213 aaaagggaatcctctttgaaat 97234
>gb|CP000024.1| Streptococcus thermophilus CNRZ1066, complete genome Length = 1796226 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 287 tctcaacctgagcaaaaaagg 307 ||||||||||||||||||||| Sbjct: 1477011 tctcaacctgagcaaaaaagg 1477031
>gb|AC147478.2| Pan troglodytes BAC clone CH251-571L4 from Y, complete sequence Length = 188138 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 431 tctaaaaagtatgctttcaagtgtc 455 |||||||||||||||| |||||||| Sbjct: 84148 tctaaaaagtatgcttacaagtgtc 84124
>gb|AC147131.2| Pan troglodytes BAC clone CH251-403A11 from Y, complete sequence Length = 168159 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 431 tctaaaaagtatgctttcaagtgtc 455 |||||||||||||||| |||||||| Sbjct: 116435 tctaaaaagtatgcttacaagtgtc 116411
>gb|AC146651.10| Medicago truncatula clone mth2-113d3, complete sequence Length = 157296 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 495 tcaatgccattgcattccatc 515 ||||||||||||||||||||| Sbjct: 155346 tcaatgccattgcattccatc 155366
>gb|BC099199.1| Rattus norvegicus cDNA clone MGC:116372 IMAGE:7383928, complete cds Length = 1338 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Plus Query: 526 cacatttgccactggaggccatgatggatttgt 558 |||||||||||| |||||| |||||||||||| Sbjct: 783 cacatttgccacaggaggctctgatggatttgt 815
>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence Length = 23952694 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 431 tctaaaaagtatgctttcaagtgtc 455 |||||||||||||||| |||||||| Sbjct: 5717417 tctaaaaagtatgcttacaagtgtc 5717393
>gb|AC067843.16| Homo sapiens chromosome 8, clone RP11-645E10, complete sequence Length = 187559 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 590 ttgtatcagtactcaaagtac 610 ||||||||||||||||||||| Sbjct: 30865 ttgtatcagtactcaaagtac 30885
>gb|AC023955.11| Homo sapiens chromosome 8, clone RP11-153B5, complete sequence Length = 160905 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 590 ttgtatcagtactcaaagtac 610 ||||||||||||||||||||| Sbjct: 31366 ttgtatcagtactcaaagtac 31386
>emb|AM055942.1| Toxoplasma gondii, strain RH, genomic DNA chromosome Ia Length = 1923819 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 105 tcactggcagctgggataaga 125 ||||||||||||||||||||| Sbjct: 241555 tcactggcagctgggataaga 241575
>gb|CP000023.1| Streptococcus thermophilus LMG 18311, complete genome Length = 1796846 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 287 tctcaacctgagcaaaaaagg 307 ||||||||||||||||||||| Sbjct: 1469270 tctcaacctgagcaaaaaagg 1469290
>gb|AC135422.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0043H23, complete sequence Length = 134097 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 234 tggttgtggcaacagcagga 253 |||||||||||||||||||| Sbjct: 42159 tggttgtggcaacagcagga 42140
>gb|AC146716.1| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1003C08, complete sequence Length = 152527 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 234 tggttgtggcaacagcagga 253 |||||||||||||||||||| Sbjct: 77637 tggttgtggcaacagcagga 77618
>gb|AC101882.14| Mus musculus chromosome 10, clone RP23-394M6, complete sequence Length = 209838 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 129 ttaaatgctgggatcccaga 148 |||||||||||||||||||| Sbjct: 27524 ttaaatgctgggatcccaga 27505
>ref|NM_001007497.1| Xenopus tropicalis bub3 protein (bub3), mRNA Length = 1407 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 440 tatgctttcaagtgtcaccg 459 |||||||||||||||||||| Sbjct: 823 tatgctttcaagtgtcaccg 842
>gb|BC079934.1| Xenopus tropicalis bub3 protein, mRNA (cDNA clone MGC:79574 IMAGE:6978795), complete cds Length = 1407 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 440 tatgctttcaagtgtcaccg 459 |||||||||||||||||||| Sbjct: 823 tatgctttcaagtgtcaccg 842
>emb|AL359547.26| Human DNA sequence from clone RP11-715G15 on chromosome 6 Contains a novel gene and the 5' end of the C6orf103 gene for chromosome 6 open reading frame 103, complete sequence Length = 129245 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 432 ctaaaaagtatgctttcaag 451 |||||||||||||||||||| Sbjct: 101505 ctaaaaagtatgctttcaag 101486
>emb|AL669816.3| Mouse DNA sequence from clone RP23-266C4 on chromosome 11 Contains the 3' end of a novel gene, complete sequence Length = 203827 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 206 tattctatgtcactggtggg 225 |||||||||||||||||||| Sbjct: 185633 tattctatgtcactggtggg 185652
>emb|BX548161.12| Zebrafish DNA sequence from clone DKEY-248F6 in linkage group 16, complete sequence Length = 188754 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 252 gaagacatgtcagtatttat 271 |||||||||||||||||||| Sbjct: 172262 gaagacatgtcagtatttat 172243
>emb|AL591511.2| Zebrafish DNA sequence from clone BUSM1-1C23 in linkage group 2 Contains 28 TCR-alpha V segments (II-48 to II-63, II-65 to II-76) one of which is a pseudogene (II-53) and a CpG island, complete sequence Length = 74508 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 252 gaagacatgtcagtatttat 271 |||||||||||||||||||| Sbjct: 33231 gaagacatgtcagtatttat 33212
>emb|CR352230.8| Zebrafish DNA sequence from clone CH211-106G8 in linkage group 2, complete sequence Length = 168916 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 252 gaagacatgtcagtatttat 271 |||||||||||||||||||| Sbjct: 42203 gaagacatgtcagtatttat 42184
>emb|BX323809.14| Zebrafish DNA sequence from clone DKEY-42J10 in linkage group 10, complete sequence Length = 194108 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 252 gaagacatgtcagtatttat 271 |||||||||||||||||||| Sbjct: 15676 gaagacatgtcagtatttat 15657 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 252 gaagacatgtcagtatttat 271 |||||||||||||||||||| Sbjct: 3124 gaagacatgtcagtatttat 3105
>gb|AC099052.2| Homo sapiens chromosome 3 clone RP11-437M11, complete sequence Length = 139280 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 287 tctcaacctgagcaaaaaag 306 |||||||||||||||||||| Sbjct: 65430 tctcaacctgagcaaaaaag 65449
>gb|AC110082.3| Homo sapiens BAC clone RP11-539F15 from 4, complete sequence Length = 72382 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 245 acagcaggaagacatgtcag 264 |||||||||||||||||||| Sbjct: 31073 acagcaggaagacatgtcag 31092
>gb|AC093855.3| Homo sapiens BAC clone RP11-511M22 from 4, complete sequence Length = 188416 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 498 atgccattgcattccatcca 517 |||||||||||||||||||| Sbjct: 73953 atgccattgcattccatcca 73934
>gb|AF167425.1| Lycopersicon esculentum 1-aminocyclopropane-1-carboxylate synthase (ACS5) and LE5-7.2 genes, complete cds Length = 14362 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 566 tgggatggcacgaacaagaa 585 |||||||||||||||||||| Sbjct: 13371 tgggatggcacgaacaagaa 13352
>dbj|AB169883.1| Macaca fascicularis brain cDNA, clone: QnpA-10286, similar to human BUB3 budding uninhibited by benzimidazoles 3 homolog(yeast) (BUB3), mRNA, RefSeq: NM_004725.1 Length = 3645 Score = 40.1 bits (20), Expect = 9.3 Identities = 38/44 (86%) Strand = Plus / Plus Query: 105 tcactggcagctgggataagacaattaaatgctgggatcccaga 148 ||||||| || |||||| ||||| |||||| |||||||||||| Sbjct: 428 tcactggaagttgggatcagacagttaaattgtgggatcccaga 471
>emb|BX322605.4| Zebrafish DNA sequence from clone RP71-80A19 in linkage group 10, complete sequence Length = 131830 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 252 gaagacatgtcagtatttat 271 |||||||||||||||||||| Sbjct: 116991 gaagacatgtcagtatttat 116972 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 252 gaagacatgtcagtatttat 271 |||||||||||||||||||| Sbjct: 103743 gaagacatgtcagtatttat 103724
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 234 tggttgtggcaacagcagga 253 |||||||||||||||||||| Sbjct: 7339382 tggttgtggcaacagcagga 7339363
>gb|AC010169.8| Homo sapiens 3 BAC RP11-424L2 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 111951 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 287 tctcaacctgagcaaaaaag 306 |||||||||||||||||||| Sbjct: 6271 tctcaacctgagcaaaaaag 6252
>gb|AC092047.3| Homo sapiens chromosome 3 clone RP11-219I21, complete sequence Length = 194742 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 287 tctcaacctgagcaaaaaag 306 |||||||||||||||||||| Sbjct: 65395 tctcaacctgagcaaaaaag 65376
>gb|AC155286.8| Mus musculus 10 BAC RP23-213N17 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 219072 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 129 ttaaatgctgggatcccaga 148 |||||||||||||||||||| Sbjct: 54733 ttaaatgctgggatcccaga 54752
>emb|AL591520.5| Zebrafish DNA sequence from clone BUSM1-138M20, complete sequence Length = 100721 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 252 gaagacatgtcagtatttat 271 |||||||||||||||||||| Sbjct: 83536 gaagacatgtcagtatttat 83555
>emb|CR760647.2| Xenopus tropicalis finished cDNA, clone TEgg014p17 Length = 2506 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 440 tatgctttcaagtgtcaccg 459 |||||||||||||||||||| Sbjct: 820 tatgctttcaagtgtcaccg 839
>gb|AC132589.4| Mus musculus BAC clone RP24-258M24 from 1, complete sequence Length = 168097 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 130 taaatgctgggatcccagag 149 |||||||||||||||||||| Sbjct: 80236 taaatgctgggatcccagag 80255
>emb|CT033144.1| Platynereis dumerilii EST IB0AAA26AA12EM1 Length = 473 Score = 40.1 bits (20), Expect = 9.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 107 actggcagctgggataagac 126 |||||||||||||||||||| Sbjct: 406 actggcagctgggataagac 425 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,349,905 Number of Sequences: 3902068 Number of extensions: 5349905 Number of successful extensions: 109614 Number of sequences better than 10.0: 56 Number of HSP's better than 10.0 without gapping: 56 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 109172 Number of HSP's gapped (non-prelim): 430 length of query: 678 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 655 effective length of database: 17,143,297,704 effective search space: 11228859996120 effective search space used: 11228859996120 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)