ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags12m13
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_476018.1| Oryza sativa (japonica cultivar-group), predic... 565 e-158
2dbj|AK071333.1| Oryza sativa (japonica cultivar-group) cDNA clon... 565 e-158
3gb|AC130728.2| Oryza sativa (japonica cultivar-group) chromosome... 204 2e-49
4dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 204 2e-49
5gb|AC136229.3| Oryza sativa (japonica cultivar-group) chromosome... 96 2e-16
6ref|XM_526292.1| PREDICTED: Pan troglodytes similar to beta-1,4-... 42 2.0
7gb|AC160028.9| Mus musculus 10 BAC RP24-570M12 (Roswell Park Can... 42 2.0
8gb|AC183103.2| Pan troglodytes BAC clone CH251-712L4 from chromo... 42 2.0
9ref|XM_977709.1| PREDICTED: Mus musculus expressed sequence AI64... 42 2.0
10ref|XM_983834.1| PREDICTED: Mus musculus expressed sequence AI64... 42 2.0
11ref|XM_908092.2| PREDICTED: Mus musculus expressed sequence AI64... 42 2.0
12gb|AC121850.3| Mus musculus BAC clone RP24-92E18 from chromosome... 42 2.0
13emb|AL356217.30| Human DNA sequence from clone RP11-518D7 on chr... 42 2.0
14gb|AC153495.10| Mus musculus 10 BAC RP23-468D5 (Roswell Park Can... 42 2.0
15emb|AL645948.10| Mouse DNA sequence from clone RP23-298M7 on chr... 42 2.0
16gb|AC009835.14| Homo sapiens chromosome 18, clone RP11-413I9, co... 42 2.0
17dbj|AK147875.1| Mus musculus melanocyte cDNA, RIKEN full-length ... 42 2.0
18dbj|AK143544.1| Mus musculus 12 days embryo whole body cDNA, RIK... 42 2.0
19ref|XM_944081.1| PREDICTED: Homo sapiens hypothetical protein LO... 42 2.0
20dbj|AK168991.1| Mus musculus 16 days embryo kidney cDNA, RIKEN f... 42 2.0
21dbj|AK167454.1| Mus musculus 12 days pregnant adult female place... 42 2.0
22gb|BC004080.1| Mus musculus expressed sequence AI642036, mRNA (c... 42 2.0
23gb|AC092903.11| Homo sapiens 3 BAC RP11-666A20 (Roswell Park Can... 42 2.0
24emb|BX005455.8| Zebrafish DNA sequence from clone CH211-77K19 in... 42 2.0
25dbj|AB093212.1| Mus musculus mRNA for mKIAA0171 protein 42 2.0
26emb|AL591826.2|CNS07EGP BAC 13C18 of library CITB 129-Sv from ch... 42 2.0
27ref|NM_103884.2| Arabidopsis thaliana CLPR1; endopeptidase Clp A... 40 7.9
28gb|AC156992.13| Mus musculus chromosome 7, clone RP23-474C17, co... 40 7.9
29gb|CP000233.1| Lactobacillus salivarius subsp. salivarius UCC118... 40 7.9
30gb|AC005164.2| Homo sapiens BAC clone CTB-135C18 from 7, complet... 40 7.9
31gb|AC124196.4| Mus musculus BAC clone RP23-296L12 from chromosom... 40 7.9
32gb|AC139886.3| Mus musculus BAC clone RP23-120M10 from chromosom... 40 7.9
33emb|AL691464.4| Human DNA sequence from clone RP4-644F6 on chrom... 40 7.9
34emb|AL161658.21| Human DNA sequence from clone RP11-470C13 on ch... 40 7.9
35emb|AL138694.18| Human DNA sequence from clone RP11-330C15 on ch... 40 7.9
36emb|AL022395.2|HS273N12 Human DNA sequence from clone RP1-273N12... 40 7.9
37gb|BT000572.1| Arabidopsis thaliana nClpP5, putative (At1g49970... 40 7.9
38emb|AL023893.1|DMC132E8 Drosophila melanogaster cosmid clone 132E8 40 7.9
39gb|AC104141.8| Drosophila melanogaster X BAC RP98-9H15 (Roswell ... 40 7.9
40gb|AC024947.5| Homo sapiens chromosome 01 clone RP11-200I10, com... 40 7.9
41ref|NM_206603.1| Drosophila melanogaster CG3056-RB, transcript v... 40 7.9
42ref|NM_130552.2| Drosophila melanogaster CG3056-RA, transcript v... 40 7.9
43gb|AC104288.4| Drosophila melanogaster X BAC RP98-30G24 (Roswell... 40 7.9
44gb|AY045677.1| Arabidopsis thaliana At1g49970/F2J10_5 mRNA, comp... 40 7.9
45emb|BX814276.1|CNS0ADR3 Arabidopsis thaliana Full-length cDNA Co... 40 7.9
46gb|AC108733.4| Homo sapiens 3 BAC RP11-789F5 (Roswell Park Cance... 40 7.9
47gb|BT003171.1| Drosophila melanogaster SD07604 full insert cDNA 40 7.9
48gb|AY086911.1| Arabidopsis thaliana clone 29389 mRNA, complete s... 40 7.9
49gb|AC015445.3|F2J10 Sequence of BAC F2J10 from Arabidopsis thali... 40 7.9
50emb|BX255877.14| Zebrafish DNA sequence from clone CH211-254C9, ... 40 7.9
51dbj|AB022330.1| Arabidopsis thaliana mRNA for nClpP5 (nuclear en... 40 7.9
52emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple... 40 7.9
53emb|CR769778.10| Zebrafish DNA sequence from clone CH211-147N12 ... 40 7.9
54gb|AE003420.2| Drosophila melanogaster chromosome X, section 4 o... 40 7.9
55emb|CR556713.11| Zebrafish DNA sequence from clone DKEY-28O14 in... 40 7.9
56gb|BT001477.1| Drosophila melanogaster LD21345 full insert cDNA 40 7.9
57dbj|AP003040.2| Homo sapiens genomic DNA, chromosome 11q clone:R... 40 7.9 
>ref|XM_476018.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1161

 Score =  565 bits (285), Expect = e-158
 Identities = 478/537 (89%), Gaps = 4/537 (0%)
 Strand = Plus / Plus

                                                                       
Query: 43  cgaccacatcccca-gcagttccgcgaggnagnaacctcaaggnatggcctgatggataa 101
           |||||||||||||| |||||||||||||| || |||||||| | ||||||||||||||||
Sbjct: 162 cgaccacatccccaagcagttccgcgagg-ag-aacctcaaag-atggcctgatggataa 218

                                                                       
Query: 102 ttacaagaatgttcctcagttcctttatggcttaagcccatctcagatggaaatgtttat 161
           |||||||||||||||||| ||||||||||||||||||||  ||||||| |||||||||||
Sbjct: 219 ttacaagaatgttcctcaattcctttatggcttaagccctgctcagatcgaaatgtttat 278

                                                                       
Query: 162 gaccgacaacaacccttataatcggctgtcacagaaagttacagaggaaagcatttctgc 221
           || |||  | || || ||| ||||||  ||||||| ||||||||||||||||||||||||
Sbjct: 279 gaacgatgataatccatatgatcggcaatcacagagagttacagaggaaagcatttctgc 338

                                                                       
Query: 222 tttgaggagttatgatgaatttggtatgtactccttatcaggcacgcatgagggccctac 281
           ||  ||||| |||||||||||||| ||||||  ||| || || | ||||||||||||| |
Sbjct: 339 ttctaggagctatgatgaatttggcatgtacaacttgtccggtatgcatgagggccctgc 398

                                                                       
Query: 282 aagttacaacatgggcatgggcatgcccagcatgagcatgggtagagcagggaaaggata 341
           | |||||| |||||| ||||| |||  || |||||||||||| || ||||||  ||||||
Sbjct: 399 aggttacagcatgggtatgggaatgggcaccatgagcatgggcagggcagggcgaggata 458

                                                                       
Query: 342 tagaagaatgagaagctcagccccagatctgccatcattgctgttggactcccgaattat 401
           ||||||||||||||| ||||| |||||||||||||||||||| |||||||| ||||||||
Sbjct: 459 tagaagaatgagaagttcagctccagatctgccatcattgctattggactctcgaattat 518

                                                                       
Query: 402 atttcttggaatgccaattgttccagctgtgactgagcttattgctgctcagtttctgtg 461
           ||| ||||||||||| ||||||||||| || || |||||||||||||| || ||||||||
Sbjct: 519 attccttggaatgcctattgttccagcagtaacagagcttattgctgcgcaatttctgtg 578

                                                                       
Query: 462 gctagactatgatgaccgcacgaagccaatttacttgtatataaactccacaggaacaat 521
           |||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| ||
Sbjct: 579 gctagattatgatgaccgcaccaagccaatttacttgtatataaactccacaggaaccat 638

                                                                    
Query: 522 ggatgaaaataatgagctggtcgcatctgaaactgatgcctatgcaattgctgattt 578
           ||||||||| ||||||||||| ||||||||||||||||| | |||||||||||||||
Sbjct: 639 ggatgaaaacaatgagctggttgcatctgaaactgatgcatttgcaattgctgattt 695
to top
>dbj|AK071333.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023091K09, full
           insert sequence
          Length = 1518

 Score =  565 bits (285), Expect = e-158
 Identities = 478/537 (89%), Gaps = 4/537 (0%)
 Strand = Plus / Plus

                                                                       
Query: 43  cgaccacatcccca-gcagttccgcgaggnagnaacctcaaggnatggcctgatggataa 101
           |||||||||||||| |||||||||||||| || |||||||| | ||||||||||||||||
Sbjct: 213 cgaccacatccccaagcagttccgcgagg-ag-aacctcaaag-atggcctgatggataa 269

                                                                       
Query: 102 ttacaagaatgttcctcagttcctttatggcttaagcccatctcagatggaaatgtttat 161
           |||||||||||||||||| ||||||||||||||||||||  ||||||| |||||||||||
Sbjct: 270 ttacaagaatgttcctcaattcctttatggcttaagccctgctcagatcgaaatgtttat 329

                                                                       
Query: 162 gaccgacaacaacccttataatcggctgtcacagaaagttacagaggaaagcatttctgc 221
           || |||  | || || ||| ||||||  ||||||| ||||||||||||||||||||||||
Sbjct: 330 gaacgatgataatccatatgatcggcaatcacagagagttacagaggaaagcatttctgc 389

                                                                       
Query: 222 tttgaggagttatgatgaatttggtatgtactccttatcaggcacgcatgagggccctac 281
           ||  ||||| |||||||||||||| ||||||  ||| || || | ||||||||||||| |
Sbjct: 390 ttctaggagctatgatgaatttggcatgtacaacttgtccggtatgcatgagggccctgc 449

                                                                       
Query: 282 aagttacaacatgggcatgggcatgcccagcatgagcatgggtagagcagggaaaggata 341
           | |||||| |||||| ||||| |||  || |||||||||||| || ||||||  ||||||
Sbjct: 450 aggttacagcatgggtatgggaatgggcaccatgagcatgggcagggcagggcgaggata 509

                                                                       
Query: 342 tagaagaatgagaagctcagccccagatctgccatcattgctgttggactcccgaattat 401
           ||||||||||||||| ||||| |||||||||||||||||||| |||||||| ||||||||
Sbjct: 510 tagaagaatgagaagttcagctccagatctgccatcattgctattggactctcgaattat 569

                                                                       
Query: 402 atttcttggaatgccaattgttccagctgtgactgagcttattgctgctcagtttctgtg 461
           ||| ||||||||||| ||||||||||| || || |||||||||||||| || ||||||||
Sbjct: 570 attccttggaatgcctattgttccagcagtaacagagcttattgctgcgcaatttctgtg 629

                                                                       
Query: 462 gctagactatgatgaccgcacgaagccaatttacttgtatataaactccacaggaacaat 521
           |||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| ||
Sbjct: 630 gctagattatgatgaccgcaccaagccaatttacttgtatataaactccacaggaaccat 689

                                                                    
Query: 522 ggatgaaaataatgagctggtcgcatctgaaactgatgcctatgcaattgctgattt 578
           ||||||||| ||||||||||| ||||||||||||||||| | |||||||||||||||
Sbjct: 690 ggatgaaaacaatgagctggttgcatctgaaactgatgcatttgcaattgctgattt 746
to top
>gb|AC130728.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0663C08,
             complete sequence
          Length = 142196

 Score =  204 bits (103), Expect = 2e-49
 Identities = 184/211 (87%)
 Strand = Plus / Minus

                                                                         
Query: 206   aggaaagcatttctgctttgaggagttatgatgaatttggtatgtactccttatcaggca 265
             ||||||||||||||||||  ||||| |||||||||||||| ||||||  ||| || || |
Sbjct: 56546 aggaaagcatttctgcttctaggagctatgatgaatttggcatgtacaacttgtccggta 56487

                                                                         
Query: 266   cgcatgagggccctacaagttacaacatgggcatgggcatgcccagcatgagcatgggta 325
              ||||||||||||| || |||||| |||||| ||||| |||  || |||||||||||| |
Sbjct: 56486 tgcatgagggccctgcaggttacagcatgggtatgggaatgggcaccatgagcatgggca 56427

                                                                         
Query: 326   gagcagggaaaggatatagaagaatgagaagctcagccccagatctgccatcattgctgt 385
             | ||||||  ||||||||||||||||||||| ||||| |||||||||||||||||||| |
Sbjct: 56426 gggcagggcgaggatatagaagaatgagaagttcagctccagatctgccatcattgctat 56367

                                            
Query: 386   tggactcccgaattatatttcttggaatgcc 416
             ||||||| ||||||||||| |||||||||||
Sbjct: 56366 tggactctcgaattatattccttggaatgcc 56336



 Score =  147 bits (74), Expect = 5e-32
 Identities = 98/106 (92%)
 Strand = Plus / Minus

                                                                         
Query: 418   attgttccagctgtgactgagcttattgctgctcagtttctgtggctagactatgatgac 477
             ||||||||||| || || |||||||||||||| || |||||||||||||| |||||||||
Sbjct: 56227 attgttccagcagtaacagagcttattgctgcgcaatttctgtggctagattatgatgac 56168

                                                           
Query: 478   cgcacgaagccaatttacttgtatataaactccacaggaacaatgg 523
             ||||| ||||||||||||||||||||||||||||||||||| ||||
Sbjct: 56167 cgcaccaagccaatttacttgtatataaactccacaggaaccatgg 56122



 Score =  121 bits (61), Expect = 3e-24
 Identities = 103/117 (88%)
 Strand = Plus / Minus

                                                                         
Query: 92    tgatggataattacaagaatgttcctcagttcctttatggcttaagcccatctcagatgg 151
             |||||||||||||||||||||||||||| ||||||||||||||||||||  ||||||| |
Sbjct: 56760 tgatggataattacaagaatgttcctcaattcctttatggcttaagccctgctcagatcg 56701

                                                                      
Query: 152   aaatgtttatgaccgacaacaacccttataatcggctgtcacagaaagttacagagg 208
             |||||||||||| |||  | || || ||| ||||||  ||||||| |||||||||||
Sbjct: 56700 aaatgtttatgaacgatgataatccatatgatcggcaatcacagagagttacagagg 56644



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                      
Query: 522   ggatgaaaataatgagctggtcgcatctgaaactgatgcctatgcaattgctgattt 578
             ||||||||| ||||||||||| ||||||||||||||||| | |||||||||||||||
Sbjct: 56017 ggatgaaaacaatgagctggttgcatctgaaactgatgcatttgcaattgctgattt 55961



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 28/29 (96%), Gaps = 1/29 (3%)
 Strand = Plus / Minus

                                          
Query: 43    cgaccacatcccca-gcagttccgcgagg 70
             |||||||||||||| ||||||||||||||
Sbjct: 57578 cgaccacatccccaagcagttccgcgagg 57550
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  204 bits (103), Expect = 2e-49
 Identities = 184/211 (87%)
 Strand = Plus / Minus

                                                                            
Query: 206      aggaaagcatttctgctttgaggagttatgatgaatttggtatgtactccttatcaggca 265
                ||||||||||||||||||  ||||| |||||||||||||| ||||||  ||| || || |
Sbjct: 29277889 aggaaagcatttctgcttctaggagctatgatgaatttggcatgtacaacttgtccggta 29277830

                                                                            
Query: 266      cgcatgagggccctacaagttacaacatgggcatgggcatgcccagcatgagcatgggta 325
                 ||||||||||||| || |||||| |||||| ||||| |||  || |||||||||||| |
Sbjct: 29277829 tgcatgagggccctgcaggttacagcatgggtatgggaatgggcaccatgagcatgggca 29277770

                                                                            
Query: 326      gagcagggaaaggatatagaagaatgagaagctcagccccagatctgccatcattgctgt 385
                | ||||||  ||||||||||||||||||||| ||||| |||||||||||||||||||| |
Sbjct: 29277769 gggcagggcgaggatatagaagaatgagaagttcagctccagatctgccatcattgctat 29277710

                                               
Query: 386      tggactcccgaattatatttcttggaatgcc 416
                ||||||| ||||||||||| |||||||||||
Sbjct: 29277709 tggactctcgaattatattccttggaatgcc 29277679



 Score =  147 bits (74), Expect = 5e-32
 Identities = 98/106 (92%)
 Strand = Plus / Minus

                                                                            
Query: 418      attgttccagctgtgactgagcttattgctgctcagtttctgtggctagactatgatgac 477
                ||||||||||| || || |||||||||||||| || |||||||||||||| |||||||||
Sbjct: 29277570 attgttccagcagtaacagagcttattgctgcgcaatttctgtggctagattatgatgac 29277511

                                                              
Query: 478      cgcacgaagccaatttacttgtatataaactccacaggaacaatgg 523
                ||||| ||||||||||||||||||||||||||||||||||| ||||
Sbjct: 29277510 cgcaccaagccaatttacttgtatataaactccacaggaaccatgg 29277465



 Score =  121 bits (61), Expect = 3e-24
 Identities = 103/117 (88%)
 Strand = Plus / Minus

                                                                            
Query: 92       tgatggataattacaagaatgttcctcagttcctttatggcttaagcccatctcagatgg 151
                |||||||||||||||||||||||||||| ||||||||||||||||||||  ||||||| |
Sbjct: 29278103 tgatggataattacaagaatgttcctcaattcctttatggcttaagccctgctcagatcg 29278044

                                                                         
Query: 152      aaatgtttatgaccgacaacaacccttataatcggctgtcacagaaagttacagagg 208
                |||||||||||| |||  | || || ||| ||||||  ||||||| |||||||||||
Sbjct: 29278043 aaatgtttatgaacgatgataatccatatgatcggcaatcacagagagttacagagg 29277987



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 66/72 (91%)
 Strand = Plus / Minus

                                                                            
Query: 309      cagcatgagcatgggtagagcagggaaaggatatagaagaatgagaagctcagccccaga 368
                |||||||||||||||| | ||||||  ||||||||||||||||||||| ||||| |||||
Sbjct: 11540970 cagcatgagcatgggttgggcagggcgaggatatagaagaatgagaagttcagctccaga 11540911

                            
Query: 369      tctgccatcatt 380
                ||||||||||||
Sbjct: 11540910 tctgccatcatt 11540899



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                         
Query: 522      ggatgaaaataatgagctggtcgcatctgaaactgatgcctatgcaattgctgattt 578
                ||||||||| ||||||||||| ||||||||||||||||| | |||||||||||||||
Sbjct: 29277360 ggatgaaaacaatgagctggttgcatctgaaactgatgcatttgcaattgctgattt 29277304



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 63/72 (87%)
 Strand = Plus / Minus

                                                                            
Query: 92       tgatggataattacaagaatgttcctcagttcctttatggcttaagcccatctcagatgg 151
                |||||||||||||||| ||| ||||||| ||| ||||| ||||||| ||  |||||||||
Sbjct: 11541161 tgatggataattacaaaaatattcctcaattcttttatagcttaagtcctgctcagatgg 11541102

                            
Query: 152      aaatgtttatga 163
                ||||||| ||||
Sbjct: 11541101 aaatgttcatga 11541090



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                            
Query: 418      attgttccagctgtgactgagcttattgctgctcagtttctgtggctagactatgatgac 477
                ||||||||||| || || | |||||||||||   | ||||||| |||||| |||| ||||
Sbjct: 11540752 attgttccagcagtaacagggcttattgctgtgaaatttctgtagctagattatggtgac 11540693

                                       
Query: 478      cgcacgaagccaatttacttgta 500
                | ||  |||||||||||||||||
Sbjct: 11540692 ctcatcaagccaatttacttgta 11540670



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 28/29 (96%), Gaps = 1/29 (3%)
 Strand = Plus / Minus

                                             
Query: 43       cgaccacatcccca-gcagttccgcgagg 70
                |||||||||||||| ||||||||||||||
Sbjct: 29278921 cgaccacatccccaagcagttccgcgagg 29278893
to top
>gb|AC136229.3| Oryza sativa (japonica cultivar-group) chromosome 5 PAC clone P0690B12,
              complete sequence
          Length = 135323

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 66/72 (91%)
 Strand = Plus / Minus

                                                                          
Query: 309    cagcatgagcatgggtagagcagggaaaggatatagaagaatgagaagctcagccccaga 368
              |||||||||||||||| | ||||||  ||||||||||||||||||||| ||||| |||||
Sbjct: 110464 cagcatgagcatgggttgggcagggcgaggatatagaagaatgagaagttcagctccaga 110405

                          
Query: 369    tctgccatcatt 380
              ||||||||||||
Sbjct: 110404 tctgccatcatt 110393



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 63/72 (87%)
 Strand = Plus / Minus

                                                                          
Query: 92     tgatggataattacaagaatgttcctcagttcctttatggcttaagcccatctcagatgg 151
              |||||||||||||||| ||| ||||||| ||| ||||| ||||||| ||  |||||||||
Sbjct: 110655 tgatggataattacaaaaatattcctcaattcttttatagcttaagtcctgctcagatgg 110596

                          
Query: 152    aaatgtttatga 163
              ||||||| ||||
Sbjct: 110595 aaatgttcatga 110584



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                          
Query: 418    attgttccagctgtgactgagcttattgctgctcagtttctgtggctagactatgatgac 477
              ||||||||||| || || | |||||||||||   | ||||||| |||||| |||| ||||
Sbjct: 110246 attgttccagcagtaacagggcttattgctgtgaaatttctgtagctagattatggtgac 110187

                                     
Query: 478    cgcacgaagccaatttacttgta 500
              | ||  |||||||||||||||||
Sbjct: 110186 ctcatcaagccaatttacttgta 110164
to top
>ref|XM_526292.1| PREDICTED: Pan troglodytes similar to beta-1,4-mannosyltransferase;
           beta-1,4 mannosyltransferase (LOC470909), mRNA
          Length = 996

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  accacggcgacggcccgccag 35
           |||||||||||||||||||||
Sbjct: 362 accacggcgacggcccgccag 342
to top
>gb|AC160028.9| Mus musculus 10 BAC RP24-570M12 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 223055

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 394   cgaattatatttcttggaatg 414
             |||||||||||||||||||||
Sbjct: 27069 cgaattatatttcttggaatg 27089
to top
>gb|AC183103.2| Pan troglodytes BAC clone CH251-712L4 from chromosome 3, complete
             sequence
          Length = 191366

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 15    accacggcgacggcccgccag 35
             |||||||||||||||||||||
Sbjct: 79057 accacggcgacggcccgccag 79077
to top
>ref|XM_977709.1| PREDICTED: Mus musculus expressed sequence AI642036 (AI642036), mRNA
          Length = 3538

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 291  catgggcatgggcatgcccagcatg 315
            |||||| ||||||||||||||||||
Sbjct: 2106 catgggaatgggcatgcccagcatg 2130
to top
>ref|XM_983834.1| PREDICTED: Mus musculus expressed sequence AI642036 (AI642036), mRNA
          Length = 3583

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 291  catgggcatgggcatgcccagcatg 315
            |||||| ||||||||||||||||||
Sbjct: 2151 catgggaatgggcatgcccagcatg 2175
to top
>ref|XM_908092.2| PREDICTED: Mus musculus expressed sequence AI642036, transcript
            variant 3 (AI642036), mRNA
          Length = 3538

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 291  catgggcatgggcatgcccagcatg 315
            |||||| ||||||||||||||||||
Sbjct: 2106 catgggaatgggcatgcccagcatg 2130
to top
>gb|AC121850.3| Mus musculus BAC clone RP24-92E18 from chromosome 3, complete sequence
          Length = 195731

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 523   gatgaaaataatgagctggtc 543
             |||||||||||||||||||||
Sbjct: 37161 gatgaaaataatgagctggtc 37141
to top
>emb|AL356217.30| Human DNA sequence from clone RP11-518D7 on chromosome 13 Contains a
             novel gene, complete sequence
          Length = 103060

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 523   gatgaaaataatgagctggtc 543
             |||||||||||||||||||||
Sbjct: 54387 gatgaaaataatgagctggtc 54407
to top
>gb|AC153495.10| Mus musculus 10 BAC RP23-468D5 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 179258

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 394    cgaattatatttcttggaatg 414
              |||||||||||||||||||||
Sbjct: 148372 cgaattatatttcttggaatg 148392
to top
>emb|AL645948.10| Mouse DNA sequence from clone RP23-298M7 on chromosome 11 Contains an H+
              transporting ATP synthase mitochondrial F0 complex subunit
              g (Atp5l) pseudogene, a ferritin light chain 1 (Ftl1)
              pseudogene, three novel genes, the gene for a novel ENTH
              domain containing protein, the 5' end of the Sox30 gene for
              SRY-box containing gene 30 and three Cpg islands, complete
              sequence
          Length = 207877

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 291    catgggcatgggcatgcccagcatg 315
              |||||| ||||||||||||||||||
Sbjct: 133432 catgggaatgggcatgcccagcatg 133456
to top
>gb|AC009835.14| Homo sapiens chromosome 18, clone RP11-413I9, complete sequence
          Length = 157979

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 326   gagcagggaaaggatatagaa 346
             |||||||||||||||||||||
Sbjct: 92734 gagcagggaaaggatatagaa 92754
to top
>dbj|AK147875.1| Mus musculus melanocyte cDNA, RIKEN full-length enriched library,
            clone:G270074I22 product:Epsin 4 (Epsin-related protein)
            (EpsinR) (Enthoprotin) homolog [Mus musculus], full
            insert sequence
          Length = 3376

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 291  catgggcatgggcatgcccagcatg 315
            |||||| ||||||||||||||||||
Sbjct: 1952 catgggaatgggcatgcccagcatg 1976
to top
>dbj|AK143544.1| Mus musculus 12 days embryo whole body cDNA, RIKEN full-length
            enriched library, clone:E970027B04 product:Epsin 4
            (Epsin-related protein) (EpsinR) (Enthoprotin) homolog
            [Mus musculus], full insert sequence
          Length = 3398

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 291  catgggcatgggcatgcccagcatg 315
            |||||| ||||||||||||||||||
Sbjct: 1968 catgggaatgggcatgcccagcatg 1992
to top
>ref|XM_944081.1| PREDICTED: Homo sapiens hypothetical protein LOC650195 (LOC650195),
           mRNA
          Length = 714

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  accacggcgacggcccgccag 35
           |||||||||||||||||||||
Sbjct: 362 accacggcgacggcccgccag 342
to top
>dbj|AK168991.1| Mus musculus 16 days embryo kidney cDNA, RIKEN full-length enriched
            library, clone:I920070K02 product:Epsin 4 (Epsin-related
            protein) (EpsinR) (Enthoprotin) homolog [Mus musculus],
            full insert sequence
          Length = 2039

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 291  catgggcatgggcatgcccagcatg 315
            |||||| ||||||||||||||||||
Sbjct: 1933 catgggaatgggcatgcccagcatg 1957
to top
>dbj|AK167454.1| Mus musculus 12 days pregnant adult female placenta cDNA, RIKEN
           full-length enriched library, clone:I530014J18
           product:hypothetical Methionine-rich region profile
           containing protein, full insert sequence
          Length = 2005

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 291 catgggcatgggcatgcccagcatg 315
           |||||| ||||||||||||||||||
Sbjct: 579 catgggaatgggcatgcccagcatg 603
to top
>gb|BC004080.1| Mus musculus expressed sequence AI642036, mRNA (cDNA clone
            IMAGE:3592699), partial cds
          Length = 2943

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 291  catgggcatgggcatgcccagcatg 315
            |||||| ||||||||||||||||||
Sbjct: 1505 catgggaatgggcatgcccagcatg 1529
to top
>gb|AC092903.11| Homo sapiens 3 BAC RP11-666A20 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 161141

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 15    accacggcgacggcccgccag 35
             |||||||||||||||||||||
Sbjct: 83513 accacggcgacggcccgccag 83493
to top
>emb|BX005455.8| Zebrafish DNA sequence from clone CH211-77K19 in linkage group 19,
            complete sequence
          Length = 164741

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 411  aatgccaattgttccagctgtgact 435
            |||||||||||||||||||| ||||
Sbjct: 1379 aatgccaattgttccagctgggact 1403
to top
>dbj|AB093212.1| Mus musculus mRNA for mKIAA0171 protein
          Length = 6730

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 291  catgggcatgggcatgcccagcatg 315
            |||||| ||||||||||||||||||
Sbjct: 5301 catgggaatgggcatgcccagcatg 5325
to top
>emb|AL591826.2|CNS07EGP BAC 13C18 of library CITB 129-Sv from chromosome 10 of strain 129 of Mus
              musculus
          Length = 172715

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 394    cgaattatatttcttggaatg 414
              |||||||||||||||||||||
Sbjct: 125707 cgaattatatttcttggaatg 125727
to top
>ref|NM_103884.2| Arabidopsis thaliana CLPR1; endopeptidase Clp AT1G49970 (CLPR1)
           mRNA, complete cds
          Length = 1714

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 447 tgctcagtttctgtggctagactatgatgaccgcacgaagccaatttacttgtatataaa 506
           |||||| ||| ||||| ||||||||||| |||  || ||||| || ||||| ||||||||
Sbjct: 738 tgctcaatttatgtggttagactatgataacccaacaaagcccatctacttatatataaa 797



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 196 aaagttacagaggaaagcat 215
           ||||||||||||||||||||
Sbjct: 487 aaagttacagaggaaagcat 506
to top
>gb|AC156992.13| Mus musculus chromosome 7, clone RP23-474C17, complete sequence
          Length = 178169

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 361   gccccagatctgccatcatt 380
             ||||||||||||||||||||
Sbjct: 38115 gccccagatctgccatcatt 38096
to top
>gb|CP000233.1| Lactobacillus salivarius subsp. salivarius UCC118, complete genome
          Length = 1827111

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 555    tgatgcctatgcaattgctg 574
              ||||||||||||||||||||
Sbjct: 205848 tgatgcctatgcaattgctg 205867
to top
>gb|AC005164.2| Homo sapiens BAC clone CTB-135C18 from 7, complete sequence
          Length = 123331

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 189    gtcacagaaagttacagagg 208
              ||||||||||||||||||||
Sbjct: 117868 gtcacagaaagttacagagg 117849
to top
>gb|AC124196.4| Mus musculus BAC clone RP23-296L12 from chromosome 13, complete sequence
          Length = 193553

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 334    aaaggatatagaagaatgag 353
              ||||||||||||||||||||
Sbjct: 122340 aaaggatatagaagaatgag 122359
to top
>gb|AC139886.3| Mus musculus BAC clone RP23-120M10 from chromosome 15, complete
             sequence
          Length = 211336

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 448   gctcagtttctgtggctaga 467
             ||||||||||||||||||||
Sbjct: 85637 gctcagtttctgtggctaga 85656
to top
>emb|AL691464.4| Human DNA sequence from clone RP4-644F6 on chromosome 1 Contains a
             novel gene (DKFZp686G0786), a calpain, small subunit 1
             (CAPNS1) pseudogene and a guanylate binding protein
             pseudogene, complete sequence
          Length = 83709

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 114   tcctcagttcctttatggct 133
             ||||||||||||||||||||
Sbjct: 81162 tcctcagttcctttatggct 81143
to top
>emb|AL161658.21| Human DNA sequence from clone RP11-470C13 on chromosome 20 Contains the
             3' end of the gene for KIAA1272 protein (similar to rat
             tulip proteins 1 and 2), the INSM1 gene for
             insulinoma-associated protein 1, the 3' end of the
             C20orf26 gene and a CpG island, complete sequence
          Length = 67356

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 325   agagcagggaaaggatatag 344
             ||||||||||||||||||||
Sbjct: 63626 agagcagggaaaggatatag 63607
to top
>emb|AL138694.18| Human DNA sequence from clone RP11-330C15 on chromosome 13q33.1-34
              Contains a pseudogene similar to part of host cell factor 2
              (HCF-2) and a CpG island, complete sequence
          Length = 157264

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 337    ggatatagaagaatgagaag 356
              ||||||||||||||||||||
Sbjct: 144717 ggatatagaagaatgagaag 144736
to top
>emb|AL022395.2|HS273N12 Human DNA sequence from clone RP1-273N12 on chromosome 6q16.1-16.3
              Contains the FBXL4 gene for F-box and leucine-rich repeat
              protein 4 and the POU3F2 gene for POU domain class 3
              transcription factor 2 and a CpG island, complete sequence
          Length = 126882

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 252    ctccttatcaggcacgcatgaggg 275
              |||||||||||||| |||||||||
Sbjct: 116880 ctccttatcaggcaggcatgaggg 116857
to top
>gb|BT000572.1| Arabidopsis thaliana nClpP5, putative  (At1g49970/F2J10_5) mRNA,
           complete cds
          Length = 1164

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 447 tgctcagtttctgtggctagactatgatgaccgcacgaagccaatttacttgtatataaa 506
           |||||| ||| ||||| ||||||||||| |||  || ||||| || ||||| ||||||||
Sbjct: 591 tgctcaatttatgtggttagactatgataacccaacaaagcccatctacttatatataaa 650



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 196 aaagttacagaggaaagcat 215
           ||||||||||||||||||||
Sbjct: 340 aaagttacagaggaaagcat 359
to top
>emb|AL023893.1|DMC132E8 Drosophila melanogaster cosmid clone 132E8
          Length = 39910

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 291   catgggcatgggcatgccca 310
             ||||||||||||||||||||
Sbjct: 10265 catgggcatgggcatgccca 10284
to top
>gb|AC104141.8| Drosophila melanogaster X BAC RP98-9H15 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 181360

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 291   catgggcatgggcatgccca 310
             ||||||||||||||||||||
Sbjct: 49686 catgggcatgggcatgccca 49705
to top
>gb|AC024947.5| Homo sapiens chromosome 01 clone RP11-200I10, complete sequence
          Length = 163033

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 189    gtcacagaaagttacagagg 208
              ||||||||||||||||||||
Sbjct: 124239 gtcacagaaagttacagagg 124220
to top
>ref|NM_206603.1| Drosophila melanogaster CG3056-RB, transcript variant B (CG3056),
            mRNA
          Length = 3075

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 291  catgggcatgggcatgccca 310
            ||||||||||||||||||||
Sbjct: 1342 catgggcatgggcatgccca 1361
to top
>ref|NM_130552.2| Drosophila melanogaster CG3056-RA, transcript variant A (CG3056),
            mRNA
          Length = 3022

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 291  catgggcatgggcatgccca 310
            ||||||||||||||||||||
Sbjct: 1342 catgggcatgggcatgccca 1361
to top
>gb|AC104288.4| Drosophila melanogaster X BAC RP98-30G24 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 164252

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 291    catgggcatgggcatgccca 310
              ||||||||||||||||||||
Sbjct: 109201 catgggcatgggcatgccca 109220
to top
>gb|AY045677.1| Arabidopsis thaliana At1g49970/F2J10_5 mRNA, complete cds
          Length = 1385

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 447 tgctcagtttctgtggctagactatgatgaccgcacgaagccaatttacttgtatataaa 506
           |||||| ||| ||||| ||||||||||| |||  || ||||| || ||||| ||||||||
Sbjct: 695 tgctcaatttatgtggttagactatgataacccaacaaagcccatctacttatatataaa 754



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 196 aaagttacagaggaaagcat 215
           ||||||||||||||||||||
Sbjct: 444 aaagttacagaggaaagcat 463
to top
>emb|BX814276.1|CNS0ADR3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB65ZG01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 726

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 447 tgctcagtttctgtggctagactatgatgaccgcacgaagccaatttacttgtatataaa 506
           |||||| ||| ||||| ||||||||||| |||  || ||||| || ||||| ||||||||
Sbjct: 6   tgctcaatttatgtggttagactatgataacccaacaaagcccatctacttatatataaa 65
to top
>gb|AC108733.4| Homo sapiens 3 BAC RP11-789F5 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 171184

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 194    agaaagttacagaggaaagcattt 217
              ||||||||| ||||||||||||||
Sbjct: 110614 agaaagttagagaggaaagcattt 110591
to top
>gb|BT003171.1| Drosophila melanogaster SD07604 full insert cDNA
          Length = 3080

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 291  catgggcatgggcatgccca 310
            ||||||||||||||||||||
Sbjct: 1313 catgggcatgggcatgccca 1332
to top
>gb|AY086911.1| Arabidopsis thaliana clone 29389 mRNA, complete sequence
          Length = 1376

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 196 aaagttacagaggaaagcat 215
           ||||||||||||||||||||
Sbjct: 385 aaagttacagaggaaagcat 404
to top
>gb|AC015445.3|F2J10 Sequence of BAC F2J10 from Arabidopsis thaliana chromosome 1, complete
             sequence
          Length = 91720

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                         
Query: 447   tgctcagtttctgtggctagactatgatgaccgcacgaagccaatttacttgtatataaa 506
             |||||| ||| ||||| ||||||||||| |||  || ||||| || ||||| ||||||||
Sbjct: 72977 tgctcaatttatgtggttagactatgataacccaacaaagcccatctacttatatataaa 73036
to top
>emb|BX255877.14| Zebrafish DNA sequence from clone CH211-254C9, complete sequence
          Length = 152976

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 488    caatttacttgtatataaac 507
              ||||||||||||||||||||
Sbjct: 116779 caatttacttgtatataaac 116760
to top
>dbj|AB022330.1| Arabidopsis thaliana mRNA for nClpP5 (nuclear encoded ClpP5),
           complete cds
          Length = 1463

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 447 tgctcagtttctgtggctagactatgatgaccgcacgaagccaatttacttgtatataaa 506
           |||||| ||| ||||| ||||||||||| |||  || ||||| || ||||| ||||||||
Sbjct: 738 tgctcaatttatgtggttagactatgataacccaacaaagcccatctacttatatataaa 797



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 196 aaagttacagaggaaagcat 215
           ||||||||||||||||||||
Sbjct: 487 aaagttacagaggaaagcat 506
to top
>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence
          Length = 3716413

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 16     ccacggcgacggcccgccag 35
              ||||||||||||||||||||
Sbjct: 360974 ccacggcgacggcccgccag 360955
to top
>emb|CR769778.10| Zebrafish DNA sequence from clone CH211-147N12 in linkage group 18,
             complete sequence
          Length = 162450

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 513   aggaacaatggatgaaaataatga 536
             |||||||||||||||||| |||||
Sbjct: 43429 aggaacaatggatgaaaagaatga 43406



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 513   aggaacaatggatgaaaataatga 536
             |||||||||||||||||| |||||
Sbjct: 43019 aggaacaatggatgaaaagaatga 42996
to top
>gb|AE003420.2| Drosophila melanogaster chromosome X, section 4 of 74 of the complete
              sequence
          Length = 308311

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 291    catgggcatgggcatgccca 310
              ||||||||||||||||||||
Sbjct: 220521 catgggcatgggcatgccca 220540
to top
>emb|CR556713.11| Zebrafish DNA sequence from clone DKEY-28O14 in linkage group 11,
              complete sequence
          Length = 229692

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 443    ttgctgctcagtttctgtgg 462
              ||||||||||||||||||||
Sbjct: 206479 ttgctgctcagtttctgtgg 206498
to top
>gb|BT001477.1| Drosophila melanogaster LD21345 full insert cDNA
          Length = 3052

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 291  catgggcatgggcatgccca 310
            ||||||||||||||||||||
Sbjct: 1293 catgggcatgggcatgccca 1312
to top
>dbj|AP003040.2| Homo sapiens genomic DNA, chromosome 11q clone:RP11-335F8, complete
             sequence
          Length = 80198

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 514   ggaacaatggatgaaaataa 533
             ||||||||||||||||||||
Sbjct: 23570 ggaacaatggatgaaaataa 23589


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,329,775
Number of Sequences: 3902068
Number of extensions: 5329775
Number of successful extensions: 113880
Number of sequences better than 10.0: 57
Number of HSP's better than 10.0 without gapping: 58
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 113647
Number of HSP's gapped (non-prelim): 227
length of query: 583
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 560
effective length of database: 17,143,297,704
effective search space: 9600246714240
effective search space used: 9600246714240
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top