Clone Name	bags12k24
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein g...	515	e-143
2	emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putat...	500	e-138
3	gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding p...	488	e-134
4	gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds	484	e-133
5	emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein	440	e-120
6	emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll ...	375	e-100
7	emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chl...	365	1e-97
8	emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlo...	361	2e-96
9	emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding...	351	2e-93
10	ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predic...	343	4e-91
11	gb|AY100470.1| Oryza sativa (indica cultivar-group) putative sol...	343	4e-91
12	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	343	4e-91
13	dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic D...	343	4e-91
14	dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clon...	343	4e-91
15	dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clon...	343	4e-91
16	dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clon...	343	4e-91
17	dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clon...	341	2e-90
18	gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protei...	331	2e-87
19	dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D...	321	1e-84
20	dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic D...	321	1e-84
21	dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic D...	321	1e-84
22	dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clon...	321	1e-84
23	dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clon...	321	1e-84
24	dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clon...	321	1e-84
25	dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clon...	321	1e-84
26	ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predic...	319	6e-84
27	dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic D...	319	6e-84
28	dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clon...	319	6e-84
29	dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clon...	319	6e-84
30	emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chloro...	315	9e-83
31	dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clon...	313	4e-82
32	dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRN...	313	4e-82
33	gb|U21114.1|STU21114 Solanum tuberosum chlorophyll a/b binding p...	311	1e-81
34	gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding p...	311	1e-81
35	emb|AJ843976.1| Plantago major partial mRNA for light harvesting...	299	5e-78
36	gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding p...	291	1e-75
37	gb|U21113.1|STU21113 Solanum tuberosum chlorophyll a/b binding p...	287	2e-74
38	gb|U21112.1|STU21112 Solanum tuberosum chlorophyll a/b binding p...	287	2e-74
39	emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding p...	283	3e-73
40	emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chloro...	283	3e-73
41	gb|AY389573.1| Hyacinthus orientalis chloroplast chlorophyll A-B...	281	1e-72
42	gb|BT014208.1| Lycopersicon esculentum clone 133385R, mRNA sequence	272	1e-69
43	emb|X52743.1|NTCAB21 Tabacco Cab21 mRNA for major chlorophyll a/...	272	1e-69
44	emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/...	272	1e-69
45	gb|M14443.1|TOMCBPA Tomato chlorophyll a/b-binding protein gene ...	272	1e-69
46	emb|X02359.1|PECAB22L Petunia gene for chlorophyll a/b binding p...	270	5e-69
47	dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone...	268	2e-68
48	gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B...	266	8e-68
49	emb|X52744.1|NTCAB40 Tabacco Cab40 mRNA for major chlorophyll a/...	266	8e-68
50	emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding pr...	260	5e-66
51	gb|AY109324.1| Zea mays CL187_1 mRNA sequence	258	2e-65
52	dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 g...	252	1e-63
53	gb|AY389553.1| Hyacinthus orientalis chloroplast chlorophyll A-B...	250	5e-63
54	gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B...	250	5e-63
55	gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab...	248	2e-62
56	dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue...	246	7e-62
57	gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b bi...	244	3e-61
58	gb|M16058.1|CUSLHCPB Cucumber LHCP mRNA encoding chlorophyll a/b...	244	3e-61
59	dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for ...	244	3e-61
60	emb|AJ318069.1|STU318069 Solanum tuberosum mRNA for ferredoxin-t...	240	4e-60
61	gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b ...	236	7e-59
62	gb|AF295639.1| Beta vulgaris chlorophyll a/b binding protein (ca...	234	3e-58
63	gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene ...	234	3e-58
64	emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll...	232	1e-57
65	gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll...	232	1e-57
66	emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b bin...	230	4e-57
67	emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b bindin...	230	4e-57
68	gb|M21397.1|TOBCABA Tobacco chlorophyll a/b-binding protein (Cab...	230	4e-57
69	dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harv...	230	4e-57
70	dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harv...	230	4e-57
71	gb|AY198376.1| Citrus limon chlorophyll a/b-binding protein prec...	228	2e-56
72	gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast c...	226	7e-56
73	gb|M16057.1|CUSLHCPA Cucumber LHCP mRNA encoding chlorophyll a/b...	226	7e-56
74	gb|AY617096.1| Picea sitchensis chloroplast light harvesting chl...	218	2e-53
75	gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll...	216	6e-53
76	dbj|AB012636.1| Nicotiana sylvestris Lhcb1*1 gene for light harv...	216	6e-53
77	emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/...	214	3e-52
78	gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding pro...	214	3e-52
79	emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll ...	214	3e-52
80	gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein...	212	1e-51
81	emb|X02360.1|PECAB22R Petunia gene for chlorophyll a/b binding p...	210	4e-51
82	emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for lig...	210	4e-51
83	emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for ligh...	210	4e-51
84	emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding pr...	208	2e-50
85	gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding p...	204	2e-49
86	gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll...	204	2e-49
87	gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chl...	202	1e-48
88	gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlor...	202	1e-48
89	dbj|AB050125.1| Amaranthus tricolor cab1b mRNA for type I chloro...	202	1e-48
90	gb|AF220527.1|AF220527 Euphorbia esula chlorophyll a/b binding p...	198	1e-47
91	gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protei...	196	6e-47
92	gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (L...	194	2e-46
93	emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chloro...	194	2e-46
94	gb|AY845253.1| Pisum sativum light-harvesting chlorophyll-a/b bi...	192	9e-46
95	gb|AY617083.1| Pinus radiata chloroplast light harvesting chloro...	192	9e-46
96	gb|AY617081.1| Pinus echinata chloroplast light harvesting chlor...	192	9e-46
97	dbj|AB236867.1| Panax ginseng cab mRNA for chlorophyll a/b bindi...	192	9e-46
98	gb|AY219853.1| Nicotiana tabacum chlorophyll a/b binding protein...	192	9e-46
99	emb|X58230.1|NTCAB36 Tobacco CAB36 gene for chlorophyll a/b bind...	192	9e-46
100	emb|X16536.1|GMCAB5 G.max DNA for Cab5	192	9e-46
101	emb|X68333.1|HHLHC H.helix mRNA for light harvesting chlorophyll...	192	9e-46
102	emb|Z13987.1|STCABPSII S.tuberosum gene for chlorophyll a/b-bind...	190	4e-45
103	emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chloro...	188	1e-44
104	gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlor...	186	6e-44
105	gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlor...	186	6e-44
106	gb|U21115.1|STU21115 Solanum tuberosum chlorophyll a/b binding p...	186	6e-44
107	dbj|D14002.1|LAUCAB Lettuce mRNA for light-harvesting chlorophyl...	186	6e-44
108	emb|X54090.1|GHCAB G.hirsutum cab gene for chlorophyll ab bindin...	184	2e-43
109	emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll...	184	2e-43
110	gb|AY617084.1| Pinus contorta chloroplast light harvesting chlor...	184	2e-43
111	gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlo...	184	2e-43
112	gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding...	184	2e-43
113	gb|AF039598.1| Prunus persica light harvesting chlorophyll A/B b...	184	2e-43
114	emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b bind...	184	2e-43
115	gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene...	184	2e-43
116	dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chloro...	182	9e-43
117	gb|M17558.1|TOMCAB4A Tomato Cab-4 gene encoding chlorophyll a/b-...	182	9e-43
118	gb|J01253.1|PEACAB15 Pea major chlorophyll a/b-binding thylakoid...	182	9e-43
119	dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-b...	182	9e-43
120	ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2...	180	3e-42
121	ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll bindin...	180	3e-42
122	gb|AY142513.1| Arabidopsis thaliana putative photosystem II type...	180	3e-42
123	gb|AY045806.1| Arabidopsis thaliana putative photosystem II type...	180	3e-42
124	gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 ma...	180	3e-42
125	gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 ma...	180	3e-42
126	gb|AY081587.1| Arabidopsis thaliana photosystem II type I chloro...	180	3e-42
127	gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co...	180	3e-42
128	gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co...	180	3e-42
129	gb|AY065125.1| Arabidopsis thaliana photosystem II type I chloro...	180	3e-42
130	gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 ...	180	3e-42
131	gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 ...	180	3e-42
132	gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 ...	180	3e-42
133	gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co...	180	3e-42
134	gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 ...	180	3e-42
135	emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Co...	180	3e-42
136	emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Co...	180	3e-42
137	emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II c...	180	3e-42
138	gb|M21396.1|SOYCBPA Soybean light-harvesting chlorophyll a/b-bin...	180	3e-42
139	gb|AY617093.1| Pinus remota chloroplast light harvesting chlorop...	178	1e-41
140	gb|AY617092.1| Pinus monophylla chloroplast light harvesting chl...	178	1e-41
141	emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-h...	178	1e-41
142	dbj|AB013728.1| Cryptomeria japonica mRNA for light-harvesting c...	178	1e-41
143	gb|DQ018375.1| Pinus gerardiana chloroplast putative light harve...	176	5e-41
144	emb|X56538.1|PSCABIIC P.sativum Cab-8 gene for photosystemm II c...	176	5e-41
145	gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding p...	176	5e-41
146	gb|DQ124219.1| Fagus sylvatica putative chlorophyll a/b-binding ...	174	2e-40
147	emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Co...	172	9e-40
148	dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light...	172	9e-40
149	emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding ...	168	1e-38
150	gb|AY617091.1| Pinus strobus chloroplast light harvesting chloro...	168	1e-38
151	gb|AY617090.1| Pinus monticola chloroplast light harvesting chlo...	168	1e-38
152	gb|AY617089.1| Pinus lambertiana chloroplast light harvesting ch...	168	1e-38
153	gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlor...	168	1e-38
154	emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b...	168	1e-38
155	emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting...	168	1e-38
156	gb|M16887.1|SIPCAB White campion chlorophyll a/b-binding protein...	168	1e-38
157	gb|AF162200.1|AF162200 Lactuca sativa light-harvesting chlorophy...	167	5e-38
158	dbj|AB006081.1| Fagus crenata mRNA for chlorophyll a/b-binding p...	167	5e-38
159	ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2...	165	2e-37
160	ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) ...	165	2e-37
161	gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/...	165	2e-37
162	dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene...	165	2e-37
163	emb|BX814757.1|CNS0AEAM Arabidopsis thaliana Full-length cDNA Co...	163	8e-37
164	gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chl...	161	3e-36
165	dbj|AB012639.1| Nicotiana sylvestris Lhcb1*7 gene for light harv...	159	1e-35
166	gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosyste...	157	5e-35
167	emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Co...	155	2e-34
168	emb|AJ234428.1|HVU234428 Hordeum vulgare partial mRNA; clone cMW...	155	2e-34
169	gb|DQ018376.1| Pinus krempfii chloroplast putative light harvest...	153	8e-34
170	emb|Z75663.1|AGCHLABBP A.graveolens mRNA for chlorophyll a/b bin...	153	8e-34
171	gb|M64619.1|PEACAB66 Pea cab gene, complete cds	153	8e-34
172	gb|K02067.1|PEACAB80 Pea (P.sativum) gene AB80 encoding major li...	153	8e-34
173	emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Co...	149	1e-32
174	emb|X16535.1|GMCAB4 G.max DNA for Cab4	149	1e-32
175	gb|DQ471302.1| Carya cathayensis putative chloroplast chlorophyl...	147	5e-32
176	emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/...	147	5e-32
177	emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chl...	145	2e-31
178	emb|X04966.1|PHCAB37 Petunia Cab gene for chlorophyll a/b bindin...	145	2e-31
179	gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence	143	8e-31
180	gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/...	141	3e-30
181	gb|AF133340.1|AF133340 Phalaenopsis sp. 'KCbutterfly' putative c...	141	3e-30
182	gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting comple...	137	5e-29
183	dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvest...	137	5e-29
184	ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll bindin...	135	2e-28
185	gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence	135	2e-28
186	gb|AF339687.1| Arabidopsis thaliana putative photosystem II type...	135	2e-28
187	gb|AF326864.1| Arabidopsis thaliana putative photosystem II type...	135	2e-28
188	gb|AY120776.1| Arabidopsis thaliana putative photosystem II type...	135	2e-28
189	gb|DQ355993.1| Brassica napus chlorophyll a/b binding protein (L...	135	2e-28
190	emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II ...	135	2e-28
191	gb|BT002103.1| Arabidopsis thaliana putative photosystem II type...	135	2e-28
192	gb|AF279250.1|AF279250 Vigna radiata LHCII type I chlorophyll a/...	133	7e-28
193	gb|U01964.1|GMU01964 Glycine max cv. Dare photosystem II type I ...	133	7e-28
194	gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b...	131	3e-27
195	gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II ch...	131	3e-27
196	gb|L36064.1|PRULHP Prunus persica (clone pAB19) light harvesting...	131	3e-27
197	gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genom...	129	1e-26
198	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	129	1e-26
199	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	129	1e-26
200	emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Co...	129	1e-26
201	emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophy...	129	1e-26
202	gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding prot...	129	1e-26
203	ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BIND...	127	5e-26
204	gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-bin...	127	5e-26
205	gb|AY050935.1| Arabidopsis thaliana putative photosystem II type...	127	5e-26
206	gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com...	127	5e-26
207	gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 m...	127	5e-26
208	gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com...	127	5e-26
209	emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Co...	127	5e-26
210	gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P...	127	5e-26
211	gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N...	127	5e-26
212	gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete s...	127	5e-26
213	gb|M97171.1|SOYCAB6A Glycine max chlorophyll a/b binding protein...	123	7e-25
214	emb|Z35160.1|STCHLABP S.tuberosum gene for chlorophyll a/b bindi...	123	7e-25
215	emb|X12980.1|GMCAB2 Soybean Cab2 gene for minor PSII LHCII chlor...	123	7e-25
216	gb|M86906.1|PEACHLROPH Pea (subclone AB9) Cab9 gene, 3' end	123	7e-25
217	ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding ...	121	3e-24
218	gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472)...	121	3e-24
219	gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein...	121	3e-24
220	gb|AY128345.1| Arabidopsis thaliana photosystem II type I chloro...	121	3e-24
221	gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding prot...	121	3e-24
222	gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding prot...	121	3e-24
223	gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com...	121	3e-24
224	gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com...	121	3e-24
225	gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com...	121	3e-24
226	emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Co...	121	3e-24
227	dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clon...	121	3e-24
228	dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRN...	121	3e-24
229	ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BIND...	119	1e-23
230	gb|AC139600.16| Medicago truncatula clone mth2-20m4, complete se...	119	1e-23
231	gb|DQ418483.1| Zingiber officinale chloroplast chlorophyll a/b-b...	119	1e-23
232	gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding prot...	119	1e-23
233	gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding prot...	119	1e-23
234	emb|BX817619.1|CNS0AAVV Arabidopsis thaliana Full-length cDNA Co...	119	1e-23
235	emb|X74731.1|AHLHCB A.hypochondriacus Lhcb1*Ah1 mRNA	119	1e-23
236	emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophy...	119	1e-23
237	emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophy...	119	1e-23
238	dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene...	117	4e-23
239	gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence	115	2e-22
240	emb|AJ000765.1|CRAJ765 Chlamydomonas reinhardtii mRNA for calret...	115	2e-22
241	gb|AF195221.1|AF195221 Pyrus pyrifolia strain Whangkeumbae chlor...	115	2e-22
242	dbj|AP008949.1| Lotus japonicus genomic DNA, chromosome 2, clone...	115	2e-22
243	gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting ...	113	7e-22
244	gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding prot...	113	7e-22
245	gb|M30616.1|TOMCBPC2 Tomato chlorophyll a/b-binding protein Cab-...	113	7e-22
246	gb|K00973.1|PETCAB3 Petunia major chlorophyll a/b binding protei...	111	3e-21
247	emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putativ...	109	1e-20
248	emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b bindi...	107	4e-20
249	gb|M23532.1|PCPCBP P.patens major chlorophyll binding protein ge...	107	4e-20
250	gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvestin...	105	2e-19
251	gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete s...	105	2e-19
252	emb|X74732.1|AHLHAH A.hypochondriacus Lhcb2*Ah1 mRNA	103	7e-19
253	dbj|AB050123.1| Amaranthus tricolor cab1a mRNA for type I chloro...	101	3e-18
254	emb|AJ234427.1|HVU234427 Hordeum vulgare partial mRNA; clone cMW...	100	1e-17
255	emb|CT571263.1| Medicago truncatula chromosome 5 clone mte1-7c20...	100	1e-17
256	emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-bi...	98	4e-17
257	gb|M14449.1|TOMCBPG Tomato chlorophyll a/b-binding protein gene ...	98	4e-17
258	emb|Z49749.1|PMLHCABBP P.menziesii mRNA for light-harvesting chl...	96	2e-16
259	emb|AJ538464.1|NTA538464 Nicotiana tabacum cDNA-AFLP-fragment BC...	94	6e-16
260	ref|NM_126540.2| Arabidopsis thaliana LHCB2.1; chlorophyll bindi...	92	2e-15
261	gb|AY045787.1| Arabidopsis thaliana At2g05100 mRNA sequence	92	2e-15
262	gb|AC007443.5| Arabidopsis thaliana chromosome 2 clone F15L11 ma...	92	2e-15
263	gb|AY052348.1| Arabidopsis thaliana At2g05100/F15L11.2 mRNA, com...	92	2e-15
264	gb|AY052275.1| Arabidopsis thaliana At2g05100/F15L11.2 mRNA, com...	92	2e-15
265	gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430...	92	2e-15
266	emb|BX819843.1|CNS0A9GW Arabidopsis thaliana Full-length cDNA Co...	92	2e-15
267	emb|BX819702.1|CNS0A9H1 Arabidopsis thaliana Full-length cDNA Co...	92	2e-15
268	emb|BX821844.1|CNS0A936 Arabidopsis thaliana Full-length cDNA Co...	92	2e-15
269	emb|BX821132.1|CNS0A9BI Arabidopsis thaliana Full-length cDNA Co...	92	2e-15
270	emb|BX819861.1|CNS0A9DS Arabidopsis thaliana Full-length cDNA Co...	92	2e-15
271	emb|BX819688.1|CNS0A9G4 Arabidopsis thaliana Full-length cDNA Co...	92	2e-15
272	emb|BX819687.1|CNS0A9G3 Arabidopsis thaliana Full-length cDNA Co...	92	2e-15
273	emb|BX819683.1|CNS0A80L Arabidopsis thaliana Full-length cDNA Co...	92	2e-15
274	emb|BX842010.1|CNS09YA7 Arabidopsis thaliana Full-length cDNA Co...	92	2e-15
275	gb|AF134124.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.3) mRNA...	92	2e-15
276	gb|AF134122.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.1) mRNA...	92	2e-15
277	gb|AF279248.1|AF279248 Vigna radiata LHCII type II chlorophyll a...	92	2e-15
278	gb|BT001933.1| Arabidopsis thaliana clone C105385 putative chlor...	92	2e-15
279	gb|AF330793.1|AF330793 Chlamydomonas reinhardtii light-harvestin...	90	1e-14
280	emb|AJ538493.1|NTA538493 Nicotiana tabacum cDNA-AFLP-fragment BC...	90	1e-14
281	gb|K00974.1|PETCAB4 Petunia major chlorophyll a/b binding protei...	90	1e-14
282	gb|AF017998.1|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b bin...	90	1e-14
283	gb|M30618.1|TOMCBPD2 Tomato chlorophyll a/b-binding protein Cab-...	90	1e-14
284	dbj|AB051209.1| Chlamydomonas reinhardtii mRNA for light-harvest...	90	1e-14
285	dbj|AB051208.1| Chlamydomonas reinhardtii mRNA for light-harvest...	90	1e-14
286	dbj|AB051205.1| Chlamydomonas reinhardtii gene for light-harvest...	90	1e-14
287	dbj|AB051204.1| Chlamydomonas reinhardtii gene for light-harvest...	90	1e-14
288	ref|NM_126537.2| Arabidopsis thaliana LHCB2.2; chlorophyll bindi...	88	4e-14
289	ref|NM_001036246.1| Arabidopsis thaliana ATP binding / kinase/ p...	88	4e-14
290	gb|AY093372.1| Arabidopsis thaliana putative chlorophyll a/b bin...	88	4e-14
291	gb|AC007211.6| Arabidopsis thaliana chromosome 2 BAC F1O13 genom...	88	4e-14
292	gb|AY066036.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, com...	88	4e-14
293	gb|AY062563.1| Arabidopsis thaliana putative chlorophyll a/b bin...	88	4e-14
294	gb|AY054218.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, com...	88	4e-14
295	emb|BX819347.1|CNS0A9RX Arabidopsis thaliana Full-length cDNA Co...	88	4e-14
296	emb|BX820206.1|CNS0A9D7 Arabidopsis thaliana Full-length cDNA Co...	88	4e-14
297	emb|BX820202.1|CNS0A9FS Arabidopsis thaliana Full-length cDNA Co...	88	4e-14
298	emb|BX819668.1|CNS0A9CZ Arabidopsis thaliana Full-length cDNA Co...	88	4e-14
299	emb|BX819509.1|CNS0A82Q Arabidopsis thaliana Full-length cDNA Co...	88	4e-14
300	gb|AF134123.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.2) mRNA...	88	4e-14
301	gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-bindi...	88	4e-14
302	emb|AJ539048.1|NTA539048 Nicotiana tabacum cDNA-AFLP-fragment BT...	88	4e-14
303	emb|X61915.1|PTCABP P.thunbergii cab gene	86	2e-13
304	gb|AF495473.1| Chlamydomonas reinhardtii major light-harvesting ...	86	2e-13
305	emb|BX819270.1|CNS0A9RF Arabidopsis thaliana Full-length cDNA Co...	86	2e-13
306	dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clon...	86	2e-13
307	dbj|AB051206.1| Chlamydomonas reinhardtii gene for light-harvest...	86	2e-13
308	emb|AJ538931.1|NTA538931 Nicotiana tabacum cDNA-AFLP-fragment BT...	84	6e-13
309	gb|M17559.1|TOMCAB5A Tomato Cab-5 gene encoding chlorophyll a/b-...	84	6e-13
310	gb|M23531.1|DUNCBP D.salina major chlorophyll binding protein mR...	84	6e-13
311	gb|AF104631.3| Chlamydomonas reinhardtii light harvesting comple...	82	2e-12
312	gb|AF479778.1| Chlamydomonas reinhardtii major light-harvesting ...	82	2e-12
313	emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Co...	82	2e-12
314	emb|X63197.1|HVLHBC H.vulgare lhbC mRNA for type III LHCII CAB p...	82	2e-12
315	gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvestin...	82	2e-12
316	gb|AF495472.1| Chlamydomonas reinhardtii major light-harvesting ...	80	1e-11
317	emb|X69434.1|CSCAB1 C.stellata cab1 mRNA for chlorophyll a/b bin...	80	1e-11
318	gb|M34396.1|PMJCABF3 Polystichum munitum chlorophyll a/b-binding...	80	1e-11
319	gb|M30622.1|TOMCBPF2 Tomato chlorophyll a/b-binding protein Cab-...	80	1e-11
320	gb|M30620.1|TOMCBPE2 Tomato chlorophyll a/b-binding protein Cab-...	80	1e-11
321	gb|M24072.1|CRECABA C.reinhardtii encoding chlorophyll a/b-bindi...	80	1e-11
322	gb|AF479779.1| Chlamydomonas reinhardtii major light-harvesting ...	78	4e-11
323	gb|AF312227.1|AF312227 Citrus reticulata light-harvesting chloro...	78	4e-11
324	gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chl...	78	4e-11
325	gb|AY112240.1| Zea mays CL187_6 mRNA sequence	76	1e-10
326	emb|AJ538840.1|NTA538840 Nicotiana tabacum cDNA-AFLP-fragment BT...	74	6e-10
327	gb|AF207690.1|AF207690 Daucus carota cultivar Kurodagosun chloro...	74	6e-10
328	emb|X13407.1|PTCAB Pinus thunbergii cab mRNA for light-harvestin...	72	2e-09
329	gb|AY845254.1| Pisum sativum light-harvesting chlorophyll-a/b bi...	70	9e-09
330	emb|AJ538915.1|NTA538915 Nicotiana tabacum cDNA-AFLP-fragment BT...	70	9e-09
331	emb|X57082.1|PSCABII P.sativum Cab II gene for chlorophyll a/b-b...	70	9e-09
332	gb|K00972.1|PETCAB146 Petunia major chlorophyll a/b binding prot...	70	9e-09
333	gb|M60049.1|DUNCAB D.tertiolecta 28.5-kDa LHCII apoprotein mRNA,...	70	9e-09
334	dbj|AU066541.1| Chlamydomonas sp. HS-5 mRNA for hypothetical pro...	70	9e-09
335	ref|XM_478729.1| Oryza sativa (japonica cultivar-group), mRNA	68	4e-08
336	ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group...	68	4e-08
337	ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group...	68	4e-08
338	ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group...	68	4e-08
339	ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group...	68	4e-08
340	ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group...	68	4e-08
341	ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group...	68	4e-08
342	ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group...	68	4e-08
343	gb|AF417304.1| Castanea sativa putative chlorophyll-A-B-binding ...	68	4e-08
344	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	68	4e-08
345	dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic D...	68	4e-08
346	dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clon...	68	4e-08
347	dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clon...	68	4e-08
348	dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clon...	68	4e-08
349	emb|X17697.1|MDCHBP Apple light-harvesting chlorophyll a/b bindi...	68	4e-08
350	dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clon...	68	4e-08
351	dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clon...	68	4e-08
352	dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clon...	68	4e-08
353	dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clon...	68	4e-08
354	dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clon...	68	4e-08
355	dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clon...	68	4e-08
356	dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clon...	68	4e-08
357	dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clon...	68	4e-08
358	gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein...	68	4e-08
359	gb|AY646197.1| Chlorella pyrenoidosa chloroplast light-harvestin...	66	1e-07
360	gb|DQ455591.1| Phaseolus vulgaris chloroplast chlorophyll a/b bi...	66	1e-07
361	gb|AY267623.1| Bigelowiella natans chlorophyll a/b-binding prote...	66	1e-07
362	gb|AF268320.1|AF268320 Chlorarachnion CCMP621 light-harvesting c...	66	1e-07
363	gb|AF268319.1|AF268319 Chlorarachnion CCMP621 light-harvesting c...	66	1e-07
364	emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Co...	66	1e-07
365	emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding pr...	66	1e-07
366	emb|X61361.1|EGLHCAB E.gracilis gene for light harvesting chloro...	64	6e-07
367	emb|Z29965.1|TRLHCABBP T.repens (Huia) mRNA for light-harvesting...	64	6e-07
368	gb|AF022738.1|AF022738 Oryza sativa chlorophyll a-b binding prot...	64	6e-07
369	gb|DQ275468.1| Arachis hypogaea clone PNDI 2 unknown mRNA	64	6e-07
370	dbj|AU066540.1| Chlamydomonas sp. HS-5 mRNA for hypothetical pro...	64	6e-07
371	gb|AY554168.1| Nicotiana tabacum chloroplast chlorophyll a-b bin...	62	2e-06
372	emb|X76632.1|PPCAB P.patens (Hedw.) B.S.G. partial mRNA for chlo...	60	9e-06
373	ref|NM_113685.3| Arabidopsis thaliana LHCB2:4; chlorophyll bindi...	58	3e-05
374	gb|DQ226800.1| Boechera divaricarpa isolate SLW-B-D01 mRNA sequence	58	3e-05
375	gb|BT006298.1| Arabidopsis thaliana At3g27700 mRNA, complete cds	58	3e-05
376	gb|AF268321.1|AF268321 Chlorarachnion CCMP621 light-harvesting c...	58	3e-05
377	gb|AF370557.1|AF370557 Arabidopsis thaliana light harvesting chl...	58	3e-05
378	gb|AY088541.1| Arabidopsis thaliana clone 7700 mRNA, complete se...	58	3e-05
379	gb|AF134125.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2:4) mRNA...	58	3e-05
380	dbj|AB018114.1| Arabidopsis thaliana genomic DNA, chromosome 3, ...	58	3e-05
381	gb|DQ226725.1| Boechera divaricarpa isolate SLW-A-F06 mRNA sequence	56	1e-04
382	gb|AY818400.1| Manihot esculenta chloroplast chlorophyll A/B bin...	54	5e-04
383	gb|AF139465.2|AF139465 Vigna radiata LHCII type III chlorophyll ...	52	0.002
384	gb|BT013404.1| Lycopersicon esculentum clone 135718R, mRNA sequence	50	0.008
385	gb|M37489.1|PINCABII2 Pinus sylvestris chlorophyll a/b-binding p...	50	0.008
386	emb|X60275.1|LELHBC1G L.esculentum lhbC1 gene for LHCII type III	50	0.008
387	gb|BT012757.1| Lycopersicon esculentum clone 113701F, mRNA sequence	48	0.034
388	emb|AJ538874.1|NTA538874 Nicotiana tabacum cDNA-AFLP-fragment BT...	48	0.034
389	dbj|AP006706.1| Lotus japonicus genomic DNA, chromosome 3, clone...	46	0.13
390	emb|AL353786.16| Human DNA sequence from clone RP5-1175B15 on ch...	44	0.52
391	emb|AL162171.4|CNS01RHP Human chromosome 14 DNA sequence BAC R-5...	44	0.52
392	gb|AF093617.1|AF093617 Acetabularia acetabulum clone JO-10 chlor...	44	0.52
393	gb|L29644.1|EGRLHCPII Euglena gracilis chlorophyll a/b binding p...	44	0.52
394	gb|U03392.1|EGU03392 Euglena gracilis var. bacillaris PSII chlor...	44	0.52
395	dbj|AB079894.1| Sus scrofa gene for T-cell receptor beta-chain, ...	44	0.52
396	emb|CR522870.1| Desulfotalea psychrophila LSv54 chromosome	42	2.1
397	ref|XM_815782.1| Trypanosoma cruzi strain CL Brener hypothetical...	40	8.2
398	gb|AC135257.1| Genomic sequence for Oryza sativa, Nipponbare str...	40	8.2
399	emb|AL365506.10| Human DNA sequence from clone RP11-640E12 on ch...	40	8.2
400	emb|AL355472.19| Human DNA sequence from clone RP5-827C21 on chr...	40	8.2
401	emb|AL356464.15| Human DNA sequence from clone RP11-38O23 on chr...	40	8.2
402	emb|AL022343.6|HS608E8 Human DNA sequence from clone RP4-608E8 o...	40	8.2
403	dbj|AP008230.1| Desulfitobacterium hafniense Y51 genomic DNA, co...	40	8.2
404	gb|AC073174.5| Homo sapiens chromosome 10 clone RP11-319F12, com...	40	8.2
405	gb|AF339312.1|AF339312 Hepatitis C virus isolate HCP98 polyprote...	40	8.2
406	gb|AC097468.3| Homo sapiens BAC clone RP11-33O4 from 2, complete...	40	8.2
407	dbj|AP003270.4| Oryza sativa (japonica cultivar-group) genomic D...	40	8.2
408	dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome	40	8.2
409	dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome	40	8.2
410	emb|X61608.1|BNLHCB3A B.napus gene for LHCII Type III chlorophyl...	40	8.2
411	emb|Z98304.1|HS54B20 Human DNA sequence from clone RP1-54B20 on ...	40	8.2
412	gb|M30396.1|PMJCABF7 Polystichum munitum chlorophyll a/b-binding...	40	8.2

---

>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds
          Length = 1191

 Score =  515 bits (260), Expect = e-143
 Identities = 435/492 (88%), Gaps = 1/492 (0%)
 Strand = Plus / Plus

                                                                       
Query: 110 catgcgcaagacggcggcaaaggccaagaaggttgcctccagcagcccgtggtacggctc 169
           |||||||||||| ||||| ||||||||  | ||| | || ||||||||||||||||||||
Sbjct: 299 catgcgcaagactgcggcgaaggccaaacaagtttcgtcgagcagcccgtggtacggctc 358

                                                                       
Query: 170 tgaccgggtcctctacctcggcccactttctggtgagcccccgagctacctgaccggtga 229
           |||||| || |||||||||||||| ||||| || |||||||| |||||| |||| |||||
Sbjct: 359 tgaccgtgtgctctacctcggcccgctttccggcgagccccccagctacttgactggtga 418

                                                                       
Query: 230 gttccccggtgactacgggtgggacaccgctggactgtcggctgacccagagaccttcgc 289
           ||||||||||||||| |||||||||||||| || || ||||||||||| |||||||||||
Sbjct: 419 gttccccggtgactatgggtgggacaccgccgggctctcggctgaccctgagaccttcgc 478

                                                                       
Query: 290 caagaaccgggagctcgaggtgatccattgccgttgggccatgcttggcgcgctcggttg 349
           ||||||||||||||||||||||||||| ||||| ||||||||||| || ||||| |||||
Sbjct: 479 caagaaccgggagctcgaggtgatccactgccgatgggccatgctcggtgcgcttggttg 538

                                                                       
Query: 350 tgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgaggctgtttggttcaa 409
           |||||| |||||| |||| |||||||| ||||| |||||||| ||||| | |||||||||
Sbjct: 539 tgtctttcccgagttgcttgcccgcaatggtgtgaagttcggcgaggccggttggttcaa 598

                                                                       
Query: 410 ggctggatctcagatcttcagcgagggtggccttgactacctcggcaacccaagccttgt 469
           |||||| ||||||||||||||||| |||||||| |||||||| |||||||| ||||| ||
Sbjct: 599 ggctggctctcagatcttcagcgatggtggcctcgactaccttggcaaccccagcctcgt 658

                                                                       
Query: 470 gcacgcccagagtatccttgccatttgggcttgtcaggttgtgctcatgggtgccgttga 529
            |||||||||||  |||| ||||| ||||||||||| |||||||||||||| ||||||||
Sbjct: 659 ccacgcccagagcctcctcgccatatgggcttgtcaagttgtgctcatgggggccgttga 718

                                                                       
Query: 530 gggttaccgcattgctggtggaccacttggtgagatcgtcgacccattataccccgggtg 589
           ||| ||||||||||||||||| || || || ||||||||||||||| | || ||| ||||
Sbjct: 719 ggggtaccgcattgctggtggtccgctcggcgagatcgtcgacccactcta-ccctggtg 777

                       
Query: 590 gcagcttcgacc 601
           ||||||| ||||
Sbjct: 778 gcagctttgacc 789

---

>emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putative chlorophyll a/b
           binding protein (cab gene)
          Length = 760

 Score =  500 bits (252), Expect = e-138
 Identities = 433/492 (88%), Gaps = 1/492 (0%)
 Strand = Plus / Plus

                                                                       
Query: 110 catgcgcaagacggcggcaaaggccaagaaggttgcctccagcagcccgtggtacggctc 169
           |||||||||||| ||||| ||||||||  | ||| | || ||||||||||||||||||||
Sbjct: 94  catgcgcaagactgcggcgaaggccaaacaagtttcgtcgagcagcccgtggtacggctc 153

                                                                       
Query: 170 tgaccgggtcctctacctcggcccactttctggtgagcccccgagctacctgaccggtga 229
           |||||| || |||||||||||| | ||||| || || ||||| |||||| |||| |||||
Sbjct: 154 tgaccgtgtgctctacctcggctcgctttccggcgaaccccccagctacttgactggtga 213

                                                                       
Query: 230 gttccccggtgactacgggtgggacaccgctggactgtcggctgacccagagaccttcgc 289
           ||||||||||||||| |||||||||||||| || || ||||||||||| |||||||||||
Sbjct: 214 gttccccggtgactatgggtgggacaccgccgggctctcggctgaccctgagaccttcgc 273

                                                                       
Query: 290 caagaaccgggagctcgaggtgatccattgccgttgggccatgcttggcgcgctcggttg 349
           ||||||||||||||||||||||||||| ||||| ||||||||||| || ||||| |||||
Sbjct: 274 caagaaccgggagctcgaggtgatccactgccgatgggccatgctcggtgcgcttggttg 333

                                                                       
Query: 350 tgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgaggctgtttggttcaa 409
           |||||| |||||| |||| |||||||| ||||| |||||||| ||||| || ||||||| 
Sbjct: 334 tgtctttcccgagttgcttgcccgcaatggtgtgaagttcggcgaggccgtctggttcat 393

                                                                       
Query: 410 ggctggatctcagatcttcagcgagggtggccttgactacctcggcaacccaagccttgt 469
           |||||| |||||||| ||||||||||||||||| |||||||| |||||||| ||||| ||
Sbjct: 394 ggctggctctcagattttcagcgagggtggcctcgactaccttggcaaccccagcctcgt 453

                                                                       
Query: 470 gcacgcccagagtatccttgccatttgggcttgtcaggttgtgctcatgggtgccgttga 529
            ||||||||||| ||||| ||||| ||||||||||| |||||||||||||| ||||||||
Sbjct: 454 ccacgcccagagcatcctcgccatatgggcttgtcaagttgtgctcatgggggccgttga 513

                                                                       
Query: 530 gggttaccgcattgctggtggaccacttggtgagatcgtcgacccattataccccgggtg 589
           ||| ||||||||||||||||| || || || ||||||||||||||| | || ||| ||||
Sbjct: 514 ggggtaccgcattgctggtggtccgctcggcgagatcgtcgacccactcta-ccctggtg 572

                       
Query: 590 gcagcttcgacc 601
           ||||||| ||||
Sbjct: 573 gcagctttgacc 584

---

>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor
           (Wcab) mRNA, complete cds
          Length = 918

 Score =  488 bits (246), Expect = e-134
 Identities = 486/566 (85%)
 Strand = Plus / Plus

                                                                       
Query: 10  caatggcggcaacgaccatgtccctctcttccccagcctttgccggcaaggtagtgaagg 69
           ||||||||||| | |||||||||||||| ||| |  |||||||||||||||  |||||| 
Sbjct: 8   caatggcggcagccaccatgtccctctcctcctcgacctttgccggcaaggcggtgaaga 67

                                                                       
Query: 70  acttgccatcgtcgtctcttttcggggaggctcgcgtcaccatgcgcaagacggcggcaa 129
           |  | ||||| | | |||| || || ||||| |||||||||||||||||||| || ||||
Sbjct: 68  atgtaccatctttggctctcttgggcgaggcccgcgtcaccatgcgcaagaccgcagcaa 127

                                                                       
Query: 130 aggccaagaaggttgcctccagcagcccgtggtacggctctgaccgggtcctctacctcg 189
           |||| ||| ||||| ||||| ||||||| ||||||||  ||||||| || ||||||||||
Sbjct: 128 aggcaaagcaggtttcctccggcagcccatggtacggtgctgaccgtgtgctctacctcg 187

                                                                       
Query: 190 gcccactttctggtgagcccccgagctacctgaccggtgagttccccggtgactacgggt 249
           ||||||| || |||||||| |||||||||||||||||||||||||| || ||||| ||||
Sbjct: 188 gcccactctccggtgagcctccgagctacctgaccggtgagttccctggcgactatgggt 247

                                                                       
Query: 250 gggacaccgctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgagg 309
           ||||||| |||||||| ||||||||||| ||||||||| |||||||||||||||| ||||
Sbjct: 248 gggacactgctggactttcggctgacccggagaccttctccaagaaccgggagctggagg 307

                                                                       
Query: 310 tgatccattgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcg 369
           ||||||| || || |||||||||||||| || || |||||||||||||| ||| ||||||
Sbjct: 308 tgatccactgtcgctgggccatgcttggggcacttggttgtgtcttccctgagttgctcg 367

                                                                       
Query: 370 cccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttca 429
           |||||||||| || ||||| || ||||| |||||||||||||| || || |||||||| |
Sbjct: 368 cccgcaacggcgtcaagtttggcgaggccgtttggttcaaggccggctcccagatcttta 427

                                                                       
Query: 430 gcgagggtggccttgactacctcggcaacccaagccttgtgcacgcccagagtatccttg 489
           | |||||||| || ||||||||||||||||| ||||| |||||||| || || ||||| |
Sbjct: 428 gtgagggtggtctcgactacctcggcaaccccagcctagtgcacgcacaaagcatcctag 487

                                                                       
Query: 490 ccatttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggtg 549
           | |||||||| || ||||| ||||||||||||||||| ||||| |||||  |||| || |
Sbjct: 488 ctatttgggcatgccaggtcgtgctcatgggtgccgtcgaggggtaccgtgttgccggcg 547

                                     
Query: 550 gaccacttggtgagatcgtcgaccca 575
           | ||||| ||||||||||| ||||||
Sbjct: 548 gcccactcggtgagatcgttgaccca 573

---

>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds
          Length = 1044

 Score =  484 bits (244), Expect = e-133
 Identities = 464/536 (86%), Gaps = 1/536 (0%)
 Strand = Plus / Plus

                                                                       
Query: 66  aaggacttgccatcgtcgtctcttttcggggaggctcgcgtcaccatgcgcaagacggcg 125
           |||||| |||| |||||| | || ||||||||||| |||||||||||||||||||| |||
Sbjct: 118 aaggacctgccgtcgtcggcgctcttcggggaggcgcgcgtcaccatgcgcaagaccgcg 177

                                                                       
Query: 126 gcaaaggccaagaaggttgcctccagcagcccgtggtacggctctgaccgggtcctctac 185
           || |||||||||  |||  | ||| |||||||||||||||| || ||||| || ||||||
Sbjct: 178 gccaaggccaagccggtgtcgtccggcagcccgtggtacgggtccgaccgcgtgctctac 237

                                                                       
Query: 186 ctcggcccactttctggtgagcccccgagctacctgaccggtgagttccccggtgactac 245
           |||||||| || || || || |||||||||||||| ||||| ||||||||||| ||||||
Sbjct: 238 ctcggcccgctctccggcgaccccccgagctacctcaccggcgagttccccggcgactac 297

                                                                       
Query: 246 gggtgggacaccgctggactgtcggctgacccagagaccttcgccaagaaccgggagctc 305
           |||||||||||||| || |||||||| ||||| |||||||||||||||||||||||||| 
Sbjct: 298 gggtgggacaccgcggggctgtcggccgaccccgagaccttcgccaagaaccgggagctg 357

                                                                       
Query: 306 gaggtgatccattgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctg 365
           ||||||||||| ||||| ||||||||||| ||||||||||| || |||||||||||||||
Sbjct: 358 gaggtgatccactgccggtgggccatgctgggcgcgctcggctgcgtcttccccgagctg 417

                                                                       
Query: 366 ctcgcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatc 425
           |||||||||||||| || |||||||| ||||| || ||||||||||| || || ||||||
Sbjct: 418 ctcgcccgcaacggcgtcaagttcggcgaggccgtgtggttcaaggccggctcccagatc 477

                                                                       
Query: 426 ttcagcgagggtggccttgactacctcggcaacccaagccttgtgcacgcccagagtatc 485
           ||||||||||| ||||| ||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 478 ttcagcgagggcggcctcgactacctcggcaaccccagcctggtccacgcgcagagcatc 537

                                                                       
Query: 486 cttgccatttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgct 545
           || ||||| ||||| || ||||| ||||||||||| ||||| ||||| |||||| | || 
Sbjct: 538 ctcgccatctgggcctgccaggtcgtgctcatgggcgccgtcgaggggtaccgcgtcgcc 597

                                                                   
Query: 546 ggtggaccacttggtgagatcgtcgacccattataccccgggtggcagcttcgacc 601
           || || || || || ||||||||||||||  | |||||| || |||||||||||||
Sbjct: 598 ggcggcccgctcggcgagatcgtcgacccgctctacccc-ggcggcagcttcgacc 652

---

>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein
          Length = 934

 Score =  440 bits (222), Expect = e-120
 Identities = 423/490 (86%)
 Strand = Plus / Plus

                                                                       
Query: 85  ctcttttcggggaggctcgcgtcaccatgcgcaagacggcggcaaaggccaagaaggttg 144
           |||| ||||| |||||||||||||||||||||||||| ||||| || || ||| | ||| 
Sbjct: 92  ctctcttcggtgaggctcgcgtcaccatgcgcaagaccgcggcgaaagctaagcaagttt 151

                                                                       
Query: 145 cctccagcagcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtg 204
           ||||||||||||| ||||||||  |||| || || ||||||||||||||||| ||| | |
Sbjct: 152 cctccagcagcccatggtacggagctgatcgtgtgctctacctcggcccactctctcgcg 211

                                                                       
Query: 205 agcccccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggac 264
           ||||||| |||||||| |||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 212 agcccccaagctacctcaccggtgatttccccggtgactacgggtgggacacggctggac 271

                                                                       
Query: 265 tgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgtt 324
           | || |||||||| ||||||||| | |||||||| ||| | |||||||| || ||||| |
Sbjct: 272 tctctgctgaccccgagaccttctcgaagaaccgcgagttggaggtgatacactgccgct 331

                                                                       
Query: 325 gggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgtta 384
           |||| |||||||| || || ||||| || ||||| ||| |||| |||||||| || || |
Sbjct: 332 gggctatgcttggtgcactgggttgcgtgttccctgagttgcttgcccgcaatggcgtga 391

                                                                       
Query: 385 agttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttg 444
           ||||||| |||||||| ||||||||||| || || || |||||||||||||||||||| |
Sbjct: 392 agttcggcgaggctgtctggttcaaggccggctcgcaaatcttcagcgagggtggcctcg 451

                                                                       
Query: 445 actacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtc 504
           |||||||||||||||||||||| || || || ||||| |||||||||||||||||||| |
Sbjct: 452 actacctcggcaacccaagcctcgtccatgctcagagcatccttgccatttgggcttgcc 511

                                                                       
Query: 505 aggttgtgctcatgggtgccgttgagggttaccgcattgctggtggaccacttggtgaga 564
           |||||||||||||||| || |||||||| |||||  ||||||| || ||||| || ||||
Sbjct: 512 aggttgtgctcatgggcgctgttgaggggtaccgtgttgctggcggcccactcggcgaga 571

                     
Query: 565 tcgtcgaccc 574
           ||||||||||
Sbjct: 572 tcgtcgaccc 581

---

>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein
           LHCP
          Length = 967

 Score =  375 bits (189), Expect = e-100
 Identities = 435/515 (84%), Gaps = 4/515 (0%)
 Strand = Plus / Plus

                                                                       
Query: 90  ttcggggaggctcgcgtcaccatgcgcaagacggcggcaaaggccaagaa---ggttgcc 146
           ||||| ||||| ||||| || ||||||||||||||||| |||||||||     ||  || 
Sbjct: 137 ttcggcgaggcccgcgtgacgatgcgcaagacggcggcgaaggccaagccagcggcggcg 196

                                                                       
Query: 147 tccagcagcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgag 206
           ||| | ||||||||||||||| | ||||| || || ||||| |||||||| || || |||
Sbjct: 197 tccgggagcccgtggtacggccccgaccgcgtgctgtacctgggcccactgtccggcgag 256

                                                                       
Query: 207 cccccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactg 266
           || |||||||||||||| || |||||||| || |||||||| ||||||||||| || |||
Sbjct: 257 ccgccgagctacctgacgggcgagttcccgggcgactacggctgggacaccgcggggctg 316

                                                                       
Query: 267 tcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgg 326
           ||||| ||||| ||||| |||||||||||||||||||| ||||||||||| ||||| |||
Sbjct: 317 tcggcggacccggagacgttcgccaagaaccgggagctggaggtgatccactgccgctgg 376

                                                                       
Query: 327 gccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaag 386
           |||||||| |||||||||||||| |||||||| ||||| |||||||||||||| || |||
Sbjct: 377 gccatgctgggcgcgctcggttgcgtcttcccggagcttctcgcccgcaacggcgtcaag 436

                                                                       
Query: 387 ttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgac 446
           ||||| ||||| || ||||||||||| || || ||||||||||||||||| || || |||
Sbjct: 437 ttcggcgaggccgtgtggttcaaggccggctcccagatcttcagcgagggcgggctggac 496

                                                                       
Query: 447 tacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcag 506
           |||||||| ||||| |||||  | ||||| ||||| ||||||||||| ||||| || |||
Sbjct: 497 tacctcgggaacccgagcctcatccacgcgcagagcatccttgccatctgggcctgccag 556

                                                                       
Query: 507 gttgtgctcatgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatc 566
           || ||||||||||| ||||| ||||| |||||||| || || || || || || ||| ||
Sbjct: 557 gtcgtgctcatgggcgccgtcgagggctaccgcatcgccggcggcccgctcggcgaggtc 616

                                              
Query: 567 gtcgacccattataccccgggtggcagcttcgacc 601
           ||||||||  | |||||| || |||||||||||||
Sbjct: 617 gtcgacccgctctacccc-ggcggcagcttcgacc 650

---

>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding
            protein
          Length = 2261

 Score =  365 bits (184), Expect = 1e-97
 Identities = 408/482 (84%), Gaps = 3/482 (0%)
 Strand = Plus / Plus

                                                                        
Query: 96   gaggctcgcgtcaccatgcgcaagacggcggcaaaggccaagaa---ggttgcctccagc 152
            ||||| ||||| || ||||||||||||||||| |||||||||     ||  || ||| | 
Sbjct: 1091 gaggcccgcgtgacgatgcgcaagacggcggcgaaggccaagccagcggcggcgtccggg 1150

                                                                        
Query: 153  agcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccccg 212
            ||||||||||||||| | ||||| || || ||||| |||||||| || || ||||| |||
Sbjct: 1151 agcccgtggtacggccccgaccgcgtgctgtacctgggcccactgtccggcgagccgccg 1210

                                                                        
Query: 213  agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
            ||||||||||| || |||||||| || |||||||| ||||||||||| || |||||||| 
Sbjct: 1211 agctacctgacgggcgagttcccgggcgactacggctgggacaccgcggggctgtcggcg 1270

                                                                        
Query: 273  gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
            ||||| ||||| |||||||||||||||||||| ||||||||||| | ||| |||||||||
Sbjct: 1271 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccgctgggccatg 1330

                                                                        
Query: 333  cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
            || |||||||||||||| |||||||| |||||||||||||||||||| || |||||||| 
Sbjct: 1331 ctgggcgcgctcggttgcgtcttcccggagctgctcgcccgcaacggcgtcaagttcggc 1390

                                                                        
Query: 393  gaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctc 452
            ||||| ||| |||||||||| || || |||||||||||||||||||| || |||||||||
Sbjct: 1391 gaggccgttgggttcaaggccggctcccagatcttcagcgagggtggactggactacctc 1450

                                                                        
Query: 453  ggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtg 512
            || ||||| |||||  | ||||| ||||| ||||| ||||| ||||| || ||||| |||
Sbjct: 1451 gggaacccgagcctcatccacgcgcagagcatcctcgccatctgggcctgccaggtcgtg 1510

                                                                        
Query: 513  ctcatgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgac 572
            |||||||| ||||| ||||| |||||||| || || || || || || ||| ||||||||
Sbjct: 1511 ctcatgggcgccgtcgagggctaccgcatcgccggcggcccgctcggcgaggtcgtcgac 1570

              
Query: 573  cc 574
            ||
Sbjct: 1571 cc 1572

---

>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding
           protein
          Length = 869

 Score =  361 bits (182), Expect = 2e-96
 Identities = 394/464 (84%), Gaps = 3/464 (0%)
 Strand = Plus / Plus

                                                                       
Query: 79  cgtcgtctcttttcggggaggctcgcgtcaccatgcgcaagacggcggcaaaggccaaga 138
           |||||||||| ||||| ||||| ||||| || ||||||||||||||||| ||||| ||| 
Sbjct: 74  cgtcgtctctcttcggcgaggcccgcgtgacgatgcgcaagacggcggcgaaggcaaagc 133

                                                                       
Query: 139 aggttgc---ctccagcagcccgtggtacggctctgaccgggtcctctacctcggcccac 195
            ||  ||   |||| ||||||||||||||||| | ||||| || |||||||| |||||||
Sbjct: 134 cggcggcgagctccggcagcccgtggtacggccccgaccgcgtgctctacctgggcccac 193

                                                                       
Query: 196 tttctggtgagcccccgagctacctgaccggtgagttccccggtgactacgggtgggaca 255
           | || || |||||||||||||||||||| || |||||||| || |||||||| |||||||
Sbjct: 194 tgtccggcgagcccccgagctacctgacgggcgagttcccgggcgactacggctgggaca 253

                                                                       
Query: 256 ccgctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatcc 315
           |||| || |||||||| ||||| ||||| |||||||||||||||||||| ||||| ||||
Sbjct: 254 ccgcggggctgtcggcggacccggagacgttcgccaagaaccgggagctggaggtcatcc 313

                                                                       
Query: 316 attgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgca 375
           | | ||| ||||||||||| |||||| | || || || ||||| ||||||||||||||||
Sbjct: 314 actcccgctgggccatgctgggcgcgttgggctgcgtgttcccggagctgctcgcccgca 373

                                                                       
Query: 376 acggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagg 435
           |||| || |||||||| ||||| || ||||||||||| || || ||||||||||||||||
Sbjct: 374 acggcgtcaagttcggcgaggccgtgtggttcaaggccgggtcgcagatcttcagcgagg 433

                                                                       
Query: 436 gtggccttgactacctcggcaacccaagccttgtgcacgcccagagtatccttgccattt 495
           |||| || ||||||||||||||||| |||||  | ||||| ||||| ||||| ||||| |
Sbjct: 434 gtgggctggactacctcggcaacccgagcctgatccacgcgcagagcatcctcgccatct 493

                                                       
Query: 496 gggcttgtcaggttgtgctcatgggtgccgttgagggttaccgc 539
           |||| || ||||| ||||||||||| ||| | ||||| ||||||
Sbjct: 494 gggcctgccaggtcgtgctcatgggcgccatcgaggggtaccgc 537

---

>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein
          Length = 2100

 Score =  351 bits (177), Expect = 2e-93
 Identities = 396/469 (84%)
 Strand = Plus / Plus

                                                                        
Query: 106  tcaccatgcgcaagacggcggcaaaggccaagaaggttgcctccagcagcccgtggtacg 165
            |||||||||||||||| | ||  ||| |||||  ||  || ||| ||||||| |||||||
Sbjct: 974  tcaccatgcgcaagaccgtgggcaagcccaaggtggcggcgtccggcagcccctggtacg 1033

                                                                        
Query: 166  gctctgaccgggtcctctacctcggcccactttctggtgagcccccgagctacctgaccg 225
            || | ||||| |||   |||||||||||  | || || ||||||||||||||||| ||||
Sbjct: 1034 gccccgaccgcgtcaagtacctcggccccttctccggcgagcccccgagctacctcaccg 1093

                                                                        
Query: 226  gtgagttccccggtgactacgggtgggacaccgctggactgtcggctgacccagagacct 285
            | ||||||||||| |||||||| ||||||||||| || ||||| || ||||| ||||| |
Sbjct: 1094 gcgagttccccggcgactacggctgggacaccgccgggctgtccgccgaccccgagacat 1153

                                                                        
Query: 286  tcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgcttggcgcgctcg 345
            ||||||||||||| ||||| ||||||||||| | ||| ||||||||||| ||||||||||
Sbjct: 1154 tcgccaagaaccgcgagctggaggtgatccactcccgctgggccatgctcggcgcgctcg 1213

                                                                        
Query: 346  gttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgaggctgtttggt 405
            | || |||||||||||||||||| |||||||||| || |||||||| ||||| || ||||
Sbjct: 1214 gctgcgtcttccccgagctgctctcccgcaacggcgtcaagttcggcgaggccgtctggt 1273

                                                                        
Query: 406  tcaaggctggatctcagatcttcagcgagggtggccttgactacctcggcaacccaagcc 465
            ||||||| || || ||||||||||||||||| || || ||||||||||||||||| ||||
Sbjct: 1274 tcaaggccggctcccagatcttcagcgagggcgggctggactacctcggcaaccccagcc 1333

                                                                        
Query: 466  ttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctcatgggtgccg 525
            |  | ||||| ||||| ||||| ||||| ||||| || ||||| ||||||||||||||||
Sbjct: 1334 tgatccacgcgcagagcatcctcgccatctgggcctgccaggtcgtgctcatgggtgccg 1393

                                                             
Query: 526  ttgagggttaccgcattgctggtggaccacttggtgagatcgtcgaccc 574
            | ||||| ||||||||||| || || || || || ||| ||||||||||
Sbjct: 1394 tcgagggctaccgcattgccggcgggccgctcggcgaggtcgtcgaccc 1442

---

>ref|NM_191799.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 798

 Score =  343 bits (173), Expect = 4e-91
 Identities = 381/449 (84%), Gaps = 1/449 (0%)
 Strand = Plus / Plus

                                                                       
Query: 153 agcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccccg 212
           ||||||||||||||| | ||||| || |||||||||||||| || || || ||||| |||
Sbjct: 139 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 198

                                                                       
Query: 213 agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
             |||||| ||||| ||||||||||| |||||||| ||||||||||| || |||||||| 
Sbjct: 199 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 258

                                                                       
Query: 273 gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
           ||||| ||||| |||||||||||||||||||| ||||||||||| ||||| |||||||||
Sbjct: 259 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 318

                                                                       
Query: 333 cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
           || ||||||||||| || |||||||| ||||| |||||||||||||| || |||||||| 
Sbjct: 319 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaacggcgtgaagttcggc 378

                                                                       
Query: 393 gaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctc 452
           ||||| || ||||||||||| || || ||||||||||||||||| || || |||||||||
Sbjct: 379 gaggccgtgtggttcaaggcggggtcccagatcttcagcgagggggggctcgactacctc 438

                                                                       
Query: 453 ggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtg 512
           |||||||| |||||  | ||||| ||||| ||||| || || |||| ||| ||||| |||
Sbjct: 439 ggcaaccccagcctgatccacgcgcagagcatcctggcgatctggggttgccaggtcgtg 498

                                                                       
Query: 513 ctcatgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgac 572
           |||||||| ||||| ||||| |||||| | || || || || || || ||| ||||||||
Sbjct: 499 ctcatgggcgccgtcgaggggtaccgcgtcgccggcggcccgctcggcgaggtcgtcgac 558

                                        
Query: 573 ccattataccccgggtggcagcttcgacc 601
           ||  | |||||| || |||||||||||||
Sbjct: 559 ccgctctacccc-ggcggcagcttcgacc 586

---

>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase
             IV-1 gene, complete cds
          Length = 15000

 Score =  343 bits (173), Expect = 4e-91
 Identities = 381/449 (84%), Gaps = 1/449 (0%)
 Strand = Plus / Minus

                                                                         
Query: 153   agcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccccg 212
             ||||||||||||||| | ||||| || |||||||||||||| || || || ||||| |||
Sbjct: 14535 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 14476

                                                                         
Query: 213   agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
               |||||| ||||| ||||||||||| |||||||| ||||||||||| || |||||||| 
Sbjct: 14475 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 14416

                                                                         
Query: 273   gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
             ||||| ||||| |||||||||||||||||||| ||||||||||| ||||| |||||||||
Sbjct: 14415 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 14356

                                                                         
Query: 333   cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
             || ||||||||||| || |||||||| ||||| |||||||||||||| || |||||||| 
Sbjct: 14355 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaacggcgtgaagttcggc 14296

                                                                         
Query: 393   gaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctc 452
             ||||| || ||||||||||| || || ||||||||||||||||| || || |||||||||
Sbjct: 14295 gaggccgtgtggttcaaggcggggtcccagatcttcagcgagggggggctcgactacctc 14236

                                                                         
Query: 453   ggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtg 512
             |||||||| |||||  | ||||| ||||| ||||| || || |||| ||| ||||| |||
Sbjct: 14235 ggcaaccccagcctgatccacgcgcagagcatcctggcgatctggggttgccaggtcgtg 14176

                                                                         
Query: 513   ctcatgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgac 572
             |||||||| ||||| ||||| |||||| | || || || || || || ||| ||||||||
Sbjct: 14175 ctcatgggcgccgtcgaggggtaccgcgtcgccggcggcccgctcggcgaggtcgtcgac 14116

                                          
Query: 573   ccattataccccgggtggcagcttcgacc 601
             ||  | |||||| || |||||||||||||
Sbjct: 14115 ccgctctacccc-ggcggcagcttcgacc 14088

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  343 bits (173), Expect = 4e-91
 Identities = 381/449 (84%), Gaps = 1/449 (0%)
 Strand = Plus / Plus

                                                                            
Query: 153      agcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccccg 212
                ||||||||||||||| | ||||| || |||||||||||||| || || || ||||| |||
Sbjct: 30024476 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 30024535

                                                                            
Query: 213      agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
                  |||||| ||||| ||||||||||| |||||||| ||||||||||| || |||||||| 
Sbjct: 30024536 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 30024595

                                                                            
Query: 273      gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
                ||||| ||||| |||||||||||||||||||| ||||||||||| ||||| |||||||||
Sbjct: 30024596 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 30024655

                                                                            
Query: 333      cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
                || ||||||||||| || |||||||| ||||| |||||||||||||| || |||||||| 
Sbjct: 30024656 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaacggcgtgaagttcggc 30024715

                                                                            
Query: 393      gaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctc 452
                ||||| || ||||||||||| || || ||||||||||||||||| || || |||||||||
Sbjct: 30024716 gaggccgtgtggttcaaggcggggtcccagatcttcagcgagggggggctcgactacctc 30024775

                                                                            
Query: 453      ggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtg 512
                |||||||| |||||  | ||||| ||||| ||||| || || |||| ||| ||||| |||
Sbjct: 30024776 ggcaaccccagcctgatccacgcgcagagcatcctggcgatctggggttgccaggtcgtg 30024835

                                                                            
Query: 513      ctcatgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgac 572
                |||||||| ||||| ||||| |||||| | || || || || || || ||| ||||||||
Sbjct: 30024836 ctcatgggcgccgtcgaggggtaccgcgtcgccggcggcccgctcggcgaggtcgtcgac 30024895

                                             
Query: 573      ccattataccccgggtggcagcttcgacc 601
                ||  | |||||| || |||||||||||||
Sbjct: 30024896 ccgctctacccc-ggcggcagcttcgacc 30024923



 Score =  319 bits (161), Expect = 6e-84
 Identities = 378/449 (84%), Gaps = 1/449 (0%)
 Strand = Plus / Plus

                                                                            
Query: 153      agcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccccg 212
                ||||||||||||||| | ||||| || |||||||||||||| || || || ||||| |||
Sbjct: 23603670 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 23603729

                                                                            
Query: 213      agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
                |||||||||||||| ||||||||||| |||||||||||||||||||| || || || || 
Sbjct: 23603730 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 23603789

                                                                            
Query: 273      gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
                ||||| ||||| |||||||||||||||||||| ||||||||||| | | | ||||| |||
Sbjct: 23603790 gacccggagacgttcgccaagaaccgggagctggaggtgatccactccaggtgggcgatg 23603849

                                                                            
Query: 333      cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
                || |||||||| || || || ||||| ||||| |||||||||||||| || |||||||| 
Sbjct: 23603850 ctcggcgcgctgggctgcgtgttcccggagctcctcgcccgcaacggcgtcaagttcggc 23603909

                                                                            
Query: 393      gaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctc 452
                ||||| || ||||||||||| || || ||||||||||||||||| || || |||||||||
Sbjct: 23603910 gaggcggtgtggttcaaggcggggtcgcagatcttcagcgagggcgggctcgactacctc 23603969

                                                                            
Query: 453      ggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtg 512
                |||||||| |||||  | ||||| ||||| ||||| ||||| |||||    ||||| |||
Sbjct: 23603970 ggcaacccgagcctgatccacgcgcagagcatcctcgccatctgggcggtccaggtggtg 23604029

                                                                            
Query: 513      ctcatgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgac 572
                |||||||| ||||| ||||| |||||||| || || || || || || ||| ||||||||
Sbjct: 23604030 ctcatgggcgccgtcgaggggtaccgcatcgccggcgggccgctcggcgaggtcgtcgac 23604089

                                             
Query: 573      ccattataccccgggtggcagcttcgacc 601
                ||  | |||||| || |||||||||||||
Sbjct: 23604090 ccgctctacccc-ggcggcagcttcgacc 23604117



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                                    
Query: 155      cccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgag 206
                ||||||||||||| | ||||| ||| |||||||| |||| || || ||||||
Sbjct: 37443416 cccgtggtacggccccgaccgcgtcatctacctccgcccgctctccggtgag 37443365

---

>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0690B02
          Length = 153116

 Score =  343 bits (173), Expect = 4e-91
 Identities = 381/449 (84%), Gaps = 1/449 (0%)
 Strand = Plus / Plus

                                                                         
Query: 153   agcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccccg 212
             ||||||||||||||| | ||||| || |||||||||||||| || || || ||||| |||
Sbjct: 20466 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 20525

                                                                         
Query: 213   agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
               |||||| ||||| ||||||||||| |||||||| ||||||||||| || |||||||| 
Sbjct: 20526 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 20585

                                                                         
Query: 273   gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
             ||||| ||||| |||||||||||||||||||| ||||||||||| ||||| |||||||||
Sbjct: 20586 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 20645

                                                                         
Query: 333   cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
             || ||||||||||| || |||||||| ||||| |||||||||||||| || |||||||| 
Sbjct: 20646 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaacggcgtgaagttcggc 20705

                                                                         
Query: 393   gaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctc 452
             ||||| || ||||||||||| || || ||||||||||||||||| || || |||||||||
Sbjct: 20706 gaggccgtgtggttcaaggcggggtcccagatcttcagcgagggggggctcgactacctc 20765

                                                                         
Query: 453   ggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtg 512
             |||||||| |||||  | ||||| ||||| ||||| || || |||| ||| ||||| |||
Sbjct: 20766 ggcaaccccagcctgatccacgcgcagagcatcctggcgatctggggttgccaggtcgtg 20825

                                                                         
Query: 513   ctcatgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgac 572
             |||||||| ||||| ||||| |||||| | || || || || || || ||| ||||||||
Sbjct: 20826 ctcatgggcgccgtcgaggggtaccgcgtcgccggcggcccgctcggcgaggtcgtcgac 20885

                                          
Query: 573   ccattataccccgggtggcagcttcgacc 601
             ||  | |||||| || |||||||||||||
Sbjct: 20886 ccgctctacccc-ggcggcagcttcgacc 20913

---

>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full
           insert sequence
          Length = 1055

 Score =  343 bits (173), Expect = 4e-91
 Identities = 381/449 (84%), Gaps = 1/449 (0%)
 Strand = Plus / Plus

                                                                       
Query: 153 agcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccccg 212
           ||||||||||||||| | ||||| || |||||||||||||| || || || ||||| |||
Sbjct: 220 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 279

                                                                       
Query: 213 agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
             |||||| ||||| ||||||||||| |||||||| ||||||||||| || |||||||| 
Sbjct: 280 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 339

                                                                       
Query: 273 gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
           ||||| ||||| |||||||||||||||||||| ||||||||||| ||||| |||||||||
Sbjct: 340 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 399

                                                                       
Query: 333 cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
           || ||||||||||| || |||||||| ||||| |||||||||||||| || |||||||| 
Sbjct: 400 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaacggcgtgaagttcggc 459

                                                                       
Query: 393 gaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctc 452
           ||||| || ||||||||||| || || ||||||||||||||||| || || |||||||||
Sbjct: 460 gaggccgtgtggttcaaggcggggtcccagatcttcagcgagggggggctcgactacctc 519

                                                                       
Query: 453 ggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtg 512
           |||||||| |||||  | ||||| ||||| ||||| || || |||| ||| ||||| |||
Sbjct: 520 ggcaaccccagcctgatccacgcgcagagcatcctggcgatctggggttgccaggtcgtg 579

                                                                       
Query: 513 ctcatgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgac 572
           |||||||| ||||| ||||| |||||| | || || || || || || ||| ||||||||
Sbjct: 580 ctcatgggcgccgtcgaggggtaccgcgtcgccggcggcccgctcggcgaggtcgtcgac 639

                                        
Query: 573 ccattataccccgggtggcagcttcgacc 601
           ||  | |||||| || |||||||||||||
Sbjct: 640 ccgctctacccc-ggcggcagcttcgacc 667

---

>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full
           insert sequence
          Length = 1055

 Score =  343 bits (173), Expect = 4e-91
 Identities = 381/449 (84%), Gaps = 1/449 (0%)
 Strand = Plus / Plus

                                                                       
Query: 153 agcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccccg 212
           ||||||||||||||| | ||||| || |||||||||||||| || || || ||||| |||
Sbjct: 220 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 279

                                                                       
Query: 213 agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
             |||||| ||||| ||||||||||| |||||||| ||||||||||| || |||||||| 
Sbjct: 280 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 339

                                                                       
Query: 273 gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
           ||||| ||||| |||||||||||||||||||| ||||||||||| ||||| |||||||||
Sbjct: 340 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 399

                                                                       
Query: 333 cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
           || ||||||||||| || |||||||| ||||| |||||||||||||| || |||||||| 
Sbjct: 400 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaacggcgtgaagttcggc 459

                                                                       
Query: 393 gaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctc 452
           ||||| || ||||||||||| || || ||||||||||||||||| || || |||||||||
Sbjct: 460 gaggccgtgtggttcaaggcggggtcccagatcttcagcgagggggggctcgactacctc 519

                                                                       
Query: 453 ggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtg 512
           |||||||| |||||  | ||||| ||||| ||||| || || |||| ||| ||||| |||
Sbjct: 520 ggcaaccccagcctgatccacgcgcagagcatcctggcgatctggggttgccaggtcgtg 579

                                                                       
Query: 513 ctcatgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgac 572
           |||||||| ||||| ||||| |||||| | || || || || || || ||| ||||||||
Sbjct: 580 ctcatgggcgccgtcgaggggtaccgcgtcgccggcggcccgctcggcgaggtcgtcgac 639

                                        
Query: 573 ccattataccccgggtggcagcttcgacc 601
           ||  | |||||| || |||||||||||||
Sbjct: 640 ccgctctacccc-ggcggcagcttcgacc 667

---

>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full
           insert sequence
          Length = 1057

 Score =  343 bits (173), Expect = 4e-91
 Identities = 381/449 (84%), Gaps = 1/449 (0%)
 Strand = Plus / Plus

                                                                       
Query: 153 agcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccccg 212
           ||||||||||||||| | ||||| || |||||||||||||| || || || ||||| |||
Sbjct: 222 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 281

                                                                       
Query: 213 agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
             |||||| ||||| ||||||||||| |||||||| ||||||||||| || |||||||| 
Sbjct: 282 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 341

                                                                       
Query: 273 gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
           ||||| ||||| |||||||||||||||||||| ||||||||||| ||||| |||||||||
Sbjct: 342 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 401

                                                                       
Query: 333 cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
           || ||||||||||| || |||||||| ||||| |||||||||||||| || |||||||| 
Sbjct: 402 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaacggcgtgaagttcggc 461

                                                                       
Query: 393 gaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctc 452
           ||||| || ||||||||||| || || ||||||||||||||||| || || |||||||||
Sbjct: 462 gaggccgtgtggttcaaggcggggtcccagatcttcagcgagggggggctcgactacctc 521

                                                                       
Query: 453 ggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtg 512
           |||||||| |||||  | ||||| ||||| ||||| || || |||| ||| ||||| |||
Sbjct: 522 ggcaaccccagcctgatccacgcgcagagcatcctggcgatctggggttgccaggtcgtg 581

                                                                       
Query: 513 ctcatgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgac 572
           |||||||| ||||| ||||| |||||| | || || || || || || ||| ||||||||
Sbjct: 582 ctcatgggcgccgtcgaggggtaccgcgtcgccggcggcccgctcggcgaggtcgtcgac 641

                                        
Query: 573 ccattataccccgggtggcagcttcgacc 601
           ||  | |||||| || |||||||||||||
Sbjct: 642 ccgctctacccc-ggcggcagcttcgacc 669

---

>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full
           insert sequence
          Length = 1057

 Score =  341 bits (172), Expect = 2e-90
 Identities = 380/448 (84%), Gaps = 1/448 (0%)
 Strand = Plus / Plus

                                                                       
Query: 153 agcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccccg 212
           ||||||||||||||| | ||||| || |||||||||||||| || || || ||||| |||
Sbjct: 222 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 281

                                                                       
Query: 213 agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
             |||||| ||||| ||||||||||| |||||||| ||||||||||| || |||||||| 
Sbjct: 282 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 341

                                                                       
Query: 273 gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
           ||||| ||||| |||||||||||||||||||| ||||||||||| ||||| |||||||||
Sbjct: 342 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 401

                                                                       
Query: 333 cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
           || ||||||||||| || |||||||| ||||| |||||||||||||| || |||||||| 
Sbjct: 402 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaacggcgtgaagttcggc 461

                                                                       
Query: 393 gaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctc 452
           ||||| || ||||||||||| || || ||||||||||||||||| || || |||||||||
Sbjct: 462 gaggccgtgtggttcaaggcggggtcccagatcttcagcgagggggggctcgactacctc 521

                                                                       
Query: 453 ggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtg 512
           |||||||| |||||  | ||||| ||||| ||||| || || |||| ||| ||||| |||
Sbjct: 522 ggcaaccccagcctgatccacgcgcagagcatcctggcgatctggggttgccaggtcgtg 581

                                                                       
Query: 513 ctcatgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgac 572
           |||||||| ||||| ||||| |||||| | || || || || || || ||| ||||||||
Sbjct: 582 ctcatgggcgccgtcgaggggtaccgcgtcgccggcggcccgctcggcgaggtcgtcgac 641

                                       
Query: 573 ccattataccccgggtggcagcttcgac 600
           ||  | |||||| || ||||||||||||
Sbjct: 642 ccgctctacccc-ggcggcagcttcgac 668

---

>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA,
           complete cds
          Length = 1022

 Score =  331 bits (167), Expect = 2e-87
 Identities = 332/387 (85%)
 Strand = Plus / Plus

                                                                       
Query: 153 agcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccccg 212
           ||||||||||||||| | ||||| || |||||||||||||| || || || ||||| |||
Sbjct: 181 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 240

                                                                       
Query: 213 agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
             |||||| ||||| |||||| |||| |||||||| ||||||||||| || |||||||| 
Sbjct: 241 tcctacctcaccggcgagttctccggcgactacggctgggacaccgccgggctgtcggcc 300

                                                                       
Query: 273 gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
           ||||| ||||| |||||||||||||||||||| ||||||||||| ||||| |||||||||
Sbjct: 301 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 360

                                                                       
Query: 333 cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
           || ||||||||||| || |||||||| ||||| |||||||||||||| || |||||||| 
Sbjct: 361 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaacggcgtgaagttcggc 420

                                                                       
Query: 393 gaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctc 452
           ||||| || ||||||||||| || || ||||||||||||||||| || || |||||||||
Sbjct: 421 gaggccgtgtggttcaaggcggggtcccagatcttcagcgagggggggctcgactacctc 480

                                                                       
Query: 453 ggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtg 512
           |||||||| |||||  | ||||| ||||| ||||| || ||||||| ||| ||||| |||
Sbjct: 481 ggcaaccccagcctgatccacgcgcagagcatcctggcgatttggggttgccaggtcgtg 540

                                      
Query: 513 ctcatgggtgccgttgagggttaccgc 539
            ||||||| ||||| ||||| ||||||
Sbjct: 541 ttcatgggcgccgtcgaggggtaccgc 567

---

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  321 bits (162), Expect = 1e-84
 Identities = 357/422 (84%)
 Strand = Plus / Plus

                                                                            
Query: 153      agcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccccg 212
                ||||||||||||||| | ||||| ||||||||||||||||| || || || ||||| |||
Sbjct: 10793123 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 10793182

                                                                            
Query: 213      agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
                |||||||| ||||| |||||||| || |||||||||||||||||||| || || || || 
Sbjct: 10793183 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 10793242

                                                                            
Query: 273      gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
                ||||| ||||| |||||||||||||||||||| ||||||||||| | ||| ||||| |||
Sbjct: 10793243 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 10793302

                                                                            
Query: 333      cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
                || ||||||||||| || |||||||| ||||| |||||||| ||||| || |||||||| 
Sbjct: 10793303 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccggaacggcgtcaagttcggc 10793362

                                                                            
Query: 393      gaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctc 452
                ||||| || ||||||||||| || || ||||||||||||||||| || || |||||||||
Sbjct: 10793363 gaggccgtgtggttcaaggcgggctcgcagatcttcagcgagggcgggctcgactacctc 10793422

                                                                            
Query: 453      ggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtg 512
                |||||||| |||||  | ||||| ||||| ||||| ||||| |||||    ||||| |||
Sbjct: 10793423 ggcaacccgagcctgatccacgcgcagagcatcctcgccatctgggcggtgcaggtggtg 10793482

                                                                            
Query: 513      ctcatgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgac 572
                |||||||| ||||| ||||| |||||||| || || || || || || ||| ||||||||
Sbjct: 10793483 ctcatgggcgccgtcgaggggtaccgcatcgccggcgggccgctcggcgaggtcgtcgac 10793542

                  
Query: 573      cc 574
                ||
Sbjct: 10793543 cc 10793544

---

>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0512H04
          Length = 151049

 Score =  321 bits (162), Expect = 1e-84
 Identities = 357/422 (84%)
 Strand = Plus / Plus

                                                                         
Query: 153   agcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccccg 212
             ||||||||||||||| | ||||| ||||||||||||||||| || || || ||||| |||
Sbjct: 16846 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 16905

                                                                         
Query: 213   agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
             |||||||| ||||| |||||||| || |||||||||||||||||||| || || || || 
Sbjct: 16906 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 16965

                                                                         
Query: 273   gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
             ||||| ||||| |||||||||||||||||||| ||||||||||| | ||| ||||| |||
Sbjct: 16966 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 17025

                                                                         
Query: 333   cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
             || ||||||||||| || |||||||| ||||| |||||||| ||||| || |||||||| 
Sbjct: 17026 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccggaacggcgtcaagttcggc 17085

                                                                         
Query: 393   gaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctc 452
             ||||| || ||||||||||| || || ||||||||||||||||| || || |||||||||
Sbjct: 17086 gaggccgtgtggttcaaggcgggctcgcagatcttcagcgagggcgggctcgactacctc 17145

                                                                         
Query: 453   ggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtg 512
             |||||||| |||||  | ||||| ||||| ||||| ||||| |||||    ||||| |||
Sbjct: 17146 ggcaacccgagcctgatccacgcgcagagcatcctcgccatctgggcggtgcaggtggtg 17205

                                                                         
Query: 513   ctcatgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgac 572
             |||||||| ||||| ||||| |||||||| || || || || || || ||| ||||||||
Sbjct: 17206 ctcatgggcgccgtcgaggggtaccgcatcgccggcgggccgctcggcgaggtcgtcgac 17265

               
Query: 573   cc 574
             ||
Sbjct: 17266 cc 17267

---

>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OSJNBb0085I16
          Length = 141701

 Score =  321 bits (162), Expect = 1e-84
 Identities = 357/422 (84%)
 Strand = Plus / Plus

                                                                          
Query: 153    agcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccccg 212
              ||||||||||||||| | ||||| ||||||||||||||||| || || || ||||| |||
Sbjct: 129741 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 129800

                                                                          
Query: 213    agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
              |||||||| ||||| |||||||| || |||||||||||||||||||| || || || || 
Sbjct: 129801 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 129860

                                                                          
Query: 273    gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
              ||||| ||||| |||||||||||||||||||| ||||||||||| | ||| ||||| |||
Sbjct: 129861 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 129920

                                                                          
Query: 333    cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
              || ||||||||||| || |||||||| ||||| |||||||| ||||| || |||||||| 
Sbjct: 129921 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccggaacggcgtcaagttcggc 129980

                                                                          
Query: 393    gaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctc 452
              ||||| || ||||||||||| || || ||||||||||||||||| || || |||||||||
Sbjct: 129981 gaggccgtgtggttcaaggcgggctcgcagatcttcagcgagggcgggctcgactacctc 130040

                                                                          
Query: 453    ggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtg 512
              |||||||| |||||  | ||||| ||||| ||||| ||||| |||||    ||||| |||
Sbjct: 130041 ggcaacccgagcctgatccacgcgcagagcatcctcgccatctgggcggtgcaggtggtg 130100

                                                                          
Query: 513    ctcatgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgac 572
              |||||||| ||||| ||||| |||||||| || || || || || || ||| ||||||||
Sbjct: 130101 ctcatgggcgccgtcgaggggtaccgcatcgccggcgggccgctcggcgaggtcgtcgac 130160

                
Query: 573    cc 574
              ||
Sbjct: 130161 cc 130162

---

>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full
           insert sequence
          Length = 1013

 Score =  321 bits (162), Expect = 1e-84
 Identities = 357/422 (84%)
 Strand = Plus / Plus

                                                                       
Query: 153 agcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccccg 212
           ||||||||||||||| | ||||| ||||||||||||||||| || || || ||||| |||
Sbjct: 191 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 250

                                                                       
Query: 213 agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
           |||||||| ||||| |||||||| || |||||||||||||||||||| || || || || 
Sbjct: 251 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 310

                                                                       
Query: 273 gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
           ||||| ||||| |||||||||||||||||||| ||||||||||| | ||| ||||| |||
Sbjct: 311 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 370

                                                                       
Query: 333 cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
           || ||||||||||| || |||||||| ||||| |||||||| ||||| || |||||||| 
Sbjct: 371 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccggaacggcgtcaagttcggc 430

                                                                       
Query: 393 gaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctc 452
           ||||| || ||||||||||| || || ||||||||||||||||| || || |||||||||
Sbjct: 431 gaggccgtgtggttcaaggcgggctcgcagatcttcagcgagggcgggctcgactacctc 490

                                                                       
Query: 453 ggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtg 512
           |||||||| |||||  | ||||| ||||| ||||| ||||| |||||    ||||| |||
Sbjct: 491 ggcaacccgagcctgatccacgcgcagagcatcctcgccatctgggcggtgcaggtggtg 550

                                                                       
Query: 513 ctcatgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgac 572
           |||||||| ||||| ||||| |||||||| || || || || || || ||| ||||||||
Sbjct: 551 ctcatgggcgccgtcgaggggtaccgcatcgccggcgggccgctcggcgaggtcgtcgac 610

             
Query: 573 cc 574
           ||
Sbjct: 611 cc 612

---

>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full
           insert sequence
          Length = 1021

 Score =  321 bits (162), Expect = 1e-84
 Identities = 357/422 (84%)
 Strand = Plus / Plus

                                                                       
Query: 153 agcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccccg 212
           ||||||||||||||| | ||||| ||||||||||||||||| || || || ||||| |||
Sbjct: 196 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 255

                                                                       
Query: 213 agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
           |||||||| ||||| |||||||| || |||||||||||||||||||| || || || || 
Sbjct: 256 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 315

                                                                       
Query: 273 gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
           ||||| ||||| |||||||||||||||||||| ||||||||||| | ||| ||||| |||
Sbjct: 316 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 375

                                                                       
Query: 333 cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
           || ||||||||||| || |||||||| ||||| |||||||| ||||| || |||||||| 
Sbjct: 376 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccggaacggcgtcaagttcggc 435

                                                                       
Query: 393 gaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctc 452
           ||||| || ||||||||||| || || ||||||||||||||||| || || |||||||||
Sbjct: 436 gaggccgtgtggttcaaggcgggctcgcagatcttcagcgagggcgggctcgactacctc 495

                                                                       
Query: 453 ggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtg 512
           |||||||| |||||  | ||||| ||||| ||||| ||||| |||||    ||||| |||
Sbjct: 496 ggcaacccgagcctgatccacgcgcagagcatcctcgccatctgggcggtgcaggtggtg 555

                                                                       
Query: 513 ctcatgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgac 572
           |||||||| ||||| ||||| |||||||| || || || || || || ||| ||||||||
Sbjct: 556 ctcatgggcgccgtcgaggggtaccgcatcgccggcgggccgctcggcgaggtcgtcgac 615

             
Query: 573 cc 574
           ||
Sbjct: 616 cc 617

---

>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full
           insert sequence
          Length = 1056

 Score =  321 bits (162), Expect = 1e-84
 Identities = 357/422 (84%)
 Strand = Plus / Plus

                                                                       
Query: 153 agcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccccg 212
           ||||||||||||||| | ||||| ||||||||||||||||| || || || ||||| |||
Sbjct: 198 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 257

                                                                       
Query: 213 agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
           |||||||| ||||| |||||||| || |||||||||||||||||||| || || || || 
Sbjct: 258 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 317

                                                                       
Query: 273 gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
           ||||| ||||| |||||||||||||||||||| ||||||||||| | ||| ||||| |||
Sbjct: 318 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 377

                                                                       
Query: 333 cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
           || ||||||||||| || |||||||| ||||| |||||||| ||||| || |||||||| 
Sbjct: 378 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccggaacggcgtcaagttcggc 437

                                                                       
Query: 393 gaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctc 452
           ||||| || ||||||||||| || || ||||||||||||||||| || || |||||||||
Sbjct: 438 gaggccgtgtggttcaaggcgggctcgcagatcttcagcgagggcgggctcgactacctc 497

                                                                       
Query: 453 ggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtg 512
           |||||||| |||||  | ||||| ||||| ||||| ||||| |||||    ||||| |||
Sbjct: 498 ggcaacccgagcctgatccacgcgcagagcatcctcgccatctgggcggtgcaggtggtg 557

                                                                       
Query: 513 ctcatgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgac 572
           |||||||| ||||| ||||| |||||||| || || || || || || ||| ||||||||
Sbjct: 558 ctcatgggcgccgtcgaggggtaccgcatcgccggcgggccgctcggcgaggtcgtcgac 617

             
Query: 573 cc 574
           ||
Sbjct: 618 cc 619

---

>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full
           insert sequence
          Length = 1235

 Score =  321 bits (162), Expect = 1e-84
 Identities = 357/422 (84%)
 Strand = Plus / Plus

                                                                       
Query: 153 agcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccccg 212
           ||||||||||||||| | ||||| ||||||||||||||||| || || || ||||| |||
Sbjct: 196 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 255

                                                                       
Query: 213 agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
           |||||||| ||||| |||||||| || |||||||||||||||||||| || || || || 
Sbjct: 256 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 315

                                                                       
Query: 273 gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
           ||||| ||||| |||||||||||||||||||| ||||||||||| | ||| ||||| |||
Sbjct: 316 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 375

                                                                       
Query: 333 cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
           || ||||||||||| || |||||||| ||||| |||||||| ||||| || |||||||| 
Sbjct: 376 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccggaacggcgtcaagttcggc 435

                                                                       
Query: 393 gaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctc 452
           ||||| || ||||||||||| || || ||||||||||||||||| || || |||||||||
Sbjct: 436 gaggccgtgtggttcaaggcgggctcgcagatcttcagcgagggcgggctcgactacctc 495

                                                                       
Query: 453 ggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtg 512
           |||||||| |||||  | ||||| ||||| ||||| ||||| |||||    ||||| |||
Sbjct: 496 ggcaacccgagcctgatccacgcgcagagcatcctcgccatctgggcggtgcaggtggtg 555

                                                                       
Query: 513 ctcatgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgac 572
           |||||||| ||||| ||||| |||||||| || || || || || || ||| ||||||||
Sbjct: 556 ctcatgggcgccgtcgaggggtaccgcatcgccggcgggccgctcggcgaggtcgtcgac 615

             
Query: 573 cc 574
           ||
Sbjct: 616 cc 617

---

>ref|NM_192636.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 789

 Score =  319 bits (161), Expect = 6e-84
 Identities = 378/449 (84%), Gaps = 1/449 (0%)
 Strand = Plus / Plus

                                                                       
Query: 153 agcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccccg 212
           ||||||||||||||| | ||||| || |||||||||||||| || || || ||||| |||
Sbjct: 127 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 186

                                                                       
Query: 213 agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
           |||||||||||||| ||||||||||| |||||||||||||||||||| || || || || 
Sbjct: 187 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 246

                                                                       
Query: 273 gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
           ||||| ||||| |||||||||||||||||||| ||||||||||| | | | ||||| |||
Sbjct: 247 gacccggagacgttcgccaagaaccgggagctggaggtgatccactccaggtgggcgatg 306

                                                                       
Query: 333 cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
           || |||||||| || || || ||||| ||||| |||||||||||||| || |||||||| 
Sbjct: 307 ctcggcgcgctgggctgcgtgttcccggagctcctcgcccgcaacggcgtcaagttcggc 366

                                                                       
Query: 393 gaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctc 452
           ||||| || ||||||||||| || || ||||||||||||||||| || || |||||||||
Sbjct: 367 gaggcggtgtggttcaaggcggggtcgcagatcttcagcgagggcgggctcgactacctc 426

                                                                       
Query: 453 ggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtg 512
           |||||||| |||||  | ||||| ||||| ||||| ||||| |||||    ||||| |||
Sbjct: 427 ggcaacccgagcctgatccacgcgcagagcatcctcgccatctgggcggtccaggtggtg 486

                                                                       
Query: 513 ctcatgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgac 572
           |||||||| ||||| ||||| |||||||| || || || || || || ||| ||||||||
Sbjct: 487 ctcatgggcgccgtcgaggggtaccgcatcgccggcgggccgctcggcgaggtcgtcgac 546

                                        
Query: 573 ccattataccccgggtggcagcttcgacc 601
           ||  | |||||| || |||||||||||||
Sbjct: 547 ccgctctacccc-ggcggcagcttcgacc 574

---

>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0518F01
          Length = 154541

 Score =  319 bits (161), Expect = 6e-84
 Identities = 378/449 (84%), Gaps = 1/449 (0%)
 Strand = Plus / Plus

                                                                         
Query: 153   agcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccccg 212
             ||||||||||||||| | ||||| || |||||||||||||| || || || ||||| |||
Sbjct: 66369 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 66428

                                                                         
Query: 213   agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
             |||||||||||||| ||||||||||| |||||||||||||||||||| || || || || 
Sbjct: 66429 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 66488

                                                                         
Query: 273   gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
             ||||| ||||| |||||||||||||||||||| ||||||||||| | | | ||||| |||
Sbjct: 66489 gacccggagacgttcgccaagaaccgggagctggaggtgatccactccaggtgggcgatg 66548

                                                                         
Query: 333   cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
             || |||||||| || || || ||||| ||||| |||||||||||||| || |||||||| 
Sbjct: 66549 ctcggcgcgctgggctgcgtgttcccggagctcctcgcccgcaacggcgtcaagttcggc 66608

                                                                         
Query: 393   gaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctc 452
             ||||| || ||||||||||| || || ||||||||||||||||| || || |||||||||
Sbjct: 66609 gaggcggtgtggttcaaggcggggtcgcagatcttcagcgagggcgggctcgactacctc 66668

                                                                         
Query: 453   ggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtg 512
             |||||||| |||||  | ||||| ||||| ||||| ||||| |||||    ||||| |||
Sbjct: 66669 ggcaacccgagcctgatccacgcgcagagcatcctcgccatctgggcggtccaggtggtg 66728

                                                                         
Query: 513   ctcatgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgac 572
             |||||||| ||||| ||||| |||||||| || || || || || || ||| ||||||||
Sbjct: 66729 ctcatgggcgccgtcgaggggtaccgcatcgccggcgggccgctcggcgaggtcgtcgac 66788

                                          
Query: 573   ccattataccccgggtggcagcttcgacc 601
             ||  | |||||| || |||||||||||||
Sbjct: 66789 ccgctctacccc-ggcggcagcttcgacc 66816

---

>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full
           insert sequence
          Length = 1180

 Score =  319 bits (161), Expect = 6e-84
 Identities = 378/449 (84%), Gaps = 1/449 (0%)
 Strand = Plus / Plus

                                                                       
Query: 153 agcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccccg 212
           ||||||||||||||| | ||||| || |||||||||||||| || || || ||||| |||
Sbjct: 198 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 257

                                                                       
Query: 213 agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
           |||||||||||||| ||||||||||| |||||||||||||||||||| || || || || 
Sbjct: 258 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 317

                                                                       
Query: 273 gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
           ||||| ||||| |||||||||||||||||||| ||||||||||| | | | ||||| |||
Sbjct: 318 gacccggagacgttcgccaagaaccgggagctggaggtgatccactccaggtgggcgatg 377

                                                                       
Query: 333 cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
           || |||||||| || || || ||||| ||||| |||||||||||||| || |||||||| 
Sbjct: 378 ctcggcgcgctgggctgcgtgttcccggagctcctcgcccgcaacggcgtcaagttcggc 437

                                                                       
Query: 393 gaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctc 452
           ||||| || ||||||||||| || || ||||||||||||||||| || || |||||||||
Sbjct: 438 gaggcggtgtggttcaaggcggggtcgcagatcttcagcgagggcgggctcgactacctc 497

                                                                       
Query: 453 ggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtg 512
           |||||||| |||||  | ||||| ||||| ||||| ||||| |||||    ||||| |||
Sbjct: 498 ggcaacccgagcctgatccacgcgcagagcatcctcgccatctgggcggtccaggtggtg 557

                                                                       
Query: 513 ctcatgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgac 572
           |||||||| ||||| ||||| |||||||| || || || || || || ||| ||||||||
Sbjct: 558 ctcatgggcgccgtcgaggggtaccgcatcgccggcgggccgctcggcgaggtcgtcgac 617

                                        
Query: 573 ccattataccccgggtggcagcttcgacc 601
           ||  | |||||| || |||||||||||||
Sbjct: 618 ccgctctacccc-ggcggcagcttcgacc 645

---

>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full
           insert sequence
          Length = 1126

 Score =  319 bits (161), Expect = 6e-84
 Identities = 378/449 (84%), Gaps = 1/449 (0%)
 Strand = Plus / Plus

                                                                       
Query: 153 agcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccccg 212
           ||||||||||||||| | ||||| || |||||||||||||| || || || ||||| |||
Sbjct: 197 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 256

                                                                       
Query: 213 agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
           |||||||||||||| ||||||||||| |||||||||||||||||||| || || || || 
Sbjct: 257 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 316

                                                                       
Query: 273 gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
           ||||| ||||| |||||||||||||||||||| ||||||||||| | | | ||||| |||
Sbjct: 317 gacccggagacgttcgccaagaaccgggagctggaggtgatccactccaggtgggcgatg 376

                                                                       
Query: 333 cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
           || |||||||| || || || ||||| ||||| |||||||||||||| || |||||||| 
Sbjct: 377 ctcggcgcgctgggctgcgtgttcccggagctcctcgcccgcaacggcgtcaagttcggc 436

                                                                       
Query: 393 gaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctc 452
           ||||| || ||||||||||| || || ||||||||||||||||| || || |||||||||
Sbjct: 437 gaggcggtgtggttcaaggcggggtcgcagatcttcagcgagggcgggctcgactacctc 496

                                                                       
Query: 453 ggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtg 512
           |||||||| |||||  | ||||| ||||| ||||| ||||| |||||    ||||| |||
Sbjct: 497 ggcaacccgagcctgatccacgcgcagagcatcctcgccatctgggcggtccaggtggtg 556

                                                                       
Query: 513 ctcatgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgac 572
           |||||||| ||||| ||||| |||||||| || || || || || || ||| ||||||||
Sbjct: 557 ctcatgggcgccgtcgaggggtaccgcatcgccggcgggccgctcggcgaggtcgtcgac 616

                                        
Query: 573 ccattataccccgggtggcagcttcgacc 601
           ||  | |||||| || |||||||||||||
Sbjct: 617 ccgctctacccc-ggcggcagcttcgacc 644

---

>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding protein
          Length = 1664

 Score =  315 bits (159), Expect = 9e-83
 Identities = 359/425 (84%), Gaps = 3/425 (0%)
 Strand = Plus / Plus

                                                                        
Query: 153  agcccgtggtacggctctgaccgggtcctctacctcggcccactttctggt---gagccc 209
            ||||||||||||||| | ||||| ||||||||||||||||| || || ||    ||||| 
Sbjct: 585  agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctcgggccgcgagccg 644

                                                                        
Query: 210  ccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcg 269
            ||||||||||| ||||| ||||||||||| |||||||||||||||||||| || || || 
Sbjct: 645  ccgagctacctcaccggcgagttccccggcgactacgggtgggacaccgcggggctctcc 704

                                                                        
Query: 270  gctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcc 329
            || ||||| ||||| |||||||||||||||||||| ||||||||||| | ||| ||||| 
Sbjct: 705  gccgacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcg 764

                                                                        
Query: 330  atgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttc 389
            ||||| ||||||||||| || |||||||| ||||| |||||||| ||||| || ||||||
Sbjct: 765  atgctgggcgcgctcggctgcgtcttcccggagctcctcgcccggaacggcgtcaagttc 824

                                                                        
Query: 390  ggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactac 449
            || ||||| || ||||||||||| || || ||||||||||||||||| || || ||||||
Sbjct: 825  ggcgaggccgtgtggttcaaggcgggctcgcagatcttcagcgagggcgggctcgactac 884

                                                                        
Query: 450  ctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggtt 509
            ||||||||||| |||||  | ||||| ||||| ||||| ||||| |||||    ||||| 
Sbjct: 885  ctcggcaacccgagcctgatccacgcgcagagcatcctcgccatctgggcggtgcaggtg 944

                                                                        
Query: 510  gtgctcatgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtc 569
            ||||||||||| ||||| ||||| ||||| |||||||| || || || || ||| |||||
Sbjct: 945  gtgctcatgggcgccgtcgaggggtaccggattgctggcgggccgctcggcgaggtcgtc 1004

                 
Query: 570  gaccc 574
            |||||
Sbjct: 1005 gaccc 1009

---

>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full
           insert sequence
          Length = 1045

 Score =  313 bits (158), Expect = 4e-82
 Identities = 356/422 (84%)
 Strand = Plus / Plus

                                                                       
Query: 153 agcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccccg 212
           ||||||||||||||| | ||||| ||||||||||||||||| || || || ||||| |||
Sbjct: 196 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 255

                                                                       
Query: 213 agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
           |||||||| ||||| |||||||| || |||||||||||||||||||| || || || || 
Sbjct: 256 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 315

                                                                       
Query: 273 gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
           ||||| |||||  ||||||||||||||||||| ||||||||||| | ||| ||||| |||
Sbjct: 316 gacccggagacgctcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 375

                                                                       
Query: 333 cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
           || ||||||||||| || |||||||| ||||| |||||||| ||||| || |||||||| 
Sbjct: 376 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccggaacggcgtcaagttcggc 435

                                                                       
Query: 393 gaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctc 452
           ||||| || ||||||||||| || || ||||||||||||||||| || || |||||||||
Sbjct: 436 gaggccgtgtggttcaaggcgggctcgcagatcttcagcgagggcgggctcgactacctc 495

                                                                       
Query: 453 ggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtg 512
           |||||||| |||||  | ||||| ||||| ||||| ||||| |||||    ||||| |||
Sbjct: 496 ggcaacccgagcctgatccacgcgcagagcatcctcgccatctgggcggtgcaggtggtg 555

                                                                       
Query: 513 ctcatgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgac 572
           |||||||| ||||| ||||| |||||||| || || || || || || ||| ||||||||
Sbjct: 556 ctcatgggcgccgtcgaggggtaccgcatcgccggcgggccgctcggcgaggtcgtcgac 615

             
Query: 573 cc 574
           ||
Sbjct: 616 cc 617

---

>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 1022

 Score =  313 bits (158), Expect = 4e-82
 Identities = 356/422 (84%)
 Strand = Plus / Plus

                                                                       
Query: 153 agcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccccg 212
           ||||||||||||||| | ||||| ||||||||||||||||| || || || ||||| |||
Sbjct: 177 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 236

                                                                       
Query: 213 agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
           |||||||| ||||| |||||||| || |||||||||||||||||||| || || || || 
Sbjct: 237 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 296

                                                                       
Query: 273 gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
           ||||| ||||| |||||||||||||||||||| ||| ||||||| | ||| ||||| |||
Sbjct: 297 gacccggagacgttcgccaagaaccgggagctggagctgatccactcccgatgggcgatg 356

                                                                       
Query: 333 cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
           || ||||||||||| || |||||||| ||||| |||||||| ||||| || |||||||| 
Sbjct: 357 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccggaacggcgtcaagttcggc 416

                                                                       
Query: 393 gaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctc 452
           ||||| || ||||||||||| || || ||||||||||||||||| || || |||||||||
Sbjct: 417 gaggccgtgtggttcaaggcgggctcgcagatcttcagcgagggcgggctcgactacctc 476

                                                                       
Query: 453 ggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtg 512
           |||||||| |||||  | ||||| ||||| ||||| ||||| |||||    ||||| |||
Sbjct: 477 ggcaacccgagcctgatccacgcgcagagcatcctcgccatctgggcggtgcaggtggtg 536

                                                                       
Query: 513 ctcatgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgac 572
           |||||||| ||||| ||||| |||||||| || || || || || || ||| ||||||||
Sbjct: 537 ctcatgggcgccgtcgaggggtaccgcatcgccggcgggccgctcggcgaggtcgtcgac 596

             
Query: 573 cc 574
           ||
Sbjct: 597 cc 598

---

>gb|U21114.1|STU21114 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-5) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score =  311 bits (157), Expect = 1e-81
 Identities = 350/413 (84%), Gaps = 1/413 (0%)
 Strand = Plus / Plus

                                                                       
Query: 189 ggcccactttctggtgagcccccgagctacctgaccggtgagttccccggtgactacggg 248
           |||||| | ||||||||| |||| |||||| |||||||||| ||||| ||||||||||||
Sbjct: 175 ggcccattctctggtgagtccccaagctacttgaccggtgaattccctggtgactacggg 234

                                                                       
Query: 249 tgggacaccgctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgag 308
           ||||| ||||||||||| || || ||||| || ||||| ||||||||||| || ||||||
Sbjct: 235 tgggataccgctggactttcagcagaccctgaaacctttgccaagaaccgtgaactcgag 294

                                                                       
Query: 309 gtgatccattgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctc 368
           |||||||| ||| | ||||| |||||||| || || || ||||||||||| |||||  | 
Sbjct: 295 gtgatccactgcagatgggcaatgcttggtgctcttggatgtgtcttccctgagctattg 354

                                                                       
Query: 369 gcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttc 428
           ||||| |||||||| |||||||||||||  || ||||||||||| ||||| |||||||||
Sbjct: 355 gcccgtaacggtgtcaagttcggtgaggtcgtgtggttcaaggccggatcccagatcttc 414

                                                                       
Query: 429 agcgagggtggccttgactacctcggcaacccaagccttgtgcacgcccagagtatcctt 488
           ||||||||||| ||||||||| | |||||||||||| | || || || ||||| ||| | 
Sbjct: 415 agcgagggtggacttgactacttgggcaacccaagcttggtccatgcacagagcatcttg 474

                                                                       
Query: 489 gccatttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggt 548
           ||||| |||||||| || |||||  | ||||| || ||||| |||||||| |||||||||
Sbjct: 475 gccatctgggcttgccaagttgtcttgatgggagctgttgaaggttaccgtattgctggt 534

                                                                
Query: 549 ggaccacttggtgagatcgtcgacccattataccccgggtggcagcttcgacc 601
           ||||| ||||||||| | ||||||||| | || ||| ||||||||||||||||
Sbjct: 535 ggacctcttggtgaggttgtcgacccactcta-ccctggtggcagcttcgacc 586

---

>gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-1) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score =  311 bits (157), Expect = 1e-81
 Identities = 350/413 (84%), Gaps = 1/413 (0%)
 Strand = Plus / Plus

                                                                       
Query: 189 ggcccactttctggtgagcccccgagctacctgaccggtgagttccccggtgactacggg 248
           |||||| | ||||||||| |||| |||||| |||||||||| ||||| ||||||||||||
Sbjct: 175 ggcccattctctggtgagtccccaagctacttgaccggtgaattccctggtgactacggg 234

                                                                       
Query: 249 tgggacaccgctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgag 308
           ||||| ||||||||||| || || ||||| || ||||| ||||||||||| || ||||||
Sbjct: 235 tgggataccgctggactttcagcagaccctgaaacctttgccaagaaccgtgaactcgag 294

                                                                       
Query: 309 gtgatccattgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctc 368
           |||||||| ||| | ||||| |||||||| || || || ||||||||||| |||||  | 
Sbjct: 295 gtgatccactgcagatgggcaatgcttggtgctcttggatgtgtcttccctgagctattg 354

                                                                       
Query: 369 gcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttc 428
            |||| |||||||| ||||||||||||||||| ||||||||||| ||||| |||||||||
Sbjct: 355 tcccgtaacggtgtcaagttcggtgaggctgtgtggttcaaggccggatcccagatcttc 414

                                                                       
Query: 429 agcgagggtggccttgactacctcggcaacccaagccttgtgcacgcccagagtatcctt 488
           |||||||| || ||||||||| | |||||||||||| | || || || ||||| ||| | 
Sbjct: 415 agcgagggaggacttgactacttgggcaacccaagcttggtccatgcacagagcatcttg 474

                                                                       
Query: 489 gccatttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggt 548
           ||||| |||||||| || |||||  | ||||| |||||||| |||||||| |||||||||
Sbjct: 475 gccatctgggcttgccaagttgtcttgatgggagccgttgaaggttaccgtattgctggt 534

                                                                
Query: 549 ggaccacttggtgagatcgtcgacccattataccccgggtggcagcttcgacc 601
           ||||| ||||||||| | ||||||||| | || ||| ||||||||||| ||||
Sbjct: 535 ggacctcttggtgaggttgtcgacccactcta-ccctggtggcagctttgacc 586

---

>emb|AJ843976.1| Plantago major partial mRNA for light harvesting protein 1 (lhc1
           gene)
          Length = 688

 Score =  299 bits (151), Expect = 5e-78
 Identities = 380/455 (83%), Gaps = 1/455 (0%)
 Strand = Plus / Plus

                                                                       
Query: 147 tccagcagcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgag 206
           ||||||||||||||||||||| ||||||| ||    ||| | || ||| | || ||||||
Sbjct: 25  tccagcagcccgtggtacggccctgaccgcgttaagtacttggggccattctccggtgag 84

                                                                       
Query: 207 cccccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactg 266
            ||||||||||| |||||||||||||||||||||||||||| |||||||| |||||||| 
Sbjct: 85  tccccgagctacttgaccggtgagttccccggtgactacggctgggacactgctggactc 144

                                                                       
Query: 267 tcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgg 326
           || ||||||||||||||||||||||||||||| ||||| ||||||||||| |   | |||
Sbjct: 145 tcagctgacccagagaccttcgccaagaaccgtgagcttgaggtgatccactcaagatgg 204

                                                                       
Query: 327 gccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaag 386
           ||||||||||| || ||||| || || |||||||||||  | ||||| |||||||| |||
Sbjct: 205 gccatgcttggagcactcggatgcgtattccccgagctcttggcccgtaacggtgtcaag 264

                                                                       
Query: 387 ttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgac 446
           ||||| |||||||||||||||||||||||||| |||||||| |||||||||||  | |||
Sbjct: 265 ttcggcgaggctgtttggttcaaggctggatcacagatctttagcgagggtggtttggac 324

                                                                       
Query: 447 tacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcag 506
           ||| | || ||||||||| | || ||||| ||||| ||| | || || |||||||| || 
Sbjct: 325 tacttgggaaacccaagcttggtccacgctcagagcatcttggcaatctgggcttgccaa 384

                                                                       
Query: 507 gttgtgctcatgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatc 566
           ||| |  | ||||| || |||||||| |||||  |||| ||||| |||||||| ||| | 
Sbjct: 385 gttattttgatgggagctgttgagggctaccgtgttgccggtgggccacttggagaggtg 444

                                              
Query: 567 gtcgacccattataccccgggtggcagcttcgacc 601
           || |||||| | || ||| || |||||||||||||
Sbjct: 445 gttgacccactcta-cccaggaggcagcttcgacc 478

---

>gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-2) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score =  291 bits (147), Expect = 1e-75
 Identities = 327/387 (84%)
 Strand = Plus / Plus

                                                                       
Query: 189 ggcccactttctggtgagcccccgagctacctgaccggtgagttccccggtgactacggg 248
           |||||| | ||||||||| |||| || ||| |||| ||||| ||||| |||||||| || 
Sbjct: 175 ggcccattctctggtgagtccccaagttacttgactggtgaattccctggtgactatgga 234

                                                                       
Query: 249 tgggacaccgctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgag 308
           ||||| ||||||||||| || || ||||| |||||||| ||||||||||| || || |||
Sbjct: 235 tgggataccgctggactttcagcagaccctgagacctttgccaagaaccgtgaacttgag 294

                                                                       
Query: 309 gtgatccattgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctc 368
           |||||||| ||| | ||||| |||||||| || || || ||||||||||| |||||  | 
Sbjct: 295 gtgatccactgcagatgggctatgcttggtgctcttggatgtgtcttccctgagctcttg 354

                                                                       
Query: 369 gcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttc 428
           ||||| |||||||| ||||||||||||||||| ||||||||||| ||||| |||||||||
Sbjct: 355 gcccgtaacggtgtcaagttcggtgaggctgtgtggttcaaggccggatcccagatcttc 414

                                                                       
Query: 429 agcgagggtggccttgactacctcggcaacccaagccttgtgcacgcccagagtatcctt 488
           ||||||||||| ||||||||| | |||||||||||| | || || || || || ||| | 
Sbjct: 415 agcgagggtggacttgactacttgggcaacccaagcttggtccatgcacaaagcatcttg 474

                                                                       
Query: 489 gccatttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggt 548
           |||||||||||||| || |||||| | ||||| || |||||||| ||||| ||||| |||
Sbjct: 475 gccatttgggcttgccaagttgtgttaatgggagctgttgagggataccgtattgcaggt 534

                                      
Query: 549 ggaccacttggtgagatcgtcgaccca 575
           ||||| ||||||||| |||||||||||
Sbjct: 535 ggacctcttggtgaggtcgtcgaccca 561

---

>gb|U21113.1|STU21113 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-4) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score =  287 bits (145), Expect = 2e-74
 Identities = 347/413 (84%), Gaps = 1/413 (0%)
 Strand = Plus / Plus

                                                                       
Query: 189 ggcccactttctggtgagcccccgagctacctgaccggtgagttccccggtgactacggg 248
           |||||| | ||||||||| |||| || ||| |||||||||| ||||| |||||||| || 
Sbjct: 175 ggcccattctctggtgagtccccaagttacttgaccggtgaattccctggtgactatggc 234

                                                                       
Query: 249 tgggacaccgctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgag 308
           ||||| || |||||||| || || ||||| || ||||| ||||||||||| || || |||
Sbjct: 235 tgggatactgctggactttcagcagaccctgaaacctttgccaagaaccgtgaactagag 294

                                                                       
Query: 309 gtgatccattgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctc 368
           |||||||| ||| | ||||| |||||||| || || || ||||||||||| |||||  | 
Sbjct: 295 gtgatccactgcaggtgggctatgcttggtgctcttggatgtgtcttccctgagctcttg 354

                                                                       
Query: 369 gcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttc 428
           ||||| |||||||| ||||| ||||||||||| ||||||||||| ||||| |||||||||
Sbjct: 355 gcccgtaacggtgtcaagtttggtgaggctgtgtggttcaaggccggatcccagatcttc 414

                                                                       
Query: 429 agcgagggtggccttgactacctcggcaacccaagccttgtgcacgcccagagtatcctt 488
           ||||||||||| ||||||||| | || ||||||||| | || || || || || ||||| 
Sbjct: 415 agcgagggtggacttgactacttggggaacccaagcttggtccatgcacaaagcatcctg 474

                                                                       
Query: 489 gccatttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggt 548
           |||||||||||||| || |||||| | ||||| ||||||||||| ||||| |||||||||
Sbjct: 475 gccatttgggcttgccaagttgtgttgatgggagccgttgagggataccgtattgctggt 534

                                                                
Query: 549 ggaccacttggtgagatcgtcgacccattataccccgggtggcagcttcgacc 601
           ||||| ||||||||| |  |||||||| | |||||| ||||||||||| ||||
Sbjct: 535 ggacctcttggtgaggttatcgacccactctacccc-ggtggcagctttgacc 586

---

>gb|U21112.1|STU21112 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-3 gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score =  287 bits (145), Expect = 2e-74
 Identities = 347/413 (84%), Gaps = 1/413 (0%)
 Strand = Plus / Plus

                                                                       
Query: 189 ggcccactttctggtgagcccccgagctacctgaccggtgagttccccggtgactacggg 248
           |||||| | ||||||||| |||| |||||| |||| ||||| ||||| ||||||||||||
Sbjct: 175 ggcccattctctggtgagtccccaagctacttgactggtgaattccctggtgactacggg 234

                                                                       
Query: 249 tgggacaccgctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgag 308
           ||||| ||||||||||| || || ||||| || ||||| ||||||||||| || ||||||
Sbjct: 235 tgggataccgctggactttcagcagaccctgaaacctttgccaagaaccgtgaactcgag 294

                                                                       
Query: 309 gtgatccattgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctc 368
           |||||||| ||| | ||||| |||||||| || || || ||||||||||| |||||  | 
Sbjct: 295 gtgatccactgcagatgggctatgcttggtgctcttggatgtgtcttccctgagctcttg 354

                                                                       
Query: 369 gcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttc 428
           ||||| |||||||| ||||||||||||||||| |||||||| |||||||| || ||||||
Sbjct: 355 gcccgtaacggtgtcaagttcggtgaggctgtgtggttcaaagctggatcccaaatcttc 414

                                                                       
Query: 429 agcgagggtggccttgactacctcggcaacccaagccttgtgcacgcccagagtatcctt 488
            | |||||||| ||||||||| | || ||||||||  | || || || || || ||| | 
Sbjct: 415 cgtgagggtggacttgactacttgggaaacccaagtttggtccatgcacaaagcatcttg 474

                                                                       
Query: 489 gccatttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggt 548
           ||||| |||||||| || |||||| | ||||| |||||||| |||||||| |||||||||
Sbjct: 475 gccatctgggcttgccaagttgtgttgatgggagccgttgaaggttaccgtattgctggt 534

                                                                
Query: 549 ggaccacttggtgagatcgtcgacccattataccccgggtggcagcttcgacc 601
           ||||| ||||||||| | ||| ||||| | |||||| ||||||||||||||||
Sbjct: 535 ggacctcttggtgaggttgtcaacccactctacccc-ggtggcagcttcgacc 586

---

>emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding protein cab 91R
          Length = 1173

 Score =  283 bits (143), Expect = 3e-73
 Identities = 320/379 (84%)
 Strand = Plus / Plus

                                                                       
Query: 208 ccccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgt 267
           |||| |||||| |||||||||||||||| |||||||| || ||||||||||||| ||| |
Sbjct: 430 ccccaagctacttgaccggtgagttccctggtgactatggttgggacaccgctgaacttt 489

                                                                       
Query: 268 cggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttggg 327
           | ||||| || || || |||||||||||||| ||| | ||||||||||| ||| | ||||
Sbjct: 490 cagctgatcccgaaacattcgccaagaaccgtgagttggaggtgatccactgcagatggg 549

                                                                       
Query: 328 ccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagt 387
           |||||||||| || || |||||||||||||| || || || ||||| || ||||| ||||
Sbjct: 550 ccatgcttggagctcttggttgtgtcttccctgaactccttgcccgtaatggtgtcaagt 609

                                                                       
Query: 388 tcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgact 447
           ||||||||||||| ||||| ||||||||||| || || |||||||||||||| |||||||
Sbjct: 610 tcggtgaggctgtatggtttaaggctggatcccaaatattcagcgagggtggacttgact 669

                                                                       
Query: 448 acctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcagg 507
           || | |||||||||||  | || ||||| || || ||| | |||||||||||||| || |
Sbjct: 670 acttgggcaacccaagtttggtccacgcacaaagcatcttggccatttgggcttgccaag 729

                                                                       
Query: 508 ttgtgctcatgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcg 567
           ||||| | ||||| |||||||||||||||||  |||||||||| || ||||||||| | |
Sbjct: 730 ttgtgttgatgggagccgttgagggttaccgtgttgctggtgggcctcttggtgaggttg 789

                              
Query: 568 tcgacccattataccccgg 586
           | |||||| | ||||||||
Sbjct: 790 ttgacccactttaccccgg 808

---

>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding protein
          Length = 1442

 Score =  283 bits (143), Expect = 3e-73
 Identities = 355/425 (83%), Gaps = 3/425 (0%)
 Strand = Plus / Plus

                                                                        
Query: 153  agcccgtggtacggctctgaccgggtcctctacctcggcccactttctggt---gagccc 209
            ||||||||||||||| | ||||| || |||||||||||||| || || ||    ||||| 
Sbjct: 624  agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggccgcgagccg 683

                                                                        
Query: 210  ccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcg 269
            ||||||||||||||||| ||||||||||| |||||||||||||||||||| || || || 
Sbjct: 684  ccgagctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctcc 743

                                                                        
Query: 270  gctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcc 329
            || ||||| ||||| |||||||||||||||||||| ||||||||||| | | | ||||| 
Sbjct: 744  gccgacccggagacgttcgccaagaaccgggagctggaggtgatccactccaggtgggcg 803

                                                                        
Query: 330  atgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttc 389
            ||||| |||| ||| || || || ||||| ||||| |||||||||||||| || ||||||
Sbjct: 804  atgctcggcgggctgggctgcgtgttcccggagctcctcgcccgcaacggcgtcaagttc 863

                                                                        
Query: 390  ggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactac 449
            || ||||| || ||||||||||| || || ||||||||||||||||| || || ||||||
Sbjct: 864  ggggaggcggtgtggttcaaggcggggtcgcagatcttcagcgagggcgggctcgactac 923

                                                                        
Query: 450  ctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggtt 509
            ||||||||||| |||||  | ||||| ||||| ||||| ||||| |||||    ||||| 
Sbjct: 924  ctcggcaacccgagcctgatccacgcgcagagcatcctcgccatctgggcggtgcaggtg 983

                                                                        
Query: 510  gtgctcatgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtc 569
            ||||||||||| ||||| ||||| ||||| ||||| || || || || || ||| |||||
Sbjct: 984  gtgctcatgggcgccgtcgaggggtaccggattgccggcgggccgctcggcgaggtcgtc 1043

                 
Query: 570  gaccc 574
            |||||
Sbjct: 1044 gaccc 1048



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 106 tcaccatgcgcaagacggcggcaaaggccaag 137
           |||||||||||||| ||||||| ||| |||||
Sbjct: 574 tcaccatgcgcaagtcggcggcgaagcccaag 605

---

>gb|AY389573.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           40 (LHCP) mRNA, partial cds
          Length = 712

 Score =  281 bits (142), Expect = 1e-72
 Identities = 326/386 (84%), Gaps = 1/386 (0%)
 Strand = Plus / Plus

                                                                       
Query: 216 tacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgac 275
           ||||| ||||||||||||||||| |||||||| ||||||||||| || || || || |||
Sbjct: 163 tacctcaccggtgagttccccggcgactacggctgggacaccgccgggctctccgcggac 222

                                                                       
Query: 276 ccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgctt 335
           || ||||| || ||||||||||||||||||||||||||||| ||||| ||||| ||||| 
Sbjct: 223 cccgagacatttgccaagaaccgggagctcgaggtgatccactgccggtgggcaatgctg 282

                                                                       
Query: 336 ggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgag 395
           || || ||||| || |||||||||||||| || |||||||||||||| |||||||| |||
Sbjct: 283 ggtgctctcggctgcgtcttccccgagctccttgcccgcaacggtgtgaagttcggcgag 342

                                                                       
Query: 396 gctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggc 455
           || || ||||||||||| ||||||||||||||||||||||| || || |||||||| || 
Sbjct: 343 gcggtatggttcaaggccggatctcagatcttcagcgagggcgggctggactacctggga 402

                                                                       
Query: 456 aacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctc 515
           ||||| |||||||| ||||| ||||| || || ||||| |||||   ||||||||| |||
Sbjct: 403 aaccctagccttgtccacgcacagagcattctggccatctgggcaactcaggttgttctc 462

                                                                       
Query: 516 atgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgaccca 575
           ||||| || |||||||| ||| |  |||| ||||| || || || ||| | |||||||| 
Sbjct: 463 atgggagctgttgagggatacagagttgccggtggccccctcggcgaggttgtcgacccc 522

                                     
Query: 576 ttataccccgggtggcagcttcgacc 601
            | |||||| || |||||||||||||
Sbjct: 523 ctgtacccc-ggcggcagcttcgacc 547

---

>gb|BT014208.1| Lycopersicon esculentum clone 133385R, mRNA sequence
          Length = 958

 Score =  272 bits (137), Expect = 1e-69
 Identities = 345/413 (83%), Gaps = 1/413 (0%)
 Strand = Plus / Plus

                                                                       
Query: 189 ggcccactttctggtgagcccccgagctacctgaccggtgagttccccggtgactacggg 248
           |||||| | ||||||||| |||| |||||| |||||||||| || || ||||| ||||||
Sbjct: 219 ggcccattctctggtgagtccccaagctacttgaccggtgaatttcctggtgattacggg 278

                                                                       
Query: 249 tgggacaccgctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgag 308
           ||||| ||||||||||| || || ||||| || || || ||||||||||| || || |||
Sbjct: 279 tgggataccgctggactttcagcagaccctgaaacttttgccaagaaccgtgaacttgag 338

                                                                       
Query: 309 gtgatccattgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctc 368
           |||||||| ||| | ||||| |||||||| || || || ||||||||||| |||||  | 
Sbjct: 339 gtgatccactgcagatgggctatgcttggtgctcttggatgtgtcttccctgagctcttg 398

                                                                       
Query: 369 gcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttc 428
           ||||| || ||||| ||||||||||||||||| ||||||||||| ||||| |||||||||
Sbjct: 399 gcccgtaatggtgtcaagttcggtgaggctgtgtggttcaaggccggatcccagatcttc 458

                                                                       
Query: 429 agcgagggtggccttgactacctcggcaacccaagccttgtgcacgcccagagtatcctt 488
           || || ||||| ||||||||| | |||||||||||| | || || || || || ||| | 
Sbjct: 459 agtgaaggtggacttgactacttgggcaacccaagcttggtccatgcacaaagcatcttg 518

                                                                       
Query: 489 gccatttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggt 548
           ||||| |||||||| || |||||| | ||||| || |||||||| ||||| |||||||||
Sbjct: 519 gccatctgggcttgccaagttgtgttgatgggagctgttgagggataccgtattgctggt 578

                                                                
Query: 549 ggaccacttggtgagatcgtcgacccattataccccgggtggcagcttcgacc 601
           ||||| ||||||||| | ||||||||| | || ||| ||||||||||||||||
Sbjct: 579 ggacctcttggtgaggttgtcgacccactcta-ccctggtggcagcttcgacc 630

---

>emb|X52743.1|NTCAB21 Tabacco Cab21 mRNA for major chlorophyll a/b binding protein
          Length = 953

 Score =  272 bits (137), Expect = 1e-69
 Identities = 336/401 (83%), Gaps = 1/401 (0%)
 Strand = Plus / Plus

                                                                       
Query: 201 ggtgagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgct 260
           |||||| |||| |||||| |||||||||| ||||||||||| ||||||||||| || |||
Sbjct: 249 ggtgagtccccaagctacttgaccggtgaattccccggtgattacgggtgggatactgct 308

                                                                       
Query: 261 ggactgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgc 320
           ||||| || || |||||||| ||||| ||||||||||| || |||||||||||||| |||
Sbjct: 309 ggactttcagcagacccagaaacctttgccaagaaccgtgaactcgaggtgatccactgc 368

                                                                       
Query: 321 cgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggt 380
            | ||||| |||||||| || || || |||||||||||||||||  | ||||| || |||
Sbjct: 369 agatgggctatgcttggtgctcttggatgtgtcttccccgagctcttggcccgtaatggt 428

                                                                       
Query: 381 gttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggc 440
           || ||||| || |||||||| ||||||||||||||||| || ||||| ||||||||||| 
Sbjct: 429 gtcaagtttggcgaggctgtgtggttcaaggctggatcccaaatctttagcgagggtgga 488

                                                                       
Query: 441 cttgactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggct 500
           ||||||||| | |||||||||||| | || || || || || ||| | ||||| ||||||
Sbjct: 489 cttgactacttgggcaacccaagcttggtccatgcacaaagcatcttggccatctgggct 548

                                                                       
Query: 501 tgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggtggaccacttggt 560
           || || ||| |  | ||||| |||||||||||||||||  |||||||||| || ||||||
Sbjct: 549 tgccaagttatcttgatgggagccgttgagggttaccgtgttgctggtgggcctcttggt 608

                                                    
Query: 561 gagatcgtcgacccattataccccgggtggcagcttcgacc 601
           ||| | ||||||||| | || ||| ||||||||||| ||||
Sbjct: 609 gaggttgtcgacccactcta-ccctggtggcagctttgacc 648

---

>emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/b binding protein
          Length = 1025

 Score =  272 bits (137), Expect = 1e-69
 Identities = 345/413 (83%), Gaps = 1/413 (0%)
 Strand = Plus / Plus

                                                                       
Query: 189 ggcccactttctggtgagcccccgagctacctgaccggtgagttccccggtgactacggg 248
           |||||| | ||||||||| | || |||||| |||| |||||||| || ||||| ||||||
Sbjct: 236 ggcccattctctggtgagtctccaagctacttgactggtgagtttcctggtgattacggg 295

                                                                       
Query: 249 tgggacaccgctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgag 308
           |||||||| |||||||| || ||||| ||||| || |||||||||||||| ||| | |||
Sbjct: 296 tgggacactgctggactttcagctgatccagaaacattcgccaagaaccgtgagttggag 355

                                                                       
Query: 309 gtgatccattgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctc 368
           |||||||| ||| | |||||||||||||| || || ||||||||||||||||| ||  | 
Sbjct: 356 gtgatccactgcagatgggccatgcttggagctcttggttgtgtcttccccgaactcttg 415

                                                                       
Query: 369 gcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttc 428
           || || || ||||| ||||||||||| ||||| ||||||||||||||||| || || || 
Sbjct: 416 gcacgtaatggtgtcaagttcggtgaagctgtatggttcaaggctggatcccaaattttt 475

                                                                       
Query: 429 agcgagggtggccttgactacctcggcaacccaagccttgtgcacgcccagagtatcctt 488
           ||||||||||| ||||||||| | |||||||||||  | || ||||| || || ||| | 
Sbjct: 476 agcgagggtggacttgactacttgggcaacccaagtttggtccacgcacaaagcatcttg 535

                                                                       
Query: 489 gccatttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggt 548
           |||||||||||||| || |||||| | ||||| || || |||||||||||  ||||||||
Sbjct: 536 gccatttgggcttgccaagttgtgttgatgggagctgtcgagggttaccgtgttgctggt 595

                                                                
Query: 549 ggaccacttggtgagatcgtcgacccattataccccgggtggcagcttcgacc 601
           ||||| || |||||| | || |||||| | |||||| ||||||||||||||||
Sbjct: 596 ggacctctcggtgaggttgttgacccactttacccc-ggtggcagcttcgacc 647

---

>gb|M14443.1|TOMCBPA Tomato chlorophyll a/b-binding protein gene Cab-1B, complete cds
          Length = 1253

 Score =  272 bits (137), Expect = 1e-69
 Identities = 345/413 (83%), Gaps = 1/413 (0%)
 Strand = Plus / Plus

                                                                       
Query: 189 ggcccactttctggtgagcccccgagctacctgaccggtgagttccccggtgactacggg 248
           |||||| | ||||||||| |||| |||||| |||||||||| || || ||||| ||||||
Sbjct: 365 ggcccattctctggtgagtccccaagctacttgaccggtgaatttcctggtgattacggg 424

                                                                       
Query: 249 tgggacaccgctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgag 308
           ||||| ||||||||||| || || ||||| || || || ||||||||||| || || || 
Sbjct: 425 tgggataccgctggactttcagcagaccctgaaacttttgccaagaaccgtgaacttgaa 484

                                                                       
Query: 309 gtgatccattgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctc 368
           |||||||| ||| | ||||| |||||||| || || || ||||||||||| |||||  | 
Sbjct: 485 gtgatccactgcagatgggctatgcttggtgctcttggatgtgtcttccctgagctcttg 544

                                                                       
Query: 369 gcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttc 428
           ||||| || ||||| ||||||||||||||||| ||||||||||| ||||| |||||||||
Sbjct: 545 gcccgtaatggtgtcaagttcggtgaggctgtgtggttcaaggccggatcccagatcttc 604

                                                                       
Query: 429 agcgagggtggccttgactacctcggcaacccaagccttgtgcacgcccagagtatcctt 488
           || || ||||| ||||||||| | |||||||||||| | || || || || || ||| | 
Sbjct: 605 agtgaaggtggacttgactacttgggcaacccaagcttggtccatgcacaaagcatcttg 664

                                                                       
Query: 489 gccatttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggt 548
           ||||| |||||||| || |||||| | ||||| || |||||||||||||| |||||||||
Sbjct: 665 gccatctgggcttgccaagttgtgttgatgggagctgttgagggttaccgtattgctggt 724

                                                                
Query: 549 ggaccacttggtgagatcgtcgacccattataccccgggtggcagcttcgacc 601
           ||||| ||||||||| | ||||||||| | || ||| ||||||||||||||||
Sbjct: 725 ggacctcttggtgaggttgtcgacccactcta-ccctggtggcagcttcgacc 776

---

>emb|X02359.1|PECAB22L Petunia gene for chlorophyll a/b binding protein cab 22L
          Length = 1187

 Score =  270 bits (136), Expect = 5e-69
 Identities = 338/404 (83%), Gaps = 1/404 (0%)
 Strand = Plus / Plus

                                                                       
Query: 198 tctggtgagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacacc 257
           ||||||||| |||| |||||| |||| ||||||||||| ||||| || ||||||||||| 
Sbjct: 420 tctggtgaggccccaagctacttgactggtgagttccctggtgattatgggtgggacact 479

                                                                       
Query: 258 gctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccat 317
           |||||||| || ||||| ||||| || ||||||||||| || ||| | ||||||||||| 
Sbjct: 480 gctggactttcagctgatccagaaactttcgccaagaatcgtgagttggaggtgatccac 539

                                                                       
Query: 318 tgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaac 377
           ||| | |||||||||||||| || || ||||| |||||||| |||||  | ||||| |||
Sbjct: 540 tgcagatgggccatgcttggagctcttggttgcgtcttccctgagctttttgcccgtaac 599

                                                                       
Query: 378 ggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggt 437
           ||||| ||||| ||||||||||| ||| ||||||||||||| || || ||||| ||||||
Sbjct: 600 ggtgtcaagtttggtgaggctgtatggctcaaggctggatcacaaattttcagtgagggt 659

                                                                       
Query: 438 ggccttgactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgg 497
           || ||||||||| | |||||||||||  | || ||||| || || ||| | ||||| |||
Sbjct: 660 ggacttgactacttgggcaacccaagtttggtccacgcacaaagcatcttggccatctgg 719

                                                                       
Query: 498 gcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggtggaccactt 557
           ||||| || ||  || | ||||| |||||||||||||||||  ||||||||||||| |||
Sbjct: 720 gcttgccaagtattgttgatgggagccgttgagggttaccgtgttgctggtggacctctt 779

                                                       
Query: 558 ggtgagatcgtcgacccattataccccgggtggcagcttcgacc 601
           |||| | | ||||||||| | |||||| ||||||||||||||||
Sbjct: 780 ggtgtggttgtcgacccactttacccc-ggtggcagcttcgacc 822

---

>dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT10J15, TM0007,
             complete sequence
          Length = 92741

 Score =  268 bits (135), Expect = 2e-68
 Identities = 306/363 (84%)
 Strand = Plus / Minus

                                                                         
Query: 201   ggtgagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgct 260
             ||||||||||||  |||| |||||||||||||||||||||||||||| |||||||| |||
Sbjct: 66170 ggtgagcccccgtcctacttgaccggtgagttccccggtgactacggctgggacactgct 66111

                                                                         
Query: 261   ggactgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgc 320
             || || || |||||||| ||||| |||||||||||||| ||||| ||||||||||| |  
Sbjct: 66110 gggctttctgctgaccccgagacattcgccaagaaccgtgagcttgaggtgatccactct 66051

                                                                         
Query: 321   cgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggt 380
              | ||||||||| | || ||  | || ||||| ||||| |||||  | ||||||||||| 
Sbjct: 66050 aggtgggccatgttgggagctttgggctgtgttttcccagagctcttggcccgcaacggg 65991

                                                                         
Query: 381   gttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggc 440
             ||||| |||||||||||||| |||||||||||||| || || ||||||||||||||||| 
Sbjct: 65990 gttaaattcggtgaggctgtgtggttcaaggctgggtcacaaatcttcagcgagggtggg 65931

                                                                         
Query: 441   cttgactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggct 500
             ||||||||| | |||||||| ||||| || ||||| ||||| || ||||| |||||||| 
Sbjct: 65930 cttgactacttgggcaacccgagcctggtccacgctcagagcattcttgcaatttgggcc 65871

                                                                         
Query: 501   tgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggtggaccacttggt 560
               ||||||| |  | ||||| || |||||||||||||| ||||||||||| || ||||||
Sbjct: 65870 actcaggttatcttgatgggagcagttgagggttaccgtattgctggtgggcctcttggt 65811

                
Query: 561   gag 563
             |||
Sbjct: 65810 gag 65808

---

>gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           40 mRNA, complete cds
          Length = 859

 Score =  266 bits (134), Expect = 8e-68
 Identities = 329/394 (83%)
 Strand = Plus / Plus

                                                                       
Query: 106 tcaccatgcgcaagacggcggcaaaggccaagaaggttgcctccagcagcccgtggtacg 165
           |||| ||||||||||| || || ||| |||||| |||  | ||| |||||||||||||||
Sbjct: 149 tcacgatgcgcaagaccgccgccaagcccaagacggtctcgtccggcagcccgtggtacg 208

                                                                       
Query: 166 gctctgaccgggtcctctacctcggcccactttctggtgagcccccgagctacctgaccg 225
           || | ||||| |||   |||||||||||  | || || ||| ||||    ||||| ||||
Sbjct: 209 gcccggaccgtgtcaagtacctcggcccgttctccggcgaggccccatcatacctcaccg 268

                                                                       
Query: 226 gtgagttccccggtgactacgggtgggacaccgctggactgtcggctgacccagagacct 285
           | || |||||||| |||||||||||||||||||| || || || || ||||| |||||||
Sbjct: 269 gcgaattccccggcgactacgggtgggacaccgccgggctctccgccgaccccgagacct 328

                                                                       
Query: 286 tcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgcttggcgcgctcg 345
           || |||||||||||||||||||||||||||| ||||| ||||||||||| || || ||||
Sbjct: 329 tctccaagaaccgggagctcgaggtgatccactgccggtgggccatgctgggtgctctcg 388

                                                                       
Query: 346 gttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgaggctgtttggt 405
           | || |||||||||||||| |||||||||||||| || |||||||| ||||| || ||||
Sbjct: 389 gctgcgtcttccccgagctcctcgcccgcaacggcgtgaagttcggcgaggcggtctggt 448

                                                                       
Query: 406 tcaaggctggatctcagatcttcagcgagggtggccttgactacctcggcaacccaagcc 465
           ||||||| ||| | ||||||||||||||||| ||  | |||||||| |||||||| ||||
Sbjct: 449 tcaaggccggagcccagatcttcagcgagggcggattggactacctgggcaaccccagcc 508

                                             
Query: 466 ttgtgcacgcccagagtatccttgccatttgggc 499
           | || ||||| ||||| ||||| ||||| |||||
Sbjct: 509 tcgtccacgcgcagagcatcctggccatctgggc 542

---

>emb|X52744.1|NTCAB40 Tabacco Cab40 mRNA for major chlorophyll a/b binding protein
          Length = 1080

 Score =  266 bits (134), Expect = 8e-68
 Identities = 314/374 (83%)
 Strand = Plus / Plus

                                                                       
Query: 189 ggcccactttctggtgagcccccgagctacctgaccggtgagttccccggtgactacggg 248
           |||||| | ||||||||| |||| |||||| |||| ||||||||||| ||||||||||||
Sbjct: 244 ggcccattctctggtgagtccccaagctacttgactggtgagttccctggtgactacggg 303

                                                                       
Query: 249 tgggacaccgctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgag 308
           |||||||| |||||||| || ||||| ||||| || || |||||||| || ||| | |||
Sbjct: 304 tgggacactgctggactttcagctgatccagaaacttttgccaagaatcgtgagttggag 363

                                                                       
Query: 309 gtgatccattgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctc 368
           |||||||| ||| | |||||||||||||| || || |||||||||||||| |||||  | 
Sbjct: 364 gtgatccactgcagatgggccatgcttggagctcttggttgtgtcttccctgagctcttg 423

                                                                       
Query: 369 gcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttc 428
           || || |||||||| ||||| || |||||||| |||||||||||||||||||| || || 
Sbjct: 424 gcacgtaacggtgtcaagtttggcgaggctgtatggttcaaggctggatctcaaattttt 483

                                                                       
Query: 429 agcgagggtggccttgactacctcggcaacccaagccttgtgcacgcccagagtatcctt 488
           ||||||||||| ||||||||  | |||||||||||  | || ||||| || || ||| | 
Sbjct: 484 agcgagggtggacttgactatttgggcaacccaagtttggtccacgcacaaagcatcttg 543

                                                                       
Query: 489 gccatttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggt 548
           |||||||||||||| || |||||| | ||||| || ||||||||||||||  ||||||||
Sbjct: 544 gccatttgggcttgccaagttgtgttgatgggagcagttgagggttaccgtgttgctggt 603

                         
Query: 549 ggaccacttggtga 562
           ||||| || |||||
Sbjct: 604 ggacctctcggtga 617

---

>emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding protein cab 25
          Length = 1184

 Score =  260 bits (131), Expect = 5e-66
 Identities = 314/375 (83%)
 Strand = Plus / Plus

                                                                       
Query: 189 ggcccactttctggtgagcccccgagctacctgaccggtgagttccccggtgactacggg 248
           |||||| ||||||||||| |||| |||||| |||| |||||||| || |||||||| |||
Sbjct: 408 ggcccattttctggtgaggccccaagctacttgactggtgagtttcctggtgactatggg 467

                                                                       
Query: 249 tgggacaccgctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgag 308
           ||||| || |||||||| || || |||||||| || |||||||||||||||||| | |||
Sbjct: 468 tgggatactgctggactttcagcagacccagaaactttcgccaagaaccgggagttggag 527

                                                                       
Query: 309 gtgatccattgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctc 368
           |||||||| ||| | |||||||||||||| || || ||||| |||||||| |||||  | 
Sbjct: 528 gtgatccactgcagatgggccatgcttggagctcttggttgcgtcttccctgagctcttt 587

                                                                       
Query: 369 gcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttc 428
           ||||| || ||||| ||||||||||| ||||| |||||||||||||||||||| || |||
Sbjct: 588 gcccgtaatggtgtcaagttcggtgaagctgtatggttcaaggctggatctcaaattttc 647

                                                                       
Query: 429 agcgagggtggccttgactacctcggcaacccaagccttgtgcacgcccagagtatcctt 488
           || || ||||| ||||||||| | |||||||||||  | || || || || || ||| | 
Sbjct: 648 agtgaaggtggacttgactacttgggcaacccaagtttggttcatgcacaaagcatctta 707

                                                                       
Query: 489 gccatttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggt 548
           |||||||||||||| || |||||| | ||||| |||||||||||||||||  |||| |||
Sbjct: 708 gccatttgggcttgccaagttgtgttgatgggagccgttgagggttaccgtgttgccggt 767

                          
Query: 549 ggaccacttggtgag 563
           || || || ||||||
Sbjct: 768 ggtcctctcggtgag 782

---

>gb|AY109324.1| Zea mays CL187_1 mRNA sequence
          Length = 2262

 Score =  258 bits (130), Expect = 2e-65
 Identities = 273/320 (85%), Gaps = 3/320 (0%)
 Strand = Plus / Plus

                                                                        
Query: 96   gaggctcgcgtcaccatgcgcaagacggcggcaaaggccaagaa---ggttgcctccagc 152
            ||||| ||||| || ||||||||||||||||| |||||||||     ||  || ||| | 
Sbjct: 1091 gaggcccgcgtgacgatgcgcaagacggcggcgaaggccaagccagcggcggcgtccggg 1150

                                                                        
Query: 153  agcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccccg 212
            ||||||||||||||| | ||||| || || ||||| |||||||| || || ||||| |||
Sbjct: 1151 agcccgtggtacggccccgaccgcgtgctgtacctgggcccactgtccggcgagccgccg 1210

                                                                        
Query: 213  agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
            ||||||||||| || |||||||| || |||||||| ||||||||||| || |||||||| 
Sbjct: 1211 agctacctgacgggcgagttcccgggcgactacggctgggacaccgcggggctgtcggcg 1270

                                                                        
Query: 273  gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
            ||||| ||||| |||||||||||||||||||| ||||||||||| | ||| |||||||||
Sbjct: 1271 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccgctgggccatg 1330

                                                                        
Query: 333  cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
            || ||||||||||| || |||||||| |||||||||||||||||||| || |||||||| 
Sbjct: 1331 ctgggcgcgctcggctgcgtcttcccggagctgctcgcccgcaacggcgtcaagttcggc 1390

                                
Query: 393  gaggctgtttggttcaaggc 412
            ||||| ||| ||||||||||
Sbjct: 1391 gaggccgttgggttcaaggc 1410



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 109/131 (83%)
 Strand = Plus / Plus

                                                                        
Query: 444  gactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgt 503
            |||||||||| |||||| |||||  | ||||| ||||| ||||| ||||| ||||| || 
Sbjct: 1442 gactacctcgtcaacccgagcctcatccacgcgcagagcatcctcgccatctgggcctgc 1501

                                                                        
Query: 504  caggttgtgctcatgggtgccgttgagggttaccgcattgctggtggaccacttggtgag 563
            ||||| ||||||||||| ||||| ||||| |||||||| || || ||||| || || |||
Sbjct: 1502 caggtcgtgctcatgggcgccgtcgagggctaccgcatcgccggcggaccgctcggcgag 1561

                       
Query: 564  atcgtcgaccc 574
             ||||||||||
Sbjct: 1562 gtcgtcgaccc 1572

---

>dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 genes for light
            harvesting chlorophyll a/b-binding protein, complete cds
          Length = 7965

 Score =  252 bits (127), Expect = 1e-63
 Identities = 313/375 (83%)
 Strand = Plus / Plus

                                                                        
Query: 201  ggtgagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgct 260
            |||||| |||| |||||| |||||||||| || ||||||||||| |||||||| || |||
Sbjct: 4521 ggtgagtccccaagctacttgaccggtgaatttcccggtgactatgggtgggatactgct 4580

                                                                        
Query: 261  ggactgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgc 320
            ||||| || || || ||||| ||||| ||||||||||| ||||||||||||||||| |||
Sbjct: 4581 ggactttcagcagatccagaaacctttgccaagaaccgtgagctcgaggtgatccactgc 4640

                                                                        
Query: 321  cgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggt 380
             | ||||| |||||||| || || || |||||||||||||||||  | ||||| ||||||
Sbjct: 4641 agatgggctatgcttggtgctcttggatgtgtcttccccgagctcttggcccgtaacggt 4700

                                                                        
Query: 381  gttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggc 440
            |||||||| || |||||||| ||||||||||| ||||| || ||||||||||| ||||| 
Sbjct: 4701 gttaagtttggcgaggctgtgtggttcaaggccggatcccaaatcttcagcgatggtgga 4760

                                                                        
Query: 441  cttgactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggct 500
            ||||||||  | |||||||||||| |  | ||||| || || ||| | || || ||||||
Sbjct: 4761 cttgactatttgggcaacccaagcttgatccacgcacaaagcatcttggcaatatgggct 4820

                                                                        
Query: 501  tgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggtggaccacttggt 560
            || |||||| |  | ||||| ||||||||||| |||||  | ||||||||||| ||||||
Sbjct: 4821 tgccaggttatcttgatgggagccgttgagggataccgtgtagctggtggacctcttggt 4880

                           
Query: 561  gagatcgtcgaccca 575
            ||| | |||||||||
Sbjct: 4881 gaggttgtcgaccca 4895



 Score =  248 bits (125), Expect = 2e-62
 Identities = 333/401 (83%), Gaps = 1/401 (0%)
 Strand = Plus / Plus

                                                                        
Query: 201  ggtgagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgct 260
            |||||| |||| |||||| |||||||||| ||||| ||||| ||||||||||| || |||
Sbjct: 7061 ggtgaggccccaagctacttgaccggtgaattcccaggtgattacgggtgggatactgct 7120

                                                                        
Query: 261  ggactgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgc 320
            ||||| || || || ||||| ||||| ||||||||||| || |||||||||||||| |||
Sbjct: 7121 ggactttcagcggatccagaaacctttgccaagaaccgtgaactcgaggtgatccactgc 7180

                                                                        
Query: 321  cgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggt 380
             | ||||| |||||||| || || || ||||||||||| |||||  | || || ||||||
Sbjct: 7181 agatgggctatgcttggtgctcttggatgtgtcttccctgagctcttggctcgtaacggt 7240

                                                                        
Query: 381  gttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggc 440
            || ||||| || || ||||| ||||||||||||||||| || ||||| ||||||||||| 
Sbjct: 7241 gtcaagtttggcgaagctgtctggttcaaggctggatcccaaatctttagcgagggtgga 7300

                                                                        
Query: 441  cttgactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggct 500
            ||||||||| | |||||||||||| | ||||| || || || ||| | ||||| ||||||
Sbjct: 7301 cttgactacttgggcaacccaagcttggtgcatgcacaaagcatcttggccatctgggct 7360

                                                                        
Query: 501  tgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggtggaccacttggt 560
            || || ||| |  | ||||| |||||||||||||||||  |||||||||| || ||||||
Sbjct: 7361 tgccaagttatcttgatgggagccgttgagggttaccgtgttgctggtgggcctcttggt 7420

                                                     
Query: 561  gagatcgtcgacccattataccccgggtggcagcttcgacc 601
            ||| | ||||||||| | || ||| ||||||||||| ||||
Sbjct: 7421 gaggttgtcgacccactcta-ccctggtggcagctttgacc 7460



 Score =  216 bits (109), Expect = 6e-53
 Identities = 338/413 (81%), Gaps = 1/413 (0%)
 Strand = Plus / Plus

                                                                        
Query: 189  ggcccactttctggtgagcccccgagctacctgaccggtgagttccccggtgactacggg 248
            |||||| ||||||||||| | || |||||  |||| ||||| ||||| |||||||| |||
Sbjct: 2056 ggcccattttctggtgagtctccaagctatttgactggtgaattccctggtgactatggg 2115

                                                                        
Query: 249  tgggacaccgctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgag 308
            ||||| || |||||||| || || |||||||| || || ||||||||||| || ||||||
Sbjct: 2116 tgggatactgctggactttcagccgacccagaaacttttgccaagaaccgtgaactcgag 2175

                                                                        
Query: 309  gtgatccattgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctc 368
            ||||| || ||| | ||||| |||||||| || || || ||||| |||||||||||  | 
Sbjct: 2176 gtgattcactgcagatgggctatgcttggtgctcttggatgtgttttccccgagctcttg 2235

                                                                        
Query: 369  gcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttc 428
            ||||| || || || ||||| ||||||||||| ||||||||||||||||| || ||||| 
Sbjct: 2236 gcccgtaatggcgtcaagtttggtgaggctgtatggttcaaggctggatcacaaatcttt 2295

                                                                        
Query: 429  agcgagggtggccttgactacctcggcaacccaagccttgtgcacgcccagagtatcctt 488
            ||||||||||| ||||||||| | ||||| |||||| |  | ||||| || || ||| | 
Sbjct: 2296 agcgagggtggacttgactacttgggcaatccaagcttgatccacgcacaaagcatcttg 2355

                                                                        
Query: 489  gccatttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggt 548
            || || |||||||| || ||| |  | ||||| |||||||||||||||||  ||||||||
Sbjct: 2356 gctatctgggcttgccaagttatcttgatgggagccgttgagggttaccgtgttgctggt 2415

                                                                 
Query: 549  ggaccacttggtgagatcgtcgacccattataccccgggtggcagcttcgacc 601
            || || ||||||||| | ||||||||| | || ||| ||||||||||| ||||
Sbjct: 2416 gggcctcttggtgaggttgtcgacccactcta-ccctggtggcagctttgacc 2467

---

>gb|AY389553.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           (CAB) mRNA, partial cds
          Length = 720

 Score =  250 bits (126), Expect = 5e-63
 Identities = 322/386 (83%), Gaps = 1/386 (0%)
 Strand = Plus / Plus

                                                                       
Query: 216 tacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgac 275
           ||||| ||||||||||||||||| |||||||| ||||||||||| || || || || |||
Sbjct: 243 tacctcaccggtgagttccccggcgactacggctgggacaccgccgggctctcagcggac 302

                                                                       
Query: 276 ccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgctt 335
           || ||||| |||||||||||||||||||||||||||||||| ||| | ||||| ||||| 
Sbjct: 303 cccgagacattcgccaagaaccgggagctcgaggtgatccactgcaggtgggcaatgctg 362

                                                                       
Query: 336 ggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgag 395
           ||||| ||||| || |||||||||||||| |||||||||||||| || |||||||| |||
Sbjct: 363 ggcgctctcggctgcgtcttccccgagctcctcgcccgcaacggcgtgaagttcggcgag 422

                                                                       
Query: 396 gctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggc 455
           || || ||||||||||| ||  | ||||||||||||||||| ||  | |||||||| |||
Sbjct: 423 gcggtctggttcaaggccggcgcccagatcttcagcgagggcggattggactacctgggc 482

                                                                       
Query: 456 aacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctc 515
           ||||| ||||| || ||||| ||||| || || ||||| |||||   ||||||  | |||
Sbjct: 483 aaccctagcctggtccacgcacagagcattctggccatatgggcgactcaggtccttctc 542

                                                                       
Query: 516 atgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgaccca 575
           ||||| ||||| ||||| ||| |  |||| || || || || || ||| |||||||||||
Sbjct: 543 atgggggccgtcgagggatacagagttgccggcgggccgctcggcgaggtcgtcgaccca 602

                                     
Query: 576 ttataccccgggtggcagcttcgacc 601
            | |||||| || |||||||||||||
Sbjct: 603 ctgtacccc-ggcggcagcttcgacc 627

---

>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           3C (LHCP) mRNA, partial cds
          Length = 661

 Score =  250 bits (126), Expect = 5e-63
 Identities = 322/386 (83%), Gaps = 1/386 (0%)
 Strand = Plus / Plus

                                                                       
Query: 216 tacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgac 275
           ||||| ||||||||||||||||| |||||||| ||||||||||| || || || || |||
Sbjct: 78  tacctcaccggtgagttccccggcgactacggctgggacaccgccgggctctcagcggac 137

                                                                       
Query: 276 ccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgctt 335
           || ||||| |||||||||||||||||||||||||||||||| ||| | ||||| ||||| 
Sbjct: 138 cccgagacattcgccaagaaccgggagctcgaggtgatccactgcaggtgggcaatgctg 197

                                                                       
Query: 336 ggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgag 395
           ||||| ||||| || |||||||||||||| |||||||||||||| || |||||||| |||
Sbjct: 198 ggcgctctcggctgcgtcttccccgagctcctcgcccgcaacggcgtgaagttcggcgag 257

                                                                       
Query: 396 gctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggc 455
           || || ||||||||||| ||  | ||||||||||||||||| ||  | |||||||| |||
Sbjct: 258 gcggtctggttcaaggccggcgcccagatcttcagcgagggcggattggactacctgggc 317

                                                                       
Query: 456 aacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctc 515
           ||||| ||||| || ||||| ||||| || || ||||| |||||   ||||||  | |||
Sbjct: 318 aaccctagcctggtccacgcacagagcattctggccatatgggcgactcaggtccttctc 377

                                                                       
Query: 516 atgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgaccca 575
           ||||| ||||| ||||| ||| |  |||| || || || || || ||| |||||||||||
Sbjct: 378 atgggggccgtcgagggatacagagttgccggcgggccgctcggcgaggtcgtcgaccca 437

                                     
Query: 576 ttataccccgggtggcagcttcgacc 601
            | |||||| || |||||||||||||
Sbjct: 438 ctgtacccc-ggcggcagcttcgacc 462

---

>gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab-E) gene, complete cds
          Length = 1815

 Score =  248 bits (125), Expect = 2e-62
 Identities = 342/413 (82%), Gaps = 1/413 (0%)
 Strand = Plus / Plus

                                                                        
Query: 189  ggcccactttctggtgagcccccgagctacctgaccggtgagttccccggtgactacggg 248
            |||||| | ||||||||| | || |||||| |||| |||||||| || ||||| ||||||
Sbjct: 1156 ggcccattctctggtgagtctccaagctacttgactggtgagtttcctggtgattacggg 1215

                                                                        
Query: 249  tgggacaccgctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgag 308
            |||||||| || ||||| || ||||| ||||| || |||||||||||||| ||| | |||
Sbjct: 1216 tgggacactgccggactttcagctgatccagaaacattcgccaagaaccgtgagttggag 1275

                                                                        
Query: 309  gtgatccattgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctc 368
            |||||||| ||| | |||||||||||||| || || ||||||||||||||||| ||  | 
Sbjct: 1276 gtgatccactgcagatgggccatgcttggagctcttggttgtgtcttccccgaactcttg 1335

                                                                        
Query: 369  gcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttc 428
            || || || ||||| ||||||||||| ||||| ||||||||||||||||| || || || 
Sbjct: 1336 gcacgtaatggtgtcaagttcggtgaagctgtatggttcaaggctggatcccaaattttt 1395

                                                                        
Query: 429  agcgagggtggccttgactacctcggcaacccaagccttgtgcacgcccagagtatcctt 488
            ||||||||||| ||||||||| | |||||||||||  | || ||||| || || ||| | 
Sbjct: 1396 agcgagggtggacttgactacttgggcaacccaagtttggtccacgcacaaagcatcttg 1455

                                                                        
Query: 489  gccatttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggt 548
            |||||||||||||| || |||||| | ||||| || || || ||||||||  ||||||||
Sbjct: 1456 gccatttgggcttgccaagttgtgttgatgggagctgtcgaaggttaccgtgttgctggt 1515

                                                                 
Query: 549  ggaccacttggtgagatcgtcgacccattataccccgggtggcagcttcgacc 601
            | ||| || |||||| | || |||||| | |||||| ||||||||||||||||
Sbjct: 1516 gaacctctcggtgaggttgttgacccactttacccc-ggtggcagcttcgacc 1567

---

>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds
          Length = 695

 Score =  246 bits (124), Expect = 7e-62
 Identities = 244/284 (85%)
 Strand = Plus / Plus

                                                                       
Query: 216 tacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgac 275
           ||||| ||||| |||||| |||| |||||||| ||||||||||| || || || || |||
Sbjct: 113 tacctcaccggcgagttcgccggcgactacggctgggacaccgccgggctctccgccgac 172

                                                                       
Query: 276 ccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgctt 335
           || |||||||||||||||||||| ||||| |||||||||||     | ||||||||||| 
Sbjct: 173 cccgagaccttcgccaagaaccgcgagctggaggtgatccacgcgaggtgggccatgctc 232

                                                                       
Query: 336 ggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgag 395
           ||||||||||| || ||||||||||||||||||||||||||||| || |||||||| |||
Sbjct: 233 ggcgcgctcggctgcgtcttccccgagctgctcgcccgcaacggcgtcaagttcggcgag 292

                                                                       
Query: 396 gctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggc 455
           || || ||||||||||| || || ||||||||||||||||| || || ||||||||||| 
Sbjct: 293 gccgtctggttcaaggccggctcccagatcttcagcgagggcgggctcgactacctcggg 352

                                                       
Query: 456 aacccaagccttgtgcacgcccagagtatccttgccatttgggc 499
           ||||| ||||| |||||||| ||||| ||||| ||||| |||||
Sbjct: 353 aaccccagcctggtgcacgcgcagagcatcctcgccatctgggc 396

---

>gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b binding protein
           3C-like mRNA, complete cds
          Length = 1055

 Score =  244 bits (123), Expect = 3e-61
 Identities = 312/375 (83%)
 Strand = Plus / Plus

                                                                       
Query: 189 ggcccactttctggtgagcccccgagctacctgaccggtgagttccccggtgactacggg 248
           |||||| | ||||||||  |||| |||||| |||| |||||||| || ||||||||||| 
Sbjct: 216 ggcccattctctggtgaagccccaagctacttgactggtgagtttcctggtgactacgga 275

                                                                       
Query: 249 tgggacaccgctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgag 308
           |||||||| |||||||| || |||||||| || || ||||| |||||||| ||||| |||
Sbjct: 276 tgggacactgctggactttcagctgaccctgaaacattcgctaagaaccgtgagcttgag 335

                                                                       
Query: 309 gtgatccattgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctc 368
           |||||||| ||| | |||||||||||||| || || || ||||||||||| |||||  | 
Sbjct: 336 gtgatccactgcagatgggccatgcttggtgctcttggatgtgtcttccctgagcttttg 395

                                                                       
Query: 369 gcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttc 428
           ||||| || ||||| ||||| || || ||||| ||||||||||||||||| || || |||
Sbjct: 396 gcccgtaatggtgtcaagtttggcgaagctgtatggttcaaggctggatcccaaattttc 455

                                                                       
Query: 429 agcgagggtggccttgactacctcggcaacccaagccttgtgcacgcccagagtatcctt 488
           ||||||||||| ||||||||| | |||||||||||  | || || || || || ||| | 
Sbjct: 456 agcgagggtggacttgactacttgggcaacccaagtttggtccatgcacaaagcatcttg 515

                                                                       
Query: 489 gccatttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggt 548
           || || |||||||| || |||||| | ||||| ||||||||||||||||| |||||||||
Sbjct: 516 gctatctgggcttgccaagttgtgttgatgggagccgttgagggttaccgtattgctggt 575

                          
Query: 549 ggaccacttggtgag 563
           || || |||||||||
Sbjct: 576 gggcctcttggtgag 590

---

>gb|M16058.1|CUSLHCPB Cucumber LHCP mRNA encoding chlorophyll a/b-binding protein,
           partial cds
          Length = 748

 Score =  244 bits (123), Expect = 3e-61
 Identities = 300/359 (83%)
 Strand = Plus / Plus

                                                                       
Query: 198 tctggtgagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacacc 257
           ||||||||||| ||   |||||| ||||| |||||||| ||||||||||| |||||||| 
Sbjct: 9   tctggtgagccaccatcctaccttaccggagagttccctggtgactacggttgggacact 68

                                                                       
Query: 258 gctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccat 317
           |||||||| || ||||| || |||||||||||||||||||| ||| | || |||||||| 
Sbjct: 69  gctggactttcagctgatcccgagaccttcgccaagaaccgagagttggaagtgatccac 128

                                                                       
Query: 318 tgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaac 377
           | |   |||||||||||||| ||  | || ||||| ||||| |||||  |  | ||||| 
Sbjct: 129 tccacatgggccatgcttggagctttggggtgtgttttccctgagcttttgtctcgcaat 188

                                                                       
Query: 378 ggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggt 437
           ||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 189 ggtgtgaagtttggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggc 248

                                                                       
Query: 438 ggccttgactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgg 497
           || ||||||||| | |||||||| ||| | || || || ||||| ||  | ||||| |||
Sbjct: 249 gggcttgactacttgggcaaccccagcttggtccatgctcagagcattttggccatctgg 308

                                                                      
Query: 498 gcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggtggaccact 556
           ||||| ||||||||| | ||||||||||| ||||||||||| |||||||| || |||||
Sbjct: 309 gcttgccaggttgtgttgatgggtgccgtcgagggttaccgtattgctggcggcccact 367

---

>dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting
            chlorophyll a/b-binding protein, complete cds
          Length = 7299

 Score =  244 bits (123), Expect = 3e-61
 Identities = 340/411 (82%), Gaps = 1/411 (0%)
 Strand = Plus / Plus

                                                                        
Query: 189  ggcccactttctggtgagcccccgagctacctgaccggtgagttccccggtgactacggg 248
            |||||| | ||||||||| | || |||||| |||| ||||| ||||| ||||||||||||
Sbjct: 4540 ggcccattctctggtgagtctccaagctacttgactggtgaattccctggtgactacggg 4599

                                                                        
Query: 249  tgggacaccgctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgag 308
            |||||||| |||||||| || ||||| ||||| || || || |||||||| ||| | |||
Sbjct: 4600 tgggacactgctggactttcagctgatccagaaacttttgctaagaaccgtgagttggag 4659

                                                                        
Query: 309  gtgatccattgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctc 368
            |||||||| ||| | ||||| |||||||| || || ||||||||||||||||||||  | 
Sbjct: 4660 gtgatccactgcagatgggcaatgcttggagctcttggttgtgtcttccccgagctcttg 4719

                                                                        
Query: 369  gcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttc 428
            ||||| || ||||||||||| || ||||| || |||||||||||||||||||| || |||
Sbjct: 4720 gcccgtaatggtgttaagtttggcgaggccgtatggttcaaggctggatctcaaattttc 4779

                                                                        
Query: 429  agcgagggtggccttgactacctcggcaacccaagccttgtgcacgcccagagtatcctt 488
            || || ||||| ||||||||| | |||||||||||  | || ||||| || || ||  | 
Sbjct: 4780 agtgaaggtggacttgactacttgggcaacccaagtttggtccacgcacaaagcatttta 4839

                                                                        
Query: 489  gccatttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggt 548
            ||||| |||||||| || ||| |  | ||||| |||||||||||||||||  ||||||||
Sbjct: 4840 gccatctgggcttgccaagttatattgatgggagccgttgagggttaccgtgttgctggt 4899

                                                               
Query: 549  ggaccacttggtgagatcgtcgacccattataccccgggtggcagcttcga 599
            || || ||||||||| | || |||||| | |||||| ||||||||||||||
Sbjct: 4900 gggcctcttggtgaggttgttgacccactttacccc-ggtggcagcttcga 4949



 Score =  242 bits (122), Expect = 1e-60
 Identities = 329/398 (82%)
 Strand = Plus / Minus

                                                                        
Query: 189  ggcccactttctggtgagcccccgagctacctgaccggtgagttccccggtgactacggg 248
            |||||| | ||||||||| | || |||||| |||| |||||||| || |||||||| || 
Sbjct: 2493 ggcccattctctggtgagtctccaagctacttgactggtgagtttccaggtgactatgga 2434

                                                                        
Query: 249  tgggacaccgctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgag 308
            |||||||| |||||||| || ||||| ||||| || || ||||||||||| ||| | |||
Sbjct: 2433 tgggacactgctggactttcagctgatccagaaacttttgccaagaaccgtgagttggag 2374

                                                                        
Query: 309  gtgatccattgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctc 368
            |||||||| ||| | |||||||||||||| || || ||||||||||||||||||||  | 
Sbjct: 2373 gtgatccactgcagatgggccatgcttggagctcttggttgtgtcttccccgagctcttg 2314

                                                                        
Query: 369  gcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttc 428
            || || |||||||| |||||||| || ||||| |||||||||||||| || ||||| |||
Sbjct: 2313 gcacgtaacggtgtcaagttcggagaagctgtatggttcaaggctggttcccagattttc 2254

                                                                        
Query: 429  agcgagggtggccttgactacctcggcaacccaagccttgtgcacgcccagagtatcctt 488
            ||||||||||| ||||||||| | |||||||||||  | || ||||| || || ||| | 
Sbjct: 2253 agcgagggtggtcttgactacttgggcaacccaagtttggttcacgcacaaagcatcttg 2194

                                                                        
Query: 489  gccatttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggt 548
            || ||||||||||| || || ||  | ||||| || ||||||||||||||  ||||||||
Sbjct: 2193 gctatttgggcttgccaagtcgtattgatgggagctgttgagggttaccgtgttgctggt 2134

                                                  
Query: 549  ggaccacttggtgagatcgtcgacccattataccccgg 586
            || || ||||||||| | || |||||| | ||||||||
Sbjct: 2133 gggcctcttggtgaggttgttgacccactttaccccgg 2096

---

>emb|AJ318069.1|STU318069 Solanum tuberosum mRNA for ferredoxin-thioredoxin-reductase
           catalytic subunit B (ftrbpot gene)
          Length = 701

 Score =  240 bits (121), Expect = 4e-60
 Identities = 344/413 (83%), Gaps = 4/413 (0%)
 Strand = Plus / Minus

                                                                       
Query: 189 ggcccactttctggtgagcccccgagctacctgaccggtgagttccccggtgactacggg 248
           |||||| | ||||||||| |||| |||||| |||||||||| ||||| ||||||||||||
Sbjct: 618 ggcccattctctggtgagtccccaagctacttgaccggtgaattccctggtgactacggg 559

                                                                       
Query: 249 tgggacaccgctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgag 308
           ||||| ||||||||||| || || ||||| || ||||| ||||||||||| || ||||||
Sbjct: 558 tgggataccgctggactttcagcagaccctgaaacctttgccaagaaccgtgaactcgag 499

                                                                       
Query: 309 gtgatccattgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctc 368
           |||||||| ||| | | ||| |||||||| || ||  | ||||||||||| |||||  | 
Sbjct: 498 gtgatccactgcagat-ggctatgcttggtgctct-tgatgtgtcttccctgagctattg 441

                                                                       
Query: 369 gcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttc 428
           ||||| || ||||| ||||||||||||||||| ||||||||||| ||||| || ||||||
Sbjct: 440 gcccgtaatggtgtcaagttcggtgaggctgtgtggttcaaggccggatcccacatcttc 381

                                                                       
Query: 429 agcgagggtggccttgactacctcggcaacccaagccttgtgcacgcccagagtatcctt 488
           ||||||||||| ||||||||| | |||||||||||| | || || || ||||| ||| | 
Sbjct: 380 agcgagggtggacttgactacttgggcaacccaagcttggtccatgcacagagcatcttg 321

                                                                       
Query: 489 gccatttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggt 548
           ||||| |||||||| || |||||  |    || |||||||| |||||||| |||||||||
Sbjct: 320 gccatctgggcttgccaagttgtcattgatggagccgttgaaggttaccgtattgctggt 261

                                                                
Query: 549 ggaccacttggtgagatcgtcgacccattataccccgggtggcagcttcgacc 601
            |||| ||||||||| | ||||||||| | || ||| ||||||||||| ||||
Sbjct: 260 -gacctcttggtgaggttgtcgacccactcta-ccctggtggcagctttgacc 210

---

>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds
          Length = 1633

 Score =  236 bits (119), Expect = 7e-59
 Identities = 321/387 (82%), Gaps = 1/387 (0%)
 Strand = Plus / Plus

                                                                       
Query: 215 ctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctga 274
           |||||||||||| |||||| |||| |||||||| ||||||||||| || || ||||| ||
Sbjct: 598 ctacctgaccggcgagttcgccggcgactacggctgggacaccgccgggctctcggccga 657

                                                                       
Query: 275 cccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgct 334
           ||| |||||||||||||||||||||||||| |||||||||||    || |||||||||||
Sbjct: 658 ccccgagaccttcgccaagaaccgggagctggaggtgatccacgcgcggtgggccatgct 717

                                                                       
Query: 335 tggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtga 394
            |||||||| || || || ||||| |||||||| || |||||||| || ||||| || ||
Sbjct: 718 cggcgcgctgggctgcgtgttcccggagctgctggcgcgcaacggcgtgaagtttggcga 777

                                                                       
Query: 395 ggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcgg 454
           ||| || ||||||||||| || || ||||||||||||||||| || || |||||||| ||
Sbjct: 778 ggccgtgtggttcaaggcgggttcgcagatcttcagcgagggggggctggactacctggg 837

                                                                       
Query: 455 caacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgct 514
           |||||| ||||| |||||||| ||||| ||||| ||||| |||||    ||||| || ||
Sbjct: 838 caaccccagcctggtgcacgcgcagagcatcctggccatctgggccacgcaggtggtcct 897

                                                                       
Query: 515 catgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgaccc 574
           |||||| ||||| || || |||||| | || || || || || || ||| ||||||||||
Sbjct: 898 catgggcgccgtcgaaggctaccgcgtggccggcgggcctctgggcgaggtcgtcgaccc 957

                                      
Query: 575 attataccccgggtggcagcttcgacc 601
             | |||||| || |||||||||||||
Sbjct: 958 gctgtacccc-ggcggcagcttcgacc 983

---

>gb|AF295639.1| Beta vulgaris chlorophyll a/b binding protein (cab) gene, partial
           cds, nuclear gene for chloroplast product
          Length = 507

 Score =  234 bits (118), Expect = 3e-58
 Identities = 274/326 (84%)
 Strand = Plus / Plus

                                                                       
Query: 238 gtgactacgggtgggacaccgctggactgtcggctgacccagagaccttcgccaagaacc 297
           |||| ||||| |||||||| |||||||| || ||||||||||| ||||| ||||||||||
Sbjct: 1   gtgattacggttgggacactgctggactctcagctgacccagaaacctttgccaagaacc 60

                                                                       
Query: 298 gggagctcgaggtgatccattgccgttgggccatgcttggcgcgctcggttgtgtcttcc 357
           | ||||| ||||||||||||||| | ||||||||| | |||||  | |||||||| ||||
Sbjct: 61  gtgagcttgaggtgatccattgcagatgggccatgttgggcgcattaggttgtgtattcc 120

                                                                       
Query: 358 ccgagctgctcgcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggat 417
           | ||| || | |||||||| ||||||||||| || |||||||||||||||||||| ||||
Sbjct: 121 cagagttgttagcccgcaatggtgttaagtttggcgaggctgtttggttcaaggcaggat 180

                                                                       
Query: 418 ctcagatcttcagcgagggtggccttgactacctcggcaacccaagccttgtgcacgccc 477
           | || ||||| || |||||||| ||||||||| | || ||||||||  | || ||||| |
Sbjct: 181 cacaaatctttagtgagggtggacttgactacttgggtaacccaagtttggtacacgcac 240

                                                                       
Query: 478 agagtatccttgccatttgggcttgtcaggttgtgctcatgggtgccgttgagggttacc 537
           | ||||| ||||| ||||||||||| |||||| |  | ||||||||||||||||| || |
Sbjct: 241 aaagtattcttgctatttgggcttgccaggttattttgatgggtgccgttgagggctatc 300

                                     
Query: 538 gcattgctggtggaccacttggtgag 563
           |  |||| ||||| ||||||||||||
Sbjct: 301 gtgttgcaggtggtccacttggtgag 326

---

>gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene Cab-3C, complete cds
          Length = 1135

 Score =  234 bits (118), Expect = 3e-58
 Identities = 304/366 (83%)
 Strand = Plus / Plus

                                                                       
Query: 198 tctggtgagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacacc 257
           ||||| ||| |||| |||||| ||||||||||||| || ||||| ||||| |||||||| 
Sbjct: 392 tctggggagtccccaagctacttgaccggtgagtttcctggtgattacggatgggacact 451

                                                                       
Query: 258 gctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccat 317
           |||||||| || |||||||| || || ||||| |||||||| ||| | ||||| || |||
Sbjct: 452 gctggactttcagctgaccctgaaacattcgctaagaaccgtgagttggaggttattcat 511

                                                                       
Query: 318 tgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaac 377
           ||  | |||||||||||||| || || || ||||| |||||||||||  | ||||| || 
Sbjct: 512 tgtagatgggccatgcttggtgctcttggatgtgtattccccgagcttttggcccgtaat 571

                                                                       
Query: 378 ggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggt 437
           ||||||||||||||||| ||||| ||||||||||||||||| || || ||||||||||||
Sbjct: 572 ggtgttaagttcggtgaagctgtatggttcaaggctggatcacaaattttcagcgagggt 631

                                                                       
Query: 438 ggccttgactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgg 497
           || ||||||||| | || ||||||||| | || || || || || ||  | || || |||
Sbjct: 632 ggacttgactacttgggaaacccaagcttggtccatgcacaaagcattttggctatctgg 691

                                                                       
Query: 498 gcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggtggaccactt 557
           ||||| || |||||| | ||||| ||||||||||||||||| ||||||||||| || |||
Sbjct: 692 gcttgccaagttgtgttgatgggagccgttgagggttaccgtattgctggtgggcctctt 751

                 
Query: 558 ggtgag 563
           ||||||
Sbjct: 752 ggtgag 757

---

>emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll a/b binding protein
          Length = 1361

 Score =  232 bits (117), Expect = 1e-57
 Identities = 340/413 (82%), Gaps = 1/413 (0%)
 Strand = Plus / Plus

                                                                       
Query: 189 ggcccactttctggtgagcccccgagctacctgaccggtgagttccccggtgactacggg 248
           |||||| | ||||| |||||||||  |||||| |||||||||||||| || |||||||| 
Sbjct: 419 ggcccattctctggcgagcccccgtcctacctaaccggtgagttcccaggcgactacggc 478

                                                                       
Query: 249 tgggacaccgctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgag 308
           |||||||| ||||| || || || |||||||| ||||||||||||||||| || ||||| 
Sbjct: 479 tgggacactgctgggctttccgcagacccagaaaccttcgccaagaaccgtgaactcgaa 538

                                                                       
Query: 309 gtgatccattgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctc 368
           |||||||| | | | ||||||||||| || ||  | || || |||||||| ||| |||| 
Sbjct: 539 gtgatccactccaggtgggccatgctcggagccttgggctgcgtcttcccggagttgctg 598

                                                                       
Query: 369 gcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttc 428
            |||||||||| || |||||||| || || || ||||||||||| || || |||||||||
Sbjct: 599 tcccgcaacggggtgaagttcggagaagccgtgtggttcaaggccgggtcccagatcttc 658

                                                                       
Query: 429 agcgagggtggccttgactacctcggcaacccaagccttgtgcacgcccagagtatcctt 488
           ||||||||||| || |||||| | ||||||||||||||  | ||||||||||| ||||| 
Sbjct: 659 agcgagggtgggctcgactacttgggcaacccaagcctgatccacgcccagagcatcctc 718

                                                                       
Query: 489 gccatttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggt 548
           ||||| |||||    || ||| | || |||||||||||||| |||||||| |||||||||
Sbjct: 719 gccatctgggccacacaagttatcctaatgggtgccgttgaaggttaccgtattgctggt 778

                                                                
Query: 549 ggaccacttggtgagatcgtcgacccattataccccgggtggcagcttcgacc 601
           || || || |||||| ||   |||||| | || ||| ||||||||||||||||
Sbjct: 779 ggccccctcggtgaggtcactgacccaatcta-cccaggtggcagcttcgacc 830

---

>gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB2) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1027

 Score =  232 bits (117), Expect = 1e-57
 Identities = 291/349 (83%)
 Strand = Plus / Plus

                                                                       
Query: 215 ctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctga 274
           |||||| |||||||| || |||||||||||||| |||||||| ||||| || ||||||||
Sbjct: 219 ctaccttaccggtgaatttcccggtgactacggctgggacactgctgggctttcggctga 278

                                                                       
Query: 275 cccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgct 334
           ||| ||||| ||  | |||||||| |||||||||||||| |||||||| ||||| ||| |
Sbjct: 279 ccctgagacttttactaagaaccgtgagctcgaggtgattcattgccgatgggctatgtt 338

                                                                       
Query: 335 tggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtga 394
            || || || || ||||||||||| || ||  | || ||||||||||| ||||| |||||
Sbjct: 339 gggtgctctaggatgtgtcttcccagaactcttggctcgcaacggtgtcaagtttggtga 398

                                                                       
Query: 395 ggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcgg 454
           |||||| ||||||||||| ||| | |||||||| ||||||||||| ||||| ||| | ||
Sbjct: 399 ggctgtctggttcaaggccggagcccagatctttagcgagggtgggcttgattacttggg 458

                                                                       
Query: 455 caacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgct 514
           |||||||||  | || ||||| || || ||||| ||||| ||||||||||| ||| |  |
Sbjct: 459 caacccaagtttggtccacgctcaaagcatcctcgccatctgggcttgtcaagttatctt 518

                                                            
Query: 515 catgggtgccgttgagggttaccgcattgctggtggaccacttggtgag 563
            ||||||||| ||||||| |||||  |||||||||| ||||||||||||
Sbjct: 519 gatgggtgccattgagggctaccgtgttgctggtgggccacttggtgag 567

---

>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor
          Length = 2780

 Score =  230 bits (116), Expect = 4e-57
 Identities = 275/328 (83%)
 Strand = Plus / Plus

                                                                        
Query: 210  ccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcg 269
            ||||||||||||||||| ||||||||||| |||||||||||||||||||  || ||||||
Sbjct: 2119 ccgagctacctgaccggcgagttccccggcgactacgggtgggacaccgaggggctgtcg 2178

                                                                        
Query: 270  gctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcc 329
            || ||||| |||||||||||||||||||| ||||| ||||||||||| ||||| ||||||
Sbjct: 2179 gcggacccggagaccttcgccaagaaccgcgagctggaggtgatccactgccgctgggcc 2238

                                                                        
Query: 330  atgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttc 389
            ||    |  | |||||| || || ||||| |||||||||||||||||||| || ||||||
Sbjct: 2239 atcgcggtagggctcgggtgcgtgttcccggagctgctcgcccgcaacggcgtcaagttc 2298

                                                                        
Query: 390  ggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactac 449
            || ||||  || ||||||||||| || || ||||||||||||||||| || ||     | 
Sbjct: 2299 ggcgagggggtgtggttcaaggcgggctcccagatcttcagcgagggcgggctcagtcat 2358

                                                                        
Query: 450  ctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggtt 509
            | ||||||||| |||||||| ||||| ||||| ||||| || || ||||| || ||||| 
Sbjct: 2359 cccggcaacccgagccttgtccacgcgcagagcatcctggctatctgggcgtgccaggtg 2418

                                        
Query: 510  gtgctcatgggtgccgttgagggttacc 537
            ||||||||||| ||||| ||||| ||||
Sbjct: 2419 gtgctcatgggcgccgtcgaggggtacc 2446

---

>emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b binding protein
          Length = 1656

 Score =  230 bits (116), Expect = 4e-57
 Identities = 287/344 (83%)
 Strand = Plus / Plus

                                                                        
Query: 220  tgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgacccag 279
            |||| ||||||||||| ||||| || ||||||||||| |||||||| || ||||| ||||
Sbjct: 713  tgactggtgagttccctggtgattatgggtgggacactgctggactttcagctgatccag 772

                                                                        
Query: 280  agaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgcttggcg 339
            | || || || |||||||| ||||| |||||||| || ||  | ||||| |||||||| |
Sbjct: 773  aaacttttgctaagaaccgtgagctagaggtgattcactgtagatgggctatgcttggag 832

                                                                        
Query: 340  cgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgaggctg 399
            | |||||||||||||||||||| ||  | || || || ||||| ||||||||||| ||||
Sbjct: 833  ctctcggttgtgtcttccccgaactcttggctcgtaatggtgtcaagttcggtgaagctg 892

                                                                        
Query: 400  tttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggcaacc 459
            | |||||||||||||||||||| || |||||||||||||| ||||||||| | |||||||
Sbjct: 893  tctggttcaaggctggatctcaaattttcagcgagggtggacttgactacttgggcaacc 952

                                                                        
Query: 460  caagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctcatgg 519
            ||||  | || || || || || ||| | |||||||||||||| || |||||| | ||||
Sbjct: 953  caagtttggtccatgcacaaagcatcttggccatttgggcttgccaagttgtgttgatgg 1012

                                                        
Query: 520  gtgccgttgagggttaccgcattgctggtggaccacttggtgag 563
            | ||  |||||||||||||  ||||||||||||| |||||||||
Sbjct: 1013 gagctattgagggttaccgtgttgctggtggacctcttggtgag 1056

---

>gb|M21397.1|TOBCABA Tobacco chlorophyll a/b-binding protein (Cab-C) gene, complete cds
          Length = 1240

 Score =  230 bits (116), Expect = 4e-57
 Identities = 333/404 (82%), Gaps = 1/404 (0%)
 Strand = Plus / Plus

                                                                        
Query: 198  tctggtgagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacacc 257
            ||||||||| | || |||||| |||| ||||||||||| |||||||| || ||||| || 
Sbjct: 626  tctggtgagtctccaagctacttgactggtgagttccctggtgactatggatgggatact 685

                                                                        
Query: 258  gctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccat 317
            |||||||| || ||||| || || || || ||||||||||| ||| | ||||||||||| 
Sbjct: 686  gctggactttcagctgatcctgaaacttttgccaagaaccgtgagttggaggtgatccac 745

                                                                        
Query: 318  tgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaac 377
            ||  | |||||||||||||| || || ||||||||||| ||||||||  | ||||| || 
Sbjct: 746  tgtagatgggccatgcttggagctcttggttgtgtctttcccgagctcttggcccgtaat 805

                                                                        
Query: 378  ggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggt 437
            ||||||||||||||||||||||| |||||||||| |||||| || || |||||| |||||
Sbjct: 806  ggtgttaagttcggtgaggctgtatggttcaagggtggatcccaaattttcagccagggt 865

                                                                        
Query: 438  ggccttgactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgg 497
            || ||||||||| | |||||||||||  | || || || || || ||  | |||||||||
Sbjct: 866  ggacttgactacttgggcaacccaagtttggtccatgctcaaagcatattggccatttgg 925

                                                                        
Query: 498  gcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggtggaccactt 557
            |||||||| |||||| | ||||| |||||||||||||| ||  ||||||||| ||| || 
Sbjct: 926  gcttgtcaagttgtgttgatgggagccgttgagggttatcgtgttgctggtgaacctctc 985

                                                        
Query: 558  ggtgagatcgtcgacccattataccccgggtggcagcttcgacc 601
            |||||| | || |||||| | || ||| ||||| ||||||||||
Sbjct: 986  ggtgaggttgttgacccacttta-ccctggtggtagcttcgacc 1028

---

>dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3386

 Score =  230 bits (116), Expect = 4e-57
 Identities = 314/380 (82%)
 Strand = Plus / Plus

                                                                        
Query: 159  tggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccccgagctac 218
            ||||||||| ||||||| |||   ||| | |||||| | ||||||||| |||| ||||||
Sbjct: 1601 tggtacggccctgaccgtgtcaagtacttgggcccattctctggtgagtccccaagctac 1660

                                                                        
Query: 219  ctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgaccca 278
             |||| ||||||||||| ||||| || || |||||||| |||||||| || ||||| |||
Sbjct: 1661 ttgacgggtgagttccctggtgattatggatgggacactgctggactttcagctgatcca 1720

                                                                        
Query: 279  gagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgcttggc 338
            || || || || |||||||| ||| | ||||||||||||||| | |||||||||||||| 
Sbjct: 1721 gaaacttttgctaagaaccgtgagttggaggtgatccattgcagatgggccatgcttgga 1780

                                                                        
Query: 339  gcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgaggct 398
            || || ||||||||||||||||| ||  | || || ||||| || |||||||||||||||
Sbjct: 1781 gctcttggttgtgtcttccccgaactcttggctcgtaacggagtcaagttcggtgaggct 1840

                                                                        
Query: 399  gtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggcaac 458
            || ||||||||||||||||| ||||| |||||||| ||||| ||||||||| | ||||||
Sbjct: 1841 gtatggttcaaggctggatcccagattttcagcgaaggtggacttgactacttgggcaac 1900

                                                                        
Query: 459  ccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctcatg 518
            |||||  | || || || || || ||  | |||||||||||||| || |||||  | |||
Sbjct: 1901 ccaagtttggtccatgcacaaagcattttggccatttgggcttgccaagttgtcttgatg 1960

                                
Query: 519  ggtgccgttgagggttaccg 538
            || |||||||| ||||||||
Sbjct: 1961 ggagccgttgaaggttaccg 1980

---

>dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3102

 Score =  230 bits (116), Expect = 4e-57
 Identities = 287/344 (83%)
 Strand = Plus / Plus

                                                                        
Query: 220  tgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgacccag 279
            |||| ||||||||||| ||||| || ||||||||||| |||||||| || ||||| ||||
Sbjct: 2116 tgactggtgagttccctggtgattatgggtgggacactgctggactttcagctgatccag 2175

                                                                        
Query: 280  agaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgcttggcg 339
            | || || || |||||||| ||||| |||||||| || ||  | ||||| |||||||| |
Sbjct: 2176 aaacttttgctaagaaccgtgagctagaggtgattcactgtagatgggctatgcttggag 2235

                                                                        
Query: 340  cgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgaggctg 399
            | |||||||||||||||||||| ||  | || || || ||||| ||||||||||| ||||
Sbjct: 2236 ctctcggttgtgtcttccccgaactcttggctcgtaatggtgtcaagttcggtgaagctg 2295

                                                                        
Query: 400  tttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggcaacc 459
            | |||||||||||||||||||| || |||||||||||||| ||||||||| | |||||||
Sbjct: 2296 tctggttcaaggctggatctcaaattttcagcgagggtggacttgactacttgggcaacc 2355

                                                                        
Query: 460  caagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctcatgg 519
            ||||  | || || || || || ||| | |||||||||||||| || |||||| | ||||
Sbjct: 2356 caagtttggtccatgcacaaagcatcttggccatttgggcttgccaagttgtgttgatgg 2415

                                                        
Query: 520  gtgccgttgagggttaccgcattgctggtggaccacttggtgag 563
            | ||  |||||||||||||  ||||||||||||| |||||||||
Sbjct: 2416 gagctattgagggttaccgtgttgctggtggacctcttggtgag 2459

---

>gb|AY198376.1| Citrus limon chlorophyll a/b-binding protein precursor, gene,
           partial cds; nuclear gene for chloroplast product
          Length = 647

 Score =  228 bits (115), Expect = 2e-56
 Identities = 298/359 (83%)
 Strand = Plus / Plus

                                                                       
Query: 189 ggcccactttctggtgagcccccgagctacctgaccggtgagttccccggtgactacggg 248
           |||||| | ||||| |||||||| |||||| |||||||||||||||| || |||||||| 
Sbjct: 172 ggcccattctctggcgagcccccaagctacttgaccggtgagttccctggcgactacggt 231

                                                                       
Query: 249 tgggacaccgctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgag 308
           |||||||| || || || || ||||||||||| ||||| |||||||| || || ||||| 
Sbjct: 232 tgggacacagccgggctttcagctgacccagaaacctttgccaagaatcgtgaactcgaa 291

                                                                       
Query: 309 gtgatccattgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctc 368
           || ||||| ||| | ||||||||| | || || || || || |||||||| |||||  | 
Sbjct: 292 gtcatccactgcagatgggccatgttgggagctcttggatgcgtcttcccggagctcttg 351

                                                                       
Query: 369 gcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttc 428
           ||||||||||| || |||||||||||||| || ||||||||||| ||| |||||||||||
Sbjct: 352 gcccgcaacggagtcaagttcggtgaggccgtgtggttcaaggcgggagctcagatcttc 411

                                                                       
Query: 429 agcgagggtggccttgactacctcggcaacccaagccttgtgcacgcccagagtatcctt 488
           |||||||| || ||||||||| | || ||||||||| |  | ||||||||||| ||| | 
Sbjct: 412 agcgagggcgggcttgactacttgggaaacccaagcttgatccacgcccagagcatcttg 471

                                                                      
Query: 489 gccatttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctgg 547
           ||||| |||||||| ||||| ||  | ||||| ||||||||||||||| | ||||||||
Sbjct: 472 gccatctgggcttgccaggtggtcttgatgggagccgttgagggttacagaattgctgg 530

---

>gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast chlorophyll a/b binding
           protein mRNA, complete cds
          Length = 997

 Score =  226 bits (114), Expect = 7e-56
 Identities = 273/326 (83%)
 Strand = Plus / Plus

                                                                       
Query: 240 gactacgggtgggacaccgctggactgtcggctgacccagagaccttcgccaagaaccgg 299
           ||||||||||||||||| || || |||||||| ||||| ||||| ||||| |||||| | 
Sbjct: 299 gactacgggtgggacacggcggggctgtcggcggacccggagacgttcgcgaagaacaga 358

                                                                       
Query: 300 gagctcgaggtgatccattgccgttgggccatgcttggcgcgctcggttgtgtcttcccc 359
           ||||| ||||||||||| |  || ||||| ||| | || || || || || |||||||| 
Sbjct: 359 gagctggaggtgatccactcgcggtgggcgatgttgggagccctgggctgcgtcttcccg 418

                                                                       
Query: 360 gagctgctcgcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatct 419
           ||||||||| |||||||||| || |||||||| |||||||| ||||||||||| || |||
Sbjct: 419 gagctgctctcccgcaacggcgtcaagttcggcgaggctgtctggttcaaggcgggctct 478

                                                                       
Query: 420 cagatcttcagcgagggtggccttgactacctcggcaacccaagccttgtgcacgcccag 479
           |||||||||||||| || ||||| |||||||| ||||||||||||||  | |||||||||
Sbjct: 479 cagatcttcagcgacggcggcctcgactacctgggcaacccaagcctcatccacgcccag 538

                                                                       
Query: 480 agtatccttgccatttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgc 539
           || || || ||||| ||||| || |||||  | |||||||| ||||| ||||| ||||||
Sbjct: 539 agcattctcgccatctgggcctgccaggtcatcctcatgggagccgtcgagggctaccgc 598

                                     
Query: 540 attgctggtggaccacttggtgagat 565
           |||||||| || ||||| || |||||
Sbjct: 599 attgctggcggcccactcggcgagat 624

---

>gb|M16057.1|CUSLHCPA Cucumber LHCP mRNA encoding chlorophyll a/b-binding protein,
           partial cds
          Length = 878

 Score =  226 bits (114), Expect = 7e-56
 Identities = 333/406 (82%)
 Strand = Plus / Plus

                                                                       
Query: 151 gcagcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccc 210
           ||||||||||||| ||  ||||||| |||   ||| | |||||| | ||||||||||| |
Sbjct: 107 gcagcccgtggtatggtcctgaccgtgtcaagtacttgggcccattctctggtgagccac 166

                                                                       
Query: 211 cgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcgg 270
           |   |||||| ||||| |||||||| ||||||||||| |||||||| |||||||| || |
Sbjct: 167 catcctaccttaccggagagttccctggtgactacggttgggacactgctggactttcag 226

                                                                       
Query: 271 ctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcca 330
           |||| || |||||||||||||||||||| ||| | || |||||||| | | | |||||||
Sbjct: 227 ctgatcccgagaccttcgccaagaaccgtgagttggaagtgatccactccagatgggcca 286

                                                                       
Query: 331 tgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcg 390
           ||||||| ||  | || ||||| ||||| |||||  |  | || || ||||| ||||| |
Sbjct: 287 tgcttggagctttggggtgtgttttccctgagcttttgtctcgtaatggtgtgaagtttg 346

                                                                       
Query: 391 gtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacc 450
           |||| ||||| |||||||||||||| || ||||||||||||||||| || ||||||||| 
Sbjct: 347 gtgaagctgtgtggttcaaggctggttcgcagatcttcagcgagggcgggcttgactact 406

                                                                       
Query: 451 tcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttg 510
           | |||||||| ||| | || ||||| ||||| ||  | ||||| |||||||| || ||||
Sbjct: 407 tgggcaaccccagcttggtccacgctcagagcattttggccatctgggcttgccaagttg 466

                                                         
Query: 511 tgctcatgggtgccgttgagggttaccgcattgctggtggaccact 556
           || | ||||||||||| ||||||||||| ||||||||||| |||||
Sbjct: 467 tgttgatgggtgccgtcgagggttaccgtattgctggtggcccact 512

---

>gb|AY617096.1| Picea sitchensis chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 763

 Score =  218 bits (110), Expect = 2e-53
 Identities = 315/382 (82%), Gaps = 1/382 (0%)
 Strand = Plus / Plus

                                                                       
Query: 220 tgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgacccag 279
           |||||||||||||||| |||||||||||||||||||| || || || ||||| || || |
Sbjct: 226 tgaccggtgagttcccgggtgactacgggtgggacacggcggggctttcggcagatccgg 285

                                                                       
Query: 280 agaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgcttggcg 339
           |||| || ||||||||| | ||||| || ||||||||  |||| ||||| ||||| ||||
Sbjct: 286 agacgtttgccaagaacagagagctggaagtgatccacagccggtgggcaatgctgggcg 345

                                                                       
Query: 340 cgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgaggctg 399
           | || || || || ||||| ||||| || ||| | ||||| || |||||||| ||||| |
Sbjct: 346 ctctgggctgcgttttcccggagctcctggccagaaacggagtcaagttcggggaggcgg 405

                                                                       
Query: 400 tttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggcaacc 459
           | ||||||||||| ||| ||||||||||||||||||| |||||||||||||| || ||||
Sbjct: 406 tgtggttcaaggcgggagctcagatcttcagcgagggaggccttgactacctgggaaacc 465

                                                                       
Query: 460 caagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctcatgg 519
           | ||| | || ||||||||||| |||||||| || ||||| || |||||  | |||||||
Sbjct: 466 ctagcttggttcacgcccagagcatccttgcaatctgggcatgccaggtcattctcatgg 525

                                                                       
Query: 520 gtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgacccattat 579
           | ||||| ||||| ||||| ||||| ||||| || || || ||||||   |||||  | |
Sbjct: 526 gcgccgtggagggctaccgtattgcaggtggccctctcggagagatcactgaccccatct 585

                                 
Query: 580 accccgggtggcagcttcgacc 601
           |||||||| |||||||||||||
Sbjct: 586 accccggg-ggcagcttcgacc 606

---

>gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB)
           mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1042

 Score =  216 bits (109), Expect = 6e-53
 Identities = 250/297 (84%)
 Strand = Plus / Plus

                                                                       
Query: 215 ctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctga 274
           |||||| || ||||| ||||| |||||||||||||||||||| |||||||| || |||||
Sbjct: 231 ctacctcactggtgaattccctggtgactacgggtgggacactgctggactctctgctga 290

                                                                       
Query: 275 cccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgct 334
           |||||||||||| || |||||||| || || ||||||||||| ||| | ||||| ||| |
Sbjct: 291 cccagagacctttgctaagaaccgcgaacttgaggtgatccactgcagatgggctatgtt 350

                                                                       
Query: 335 tggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtga 394
            || || || || ||||||||||| |||||  | || ||||||||||| |||||||||||
Sbjct: 351 gggtgctctgggatgtgtcttcccagagctcttggctcgcaacggtgtcaagttcggtga 410

                                                                       
Query: 395 ggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcgg 454
           ||| || ||||||||||| ||  | || |||||||| |||||||||||||||||| | ||
Sbjct: 411 ggccgtatggttcaaggccggtgcacaaatcttcagtgagggtggccttgactacttggg 470

                                                                    
Query: 455 caacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgt 511
           |||||||||| | || || || ||||| ||||| ||||| |||||||| ||||||||
Sbjct: 471 caacccaagcttggtccatgctcagagcatcctagccatctgggcttgccaggttgt 527

---

>dbj|AB012636.1| Nicotiana sylvestris Lhcb1*1 gene for light harvesting chlorophyll
           a/b-binding protein, complete cds
          Length = 3659

 Score =  216 bits (109), Expect = 6e-53
 Identities = 320/389 (82%), Gaps = 1/389 (0%)
 Strand = Plus / Plus

                                                                       
Query: 213 agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
           |||||| ||||| |||| ||||| ||||| || |||||||| || |||||||| || || 
Sbjct: 335 agctacttgaccagtgaattccctggtgattatgggtgggatactgctggactttcagca 394

                                                                       
Query: 273 gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
           || ||||| ||||| ||||||||||| || |||||||||||||| ||| | ||||| |||
Sbjct: 395 gatccagaaacctttgccaagaaccgtgaactcgaggtgatccactgcagatgggctatg 454

                                                                       
Query: 333 cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
           ||||| || || || ||||||||||| |||||  | || || |||||||| ||||| || 
Sbjct: 455 cttggtgctcttggatgtgtcttccctgagctcttggctcgtaacggtgtcaagtttggc 514

                                                                       
Query: 393 gaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctc 452
           || ||||| ||||||||||||||||| || ||||| ||||||||||| ||||||||| | 
Sbjct: 515 gaagctgtctggttcaaggctggatcccaaatctttagcgagggtggacttgactacttg 574

                                                                       
Query: 453 ggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtg 512
           |||||||||||| | || || || || || ||| | ||||| |||||||| || ||| | 
Sbjct: 575 ggcaacccaagcttggtccatgcacaaagcatcttggccatctgggcttgccaagttatc 634

                                                                       
Query: 513 ctcatgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgac 572
            | ||||| |||||||||||||||||  |||||||||| || ||||||||| | ||||||
Sbjct: 635 ttgatgggagccgttgagggttaccgtgttgctggtgggcctcttggtgaggttgtcgac 694

                                        
Query: 573 ccattataccccgggtggcagcttcgacc 601
           ||| | || ||| ||||||||||| ||||
Sbjct: 695 ccactcta-ccctggtggcagctttgacc 722

---

>emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/b binding protein
          Length = 964

 Score =  214 bits (108), Expect = 3e-52
 Identities = 331/404 (81%), Gaps = 1/404 (0%)
 Strand = Plus / Plus

                                                                       
Query: 198 tctggtgagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacacc 257
           ||||||||| | || || ||| |||| ||||| ||||| |||||||| || |||||||| 
Sbjct: 257 tctggtgagtctccaagttacttgacgggtgaattccctggtgactatggatgggacact 316

                                                                       
Query: 258 gctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccat 317
           |||||||| || ||||| ||||| || || |||||||| || ||| | ||||||||||| 
Sbjct: 317 gctggactttcagctgatccagaaacttttgccaagaatcgtgagttggaggtgatccac 376

                                                                       
Query: 318 tgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaac 377
           ||| | ||||| |||||||| || || ||||||||||||||||||||  | ||||| |||
Sbjct: 377 tgcagatgggctatgcttggagctcttggttgtgtcttccccgagctcttggcccgtaac 436

                                                                       
Query: 378 ggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggt 437
           || || ||||| ||||| || || ||||||||||||||||| || || || |||||||||
Sbjct: 437 ggggtcaagtttggtgaagcagtatggttcaaggctggatcccaaatttttagcgagggt 496

                                                                       
Query: 438 ggccttgactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgg 497
           || ||||||||| | |||||||||||  | || ||||| || || ||| | |||||||||
Sbjct: 497 ggacttgactacttgggcaacccaagtttggttcacgcacaaagcatcttggccatttgg 556

                                                                       
Query: 498 gcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggtggaccactt 557
           ||||| || |||||| | ||||| || || || ||||||||  |||||||||| || |||
Sbjct: 557 gcttgccaagttgtgttgatgggagctgtcgaaggttaccgtgttgctggtggccctctt 616

                                                       
Query: 558 ggtgagatcgtcgacccattataccccgggtggcagcttcgacc 601
           |||||| | ||||||||  | |||||| ||||||||||| ||||
Sbjct: 617 ggtgaggttgtcgacccgctctacccc-ggtggcagctttgacc 659

---

>gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding protein of LHCII type I
           precursor (CAB) mRNA, nuclear gene encoding chloroplast
           protein, complete cds
          Length = 1015

 Score =  214 bits (108), Expect = 3e-52
 Identities = 288/348 (82%)
 Strand = Plus / Plus

                                                                       
Query: 216 tacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgac 275
           ||||| || |||||||| || ||||| ||||| |||||||| ||||| || || ||||| 
Sbjct: 228 tacctcactggtgagtttccaggtgattacggttgggacactgctggcctttctgctgat 287

                                                                       
Query: 276 ccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgctt 335
           || ||||| |||||||||||||| ||||| |||||||| ||  || | ||||||||||||
Sbjct: 288 cccgagacattcgccaagaaccgtgagcttgaggtgattcacagcagatgggccatgctt 347

                                                                       
Query: 336 ggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgag 395
           || || || || |||||||||||||||||  | || || |||||||| || |||||||||
Sbjct: 348 ggagcccttggatgtgtcttccccgagctcttggctcgtaacggtgtcaaattcggtgag 407

                                                                       
Query: 396 gctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggc 455
           || || ||||||||||| ||||| || ||||||||||| ||||| ||||||||| | |||
Sbjct: 408 gccgtgtggttcaaggccggatcccaaatcttcagcgaaggtgggcttgactacttgggc 467

                                                                       
Query: 456 aacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctc 515
           ||||||||| | || || |||||||| ||| | ||||| ||||||   || ||| |  | 
Sbjct: 468 aacccaagcttggtccatgcccagagcatcttggccatatgggctacccaagttatctta 527

                                                           
Query: 516 atgggtgccgttgagggttaccgcattgctggtggaccacttggtgag 563
           |||||||||||||||||||| |||||||| ||||| ||||| ||||||
Sbjct: 528 atgggtgccgttgagggttatcgcattgcaggtgggccactaggtgag 575

---

>emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll a/b binding protein
          Length = 980

 Score =  214 bits (108), Expect = 3e-52
 Identities = 288/348 (82%)
 Strand = Plus / Plus

                                                                       
Query: 216 tacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgac 275
           ||||| |||||||||||||| ||||||||||| |||||||| ||||| || || ||||||
Sbjct: 257 tacctcaccggtgagttccctggtgactacggttgggacactgctgggctttcagctgac 316

                                                                       
Query: 276 ccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgctt 335
           ||||| |||||||| |||||||| ||||| || || ||||| ||| | ||||| ||| | 
Sbjct: 317 ccagaaaccttcgctaagaaccgtgagcttgaagttatccactgcaggtgggctatgttg 376

                                                                       
Query: 336 ggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgag 395
           || ||  | |||||||| ||||| |||||  | ||||| || ||||||||||||||||||
Sbjct: 377 ggagcattgggttgtgttttcccagagctcttggcccgtaatggtgttaagttcggtgag 436

                                                                       
Query: 396 gctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggc 455
           || |||||||| ||||| || || || ||||| ||||||||||| ||||||||| | || 
Sbjct: 437 gccgtttggtttaaggcgggttcacaaatctttagcgagggtgggcttgactacttgggt 496

                                                                       
Query: 456 aacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctc 515
           ||||||||  | || || || || ||||||||||| |||||||| ||||| ||| |  | 
Sbjct: 497 aacccaagtttggtccatgctcaaagtatccttgctatttgggcctgtcaagttatcttg 556

                                                           
Query: 516 atgggtgccgttgagggttaccgcattgctggtggaccacttggtgag 563
           |||||||| |||||||| ||||| ||||||||||| || |||||||||
Sbjct: 557 atgggtgctgttgaggggtaccgtattgctggtgggcctcttggtgag 604

---

>gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein (cab3) mRNA, nuclear
           gene encoding chloroplast protein, complete cds
          Length = 977

 Score =  212 bits (107), Expect = 1e-51
 Identities = 308/375 (82%)
 Strand = Plus / Plus

                                                                       
Query: 189 ggcccactttctggtgagcccccgagctacctgaccggtgagttccccggtgactacggg 248
           |||||| | ||||| |||||||||  |||||| || || |||||||| ||||||||||| 
Sbjct: 200 ggcccattctctggcgagcccccgtcctacctcactggcgagttcccaggtgactacggc 259

                                                                       
Query: 249 tgggacaccgctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgag 308
           |||||||| ||||| || ||||| |||||||| ||||||||||  ||||  |||||||| 
Sbjct: 260 tgggacactgctgggctttcggccgacccagaaaccttcgccagaaaccctgagctcgaa 319

                                                                       
Query: 309 gtgatccattgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctc 368
           |||||||| | | | ||||||||||| || ||  | || || ||||||||||| ||  | 
Sbjct: 320 gtgatccactccaggtgggccatgctcggggccttgggctgcgtcttccccgaactattg 379

                                                                       
Query: 369 gcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttc 428
            |||||||||| || ||||| || || ||||| ||||||||||| || || |||||||||
Sbjct: 380 tcccgcaacggggtcaagtttggagaagctgtgtggttcaaggccgggtcccagatcttc 439

                                                                       
Query: 429 agcgagggtggccttgactacctcggcaacccaagccttgtgcacgcccagagtatcctt 488
           ||||||||||| || |||||| | ||||||||||||||||| ||||||||||| ||||| 
Sbjct: 440 agcgagggtgggctggactacttgggcaacccaagccttgtccacgcccagagcatcctc 499

                                                                       
Query: 489 gccatttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggt 548
           ||||| |||||    || ||| | || |||||||| ||||||||||| || |||||||||
Sbjct: 500 gccatctgggccacccaagttatcctaatgggtgctgttgagggttatcgtattgctggt 559

                          
Query: 549 ggaccacttggtgag 563
           || || || ||||||
Sbjct: 560 gggcccctcggtgag 574

---

>emb|X02360.1|PECAB22R Petunia gene for chlorophyll a/b binding protein cab 22R
          Length = 1187

 Score =  210 bits (106), Expect = 4e-51
 Identities = 301/366 (82%)
 Strand = Plus / Plus

                                                                       
Query: 198 tctggtgagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacacc 257
           ||||||||| | || |||||| |||| |||||||||||  ||||||| || ||||| || 
Sbjct: 420 tctggtgaggcaccaagctacttgactggtgagttccctagtgactatggatgggatact 479

                                                                       
Query: 258 gctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccat 317
           |||||||| |||||||| || || || || ||||||||||| ||||| ||||| ||||| 
Sbjct: 480 gctggactttcggctgatcctgaaacttttgccaagaaccgtgagctggaggtcatccac 539

                                                                       
Query: 318 tgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaac 377
           ||  | |||||||||||||| || || |||||||||||||| || ||  | ||||| || 
Sbjct: 540 tgtagatgggccatgcttggagctcttggttgtgtcttccctgaactctttgcccgtaat 599

                                                                       
Query: 378 ggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggt 437
           ||| | || |||||||||||||| ||||||||||||||| |||| || ||||| ||||||
Sbjct: 600 ggtatcaaattcggtgaggctgtatggttcaaggctggagctcaaattttcagtgagggt 659

                                                                       
Query: 438 ggccttgactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgg 497
           || ||||||||| | |||||||||||  | || ||||| || || ||| | |||||||||
Sbjct: 660 ggacttgactacttgggcaacccaagtttggttcacgcacaaagcatcttggccatttgg 719

                                                                       
Query: 498 gcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggtggaccactt 557
           ||||| || || ||| | ||||| || ||||||||||||||  ||||||||||||| || 
Sbjct: 720 gcttgccaagtcgtgttgatgggagctgttgagggttaccgtgttgctggtggacctctc 779

                 
Query: 558 ggtgag 563
           ||||||
Sbjct: 780 ggtgag 785

---

>emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1050

 Score =  210 bits (106), Expect = 4e-51
 Identities = 314/382 (82%), Gaps = 1/382 (0%)
 Strand = Plus / Plus

                                                                       
Query: 220 tgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgacccag 279
           |||||||||||||||| |||||||||||||||||||| || || || ||||| || || |
Sbjct: 260 tgaccggtgagttcccgggtgactacgggtgggacacggcggggctttcggcagatccgg 319

                                                                       
Query: 280 agaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgcttggcg 339
           |||| || ||||||||| | ||||| || ||||||||  |||| ||||| ||||| ||||
Sbjct: 320 agacgtttgccaagaacagagagctggaagtgatccacagccggtgggcaatgctgggcg 379

                                                                       
Query: 340 cgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgaggctg 399
           | || || || || ||||| ||||| || ||| | ||||| || |||||||| ||||| |
Sbjct: 380 ctctgggctgcgttttcccggagctcctggccagaaacggagtcaagttcggggaggcgg 439

                                                                       
Query: 400 tttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggcaacc 459
           | ||||||||||| ||| ||||||||||||||||||| |||||||||||||| || ||||
Sbjct: 440 tgtggttcaaggcgggagctcagatcttcagcgagggaggccttgactacctgggaaacc 499

                                                                       
Query: 460 caagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctcatgg 519
           | ||| |  | ||||||||||| |||||||| || ||||| || |||||  | |||||||
Sbjct: 500 ctagcttgattcacgcccagagcatccttgcaatctgggcatgccaggtcattctcatgg 559

                                                                       
Query: 520 gtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgacccattat 579
           | ||||| ||||| ||||| ||||| ||||| || || || ||||||   |||||  | |
Sbjct: 560 gcgccgtggagggctaccgtattgcaggtggccctctcggagagatcactgaccccatct 619

                                 
Query: 580 accccgggtggcagcttcgacc 601
           |||||||| |||||||||||||
Sbjct: 620 accccggg-ggcagcttcgacc 640

---

>emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1062

 Score =  210 bits (106), Expect = 4e-51
 Identities = 314/382 (82%), Gaps = 1/382 (0%)
 Strand = Plus / Plus

                                                                       
Query: 220 tgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgacccag 279
           |||||||||||||||| |||||||||||||||||||| || || || ||||| || || |
Sbjct: 257 tgaccggtgagttcccgggtgactacgggtgggacacggcggggctttcggcagatccgg 316

                                                                       
Query: 280 agaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgcttggcg 339
           |||| || ||||||||| | ||||| || ||||||||  |||| ||||| ||||| ||||
Sbjct: 317 agacgtttgccaagaacagagagctggaagtgatccacagccggtgggcaatgctgggcg 376

                                                                       
Query: 340 cgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgaggctg 399
           | || || || || ||||| ||||| || ||| | ||||| || |||||||| ||||| |
Sbjct: 377 ctctgggctgcgttttcccggagctcctggccagaaacggagtcaagttcggggaggcgg 436

                                                                       
Query: 400 tttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggcaacc 459
           | ||||||||||| ||| ||||||||||||||||||| |||||||||||||| || ||||
Sbjct: 437 tgtggttcaaggcgggagctcagatcttcagcgagggaggccttgactacctgggaaacc 496

                                                                       
Query: 460 caagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctcatgg 519
           | ||| |  | ||||||||||| |||||||| || ||||| || |||||  | |||||||
Sbjct: 497 ctagcttgattcacgcccagagcatccttgcaatctgggcatgccaggtcattctcatgg 556

                                                                       
Query: 520 gtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgacccattat 579
           | ||||| ||||| ||||| ||||| ||||| || || || ||||||   |||||  | |
Sbjct: 557 gcgccgtggagggctaccgtattgcaggtggccctctcggagagatcactgaccccatct 616

                                 
Query: 580 accccgggtggcagcttcgacc 601
           |||||||| |||||||||||||
Sbjct: 617 accccggg-ggcagcttcgacc 637

---

>emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding protein cab 13
          Length = 1019

 Score =  208 bits (105), Expect = 2e-50
 Identities = 337/413 (81%), Gaps = 1/413 (0%)
 Strand = Plus / Plus

                                                                       
Query: 189 ggcccactttctggtgagcccccgagctacctgaccggtgagttccccggtgactacggg 248
           |||||| | ||||||||| |||| |||||| |||| ||||||||||| |||||||| || 
Sbjct: 299 ggcccattctctggtgaggccccaagctacttgactggtgagttccctggtgactatgga 358

                                                                       
Query: 249 tgggacaccgctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgag 308
           ||||| || |||||||| || || |||||||  || ||||||||||||||| | || |||
Sbjct: 359 tgggatactgctggactttcagccgacccagcaactttcgccaagaaccggaaactggag 418

                                                                       
Query: 309 gtgatccattgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctc 368
           || ||||| ||  | ||| |||||||||| || || ||||| |||||||| |||||  | 
Sbjct: 419 gtaatccactgtagatggaccatgcttggagctcttggttgcgtcttccctgagctcttt 478

                                                                       
Query: 369 gcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttc 428
           ||||| || ||||| ||||| ||||| ||||| |||||||||||||||||||| || |||
Sbjct: 479 gcccgtaatggtgtcaagtttggtgaagctgtatggttcaaggctggatctcaaatattc 538

                                                                       
Query: 429 agcgagggtggccttgactacctcggcaacccaagccttgtgcacgcccagagtatcctt 488
           |  |||||||| ||||||||| | |||||||||||  | || ||||| || || ||| | 
Sbjct: 539 aaagagggtggacttgactacttgggcaacccaagtttggttcacgcacaaagcatcttg 598

                                                                       
Query: 489 gccatttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggt 548
           ||||| |||||||| || |||||| | ||||| || ||||||||||||||  ||||||||
Sbjct: 599 gccatctgggcttgccaagttgtgttgatgggagctgttgagggttaccgtgttgctggt 658

                                                                
Query: 549 ggaccacttggtgagatcgtcgacccattataccccgggtggcagcttcgacc 601
           || || || |||||| |  |||| ||| |||| ||| ||||| ||||||||||
Sbjct: 659 ggtcctctcggtgaggttatcgatccactata-ccctggtggtagcttcgacc 710

---

>gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding protein (CARCAB1) mRNA,
           complete cds
          Length = 983

 Score =  204 bits (103), Expect = 2e-49
 Identities = 322/395 (81%)
 Strand = Plus / Plus

                                                                       
Query: 189 ggcccactttctggtgagcccccgagctacctgaccggtgagttccccggtgactacggg 248
           |||||| | |||||||||||||||   ||| |||| || |||||||| ||||||||||| 
Sbjct: 229 ggcccattctctggtgagcccccgtcttacttgactggagagttcccaggtgactacgga 288

                                                                       
Query: 249 tgggacaccgctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgag 308
           |||||||| |||||||| || |||||||||||||| |||||||||||||| || || || 
Sbjct: 289 tgggacactgctggactttctgctgacccagagacattcgccaagaaccgtgaacttgaa 348

                                                                       
Query: 309 gtgatccattgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctc 368
           || |||||| || | ||||| ||| | || ||  | || ||||| ||||| |||||  | 
Sbjct: 349 gtcatccatagcaggtgggctatgttgggagccttgggatgtgttttcccagagcttttg 408

                                                                       
Query: 369 gcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttc 428
            | ||||| |||||||| |||||||| ||||| ||||||||||| ||||| |||||||| 
Sbjct: 409 tctcgcaatggtgttaaattcggtgaagctgtatggttcaaggccggatcccagatcttt 468

                                                                       
Query: 429 agcgagggtggccttgactacctcggcaacccaagccttgtgcacgcccagagtatcctt 488
           ||||||||||| ||||||||| | || ||||||||  | || || || ||||| || |||
Sbjct: 469 agcgagggtggacttgactacttgggtaacccaagtttggtccatgctcagagcattctt 528

                                                                       
Query: 489 gccatttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggt 548
           ||||| |||||   ||| ||| |  | ||||| |||||||| |||||||| |||||||||
Sbjct: 529 gccatctgggccactcaagttatcttgatgggagccgttgaaggttaccgtattgctggt 588

                                              
Query: 549 ggaccacttggtgagatcgtcgacccattataccc 583
           ||||| ||||||||| | || |||||| |||||||
Sbjct: 589 ggacctcttggtgaggttgttgacccactataccc 623

---

>gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB3) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1011

 Score =  204 bits (103), Expect = 2e-49
 Identities = 304/371 (81%)
 Strand = Plus / Plus

                                                                       
Query: 216 tacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgac 275
           ||||| || ||||| ||||| |||||||| || |||||||| ||||| || || ||||||
Sbjct: 264 tacctcactggtgaattccctggtgactatggttgggacactgctgggctctcagctgac 323

                                                                       
Query: 276 ccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgctt 335
           || ||||| || || |||||||| ||||| ||||||||||| ||  | ||||||||| | 
Sbjct: 324 cccgagacttttgctaagaaccgtgagcttgaggtgatccactgtaggtgggccatgtta 383

                                                                       
Query: 336 ggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgag 395
           || || || || ||||||||||| |||||  | |||||||||||||| || |||||||||
Sbjct: 384 ggagctctaggatgtgtcttcccagagctcttggcccgcaacggtgtcaaattcggtgag 443

                                                                       
Query: 396 gctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggc 455
           ||||||||||||||||||||| | || ||||| || |||||||| || |||||| | |||
Sbjct: 444 gctgtttggttcaaggctggagcccaaatctttagtgagggtggactcgactacttgggc 503

                                                                       
Query: 456 aacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctc 515
           ||||||||  | || ||||| || || ||||| ||||||||||| ||||| ||| |  | 
Sbjct: 504 aacccaagtttggtccacgctcaaagcatcctcgccatttgggcatgtcaagttatcttg 563

                                                                       
Query: 516 atgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgaccca 575
           ||||| ||| ||||||| |||||  |||| ||||| |||||||||||| |  ||||||||
Sbjct: 564 atgggcgccattgagggctaccgtgttgccggtgggccacttggtgaggtgatcgaccca 623

                      
Query: 576 ttataccccgg 586
            | ||||||||
Sbjct: 624 ctctaccccgg 634

---

>gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score =  202 bits (102), Expect = 1e-48
 Identities = 273/330 (82%)
 Strand = Plus / Plus

                                                                       
Query: 215 ctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctga 274
           |||| ||||||||||||||||||||||||||||||||||||| || || || ||||| ||
Sbjct: 221 ctacttgaccggtgagttccccggtgactacgggtgggacacggcggggctttcggcaga 280

                                                                       
Query: 275 cccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgct 334
            |||||||| || || |||||| | ||||| || |||||||| ||||| ||||| |||||
Sbjct: 281 tccagagacttttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 340

                                                                       
Query: 335 tggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtga 394
            ||||| || ||||| || ||||| ||||| || ||  | || || ||||||||||||||
Sbjct: 341 gggcgctctgggttgcgttttcccggagcttctggctagaaatggagttaagttcggtga 400

                                                                       
Query: 395 ggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcgg 454
           ||| || ||||||||||| ||| ||||||| ||||||||||| || ||||||||||| ||
Sbjct: 401 ggccgtgtggttcaaggcgggagctcagattttcagcgagggagggcttgactacctggg 460

                                                                       
Query: 455 caacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgct 514
            ||||| ||| | || ||||| ||||| || ||||| || ||||| || |||||  | ||
Sbjct: 461 aaaccctagcttggttcacgcgcagagcattcttgcaatctgggcatgccaggtcatcct 520

                                         
Query: 515 catgggtgccgttgagggttaccgcattgc 544
           |||||| ||||| ||||| ||||| |||||
Sbjct: 521 catgggcgccgtggagggataccgtattgc 550

---

>gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score =  202 bits (102), Expect = 1e-48
 Identities = 273/330 (82%)
 Strand = Plus / Plus

                                                                       
Query: 215 ctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctga 274
           |||| ||||||||||||||||||||||||||||||||||||| || || || ||||| ||
Sbjct: 221 ctacttgaccggtgagttccccggtgactacgggtgggacacggcggggctttcggcaga 280

                                                                       
Query: 275 cccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgct 334
            |||||||| || || |||||| | ||||| || |||||||| ||||| ||||| |||||
Sbjct: 281 tccagagacttttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 340

                                                                       
Query: 335 tggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtga 394
            ||||| || ||||| || ||||| ||||| || ||  | || || ||||||||||||||
Sbjct: 341 gggcgctctgggttgcgttttcccggagcttctggcgagaaatggagttaagttcggtga 400

                                                                       
Query: 395 ggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcgg 454
           ||| || ||||||||||| ||| ||||||| ||||||||||| || ||||||||||| ||
Sbjct: 401 ggccgtgtggttcaaggcgggagctcagattttcagcgagggagggcttgactacctagg 460

                                                                       
Query: 455 caacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgct 514
            ||||| ||| | || ||||| ||||| || ||||| || ||||| || |||||  | ||
Sbjct: 461 aaaccctagcttggttcacgcgcagagcattcttgcaatctgggcatgccaggtcatcct 520

                                         
Query: 515 catgggtgccgttgagggttaccgcattgc 544
           |||||| ||||| ||||| ||||| |||||
Sbjct: 521 catgggcgccgtggagggataccgtattgc 550

---

>dbj|AB050125.1| Amaranthus tricolor cab1b mRNA for type I chlorophyll a/b-binding
           protein b, partial cds
          Length = 461

 Score =  202 bits (102), Expect = 1e-48
 Identities = 298/362 (82%), Gaps = 1/362 (0%)
 Strand = Plus / Plus

                                                                       
Query: 240 gactacgggtgggacaccgctggactgtcggctgacccagagaccttcgccaagaaccgg 299
           ||||||||||||||||| ||||| || || |||||||| || ||||| || |||||||| 
Sbjct: 1   gactacgggtgggacactgctgggctttcagctgacccggaaacctttgctaagaaccgt 60

                                                                       
Query: 300 gagctcgaggtgatccattgccgttgggccatgcttggcgcgctcggttgtgtcttcccc 359
           ||||| ||||| || || ||||| ||||||||| | || ||  | || ||||| || |||
Sbjct: 61  gagcttgaggtcattcactgccgatgggccatgttgggtgctttgggctgtgtttttccc 120

                                                                       
Query: 360 gagctgctcgcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatct 419
           |||||  | ||||| || ||||||||||| ||||| ||||||||||||||||| || || 
Sbjct: 121 gagctcttggcccgtaatggtgttaagtttggtgaagctgtttggttcaaggcgggctca 180

                                                                       
Query: 420 cagatcttcagcgagggtggccttgactacctcggcaacccaagccttgtgcacgcccag 479
           || |||||||| || ||||| ||||| ||| | || ||||||||| |  | || ||||| 
Sbjct: 181 caaatcttcagtgaaggtgggcttgattacttgggtaacccaagcttgatccatgcccaa 240

                                                                       
Query: 480 agtatccttgccatttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgc 539
           ||||||||||| |||||||||||||||||| | || |||||||| |||||||||||||| 
Sbjct: 241 agtatccttgctatttgggcttgtcaggttattctaatgggtgctgttgagggttaccgt 300

                                                                       
Query: 540 attgctggtggaccacttggtgagatcgtcgacccattataccccgggtggcagcttcga 599
           ||||||||||| || ||||| ||| | || |||||| | || ||||||||| ||||| ||
Sbjct: 301 attgctggtgggcctcttggagaggtggtggacccacttta-cccgggtggtagctttga 359

             
Query: 600 cc 601
           ||
Sbjct: 360 cc 361

---

>gb|AF220527.1|AF220527 Euphorbia esula chlorophyll a/b binding protein precursor, mRNA,
           complete cds
          Length = 927

 Score =  198 bits (100), Expect = 1e-47
 Identities = 292/356 (82%)
 Strand = Plus / Plus

                                                                       
Query: 201 ggtgagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgct 260
           ||||||||||| |||||| |||||||||| |||||||||||||| || |||||||| || 
Sbjct: 196 ggtgagcccccaagctacttgaccggtgaattccccggtgactatggctgggacactgcc 255

                                                                       
Query: 261 ggactgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgc 320
           ||||| || ||||||||||| ||||| ||||||||||| |||||||| |||||||| |  
Sbjct: 256 ggactctcagctgacccagaaacctttgccaagaaccgtgagctcgaagtgatccactca 315

                                                                       
Query: 321 cgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggt 380
            | ||||| |||||||| || || || ||||| ||||| |||||  | ||||| ||||||
Sbjct: 316 agatgggctatgcttggagctcttggatgtgttttcccggagctcttggcccggaacggt 375

                                                                       
Query: 381 gttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggc 440
           || || || || ||||| || ||||||||||| || |||||||| || || |||||||| 
Sbjct: 376 gtgaaatttggggaggcagtgtggttcaaggcagggtctcagatatttagtgagggtggt 435

                                                                       
Query: 441 cttgactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggct 500
           || |||||| | || ||||| ||| |  | ||||| || || ||  | || || ||||||
Sbjct: 436 ctagactacttgggaaacccgagcttgatccacgctcaaagcattttggcaatctgggct 495

                                                                   
Query: 501 tgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggtggaccact 556
           || ||||||||| | ||||||||||||||||||||| | ||||| |||||||||||
Sbjct: 496 tgccaggttgtgttgatgggtgccgttgagggttacagaattgcgggtggaccact 551

---

>gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 987

 Score =  196 bits (99), Expect = 6e-47
 Identities = 258/311 (82%)
 Strand = Plus / Plus

                                                                       
Query: 189 ggcccactttctggtgagcccccgagctacctgaccggtgagttccccggtgactacggg 248
           |||||| | |||||||||||||||   ||| |||| || |||||||| ||||||||||| 
Sbjct: 230 ggcccattctctggtgagcccccgtcttacttgactggagagttcccaggtgactacggt 289

                                                                       
Query: 249 tgggacaccgctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgag 308
           |||||||| |||||||| || |||||||||||||| |||||||||||||| ||||| || 
Sbjct: 290 tgggacactgctggactttctgctgacccagagacattcgccaagaaccgtgagcttgaa 349

                                                                       
Query: 309 gtgatccattgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctc 368
           || ||||| |   | ||||| ||| | || ||  | || ||||| ||||| |||||  | 
Sbjct: 350 gttatccactctagatgggctatgttaggagccttgggatgtgttttcccagagcttttg 409

                                                                       
Query: 369 gcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttc 428
            | |||||||||||||| ||||| |||||||||||||||||||| |||||||| ||||| 
Sbjct: 410 tctcgcaacggtgttaaattcggcgaggctgtttggttcaaggccggatctcaaatcttt 469

                                                                       
Query: 429 agcgagggtggccttgactacctcggcaacccaagccttgtgcacgcccagagtatcctt 488
           ||||||||||| ||||||||| | |||||||||||  | || ||||| || |||||||||
Sbjct: 470 agcgagggtggacttgactacttgggcaacccaagtttggtccacgctcaaagtatcctt 529

                      
Query: 489 gccatttgggc 499
           ||||| |||||
Sbjct: 530 gccatctgggc 540

---

>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA,
           complete cds
          Length = 998

 Score =  194 bits (98), Expect = 2e-46
 Identities = 272/330 (82%)
 Strand = Plus / Plus

                                                                       
Query: 215 ctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctga 274
           |||| ||||||||||||||||||||||||||||||||||||| || || || ||||| ||
Sbjct: 267 ctacttgaccggtgagttccccggtgactacgggtgggacacggcggggctttcggcaga 326

                                                                       
Query: 275 cccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgct 334
            |||||||| || || |||||| | ||||| || |||||||| ||||| ||||| |||||
Sbjct: 327 tccagagacttttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 386

                                                                       
Query: 335 tggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtga 394
            ||||| || ||||| || ||||| ||||| || ||  | || || || |||||||| ||
Sbjct: 387 gggcgctctgggttgcgttttcccggagcttctggcgagaaatggagtaaagttcgggga 446

                                                                       
Query: 395 ggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcgg 454
           ||| || ||||||||||| ||| ||||||| ||||||||||| || ||||||||||| ||
Sbjct: 447 ggccgtgtggttcaaggccggagctcagattttcagcgagggagggcttgactacctggg 506

                                                                       
Query: 455 caacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgct 514
            ||||| ||| | || ||||| ||||| || ||||| || ||||| || |||||| | ||
Sbjct: 507 aaaccctagcttggttcacgcgcagagcattcttgcaatctgggcatgccaggttatcct 566

                                         
Query: 515 catgggtgccgttgagggttaccgcattgc 544
           |||||| ||||| ||||| ||||| |||||
Sbjct: 567 catgggcgccgtggagggataccgtattgc 596

---

>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein
          Length = 1006

 Score =  194 bits (98), Expect = 2e-46
 Identities = 272/330 (82%)
 Strand = Plus / Plus

                                                                       
Query: 215 ctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctga 274
           |||| ||||||||||||||||||||||||||||||||||||| || || || ||||| ||
Sbjct: 276 ctacttgaccggtgagttccccggtgactacgggtgggacacggcggggctttcggcaga 335

                                                                       
Query: 275 cccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgct 334
            |||||||  || || |||||| | ||||| || |||||||| ||||| ||||| |||||
Sbjct: 336 tccagagaattttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 395

                                                                       
Query: 335 tggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtga 394
            ||||| || ||||| || ||||| ||||| || ||  | || || || |||||||||||
Sbjct: 396 gggcgctctgggttgcgttttcccggagcttctggcgagaaatggagtaaagttcggtga 455

                                                                       
Query: 395 ggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcgg 454
           ||| || ||||||||||| ||| ||||||| ||||||||||| || ||||||||||| ||
Sbjct: 456 ggccgtctggttcaaggcgggagctcagattttcagcgagggagggcttgactacctggg 515

                                                                       
Query: 455 caacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgct 514
            ||||| ||| | || ||||| ||||| || ||||| || ||||| || |||||| | ||
Sbjct: 516 aaaccctagcttggttcacgcgcagagcattcttgcaatctgggcatgccaggttatcct 575

                                         
Query: 515 catgggtgccgttgagggttaccgcattgc 544
           |||||| ||||| ||||| ||||| |||||
Sbjct: 576 catgggcgccgtggagggataccgtattgc 605

---

>gb|AY845253.1| Pisum sativum light-harvesting chlorophyll-a/b binding protein
           Lhcb1 mRNA, complete cds
          Length = 801

 Score =  192 bits (97), Expect = 9e-46
 Identities = 286/349 (81%)
 Strand = Plus / Plus

                                                                       
Query: 215 ctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctga 274
           |||| |||| || |||||||||||||||||||| |||||||| || ||||| || |||||
Sbjct: 204 ctacttgactggagagttccccggtgactacggttgggacactgccggactctctgctga 263

                                                                       
Query: 275 cccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgct 334
           ||||||||| ||| |||||||||| ||||| || || ||||| | | | ||||| ||| |
Sbjct: 264 cccagagacattctccaagaaccgtgagcttgaagtcatccactccagatgggctatgtt 323

                                                                       
Query: 335 tggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtga 394
            || ||  | || ||||||||||| |||||  |  | |||||||||||||| ||||||||
Sbjct: 324 gggtgctttgggatgtgtcttcccagagcttttgtctcgcaacggtgttaaattcggtga 383

                                                                       
Query: 395 ggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcgg 454
            ||||| ||||||||||| |||||||| ||||| ||||||||||| ||||||||| | ||
Sbjct: 384 agctgtatggttcaaggcaggatctcaaatctttagcgagggtggacttgactacttggg 443

                                                                       
Query: 455 caacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgct 514
           |||||||||| | || || || || || ||||||||||| |||||   ||||||| |  |
Sbjct: 444 caacccaagcttggtccatgctcaaagcatccttgccatctgggccactcaggttatctt 503

                                                            
Query: 515 catgggtgccgttgagggttaccgcattgctggtggaccacttggtgag 563
            ||||| || ||||| |||||||| ||||| ||||| || |||||||||
Sbjct: 504 gatgggagctgttgaaggttaccgtattgccggtggccctcttggtgag 552

---

>gb|AY617083.1| Pinus radiata chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score =  192 bits (97), Expect = 9e-46
 Identities = 268/325 (82%)
 Strand = Plus / Plus

                                                                       
Query: 220 tgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgacccag 279
           ||||||||||||||||||||||||||||||||||||| || || || ||||| || ||||
Sbjct: 226 tgaccggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccag 285

                                                                       
Query: 280 agaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgcttggcg 339
           |||| || || |||||| | ||||| || |||||||| ||||| ||||| ||||| ||||
Sbjct: 286 agacttttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgctgggcg 345

                                                                       
Query: 340 cgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgaggctg 399
           | || ||||| || ||||| ||||| || ||  | || || || |||||||||||||| |
Sbjct: 346 ctctgggttgcgttttcccggagcttctggcgagaaatggagtaaagttcggtgaggcag 405

                                                                       
Query: 400 tttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggcaacc 459
           | ||||||||||| ||| ||||||| ||||||||||| || ||||||||||| || ||||
Sbjct: 406 tgtggttcaaggcgggagctcagattttcagcgagggagggcttgactacctgggaaacc 465

                                                                       
Query: 460 caagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctcatgg 519
           | ||| | || ||||| ||||| || ||||| || ||||| || |||||  | |||||||
Sbjct: 466 ctagcttggttcacgcgcagagcattcttgcaatctgggcatgccaggtcatcctcatgg 525

                                    
Query: 520 gtgccgttgagggttaccgcattgc 544
           | ||||| ||||| ||||| |||||
Sbjct: 526 gcgccgtggagggctaccgtattgc 550

---

>gb|AY617081.1| Pinus echinata chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 762

 Score =  192 bits (97), Expect = 9e-46
 Identities = 268/325 (82%)
 Strand = Plus / Plus

                                                                       
Query: 220 tgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgacccag 279
           ||||||||||||||||||||||||||||||||||||| || || || ||||| || ||||
Sbjct: 226 tgaccggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccag 285

                                                                       
Query: 280 agaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgcttggcg 339
           |||| || || |||||| | ||||| || |||||||| ||||| ||||| ||||| ||||
Sbjct: 286 agacttttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgctgggcg 345

                                                                       
Query: 340 cgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgaggctg 399
           | || ||||| || ||||| ||||| || ||  | || || || |||||||||||||| |
Sbjct: 346 ctctgggttgcgttttcccggagcttctggcragaaatggagtaaagttcggtgaggcag 405

                                                                       
Query: 400 tttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggcaacc 459
           | ||||||||||| ||| ||||||| ||||||||||| || ||||||||||| || ||||
Sbjct: 406 tgtggttcaaggcgggagctcagattttcagcgagggagggcttgactacctgggaaacc 465

                                                                       
Query: 460 caagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctcatgg 519
           | ||| | || ||||| ||||| || ||||| || ||||| || |||||  | |||||||
Sbjct: 466 ctagcttggttcacgcgcagagcattcttgcaatctgggcatgccaggtcatcctcatgg 525

                                    
Query: 520 gtgccgttgagggttaccgcattgc 544
           | ||||| ||||| ||||| |||||
Sbjct: 526 gcgccgtggagggctaccgtattgc 550

---

>dbj|AB236867.1| Panax ginseng cab mRNA for chlorophyll a/b binding protein,
           complete cds
          Length = 935

 Score =  192 bits (97), Expect = 9e-46
 Identities = 253/305 (82%)
 Strand = Plus / Plus

                                                                       
Query: 216 tacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgac 275
           |||||||||||||| ||||| || ||||| ||||||||||| |||||||| || ||||||
Sbjct: 224 tacctgaccggtgaattccctggagactatgggtgggacactgctggactttcagctgac 283

                                                                       
Query: 276 ccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgctt 335
           |||||||| || ||||||||||| |||||||| ||||||||  || | ||||||||||||
Sbjct: 284 ccagagacatttgccaagaaccgtgagctcgaagtgatccacagcagatgggccatgctt 343

                                                                       
Query: 336 ggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgag 395
           || || || || ||||||||||| ||  | || ||  | || ||||| || ||||| |||
Sbjct: 344 ggtgcactaggctgtgtcttccctgaaattcttgcaaggaatggtgtcaaattcggcgag 403

                                                                       
Query: 396 gctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggc 455
           || |||||||||||||| ||| | || ||||||  ||| |||||||||||||| || |||
Sbjct: 404 gcagtttggttcaaggccggagcccaaatcttctccgaaggtggccttgactatcttggc 463

                                                                       
Query: 456 aacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctc 515
           ||||||| |||||| || |||||||| ||||| || || |||||  | || |||||||||
Sbjct: 464 aacccaaaccttgtccatgcccagagcatcctggctatctgggccagccaagttgtgctc 523

                
Query: 516 atggg 520
           |||||
Sbjct: 524 atggg 528

---

>gb|AY219853.1| Nicotiana tabacum chlorophyll a/b binding protein mRNA, complete
           cds
          Length = 946

 Score =  192 bits (97), Expect = 9e-46
 Identities = 253/305 (82%)
 Strand = Plus / Plus

                                                                       
Query: 216 tacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgac 275
           ||||| |||||||||||||| |||||||| || |||||||| |||||||| || ||||||
Sbjct: 261 tacctcaccggtgagttcccaggtgactatggttgggacactgctggactctcagctgac 320

                                                                       
Query: 276 ccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgctt 335
           |||||||| ||||| |  ||||| || || ||||||||||||||||||||||||||||||
Sbjct: 321 ccagagacattcgctagaaaccgtgaacttgaggtgatccattgccgttgggccatgctt 380

                                                                       
Query: 336 ggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgag 395
           || ||  | ||||||||||| |||||  | ||  |    || |||||||| |||||||| 
Sbjct: 381 ggtgctttgggttgtgtctttcccgaaatcctttcaaaaaatggtgttaaattcggtgaa 440

                                                                       
Query: 396 gctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggc 455
           ||||||||||||||||| ||| | || ||||||   || ||||| |||||||||||||||
Sbjct: 441 gctgtttggttcaaggcaggagcccaaatcttctcggaaggtggacttgactacctcggc 500

                                                                       
Query: 456 aacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctc 515
           ||||||| |||||| || ||||| || ||||| || |||||||| || || ||||| || 
Sbjct: 501 aacccaaaccttgtccatgcccaaagcatcctcgctatttgggcatgccaagttgtccta 560

                
Query: 516 atggg 520
           |||||
Sbjct: 561 atggg 565

---

>emb|X58230.1|NTCAB36 Tobacco CAB36 gene for chlorophyll a/b binding protein
          Length = 1986

 Score =  192 bits (97), Expect = 9e-46
 Identities = 250/301 (83%)
 Strand = Plus / Plus

                                                                        
Query: 220  tgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgacccag 279
            |||| ||||||||||| ||||| |||||||||||||| |||||||| || ||||||||||
Sbjct: 940  tgactggtgagttcccaggtgattacgggtgggacactgctggactttcagctgacccag 999

                                                                        
Query: 280  agaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgcttggcg 339
            |||| ||||| | |||||| ||||| |||||||||||||||||||||||||||||||| |
Sbjct: 1000 agacattcgctaggaaccgtgagcttgaggtgatccattgccgttgggccatgcttggtg 1059

                                                                        
Query: 340  cgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgaggctg 399
            |  | || ||||| ||||| ||  | ||  ||   || |||||||| ||||||||||| |
Sbjct: 1060 ctttgggctgtgtattccctgaaatcctttccaagaatggtgttaaattcggtgaggcag 1119

                                                                        
Query: 400  tttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggcaacc 459
            ||||||||||||| ||||||||||| |||   || || || ||||||||||| || ||||
Sbjct: 1120 tttggttcaaggccggatctcagatattctcagaaggcggtcttgactaccttggtaacc 1179

                                                                        
Query: 460  caagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctcatgg 519
            ||| |||| | || || ||||| || |||||| ||||||| |  || |||||||||||||
Sbjct: 1180 caaaccttatccatgcacagagcattcttgccgtttgggcatcccaagttgtgctcatgg 1239

             
Query: 520  g 520
            |
Sbjct: 1240 g 1240

---

>emb|X16536.1|GMCAB5 G.max DNA for Cab5
          Length = 1467

 Score =  192 bits (97), Expect = 9e-46
 Identities = 286/349 (81%)
 Strand = Plus / Plus

                                                                       
Query: 215 ctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctga 274
           |||||| || ||||| ||||| |||||||| || |||||||| ||||| || || |||||
Sbjct: 525 ctacctcactggtgaattcccaggtgactatggttgggacactgctgggctttctgctga 584

                                                                       
Query: 275 cccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgct 334
           |||||||||||| ||||||||||| || || || || ||||| | | | ||||||||| |
Sbjct: 585 cccagagacctttgccaagaaccgtgaacttgaagtcatccactccagatgggccatgtt 644

                                                                       
Query: 335 tggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtga 394
            || || || || ||||| |||||||| ||  | |||||||||||||| |||||||||||
Sbjct: 645 gggagccctgggctgtgttttccccgaactcttggcccgcaacggtgtcaagttcggtga 704

                                                                       
Query: 395 ggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcgg 454
            || || ||||||||||| || |||||||| ||||| |||||||| ||||||||| | ||
Sbjct: 705 agccgtgtggttcaaggccgggtctcagatattcagtgagggtgggcttgactacttggg 764

                                                                       
Query: 455 caacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgct 514
           ||||||||||||  | || || || || || |||||||| |||||    || ||| |  |
Sbjct: 765 caacccaagcctgatccatgcacaaagcattcttgccatctgggccacccaagttatctt 824

                                                            
Query: 515 catgggtgccgttgagggttaccgcattgctggtggaccacttggtgag 563
            ||||||||||||||||||||||| ||||||||||| || |||||||||
Sbjct: 825 gatgggtgccgttgagggttaccgtattgctggtgggcctcttggtgag 873

---

>emb|X68333.1|HHLHC H.helix mRNA for light harvesting chlorophyll a/b binding protein
          Length = 686

 Score =  192 bits (97), Expect = 9e-46
 Identities = 262/317 (82%)
 Strand = Plus / Plus

                                                                       
Query: 270 gctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcc 329
           ||||| || ||||| |||||||||||||| |||||||||||||||||  |  | ||||| 
Sbjct: 40  gctgatcccgagactttcgccaagaaccgtgagctcgaggtgatccacagtagatgggct 99

                                                                       
Query: 330 atgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttc 389
           |||||||| || || || |||||||| ||||||||  | ||||| |||||||| || |||
Sbjct: 100 atgcttggagcccttggctgtgtctttcccgagctcttggcccgtaacggtgtcaaattc 159

                                                                       
Query: 390 ggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactac 449
           ||||||||||| ||||||||||||||| |||| || ||||| |||||||| |||||||||
Sbjct: 160 ggtgaggctgtgtggttcaaggctggagctcaaattttcagtgagggtgggcttgactac 219

                                                                       
Query: 450 ctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggtt 509
            | |||||||||||| | || || ||||| |||||| | || || |||||    || |||
Sbjct: 220 ttgggcaacccaagcttggttcatgcccaaagtatcttggctatatgggccacccaagtt 279

                                                                       
Query: 510 gtgctcatgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtc 569
            |  | ||||||||||||||||||||||| ||||| ||||||||||| |||||| | || 
Sbjct: 280 atcttaatgggtgccgttgagggttaccgtattgccggtggaccactcggtgaggttgtt 339

                            
Query: 570 gacccattataccccgg 586
           |||||| | ||||||||
Sbjct: 340 gacccactttaccccgg 356

---

>emb|Z13987.1|STCABPSII S.tuberosum gene for chlorophyll a/b-binding protein PS II type I
          Length = 2432

 Score =  190 bits (96), Expect = 4e-45
 Identities = 308/376 (81%), Gaps = 2/376 (0%)
 Strand = Plus / Plus

                                                                        
Query: 189  ggcccactttctggtgagcccccgagctacctgaccggtgagttccccggtgactacggg 248
            |||||| | ||||||||  |||| |||||| |||| ||||||   || ||||||||||| 
Sbjct: 1081 ggcccattctctggtgaagccccaagctacttgactggtgagaaacctggtgactacgga 1140

                                                                        
Query: 249  tgggacaccgctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgag 308
            |||||||| |||||||| || ||||| ||||| || || ||||||||||| ||| | |||
Sbjct: 1141 tgggacactgctggactttcagctgatccagaaacttttgccaagaaccgtgagttggag 1200

                                                                        
Query: 309  gtgatccattgccgttgggccatgcttggcgcg-ctcggttgtgtcttccccgagctgct 367
            |||||||||||  | |||||||| |||||  || || || |||||||| || |||||  |
Sbjct: 1201 gtgatccattgtagatgggccat-cttggaacgtcttggctgtgtctttcctgagctttt 1259

                                                                        
Query: 368  cgcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatctt 427
              |||| |||||||| ||||| |||||||||||||||||||| | |||||| || || ||
Sbjct: 1260 gtcccgtaacggtgtaaagtttggtgaggctgtttggttcaaagttggatcccaaatttt 1319

                                                                        
Query: 428  cagcgagggtggccttgactacctcggcaacccaagccttgtgcacgcccagagtatcct 487
            ||| || ||||| ||||| ||| | || ||||||||  | || || || || |||||| |
Sbjct: 1320 cagtgaaggtggacttgattacttgggaaacccaagtttggtccatgcacaaagtatctt 1379

                                                                        
Query: 488  tgccatttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctgg 547
             ||||||||||||||||| |||||| | ||||| ||||||||||||||||| ||||||||
Sbjct: 1380 ggccatttgggcttgtcaagttgtgttgatgggagccgttgagggttaccgtattgctgg 1439

                            
Query: 548  tggaccacttggtgag 563
            ||| || |||||||||
Sbjct: 1440 tgggcctcttggtgag 1455

---

>emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chlorophyll a/b-binding protein
          Length = 1083

 Score =  188 bits (95), Expect = 1e-44
 Identities = 266/323 (82%)
 Strand = Plus / Plus

                                                                       
Query: 216 tacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgac 275
           |||||||||||||| |||||||||||||||||||||||||| || || |||||||| || 
Sbjct: 296 tacctgaccggtgaattccccggtgactacgggtgggacacggcggggctgtcggcggat 355

                                                                       
Query: 276 ccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgctt 335
           || ||||| ||||| |||||| | ||||| || |||||||| | ||| ||||| ||||| 
Sbjct: 356 ccggagacgttcgcgaagaacagagagctggaagtgatccactcccggtgggcgatgctg 415

                                                                       
Query: 336 ggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgag 395
           ||||| ||||| || || ||||| ||||| || ||  | ||||| || ||||||||||||
Sbjct: 416 ggcgctctcgggtgcgtattcccggagcttcttgcgaggaacggagtaaagttcggtgag 475

                                                                       
Query: 396 gctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggc 455
           || || ||||||||||| ||| ||||||||||||||||||| || ||||||||||| || 
Sbjct: 476 gcggtgtggttcaaggcgggagctcagatcttcagcgagggagggcttgactacctaggg 535

                                                                       
Query: 456 aacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctc 515
           | ||||    |  | ||||||||||| || |||||||| ||||| || |||||  | |||
Sbjct: 536 agcccacaattgatccacgcccagagcattcttgccatctgggcatgccaggtcatcctc 595

                                  
Query: 516 atgggtgccgttgagggttaccg 538
           ||||||||| | ||||| |||||
Sbjct: 596 atgggtgccatcgagggctaccg 618

---

>gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score =  186 bits (94), Expect = 6e-44
 Identities = 271/330 (82%)
 Strand = Plus / Plus

                                                                       
Query: 215 ctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctga 274
           |||| |||||||||||||||| |||||||||||||||||||| || || || ||||| ||
Sbjct: 221 ctacttgaccggtgagttcccgggtgactacgggtgggacacagcggggctttcggcgga 280

                                                                       
Query: 275 cccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgct 334
            || ||||| ||||| |||||| | ||  | || |||||||| ||||| ||||| |||||
Sbjct: 281 tccggagactttcgcgaagaacagagaattggaagtgatccactgccggtgggcaatgct 340

                                                                       
Query: 335 tggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtga 394
            ||||| || ||||| || ||||| ||||| || ||  | || || || |||||||| ||
Sbjct: 341 gggcgctctgggttgcgttttcccggagcttcttgcgagaaatggagtaaagttcgggga 400

                                                                       
Query: 395 ggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcgg 454
           ||| || ||||||||||| ||| ||||||| ||||||||||| || ||||||||||| ||
Sbjct: 401 ggcagtctggttcaaggcgggagctcagattttcagcgagggagggcttgactacctggg 460

                                                                       
Query: 455 caacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgct 514
            ||||| |||||| | ||||| |||||||| ||||| || ||||| || |||||  | ||
Sbjct: 461 aaaccctagccttatccacgcgcagagtattcttgcaatctgggcatgccaggtcatcct 520

                                         
Query: 515 catgggtgccgttgagggttaccgcattgc 544
           |||||| ||||| ||||||||||| |||||
Sbjct: 521 catgggcgccgtggagggttaccgtattgc 550

---

>gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 759

 Score =  186 bits (94), Expect = 6e-44
 Identities = 271/330 (82%)
 Strand = Plus / Plus

                                                                       
Query: 215 ctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctga 274
           |||| |||||||||||||||| |||||||||||||||||||| || || || ||||| ||
Sbjct: 210 ctacttgaccggtgagttcccgggtgactacgggtgggacacwgcggggctttcggcgga 269

                                                                       
Query: 275 cccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgct 334
            || ||||| || || |||||| | || || || |||||||| ||||| ||||| |||||
Sbjct: 270 tccggagacttttgcgaagaacagagaactggaagtgatccactgccggtgggcaatgct 329

                                                                       
Query: 335 tggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtga 394
            ||||| || ||||| || ||||| ||||| || ||| | || || || |||||||| ||
Sbjct: 330 gggcgctctgggttgcgttttcccggagcttctggccagaaatggagtaaagttcgggga 389

                                                                       
Query: 395 ggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcgg 454
            ||||| ||||||||||| ||| ||||||| ||||||||||| || ||||||||||| ||
Sbjct: 390 agctgtgtggttcaaggcgggagctcagattttcagcgagggaggrcttgactacctggg 449

                                                                       
Query: 455 caacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgct 514
            ||||| |||||| | ||||| ||||| || ||||| || ||||| || |||||  | ||
Sbjct: 450 aaaccctagccttatccacgcgcagagcattcttgcaatctgggcatgccaggtcatcct 509

                                         
Query: 515 catgggtgccgttgagggttaccgcattgc 544
           |||||| ||||| ||||||||||| |||||
Sbjct: 510 catgggcgccgtggagggttaccgtattgc 539

---

>gb|U21115.1|STU21115 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-6) gene,
           nuclear gene encoding chloroplast protein, partial cds
          Length = 405

 Score =  186 bits (94), Expect = 6e-44
 Identities = 196/230 (85%)
 Strand = Plus / Plus

                                                                       
Query: 189 ggcccactttctggtgagcccccgagctacctgaccggtgagttccccggtgactacggg 248
           |||||| | ||||||||| |||| |||||| |||||||||| ||||| ||||||||||| 
Sbjct: 175 ggcccattctctggtgagtccccaagctacttgaccggtgaattccctggtgactacggc 234

                                                                       
Query: 249 tgggacaccgctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgag 308
           ||||| || |||||||| || || ||||| || ||||| ||||||||||| || ||||||
Sbjct: 235 tgggatactgctggactttcagcagaccctgaaacctttgccaagaaccgtgaactcgag 294

                                                                       
Query: 309 gtgatccattgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctc 368
           |||||||||||| | ||||| |||||||| || || || ||||||||||| |||||  | 
Sbjct: 295 gtgatccattgcagatgggctatgcttggtgctcttggatgtgtcttccctgagctcttg 354

                                                             
Query: 369 gcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatc 418
           ||||| |||||||| ||||| ||||||||||| |||||||| ||||||||
Sbjct: 355 gcccgtaacggtgtcaagtttggtgaggctgtgtggttcaaagctggatc 404

---

>dbj|D14002.1|LAUCAB Lettuce mRNA for light-harvesting chlorophyll a/b-binding protein
           (LHCP), complete cds
          Length = 905

 Score =  186 bits (94), Expect = 6e-44
 Identities = 196/230 (85%)
 Strand = Plus / Plus

                                                                       
Query: 216 tacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgac 275
           |||||||||||||| ||||| ||||||||||| ||||||||||| ||||| || ||||| 
Sbjct: 249 tacctgaccggtgaattcccaggtgactacggctgggacaccgccggactttctgctgat 308

                                                                       
Query: 276 ccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgctt 335
           |||||||| ||  |||||||||| ||||| ||||| ||||| ||| | ||||| ||||||
Sbjct: 309 ccagagacattttccaagaaccgtgagcttgaggtcatccactgcagatgggcaatgctt 368

                                                                       
Query: 336 ggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgag 395
           || || || || || |||||||| |||||  | ||||| || ||||| ||||||||||||
Sbjct: 369 ggagctcttggctgcgtcttccctgagctcttggcccgtaatggtgtgaagttcggtgag 428

                                                             
Query: 396 gctgtttggttcaaggctggatctcagatcttcagcgagggtggccttga 445
           ||||| ||||||||||||||||| ||||||||||| || ||||| |||||
Sbjct: 429 gctgtatggttcaaggctggatcccagatcttcagtgaaggtgggcttga 478

---

>emb|X54090.1|GHCAB G.hirsutum cab gene for chlorophyll ab binding protein
          Length = 1746

 Score =  184 bits (93), Expect = 2e-43
 Identities = 252/305 (82%)
 Strand = Plus / Plus

                                                                        
Query: 216  tacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgac 275
            |||||||||||||| ||||| || |||||||||||||| || |||||| | || ||||||
Sbjct: 745  tacctgaccggtgaattccctggggactacgggtgggatactgctggattatcagctgac 804

                                                                        
Query: 276  ccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgctt 335
            |||||||| || ||||||||||| ||||| ||||||||||| ||  | ||||| ||||||
Sbjct: 805  ccagagacatttgccaagaaccgtgagcttgaggtgatccactgtaggtgggctatgctt 864

                                                                        
Query: 336  ggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgag 395
            || || || || ||||| ||||| ||  | ||  |    || ||||| |||||||| |||
Sbjct: 865  ggtgcccttggctgtgttttccctgaaattctttcaaagaatggtgtcaagttcggagag 924

                                                                        
Query: 396  gctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggc 455
            || ||||||||||||||||| || || ||||||  |||||||||||||||||| ||||||
Sbjct: 925  gcggtttggttcaaggctggttcccaaatcttctccgagggtggccttgactatctcggc 984

                                                                        
Query: 456  aacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctc 515
            ||||||| |||  | || || |||||||| ||||| || |||||||| || |||||||||
Sbjct: 985  aacccaaacctcatccatgctcagagtattcttgctatctgggcttgccaagttgtgctc 1044

                 
Query: 516  atggg 520
            |||||
Sbjct: 1045 atggg 1049

---

>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein
          Length = 1197

 Score =  184 bits (93), Expect = 2e-43
 Identities = 267/325 (82%)
 Strand = Plus / Plus

                                                                       
Query: 220 tgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgacccag 279
           ||||||||||||||||||||||||||||||||||||| || || || ||||| || ||||
Sbjct: 296 tgaccggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccag 355

                                                                       
Query: 280 agaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgcttggcg 339
           |||| || || |||||| | ||||| || ||||||||  |||| ||||| ||||| ||||
Sbjct: 356 agacttttgcgaagaacagagagctggaagtgatccacagccggtgggcaatgctgggcg 415

                                                                       
Query: 340 cgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgaggctg 399
           | || ||||| || ||||| ||||| || ||  | || || || |||||||||||||| |
Sbjct: 416 ctctgggttgcgttttcccggagcttctggcgagaaatggagtaaagttcggtgaggccg 475

                                                                       
Query: 400 tttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggcaacc 459
           | ||||||||||| ||| ||||||| ||||||||||| || ||||||||||| || ||||
Sbjct: 476 tgtggttcaaggcgggagctcagattttcagcgagggagggcttgactacctgggaaacc 535

                                                                       
Query: 460 caagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctcatgg 519
           | ||| | || ||||| ||||| || ||||| || ||||| || |||||  | |||||||
Sbjct: 536 ctagcttggttcacgcgcagagcattcttgcaatctgggcatgccaggtcatcctcatgg 595

                                    
Query: 520 gtgccgttgagggttaccgcattgc 544
           | ||||| ||||| ||||| |||||
Sbjct: 596 gcgccgtggagggctaccgtattgc 620

---

>gb|AY617084.1| Pinus contorta chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score =  184 bits (93), Expect = 2e-43
 Identities = 267/325 (82%)
 Strand = Plus / Plus

                                                                       
Query: 220 tgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgacccag 279
           ||||||||||||||||||||||||||||||||||||| || || || ||||| || ||||
Sbjct: 226 tgaccggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccag 285

                                                                       
Query: 280 agaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgcttggcg 339
           |||| || || |||||| | ||||| || ||||||||  |||| ||||| ||||| ||||
Sbjct: 286 agacttttgcgaagaacagagagctggaagtgatccacagccggtgggcaatgctgggcg 345

                                                                       
Query: 340 cgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgaggctg 399
           | || ||||| || ||||| ||||| || ||  | || || || |||||||||||||| |
Sbjct: 346 ctctgggttgcgttttcccggagcttctggcgagaaatggagtaaagttcggtgaggccg 405

                                                                       
Query: 400 tttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggcaacc 459
           | ||||||||||| ||| ||||||| ||||||||||| || ||||||||||| || ||||
Sbjct: 406 tgtggttcaaggcgggagctcagattttcagcgagggagggcttgactacctgggaaacc 465

                                                                       
Query: 460 caagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctcatgg 519
           | ||| | || ||||| ||||| || ||||| || ||||| || |||||  | |||||||
Sbjct: 466 ctagcttggttcacgcgcagagcattcttgcaatctgggcatgccaggtcatcctcatgg 525

                                    
Query: 520 gtgccgttgagggttaccgcattgc 544
           | ||||| ||||| ||||| |||||
Sbjct: 526 gcgccgtggagggctaccgtattgc 550

---

>gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score =  184 bits (93), Expect = 2e-43
 Identities = 267/325 (82%)
 Strand = Plus / Plus

                                                                       
Query: 220 tgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgacccag 279
           ||||||||||||||||||||||||||||||||||||| || || || ||||| || ||||
Sbjct: 226 tgaccggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccag 285

                                                                       
Query: 280 agaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgcttggcg 339
           |||| || || |||||| | ||||| || |||||||| ||||| ||||| ||||| ||||
Sbjct: 286 agacttttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgctgggcg 345

                                                                       
Query: 340 cgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgaggctg 399
           | || ||||| || ||||| ||||| || ||  | || || || |||||||| ||||| |
Sbjct: 346 ctctgggttgcgttttcccggagcttctggcgagaaatggagtaaagttcggggaggccg 405

                                                                       
Query: 400 tttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggcaacc 459
           | ||||||||||| ||| ||||||| ||||||||||| || ||||||||||| || ||||
Sbjct: 406 tgtggttcaaggcgggagctcagattttcagcgagggagggcttgactacctgggaaacc 465

                                                                       
Query: 460 caagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctcatgg 519
           | ||| | || ||||| ||||| || ||||| || ||||| || |||||  | |||||||
Sbjct: 466 ctagcttggttcacgcgcagagcattcttgcaatctgggcatgccaggtcatcctcatgg 525

                                    
Query: 520 gtgccgttgagggttaccgcattgc 544
           | ||||| ||||| ||||| |||||
Sbjct: 526 gcgccgtggagggctaccgtattgc 550

---

>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 980

 Score =  184 bits (93), Expect = 2e-43
 Identities = 273/333 (81%)
 Strand = Plus / Plus

                                                                       
Query: 204 gagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctgga 263
           |||||||| |||||||| || || |||||||||||||||||||| ||||||||||| || 
Sbjct: 232 gagcccccaagctacctcacaggagagttccccggtgactacggatgggacaccgccggt 291

                                                                       
Query: 264 ctgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgt 323
           || || |||||||| ||||||||||||| |||||| ||||| || || ||||| ||| | 
Sbjct: 292 ctttccgctgaccccgagaccttcgccaggaaccgtgagctagaagttatccactgcaga 351

                                                                       
Query: 324 tgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgtt 383
           |||||||||||||| || || || ||||| ||||| || ||  | ||  | ||||| || 
Sbjct: 352 tgggccatgcttggagccctaggctgtgttttccctgaacttttggctaggaacggagtg 411

                                                                       
Query: 384 aagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggcctt 443
           |||||||| || |||||||||||||||||||| || |||||||||||||| || || || 
Sbjct: 412 aagttcggagaagctgtttggttcaaggctggttcacagatcttcagcgaaggagggctc 471

                                                                       
Query: 444 gactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgt 503
           |||||| | || ||||| ||| | || ||||| ||||| ||| | ||||||||||||  |
Sbjct: 472 gactacttgggaaacccgagcttggtccacgcacagagcatcttagccatttgggctact 531

                                            
Query: 504 caggttgtgctcatgggtgccgttgagggttac 536
           |||||  | |||||||| || ||||| ||||||
Sbjct: 532 caggtgatcctcatgggagctgttgaaggttac 564

---

>gb|AF039598.1| Prunus persica light harvesting chlorophyll A/B binding protein
           (Lhcb-Pp2) mRNA, complete cds
          Length = 955

 Score =  184 bits (93), Expect = 2e-43
 Identities = 249/301 (82%)
 Strand = Plus / Plus

                                                                       
Query: 220 tgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgacccag 279
           |||| ||||| ||||| ||||||||||| |||||||| |||||||| || || ||||| |
Sbjct: 206 tgactggtgaattccctggtgactacggatgggacactgctggactatccgcagaccctg 265

                                                                       
Query: 280 agaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgcttggcg 339
           |||| || || || ||| | ||||| |||||||||||  |||| |||||||||||||| |
Sbjct: 266 agacatttgcgaaaaacggtgagcttgaggtgatccacagccgatgggccatgcttggtg 325

                                                                       
Query: 340 cgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgaggctg 399
           | || || ||||||||||| ||  | ||  |    || ||||| |||||||| |||||||
Sbjct: 326 cactgggatgtgtcttcccagaaatcctgtcaaagaatggtgtcaagttcggcgaggctg 385

                                                                       
Query: 400 tttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggcaacc 459
           |||||||||||||||||||||| ||||||  |||||||||||||||||| || |||||||
Sbjct: 386 tttggttcaaggctggatctcaaatcttctccgagggtggccttgactatcttggcaacc 445

                                                                       
Query: 460 caagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctcatgg 519
           ||| |||||| || |||||||| ||| | || || ||||||   ||||||||||||||||
Sbjct: 446 caaaccttgtccatgcccagagcatcttggcaatctgggctgtccaggttgtgctcatgg 505

            
Query: 520 g 520
           |
Sbjct: 506 g 506

---

>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein
          Length = 2574

 Score =  184 bits (93), Expect = 2e-43
 Identities = 267/325 (82%)
 Strand = Plus / Plus

                                                                        
Query: 220  tgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgacccag 279
            ||||||||||||||||||||||||||||||||||||| || || || ||||| || ||||
Sbjct: 1374 tgaccggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccag 1433

                                                                        
Query: 280  agaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgcttggcg 339
            |||| || || |||||| | ||||| || ||||||||  |||| ||||| ||||| ||||
Sbjct: 1434 agacttttgcgaagaacagagagctggaagtgatccacagccggtgggcaatgctgggcg 1493

                                                                        
Query: 340  cgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgaggctg 399
            | || ||||| || ||||| ||||| || ||  | || || || |||||||||||||| |
Sbjct: 1494 ctctgggttgcgttttcccggagcttctggcgagaaatggagtaaagttcggtgaggccg 1553

                                                                        
Query: 400  tttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggcaacc 459
            | ||||||||||| ||| ||||||| ||||||||||| || ||||||||||| || ||||
Sbjct: 1554 tgtggttcaaggcgggagctcagattttcagcgagggagggcttgactacctgggaaacc 1613

                                                                        
Query: 460  caagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctcatgg 519
            | ||| | || ||||| ||||| || ||||| || ||||| || |||||  | |||||||
Sbjct: 1614 ctagcttggttcacgcgcagagcattcttgcaatctgggcatgccaggtcatcctcatgg 1673

                                     
Query: 520  gtgccgttgagggttaccgcattgc 544
            | ||||| ||||| ||||| |||||
Sbjct: 1674 gcgccgtggagggctaccgtattgc 1698

---

>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds
          Length = 1913

 Score =  184 bits (93), Expect = 2e-43
 Identities = 252/305 (82%)
 Strand = Plus / Plus

                                                                        
Query: 216  tacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgac 275
            |||||||| || ||||||||||| ||||||||||||||||| || || || || || |||
Sbjct: 938  tacctgacgggcgagttccccggcgactacgggtgggacacggccggcctctccgccgac 997

                                                                        
Query: 276  ccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgctt 335
            || |||||||||||||||||||| ||||| ||||| |||||  |||| ||||||||||| 
Sbjct: 998  ccggagaccttcgccaagaaccgcgagctggaggtcatccacagccggtgggccatgctc 1057

                                                                        
Query: 336  ggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgag 395
            ||||||||||| ||  ||||||| ||||||||| ||   ||||| ||  ||||||| |||
Sbjct: 1058 ggcgcgctcggctgcatcttcccggagctgctctccaagaacggggtgcagttcggggag 1117

                                                                        
Query: 396  gctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggc 455
            || || ||||||||||| ||  | |||||||||  |||||| ||||| |||||||| |||
Sbjct: 1118 gccgtctggttcaaggcgggcgcccagatcttctccgagggcggcctcgactacctgggc 1177

                                                                        
Query: 456  aacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctc 515
            ||||| | ||| || ||||| ||||| ||||| ||||| |||||    ||||| ||||||
Sbjct: 1178 aaccccaacctggtccacgcgcagagcatcctcgccatctgggccacgcaggtggtgctc 1237

                 
Query: 516  atggg 520
            |||||
Sbjct: 1238 atggg 1242

---

>dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chlorophyll a/b-binding
            protein, complete cds
          Length = 1500

 Score =  182 bits (92), Expect = 9e-43
 Identities = 266/324 (82%)
 Strand = Plus / Plus

                                                                        
Query: 215  ctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctga 274
            |||||| || ||||||||||| |||||||| ||||||||||| ||||| ||||| || ||
Sbjct: 722  ctacctcactggtgagttccctggtgactatgggtgggacacagctggtctgtccgcaga 781

                                                                        
Query: 275  cccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgct 334
            |||||||||||||||||||||| ||||||| ||||||||||||| | | ||||||||| |
Sbjct: 782  cccagagaccttcgccaagaacagggagctggaggtgatccattccagatgggccatgtt 841

                                                                        
Query: 335  tggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtga 394
             || ||  | || |||||    ||||||||||| ||    |||||||| ||||| |||||
Sbjct: 842  gggagccttgggctgtgtgacgcccgagctgctggcaaagaacggtgtcaagtttggtga 901

                                                                        
Query: 395  ggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcgg 454
            |||||| |||||||||||||| || |||||||||  ||| || |||||||| || || ||
Sbjct: 902  ggctgtgtggttcaaggctggctcccagatcttcgccgatggcggccttgattatcttgg 961

                                                                        
Query: 455  caacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgct 514
            |||||| |||||||| ||||| || || ||  | ||||||||||| || |||||  | ||
Sbjct: 962  caacccgagccttgtccacgctcaaagcattttggccatttgggcctgccaggtcatcct 1021

                                    
Query: 515  catgggtgccgttgagggttaccg 538
             ||||| || |||||||| |||||
Sbjct: 1022 tatgggcgctgttgaggggtaccg 1045

---

>gb|M17558.1|TOMCAB4A Tomato Cab-4 gene encoding chlorophyll a/b-binding protein,
           complete cds
          Length = 895

 Score =  182 bits (92), Expect = 9e-43
 Identities = 236/284 (83%)
 Strand = Plus / Plus

                                                                       
Query: 237 ggtgactacgggtgggacaccgctggactgtcggctgacccagagaccttcgccaagaac 296
           ||||| ||||| |||||||| |||||||| || |||||||| ||||| || || |  |||
Sbjct: 281 ggtgattacggatgggacactgctggactctcagctgaccccgagacatttgctagaaac 340

                                                                       
Query: 297 cgggagctcgaggtgatccattgccgttgggccatgcttggcgcgctcggttgtgtcttc 356
           || ||||| |||||||| ||||||||||||||||||||||| ||  | |||||||| |||
Sbjct: 341 cgtgagcttgaggtgattcattgccgttgggccatgcttggtgctttaggttgtgttttc 400

                                                                       
Query: 357 cccgagctgctcgcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctgga 416
           |||||  | ||  |    ||||||||||| |||||||| |||||||||||||||||||||
Sbjct: 401 cccgaaatcctttcgaagaacggtgttaaattcggtgaagctgtttggttcaaggctgga 460

                                                                       
Query: 417 tctcagatcttcagcgagggtggccttgactacctcggcaacccaagccttgtgcacgcc 476
           |||||||| |||  ||| ||||| ||||||||||| || ||||||| |||||| || || 
Sbjct: 461 tctcagattttctccgaaggtgggcttgactaccttggaaacccaaaccttgtccatgct 520

                                                       
Query: 477 cagagtatccttgccatttgggcttgtcaggttgtgctcatggg 520
           ||||| || ||||| ||||||||||| || ||||| || |||||
Sbjct: 521 cagagcattcttgctatttgggcttgccaagttgttcttatggg 564

---

>gb|J01253.1|PEACAB15 Pea major chlorophyll a/b-binding thylakoid protein (polypeptide
           15) mRNA, clone pAB96
          Length = 822

 Score =  182 bits (92), Expect = 9e-43
 Identities = 281/344 (81%)
 Strand = Plus / Plus

                                                                       
Query: 220 tgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgacccag 279
           ||||||| |||||||| ||||||||||| |||||||| |||||||| || || || ||||
Sbjct: 96  tgaccggagagttcccaggtgactacggttgggacactgctggactttctgccgatccag 155

                                                                       
Query: 280 agaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgcttggcg 339
           |||| || ||||||||||| ||||| || || ||||| | | | ||||| ||| | || |
Sbjct: 156 agacatttgccaagaaccgtgagcttgaagttatccactccagatgggctatgttgggag 215

                                                                       
Query: 340 cgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgaggctg 399
           |  | || ||||||||||| |||||  |  | |||||||||||||| |||||||| ||||
Sbjct: 216 ccttgggatgtgtcttcccagagcttttgtctcgcaacggtgttaaattcggtgaagctg 275

                                                                       
Query: 400 tttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggcaacc 459
           | ||||||||||| |||||||| ||||| ||||||||||| ||||||||| | |||||||
Sbjct: 276 tatggttcaaggcaggatctcaaatctttagcgagggtggacttgactacttgggcaacc 335

                                                                       
Query: 460 caagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctcatgg 519
           ||||| | || || || || || ||||||||||| |||||   ||||||| |  | ||||
Sbjct: 336 caagcttggtccatgctcaaagcatccttgccatctgggccactcaggttatcttgatgg 395

                                                       
Query: 520 gtgccgttgagggttaccgcattgctggtggaccacttggtgag 563
           | || ||||| |||||||| ||||| ||||| || |||||||||
Sbjct: 396 gagctgttgaaggttaccgtattgccggtggccctcttggtgag 439

---

>dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-binding protein
           precursor, complete cds
          Length = 964

 Score =  182 bits (92), Expect = 9e-43
 Identities = 284/348 (81%)
 Strand = Plus / Plus

                                                                       
Query: 215 ctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctga 274
           |||||| | |||||||||| | ||||| ||||| |||||||| |||||||| ||  | ||
Sbjct: 249 ctacctcaacggtgagttcgctggtgattacggctgggacactgctggactctcatccga 308

                                                                       
Query: 275 cccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgct 334
           ||| ||||||||||||   ||||| |||||||||||||||||    || |||||||||||
Sbjct: 309 ccccgagaccttcgcccgcaaccgcgagctcgaggtgatccacgctcgatgggccatgct 368

                                                                       
Query: 335 tggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtga 394
           ||| || || || ||| |   ||| ||| || | |||   | ||||||||||||||||||
Sbjct: 369 tggagctctgggatgtctgaccccagagttgttggccaagagcggtgttaagttcggtga 428

                                                                       
Query: 395 ggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcgg 454
           ||| |||||||||||||| ||| ||||||||||||||||||| ||  | |||||| | ||
Sbjct: 429 ggccgtttggttcaaggccggagctcagatcttcagcgagggaggtttggactacttggg 488

                                                                       
Query: 455 caacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgct 514
           |||||| |||||||||||||| ||||| ||| | || || |||||||| || ||| | ||
Sbjct: 489 caaccccagccttgtgcacgctcagagcatcttggctatctgggcttgccaagttatcct 548

                                                           
Query: 515 catgggtgccgttgagggttaccgcattgctggtggaccacttggtga 562
            ||||| ||||| |||||||||||  ||||||||||||| || |||||
Sbjct: 549 gatgggagccgtcgagggttaccgtgttgctggtggacccctcggtga 596



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 102 cgcgtcaccatgcgcaagac 121
           ||||||||||||||||||||
Sbjct: 142 cgcgtcaccatgcgcaagac 161

---

>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.2 mRNA, complete cds
          Length = 3338

 Score =  180 bits (91), Expect = 3e-42
 Identities = 307/379 (81%)
 Strand = Plus / Minus

                                                                        
Query: 151  gcagcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccc 210
            ||||||| |||||||| |||||||| |||   ||| | || ||| | || || |||||||
Sbjct: 3149 gcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccc 3090

                                                                        
Query: 211  cgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcgg 270
            |||||||||| |||||||||||||||||||||||||| |||||||||||||| || || |
Sbjct: 3089 cgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccg 3030

                                                                        
Query: 271  ctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcca 330
            | ||||||||||||||||||| |||||| ||||| || || |||||  || | |||||||
Sbjct: 3029 ccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcca 2970

                                                                        
Query: 331  tgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcg 390
            |||| || || || || || || ||||| |||||  | ||  | ||||| || |||||||
Sbjct: 2969 tgctcggagccctaggctgcgttttccctgagctattggctaggaacggagtgaagttcg 2910

                                                                        
Query: 391  gtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacc 450
            | || || |||||||||||||| || || |||||||||||||| || ||  | |||||| 
Sbjct: 2909 gagaagcggtttggttcaaggccggttcacagatcttcagcgacggaggattggactact 2850

                                                                        
Query: 451  tcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttg 510
            | |||||||| ||| | || ||||| ||||| ||| | ||||||||||||  ||| ||| 
Sbjct: 2849 tgggcaacccgagcttggtccacgctcagagcatcttagccatttgggctactcaagtta 2790

                               
Query: 511  tgctcatgggtgccgttga 529
            | |||||||| || |||||
Sbjct: 2789 tcctcatgggagctgttga 2771

---

>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2)
           transcript variant AT2G34420.1 mRNA, complete cds
          Length = 1354

 Score =  180 bits (91), Expect = 3e-42
 Identities = 307/379 (81%)
 Strand = Plus / Plus

                                                                       
Query: 151 gcagcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccc 210
           ||||||| |||||||| |||||||| |||   ||| | || ||| | || || |||||||
Sbjct: 189 gcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccc 248

                                                                       
Query: 211 cgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcgg 270
           |||||||||| |||||||||||||||||||||||||| |||||||||||||| || || |
Sbjct: 249 cgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccg 308

                                                                       
Query: 271 ctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcca 330
           | ||||||||||||||||||| |||||| ||||| || || |||||  || | |||||||
Sbjct: 309 ccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcca 368

                                                                       
Query: 331 tgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcg 390
           |||| || || || || || || ||||| |||||  | ||  | ||||| || |||||||
Sbjct: 369 tgctcggagccctaggctgcgttttccctgagctattggctaggaacggagtgaagttcg 428

                                                                       
Query: 391 gtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacc 450
           | || || |||||||||||||| || || |||||||||||||| || ||  | |||||| 
Sbjct: 429 gagaagcggtttggttcaaggccggttcacagatcttcagcgacggaggattggactact 488

                                                                       
Query: 451 tcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttg 510
           | |||||||| ||| | || ||||| ||||| ||| | ||||||||||||  ||| ||| 
Sbjct: 489 tgggcaacccgagcttggtccacgctcagagcatcttagccatttgggctactcaagtta 548

                              
Query: 511 tgctcatgggtgccgttga 529
           | |||||||| || |||||
Sbjct: 549 tcctcatgggagctgttga 567

---

>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 829

 Score =  180 bits (91), Expect = 3e-42
 Identities = 307/379 (81%)
 Strand = Plus / Plus

                                                                       
Query: 151 gcagcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccc 210
           ||||||| |||||||| |||||||| |||   ||| | || ||| | || || |||||||
Sbjct: 134 gcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccc 193

                                                                       
Query: 211 cgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcgg 270
           |||||||||| |||||||||||||||||||||||||| |||||||||||||| || || |
Sbjct: 194 cgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccg 253

                                                                       
Query: 271 ctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcca 330
           | ||||||||||||||||||| |||||| ||||| || || |||||  || | |||||||
Sbjct: 254 ccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcca 313

                                                                       
Query: 331 tgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcg 390
           |||| || || || || || || ||||| |||||  | ||  | ||||| || |||||||
Sbjct: 314 tgctcggagccctaggctgcgttttccctgagctattggctaggaacggagtgaagttcg 373

                                                                       
Query: 391 gtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacc 450
           | || || |||||||||||||| || || |||||||||||||| || ||  | |||||| 
Sbjct: 374 gagaagcggtttggttcaaggccggttcacagatcttcagcgacggaggattggactact 433

                                                                       
Query: 451 tcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttg 510
           | |||||||| ||| | || ||||| ||||| ||| | ||||||||||||  ||| ||| 
Sbjct: 434 tgggcaacccgagcttggtccacgctcagagcatcttagccatttgggctactcaagtta 493

                              
Query: 511 tgctcatgggtgccgttga 529
           | |||||||| || |||||
Sbjct: 494 tcctcatgggagctgttga 512

---

>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 1015

 Score =  180 bits (91), Expect = 3e-42
 Identities = 307/379 (81%)
 Strand = Plus / Plus

                                                                       
Query: 151 gcagcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccc 210
           ||||||| |||||||| |||||||| |||   ||| | || ||| | || || |||||||
Sbjct: 189 gcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccc 248

                                                                       
Query: 211 cgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcgg 270
           |||||||||| |||||||||||||||||||||||||| |||||||||||||| || || |
Sbjct: 249 cgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccg 308

                                                                       
Query: 271 ctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcca 330
           | ||||||||||||||||||| |||||| ||||| || || |||||  || | |||||||
Sbjct: 309 ccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcca 368

                                                                       
Query: 331 tgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcg 390
           |||| || || || || || || ||||| |||||  | ||  | ||||| || |||||||
Sbjct: 369 tgctcggagccctaggctgcgttttccctgagctattggctaggaacggagtgaagttcg 428

                                                                       
Query: 391 gtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacc 450
           | || || |||||||||||||| || || |||||||||||||| || ||  | |||||| 
Sbjct: 429 gagaagcggtttggttcaaggccggttcacagatcttcagcgacggaggattggactact 488

                                                                       
Query: 451 tcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttg 510
           | |||||||| ||| | || ||||| ||||| ||| | ||||||||||||  ||| ||| 
Sbjct: 489 tgggcaacccgagcttggtccacgctcagagcatcttagccatttgggctactcaagtta 548

                              
Query: 511 tgctcatgggtgccgttga 529
           | |||||||| || |||||
Sbjct: 549 tcctcatgggagctgttga 567

---

>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete
             sequence
          Length = 112763

 Score =  180 bits (91), Expect = 3e-42
 Identities = 307/379 (81%)
 Strand = Plus / Minus

                                                                         
Query: 151   gcagcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccc 210
             ||||||| |||||||| |||||||| |||   ||| | || ||| | || || |||||||
Sbjct: 93867 gcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccc 93808

                                                                         
Query: 211   cgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcgg 270
             |||||||||| |||||||||||||||||||||||||| |||||||||||||| || || |
Sbjct: 93807 cgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccg 93748

                                                                         
Query: 271   ctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcca 330
             | ||||||||||||||||||| |||||| ||||| || || |||||  || | |||||||
Sbjct: 93747 ccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcca 93688

                                                                         
Query: 331   tgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcg 390
             |||| || || || || || || ||||| |||||  | ||  | ||||| || |||||||
Sbjct: 93687 tgctcggagccctaggctgcgttttccctgagctattggctaggaacggagtgaagttcg 93628

                                                                         
Query: 391   gtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacc 450
             | || || |||||||||||||| || || |||||||||||||| || ||  | |||||| 
Sbjct: 93627 gagaagcggtttggttcaaggccggttcacagatcttcagcgacggaggattggactact 93568

                                                                         
Query: 451   tcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttg 510
             | |||||||| ||| | || ||||| ||||| ||| | ||||||||||||  ||| ||| 
Sbjct: 93567 tgggcaacccgagcttggtccacgctcagagcatcttagccatttgggctactcaagtta 93508

                                
Query: 511   tgctcatgggtgccgttga 529
             | |||||||| || |||||
Sbjct: 93507 tcctcatgggagctgttga 93489



 Score =  135 bits (68), Expect = 2e-28
 Identities = 266/332 (80%)
 Strand = Plus / Plus

                                                                         
Query: 201   ggtgagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgct 260
             |||||||| ||||||||||| || || |||||||||||||| |||||||||||||| || 
Sbjct: 95491 ggtgagcctccgagctacctcactggagagttccccggtgattacgggtgggacactgcc 95550

                                                                         
Query: 261   ggactgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgc 320
             || || || || || || ||||||||||| | |||||| ||||| || || |||||  ||
Sbjct: 95551 ggtctatccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagc 95610

                                                                         
Query: 321   cgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggt 380
              | ||||||||||| || || || || || || ||||| |||||  | ||  | ||||| 
Sbjct: 95611 agatgggccatgctcggagccctaggctgcgttttccctgagctattggctaggaacgga 95670

                                                                         
Query: 381   gttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggc 440
             || |||||||| || || ||||||||||||||||| || |||||||||||||| || || 
Sbjct: 95671 gtgaagttcggagaagcggtttggttcaaggctggttcacagatcttcagcgacggagga 95730

                                                                         
Query: 441   cttgactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggct 500
              | |||||| | |||||||| ||| | || ||||| ||||| ||| | ||||||||||||
Sbjct: 95731 ttggactacttgggcaacccgagcttggtccacgctcagagcatcttagccatttgggct 95790

                                             
Query: 501   tgtcaggttgtgctcatgggtgccgttgaggg 532
               ||| ||| | |||||||| || ||||||||
Sbjct: 95791 actcaagttatcctcatgggagctgttgaggg 95822

---

>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete
             sequence
          Length = 93060

 Score =  180 bits (91), Expect = 3e-42
 Identities = 307/379 (81%)
 Strand = Plus / Plus

                                                                         
Query: 151   gcagcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccc 210
             ||||||| |||||||| |||||||| |||   ||| | || ||| | || || |||||||
Sbjct: 80335 gcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccc 80394

                                                                         
Query: 211   cgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcgg 270
             |||||||||| |||||||||||||||||||||||||| |||||||||||||| || || |
Sbjct: 80395 cgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccg 80454

                                                                         
Query: 271   ctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcca 330
             | ||||||||||||||||||| |||||| ||||| || || |||||  || | |||||||
Sbjct: 80455 ccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcca 80514

                                                                         
Query: 331   tgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcg 390
             |||| || || || || || || ||||| |||||  | ||  | ||||| || |||||||
Sbjct: 80515 tgctcggagccctaggctgcgttttccctgagctattggctaggaacggagtgaagttcg 80574

                                                                         
Query: 391   gtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacc 450
             | || || |||||||||||||| || || |||||||||||||| || ||  | |||||| 
Sbjct: 80575 gagaagcggtttggttcaaggccggttcacagatcttcagcgacggaggattggactact 80634

                                                                         
Query: 451   tcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttg 510
             | |||||||| ||| | || ||||| ||||| ||| | ||||||||||||  ||| ||| 
Sbjct: 80635 tgggcaacccgagcttggtccacgctcagagcatcttagccatttgggctactcaagtta 80694

                                
Query: 511   tgctcatgggtgccgttga 529
             | |||||||| || |||||
Sbjct: 80695 tcctcatgggagctgttga 80713



 Score =  135 bits (68), Expect = 2e-28
 Identities = 266/332 (80%)
 Strand = Plus / Minus

                                                                         
Query: 201   ggtgagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgct 260
             |||||||| ||||||||||| || || |||||||||||||| |||||||||||||| || 
Sbjct: 78711 ggtgagcctccgagctacctcactggagagttccccggtgattacgggtgggacactgcc 78652

                                                                         
Query: 261   ggactgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgc 320
             || || || || || || ||||||||||| | |||||| ||||| || || |||||  ||
Sbjct: 78651 ggtctatccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagc 78592

                                                                         
Query: 321   cgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggt 380
              | ||||||||||| || || || || || || ||||| |||||  | ||  | ||||| 
Sbjct: 78591 agatgggccatgctcggagccctaggctgcgttttccctgagctattggctaggaacgga 78532

                                                                         
Query: 381   gttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggc 440
             || |||||||| || || ||||||||||||||||| || |||||||||||||| || || 
Sbjct: 78531 gtgaagttcggagaagcggtttggttcaaggctggttcacagatcttcagcgacggagga 78472

                                                                         
Query: 441   cttgactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggct 500
              | |||||| | |||||||| ||| | || ||||| ||||| ||| | ||||||||||||
Sbjct: 78471 ttggactacttgggcaacccgagcttggtccacgctcagagcatcttagccatttgggct 78412

                                             
Query: 501   tgtcaggttgtgctcatgggtgccgttgaggg 532
               ||| ||| | |||||||| || ||||||||
Sbjct: 78411 actcaagttatcctcatgggagctgttgaggg 78380

---

>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420) mRNA, complete cds
          Length = 883

 Score =  180 bits (91), Expect = 3e-42
 Identities = 307/379 (81%)
 Strand = Plus / Plus

                                                                       
Query: 151 gcagcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccc 210
           ||||||| |||||||| |||||||| |||   ||| | || ||| | || || |||||||
Sbjct: 134 gcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccc 193

                                                                       
Query: 211 cgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcgg 270
           |||||||||| |||||||||||||||||||||||||| |||||||||||||| || || |
Sbjct: 194 cgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccg 253

                                                                       
Query: 271 ctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcca 330
           | ||||||||||||||||||| |||||| ||||| || || |||||  || | |||||||
Sbjct: 254 ccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcca 313

                                                                       
Query: 331 tgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcg 390
           |||| || || || || || || ||||| |||||  | ||  | ||||| || |||||||
Sbjct: 314 tgctcggagccctaggctgcgttttccctgagctattggctaggaacggagtgaagttcg 373

                                                                       
Query: 391 gtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacc 450
           | || || |||||||||||||| || || |||||||||||||| || ||  | |||||| 
Sbjct: 374 gagaagcggtttggttcaaggccggttcacagatcttcagcgacggaggattggactact 433

                                                                       
Query: 451 tcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttg 510
           | |||||||| ||| | || ||||| ||||| ||| | ||||||||||||  ||| ||| 
Sbjct: 434 tgggcaacccgagcttggtccacgctcagagcatcttagccatttgggctactcaagtta 493

                              
Query: 511 tgctcatgggtgccgttga 529
           | |||||||| || |||||
Sbjct: 494 tcctcatgggagctgttga 512

---

>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score =  180 bits (91), Expect = 3e-42
 Identities = 307/379 (81%)
 Strand = Plus / Plus

                                                                       
Query: 151 gcagcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccc 210
           ||||||| |||||||| |||||||| |||   ||| | || ||| | || || |||||||
Sbjct: 134 gcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccc 193

                                                                       
Query: 211 cgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcgg 270
           |||||||||| |||||||||||||||||||||||||| |||||||||||||| || || |
Sbjct: 194 cgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccg 253

                                                                       
Query: 271 ctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcca 330
           | ||||||||||||||||||| |||||| ||||| || || |||||  || | |||||||
Sbjct: 254 ccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcca 313

                                                                       
Query: 331 tgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcg 390
           |||| || || || || || || ||||| |||||  | ||  | ||||| || |||||||
Sbjct: 314 tgctcggagccctaggctgcgttttccctgagctattggctaggaacggagtgaagttcg 373

                                                                       
Query: 391 gtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacc 450
           | || || |||||||||||||| || || |||||||||||||| || ||  | |||||| 
Sbjct: 374 gagaagcggtttggttcaaggccggttcacagatcttcagcgacggaggattggactact 433

                                                                       
Query: 451 tcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttg 510
           | |||||||| ||| | || ||||| ||||| ||| | ||||||||||||  ||| ||| 
Sbjct: 434 tgggcaacccgagcttggtccacgctcagagcatcttagccatttgggctactcaagtta 493

                              
Query: 511 tgctcatgggtgccgttga 529
           | |||||||| || |||||
Sbjct: 494 tcctcatgggagctgttga 512

---

>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score =  180 bits (91), Expect = 3e-42
 Identities = 307/379 (81%)
 Strand = Plus / Plus

                                                                       
Query: 151 gcagcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccc 210
           ||||||| |||||||| |||||||| |||   ||| | || ||| | || || |||||||
Sbjct: 134 gcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccc 193

                                                                       
Query: 211 cgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcgg 270
           |||||||||| |||||||||||||||||||||||||| |||||||||||||| || || |
Sbjct: 194 cgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccg 253

                                                                       
Query: 271 ctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcca 330
           | ||||||||||||||||||| |||||| ||||| || || |||||  || | |||||||
Sbjct: 254 ccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcca 313

                                                                       
Query: 331 tgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcg 390
           |||| || || || || || || ||||| |||||  | ||  | ||||| || |||||||
Sbjct: 314 tgctcggagccctaggctgcgttttccctgagctattggctaggaacggagtgaagttcg 373

                                                                       
Query: 391 gtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacc 450
           | || || |||||||||||||| || || |||||||||||||| || ||  | |||||| 
Sbjct: 374 gagaagcggtttggttcaaggccggttcacagatcttcagcgacggaggattggactact 433

                                                                       
Query: 451 tcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttg 510
           | |||||||| ||| | || ||||| ||||| ||| | ||||||||||||  ||| ||| 
Sbjct: 434 tgggcaacccgagcttggtccacgctcagagcatcttagccatttgggctactcaagtta 493

                              
Query: 511 tgctcatgggtgccgttga 529
           | |||||||| || |||||
Sbjct: 494 tcctcatgggggctgttga 512

---

>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420; T31E10.24) mRNA, complete cds
          Length = 969

 Score =  180 bits (91), Expect = 3e-42
 Identities = 307/379 (81%)
 Strand = Plus / Plus

                                                                       
Query: 151 gcagcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccc 210
           ||||||| |||||||| |||||||| |||   ||| | || ||| | || || |||||||
Sbjct: 185 gcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccc 244

                                                                       
Query: 211 cgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcgg 270
           |||||||||| |||||||||||||||||||||||||| |||||||||||||| || || |
Sbjct: 245 cgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccg 304

                                                                       
Query: 271 ctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcca 330
           | ||||||||||||||||||| |||||| ||||| || || |||||  || | |||||||
Sbjct: 305 ccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcca 364

                                                                       
Query: 331 tgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcg 390
           |||| || || || || || || ||||| |||||  | ||  | ||||| || |||||||
Sbjct: 365 tgctcggagccctaggctgcgttttccctgagctattggctaggaacggagtgaagttcg 424

                                                                       
Query: 391 gtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacc 450
           | || || |||||||||||||| || || |||||||||||||| || ||  | |||||| 
Sbjct: 425 gagaagcggtttggttcaaggccggttcacagatcttcagcgacggaggattggactact 484

                                                                       
Query: 451 tcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttg 510
           | |||||||| ||| | || ||||| ||||| ||| | ||||||||||||  ||| ||| 
Sbjct: 485 tgggcaacccgagcttggtccacgctcagagcatcttagccatttgggctactcaagtta 544

                              
Query: 511 tgctcatgggtgccgttga 529
           | |||||||| || |||||
Sbjct: 545 tcctcatgggagctgttga 563

---

>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score =  180 bits (91), Expect = 3e-42
 Identities = 307/379 (81%)
 Strand = Plus / Plus

                                                                       
Query: 151 gcagcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccc 210
           ||||||| |||||||| |||||||| |||   ||| | || ||| | || || |||||||
Sbjct: 185 gcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccc 244

                                                                       
Query: 211 cgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcgg 270
           |||||||||| |||||||||||||||||||||||||| |||||||||||||| || || |
Sbjct: 245 cgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccg 304

                                                                       
Query: 271 ctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcca 330
           | ||||||||||||||||||| |||||| ||||| || || |||||  || | |||||||
Sbjct: 305 ccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcca 364

                                                                       
Query: 331 tgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcg 390
           |||| || || || || || || ||||| |||||  | ||  | ||||| || |||||||
Sbjct: 365 tgctcggagccctaggctgcgttttccctgagctattggctaggaacggagtgaagttcg 424

                                                                       
Query: 391 gtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacc 450
           | || || |||||||||||||| || || |||||||||||||| || ||  | |||||| 
Sbjct: 425 gagaagcggtttggttcaaggccggttcacagatcttcagcgacggaggattggactact 484

                                                                       
Query: 451 tcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttg 510
           | |||||||| ||| | || ||||| ||||| ||| | ||||||||||||  ||| ||| 
Sbjct: 485 tgggcaacccgagcttggtccacgctcagagcatcttagccatttgggctactcaagtta 544

                              
Query: 511 tgctcatgggtgccgttga 529
           | |||||||| || |||||
Sbjct: 545 tcctcatgggagctgttga 563

---

>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score =  180 bits (91), Expect = 3e-42
 Identities = 307/379 (81%)
 Strand = Plus / Plus

                                                                       
Query: 151 gcagcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccc 210
           ||||||| |||||||| |||||||| |||   ||| | || ||| | || || |||||||
Sbjct: 185 gcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccc 244

                                                                       
Query: 211 cgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcgg 270
           |||||||||| |||||||||||||||||||||||||| |||||||||||||| || || |
Sbjct: 245 cgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccg 304

                                                                       
Query: 271 ctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcca 330
           | ||||||||||||||||||| |||||| ||||| || || |||||  || | |||||||
Sbjct: 305 ccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcca 364

                                                                       
Query: 331 tgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcg 390
           |||| || || || || || || ||||| |||||  | ||  | ||||| || |||||||
Sbjct: 365 tgctcggagccctaggctgcgttttccctgagctattggctaggaacggagtgaagttcg 424

                                                                       
Query: 391 gtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacc 450
           | || || |||||||||||||| || || |||||||||||||| || ||  | |||||| 
Sbjct: 425 gagaagcggtttggttcaaggccggttcacagatcttcagcgacggaggattggactact 484

                                                                       
Query: 451 tcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttg 510
           | |||||||| ||| | || ||||| ||||| ||| | ||||||||||||  ||| ||| 
Sbjct: 485 tgggcaacccgagcttggtccacgctcagagcatcttagccatttgggctactcaagtta 544

                              
Query: 511 tgctcatgggtgccgttga 529
           | |||||||| || |||||
Sbjct: 545 tcctcatgggggctgttga 563

---

>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 1024

 Score =  180 bits (91), Expect = 3e-42
 Identities = 307/379 (81%)
 Strand = Plus / Plus

                                                                       
Query: 151 gcagcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccc 210
           ||||||| |||||||| |||||||| |||   ||| | || ||| | || || |||||||
Sbjct: 185 gcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccc 244

                                                                       
Query: 211 cgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcgg 270
           |||||||||| |||||||||||||||||||||||||| |||||||||||||| || || |
Sbjct: 245 cgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccg 304

                                                                       
Query: 271 ctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcca 330
           | ||||||||||||||||||| |||||| ||||| || || |||||  || | |||||||
Sbjct: 305 ccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcca 364

                                                                       
Query: 331 tgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcg 390
           |||| || || || || || || ||||| |||||  | ||  | ||||| || |||||||
Sbjct: 365 tgctcggagccctaggctgcgttttccctgagctattggctaggaacggagtgaagttcg 424

                                                                       
Query: 391 gtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacc 450
           | || || |||||||||||||| || || |||||||||||||| || ||  | |||||| 
Sbjct: 425 gagaagcggtttggttcaaggccggttcacagatcttcagcgacggaggattggactact 484

                                                                       
Query: 451 tcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttg 510
           | |||||||| ||| | || ||||| ||||| ||| | ||||||||||||  ||| ||| 
Sbjct: 485 tgggcaacccgagcttggtccacgctcagagcatcttagccatttgggctactcaagtta 544

                              
Query: 511 tgctcatgggtgccgttga 529
           | |||||||| || |||||
Sbjct: 545 tcctcatgggagctgttga 563

---

>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 995

 Score =  180 bits (91), Expect = 3e-42
 Identities = 307/379 (81%)
 Strand = Plus / Plus

                                                                       
Query: 151 gcagcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccc 210
           ||||||| |||||||| |||||||| |||   ||| | || ||| | || || |||||||
Sbjct: 185 gcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccc 244

                                                                       
Query: 211 cgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcgg 270
           |||||||||| |||||||||||||||||||||||||| |||||||||||||| || || |
Sbjct: 245 cgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccg 304

                                                                       
Query: 271 ctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcca 330
           | ||||||||||||||||||| |||||| ||||| || || |||||  || | |||||||
Sbjct: 305 ccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcca 364

                                                                       
Query: 331 tgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcg 390
           |||| || || || || || || ||||| |||||  | ||  | ||||| || |||||||
Sbjct: 365 tgctcggagccctaggctgcgttttccctgagctattggctaggaacggagtgaagttcg 424

                                                                       
Query: 391 gtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacc 450
           | || || |||||||||||||| || || |||||||||||||| || ||  | |||||| 
Sbjct: 425 gagaagcggtttggttcaaggccggttcacagatcttcagcgacggaggattggactact 484

                                                                       
Query: 451 tcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttg 510
           | |||||||| ||| | || ||||| ||||| ||| | ||||||||||||  ||| ||| 
Sbjct: 485 tgggcaacccgagcttggtccacgctcagagcatcttagccatttgggctactcaagtta 544

                              
Query: 511 tgctcatgggtgccgttga 529
           | |||||||| || |||||
Sbjct: 545 tcctcatgggagctgttga 563

---

>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score =  180 bits (91), Expect = 3e-42
 Identities = 307/379 (81%)
 Strand = Plus / Plus

                                                                       
Query: 151 gcagcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccc 210
           ||||||| |||||||| |||||||| |||   ||| | || ||| | || || |||||||
Sbjct: 185 gcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccc 244

                                                                       
Query: 211 cgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcgg 270
           |||||||||| |||||||||||||||||||||||||| |||||||||||||| || || |
Sbjct: 245 cgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccg 304

                                                                       
Query: 271 ctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcca 330
           | ||||||||||||||||||| |||||| ||||| || || |||||  || | |||||||
Sbjct: 305 ccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcca 364

                                                                       
Query: 331 tgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcg 390
           |||| || || || || || || ||||| |||||  | ||  | ||||| || |||||||
Sbjct: 365 tgctcggagccctaggctgcgttttccctgagctattggctaggaacggagtgaagttcg 424

                                                                       
Query: 391 gtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacc 450
           | || || |||||||||||||| || || |||||||||||||| || ||  | |||||| 
Sbjct: 425 gagaagcggtttggttcaaggccggttcacagatcttcagcgacggaggattggactact 484

                                                                       
Query: 451 tcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttg 510
           | |||||||| ||| | || ||||| ||||| ||| | ||||||||||||  ||| ||| 
Sbjct: 485 tgggcaacccgagcttggtccacgctcagagcatcttagccatttgggctactcaagtta 544

                              
Query: 511 tgctcatgggtgccgttga 529
           | |||||||| || |||||
Sbjct: 545 tcctcatgggagctgttga 563

---

>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS62ZC05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 903

 Score =  180 bits (91), Expect = 3e-42
 Identities = 307/379 (81%)
 Strand = Plus / Plus

                                                                       
Query: 151 gcagcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccc 210
           ||||||| |||||||| |||||||| |||   ||| | || ||| | || || |||||||
Sbjct: 166 gcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccc 225

                                                                       
Query: 211 cgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcgg 270
           |||||||||| |||||||||||||||||||||||||| |||||||||||||| || || |
Sbjct: 226 cgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccg 285

                                                                       
Query: 271 ctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcca 330
           | ||||||||||||||||||| |||||| ||||| || || |||||  || | |||||||
Sbjct: 286 ccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcca 345

                                                                       
Query: 331 tgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcg 390
           |||| || || || || || || ||||| |||||  | ||  | ||||| || |||||||
Sbjct: 346 tgctcggagccctaggctgcgttttccctgagctattggctaggaacggagtgaagttcg 405

                                                                       
Query: 391 gtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacc 450
           | || || |||||||||||||| || || |||||||||||||| || ||  | |||||| 
Sbjct: 406 gagaagcggtttggttcaaggccggttcacagatcttcagcgacggaggattggactact 465

                                                                       
Query: 451 tcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttg 510
           | |||||||| ||| | || ||||| ||||| ||| | ||||||||||||  ||| ||| 
Sbjct: 466 tgggcaacccgagcttggtccacgctcagagcatcttagccatttgggctactcaagtta 525

                              
Query: 511 tgctcatgggtgccgttga 529
           | |||||||| || |||||
Sbjct: 526 tcctcatgggagctgttga 544

---

>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS5ZF09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 885

 Score =  180 bits (91), Expect = 3e-42
 Identities = 307/379 (81%)
 Strand = Plus / Plus

                                                                       
Query: 151 gcagcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccc 210
           ||||||| |||||||| |||||||| |||   ||| | || ||| | || || |||||||
Sbjct: 169 gcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccc 228

                                                                       
Query: 211 cgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcgg 270
           |||||||||| |||||||||||||||||||||||||| |||||||||||||| || || |
Sbjct: 229 cgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccg 288

                                                                       
Query: 271 ctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcca 330
           | ||||||||||||||||||| |||||| ||||| || || |||||  || | |||||||
Sbjct: 289 ccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcca 348

                                                                       
Query: 331 tgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcg 390
           |||| || || || || || || ||||| |||||  | ||  | ||||| || |||||||
Sbjct: 349 tgctcggagccctaggctgcgttttccctgagctattggctaggaacggagtgaagttcg 408

                                                                       
Query: 391 gtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacc 450
           | || || |||||||||||||| || || |||||||||||||| || ||  | |||||| 
Sbjct: 409 gagaagcggtttggttcaaggccggttcacagatcttcagcgacggaggattggactact 468

                                                                       
Query: 451 tcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttg 510
           | |||||||| ||| | || ||||| ||||| ||| | ||||||||||||  ||| ||| 
Sbjct: 469 tgggcaacccgagcttggtccacgctcagagcatcttagccatttgggctactcaagtta 528

                              
Query: 511 tgctcatgggtgccgttga 529
           | |||||||| || |||||
Sbjct: 529 tcctcatgggagctgttga 547

---

>emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II chlorophyll a/b binding
           protein
          Length = 1405

 Score =  180 bits (91), Expect = 3e-42
 Identities = 307/379 (81%)
 Strand = Plus / Plus

                                                                       
Query: 151 gcagcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccc 210
           ||||||| |||||||| |||||||| |||   ||| | || ||| | || || |||||||
Sbjct: 434 gcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccc 493

                                                                       
Query: 211 cgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcgg 270
           |||||||||| |||||||||||||||||||||||||| |||||||||||||| || || |
Sbjct: 494 cgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccg 553

                                                                       
Query: 271 ctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcca 330
           | ||||||||||||||||||| |||||| ||||| || || |||||  || | |||||||
Sbjct: 554 ccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcca 613

                                                                       
Query: 331 tgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcg 390
           |||| || || || || || || ||||| |||||  | ||  | ||||| || |||||||
Sbjct: 614 tgctcggagccctaggctgcgttttccctgagctattggctaggaacggagtgaagttcg 673

                                                                       
Query: 391 gtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacc 450
           | || || |||||||||||||| || || |||||||||||||| || ||  | |||||| 
Sbjct: 674 gagaagcggtttggttcaaggccggttcacagatcttcagcgacggaggattggactact 733

                                                                       
Query: 451 tcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttg 510
           | |||||||| ||| | || ||||| ||||| ||| | ||||||||||||  ||| ||| 
Sbjct: 734 tgggcaacccgagcttggtccacgctcagagcatcttagccatttgggctactcaagtta 793

                              
Query: 511 tgctcatgggtgccgttga 529
           | |||||||| || |||||
Sbjct: 794 tcctcatgggagctgttga 812

---

>gb|M21396.1|SOYCBPA Soybean light-harvesting chlorophyll a/b-binding protein (LHCPII)
           mRNA, 3' end
          Length = 911

 Score =  180 bits (91), Expect = 3e-42
 Identities = 304/375 (81%)
 Strand = Plus / Plus

                                                                       
Query: 189 ggcccactttctggtgagcccccgagctacctgaccggtgagttccccggtgactacggg 248
           |||||| | ||||||||||||||   |||||| || ||||| ||||| |||||||| || 
Sbjct: 117 ggcccattctctggtgagcccccatcctacctcactggtgaattcccaggtgactatggt 176

                                                                       
Query: 249 tgggacaccgctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgag 308
           |||||||| ||||| || || ||||||||||||||||| ||||||||||| || || || 
Sbjct: 177 tgggacactgctgggctttctgctgacccagagacctttgccaagaaccgtgaacttgaa 236

                                                                       
Query: 309 gtgatccattgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctc 368
           || ||||| | | | ||||||||| | || || || || ||||| |||||||| ||  | 
Sbjct: 237 gtcatccactccagatgggccatgttgggagccctgggctgtgttttccccgaactcttg 296

                                                                       
Query: 369 gcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttc 428
           |||||||||||||| ||||||||||| ||    ||||||||||| || |||||||| |||
Sbjct: 297 gcccgcaacggtgtcaagttcggtgaagcgtcgtggttcaaggccgggtctcagatattc 356

                                                                       
Query: 429 agcgagggtggccttgactacctcggcaacccaagccttgtgcacgcccagagtatcctt 488
           || |||||||| ||||||||| | ||||||| ||||||  | || || || || || |||
Sbjct: 357 agtgagggtgggcttgactacttgggcaaccaaagcctgatccatgcacaaagcattctt 416

                                                                       
Query: 489 gccatttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggt 548
           ||||| |||||    || ||| |  | ||||||||||||||||||||||| |||||||||
Sbjct: 417 gccatctgggccacccaagttatcttgatgggtgccgttgagggttaccgtattgctggt 476

                          
Query: 549 ggaccacttggtgag 563
           || || |||||||||
Sbjct: 477 gggcctcttggtgag 491

---

>gb|AY617093.1| Pinus remota chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score =  178 bits (90), Expect = 1e-41
 Identities = 270/330 (81%)
 Strand = Plus / Plus

                                                                       
Query: 215 ctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctga 274
           |||| |||||||||||||||| |||||||||||||||||||| || || || ||||| ||
Sbjct: 221 ctacttgaccggtgagttcccgggtgactacgggtgggacactgcggggctttcggcgga 280

                                                                       
Query: 275 cccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgct 334
            || ||||| || || |||||| | ||  | || |||||||| ||||| ||||| |||||
Sbjct: 281 tccggagacttttgcgaagaacagagaattggaagtgatccactgccggtgggcaatgct 340

                                                                       
Query: 335 tggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtga 394
            ||||| || ||||| || ||||| ||||| || ||  | || || || |||||||| ||
Sbjct: 341 gggcgctctgggttgcgttttcccggagcttctggcgagaaatggagtaaagttcgggga 400

                                                                       
Query: 395 ggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcgg 454
            ||||| ||||||||||| ||| ||||||| ||||||||||| || ||||||||||| ||
Sbjct: 401 agctgtgtggttcaaggcgggagctcagattttcagcgagggagggcttgactacctggg 460

                                                                       
Query: 455 caacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgct 514
            ||||| |||||| | ||||| |||||||| ||||| || ||||| || |||||  | ||
Sbjct: 461 aaaccctagccttatccacgcgcagagtattcttgcaatctgggcatgccaggtcatcct 520

                                         
Query: 515 catgggtgccgttgagggttaccgcattgc 544
           |||||| ||||| ||||||||||| |||||
Sbjct: 521 catgggcgccgtggagggttaccgtattgc 550

---

>gb|AY617092.1| Pinus monophylla chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score =  178 bits (90), Expect = 1e-41
 Identities = 270/330 (81%)
 Strand = Plus / Plus

                                                                       
Query: 215 ctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctga 274
           |||| |||||||||||||||| |||||||||||||||||||| || || || ||||| ||
Sbjct: 221 ctacttgaccggtgagttcccgggtgactacgggtgggacactgcggggctttcggcgga 280

                                                                       
Query: 275 cccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgct 334
            || ||||| || || |||||| | || || || |||||||| ||||| ||||| |||||
Sbjct: 281 tccggagacttttgcgaagaacagagaactggaagtgatccactgccggtgggcaatgct 340

                                                                       
Query: 335 tggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtga 394
            ||||| || ||||| || ||||| ||||| || ||  | || || || |||||||| ||
Sbjct: 341 gggcgctctgggttgcgttttcccrgagcttctggcgagaaatggagtaaagttcgggga 400

                                                                       
Query: 395 ggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcgg 454
            ||||| ||||||||||| ||| ||||||| ||||||||||| || ||||||||||| ||
Sbjct: 401 agctgtgtggttcaaggcgggagctcagattttcagcgagggagggcttgactacctggg 460

                                                                       
Query: 455 caacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgct 514
            ||||| |||||| | ||||| ||||| || ||||| || ||||| || |||||  | ||
Sbjct: 461 aaaccctagccttatccacgcgcagagcattcttgcaatctgggcatgccaggtcatcct 520

                                         
Query: 515 catgggtgccgttgagggttaccgcattgc 544
           |||||| ||||| ||||||||||| |||||
Sbjct: 521 catgggcgccgtggagggttaccgtattgc 550

---

>emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1078

 Score =  178 bits (90), Expect = 1e-41
 Identities = 276/338 (81%)
 Strand = Plus / Plus

                                                                       
Query: 216 tacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgac 275
           ||||| |||||||| ||||| |||||||||||||||||||| || || |||||||| || 
Sbjct: 242 tacctaaccggtgaattcccgggtgactacgggtgggacacggcggggctgtcggcagat 301

                                                                       
Query: 276 ccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgctt 335
           || ||||| ||||| |||||| | ||||| || ||||||||  |||| ||||||||| | 
Sbjct: 302 ccggagacgttcgcgaagaacagagagctggaagtgatccacggccgatgggccatgttg 361

                                                                       
Query: 336 ggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgag 395
           || || || || || || ||||| ||||| || ||| | ||||| || ||||||||||||
Sbjct: 362 ggtgctctgggctgcgtattcccagagctccttgccagaaacggagtaaagttcggtgag 421

                                                                       
Query: 396 gctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggc 455
           || || ||||||||||| ||| ||||||||||||||||||| || ||||||||||| |||
Sbjct: 422 gcggtgtggttcaaggcgggagctcagatcttcagcgagggagggcttgactacctgggc 481

                                                                       
Query: 456 aacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctc 515
           | |||||   |  | ||||| ||||| || |||||||| | ||| || |||||  | |||
Sbjct: 482 agcccaaatttaatccacgcacagagcattcttgccatcttggcatgccaggtcatcctc 541

                                                 
Query: 516 atgggtgccgttgagggttaccgcattgctggtggacc 553
           ||||||||| ||||||| |||||  |||| ||||||||
Sbjct: 542 atgggtgccattgagggctaccgtgttgcgggtggacc 579

---

>dbj|AB013728.1| Cryptomeria japonica mRNA for light-harvesting chlorophyll
           a/b-binding protein of photosystem II, complete cds
          Length = 935

 Score =  178 bits (90), Expect = 1e-41
 Identities = 302/370 (81%), Gaps = 2/370 (0%)
 Strand = Plus / Plus

                                                                       
Query: 198 tctggtgagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacacc 257
           ||||||||||||||   ||||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 198 tctggtgagcccccatcctacctgaccggtgaattccc-ggtgactacgggtgggacacc 256

                                                                       
Query: 258 gctggactgtcggct-gacccagagaccttcgccaagaaccgggagctcgaggtgatcca 316
           || || ||||| ||  ||||||||||| || ||||||||| | ||||| || || || ||
Sbjct: 257 gccggtctgtcagccagacccagagacttttgccaagaacagagagctggaagttattca 316

                                                                       
Query: 317 ttgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaa 376
           |  ||| ||||| ||| | || || ||||| || || ||||| ||||| ||   ||| ||
Sbjct: 317 tgcccggtgggcaatgttgggagctctcgggtgcgttttcccggagcttctgagccgaaa 376

                                                                       
Query: 377 cggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgaggg 436
            ||||| |||||||| || || |||||||||||||| || || ||||||||||| |||||
Sbjct: 377 tggtgtgaagttcggggaagcggtttggttcaaggcgggctcacagatcttcagtgaggg 436

                                                                       
Query: 437 tggccttgactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttg 496
            ||  | |||||  | |||||||| ||||| |||||||| ||||| ||||||||||| ||
Sbjct: 437 cggtttggactatttgggcaaccctagcctggtgcacgcacagagcatccttgccatctg 496

                                                                       
Query: 497 ggcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggtggaccact 556
           ||| || |||||  | |||||||||||||||||||| |||||  | ||||||||||| ||
Sbjct: 497 ggcatgccaggtcatcctcatgggtgccgttgagggctaccgtgtggctggtggaccgct 556

                     
Query: 557 tggtgagatc 566
            || ||||||
Sbjct: 557 cggggagatc 566

---

>gb|DQ018375.1| Pinus gerardiana chloroplast putative light harvesting chlorophyll
           a/b binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 760

 Score =  176 bits (89), Expect = 5e-41
 Identities = 272/333 (81%)
 Strand = Plus / Plus

                                                                       
Query: 215 ctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctga 274
           |||| |||||||||||||||| ||||||||||||||||| || || || || ||||| ||
Sbjct: 221 ctacttgaccggtgagttcccgggtgactacgggtgggatacggcgggcctttcggcgga 280

                                                                       
Query: 275 cccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgct 334
            || ||||| || || |||||| | || || || |||||||| ||||| ||||| |||||
Sbjct: 281 tccggagacatttgcgaagaacagagaactggaagtgatccactgccggtgggcaatgct 340

                                                                       
Query: 335 tggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtga 394
            ||||| || ||||| || ||||| ||||| || ||  | || || || |||||||| ||
Sbjct: 341 gggcgctctgggttgcgttttcccggagcttctggcgagaaatggagtaaagttcgggga 400

                                                                       
Query: 395 ggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcgg 454
           ||| || ||||||||||| ||| ||||||| ||||||||||| || ||||||||||| ||
Sbjct: 401 ggcagtgtggttcaaggcgggagctcagattttcagcgagggagggcttgactacctggg 460

                                                                       
Query: 455 caacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgct 514
            ||||| |||||| | ||||| ||||| || ||||| || ||||| || |||||  | ||
Sbjct: 461 aaaccctagccttatccacgcgcagagcattcttgcaatctgggcatgccaggtcatcct 520

                                            
Query: 515 catgggtgccgttgagggttaccgcattgctgg 547
           |||||| ||||| ||||||||||| ||||||||
Sbjct: 521 catgggcgccgtggagggttaccgtattgctgg 553

---

>emb|X56538.1|PSCABIIC P.sativum Cab-8 gene for photosystemm II chlorophyll a/b binding
            protein
          Length = 2236

 Score =  176 bits (89), Expect = 5e-41
 Identities = 284/349 (81%)
 Strand = Plus / Plus

                                                                        
Query: 215  ctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctga 274
            |||| |||| || |||||||||||||||||||| |||||||| || ||||| || |||||
Sbjct: 1520 ctacttgactggagagttccccggtgactacggttgggacactgccggactctctgctga 1579

                                                                        
Query: 275  cccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgct 334
            ||||||||| ||| |||||||||| ||||| || || ||||| | | | ||||| ||| |
Sbjct: 1580 cccagagacattctccaagaaccgtgagcttgaagtcatccactccagatgggctatgtt 1639

                                                                        
Query: 335  tggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtga 394
             || ||  | || ||||||||||| |||||  |  | |||||||||||||| ||||||||
Sbjct: 1640 gggtgctttgggatgtgtcttcccagagcttttgtctcgcaacggtgttaaattcggtga 1699

                                                                        
Query: 395  ggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcgg 454
             ||||| ||||||||||| |||||||| ||||| ||||||||||| ||||||||| | ||
Sbjct: 1700 agctgtgtggttcaaggcaggatctcaaatctttagcgagggtggacttgactacttggg 1759

                                                                        
Query: 455  caacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgct 514
             ||||||||| | || || || || || ||||||||||| ||||||  ||| ||| |  |
Sbjct: 1760 taacccaagcttggtccatgcacaaagcatccttgccatctgggctactcaagttatctt 1819

                                                             
Query: 515  catgggtgccgttgagggttaccgcattgctggtggaccacttggtgag 563
             ||||| || || || |||||||| ||||| ||||| || |||||||||
Sbjct: 1820 gatgggagctgtcgaaggttaccgtattgccggtgggcctcttggtgag 1868

---

>gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 986

 Score =  176 bits (89), Expect = 5e-41
 Identities = 251/305 (82%)
 Strand = Plus / Plus

                                                                       
Query: 216 tacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgac 275
           ||||||||||| ||||||||||| |||||||| |||||||| ||||| |||||||| |||
Sbjct: 253 tacctgaccggagagttccccggcgactacggatgggacactgctgggctgtcggcggac 312

                                                                       
Query: 276 ccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgctt 335
           |||||||| ||||||| |||||| ||||| ||||||||||| |   | ||||||||||| 
Sbjct: 313 ccagagactttcgccaggaaccgtgagctggaggtgatccactcgaggtgggccatgctc 372

                                                                       
Query: 336 ggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgag 395
           ||||| |||||||| |||||||| ||||| ||  |    ||||| ||  ||||||| |||
Sbjct: 373 ggcgctctcggttgcgtcttcccggagctcctgtcgaagaacggggtccagttcggggag 432

                                                                       
Query: 396 gctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggc 455
           || || ||||||||||| || || |||||||||   ||||| || || |||||||| || 
Sbjct: 433 gcggtgtggttcaaggccgggtcccagatcttctcggagggagggctcgactacctgggg 492

                                                                       
Query: 456 aacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctc 515
           ||||| | ||| || |||||||| || |||||||| || |||||||| |||||||| || 
Sbjct: 493 aaccccaacctggtccacgcccaaagcatccttgcgatctgggcttgccaggttgtccta 552

                
Query: 516 atggg 520
           |||||
Sbjct: 553 atggg 557

---

>gb|DQ124219.1| Fagus sylvatica putative chlorophyll a/b-binding protein mRNA,
           partial cds
          Length = 780

 Score =  174 bits (88), Expect = 2e-40
 Identities = 229/276 (82%)
 Strand = Plus / Plus

                                                                       
Query: 189 ggcccactttctggtgagcccccgagctacctgaccggtgagttccccggtgactacggg 248
           |||||| | ||||||||||||||    ||||| || ||||| ||||| |||||||| || 
Sbjct: 163 ggcccattctctggtgagcccccatcttaccttactggtgaattccctggtgactatggc 222

                                                                       
Query: 249 tgggacaccgctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgag 308
           |||||||| ||||| || || ||||||||||| ||||| ||||||||||| ||||| || 
Sbjct: 223 tgggacactgctgggctttcagctgacccagaaacctttgccaagaaccgtgagcttgaa 282

                                                                       
Query: 309 gtgatccattgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctc 368
           |||||||| | | | |||||||||||||| || || || ||||||||||| |||||  | 
Sbjct: 283 gtgatccactccagatgggccatgcttggagctcttgggtgtgtcttccctgagctcttg 342

                                                                       
Query: 369 gcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttc 428
           ||||| ||||| |||||||| |||||||| |||||||||||||||||| | || || |||
Sbjct: 343 gcccgtaacggggttaagtttggtgaggccgtttggttcaaggctggagcccaaattttc 402

                                               
Query: 429 agcgagggtggccttgactacctcggcaacccaagc 464
           || || ||||| ||||||||| | || |||||||||
Sbjct: 403 agtgaaggtgggcttgactacttgggtaacccaagc 438



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                           
Query: 516 atgggtgccgttgagggttaccgcattgctggtggaccacttggtgag 563
           |||||||| |||||||||||||| ||||||||||| ||||||||||||
Sbjct: 490 atgggtgctgttgagggttaccgtattgctggtgggccacttggtgag 537

---

>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB71ZG07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 919

 Score =  172 bits (87), Expect = 9e-40
 Identities = 306/379 (80%)
 Strand = Plus / Minus

                                                                       
Query: 151 gcagcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccc 210
           ||||||| |||||||| |||||||| |||   ||| | || ||| | || || |||||||
Sbjct: 750 gcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccc 691

                                                                       
Query: 211 cgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcgg 270
           |||||||||| |||||||||||||||||||||||||| |||||||||||||| || || |
Sbjct: 690 cgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccg 631

                                                                       
Query: 271 ctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcca 330
           | ||||||||||||||||||| | |||| ||||| || || |||||  || | |||||||
Sbjct: 630 ccgacccagagaccttcgccagggaccgtgagctagaagttatccacagcagatgggcca 571

                                                                       
Query: 331 tgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcg 390
           |||| || || || || || || ||||| |||||  | ||  | ||||| || |||||||
Sbjct: 570 tgctcggagccctaggctgcgttttccctgagctattggctaggaacggagtgaagttcg 511

                                                                       
Query: 391 gtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacc 450
           | || || |||||||||||||| || || |||||||||||||| || ||  | |||||| 
Sbjct: 510 gagaagcggtttggttcaaggccggttcacagatcttcagcgacggaggattggactact 451

                                                                       
Query: 451 tcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttg 510
           | |||||||| ||| | || ||||| ||||| ||| | ||||||||||||  ||| ||| 
Sbjct: 450 tgggcaacccgagcttggtccacgctcagagcatcttagccatttgggctactcaagtta 391

                              
Query: 511 tgctcatgggtgccgttga 529
           | |||||||| || |||||
Sbjct: 390 tcctcatgggagctgttga 372

---

>dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light harvesting a/b binding
           protein, complete cds
          Length = 1055

 Score =  172 bits (87), Expect = 9e-40
 Identities = 264/323 (81%)
 Strand = Plus / Plus

                                                                       
Query: 216 tacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgac 275
           |||||||||||||| |||||||||||||||||||||||||| || || || ||||| || 
Sbjct: 303 tacctgaccggtgaattccccggtgactacgggtgggacacggcggggctttcggcggat 362

                                                                       
Query: 276 ccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgctt 335
           || ||||| ||||| |||||| | ||||| || |||||||| | ||| ||||| ||||| 
Sbjct: 363 ccggagacgttcgcgaagaacagagagctggaagtgatccactcccggtgggcgatgctg 422

                                                                       
Query: 336 ggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgag 395
           ||||| ||||| || || ||||| ||||| || ||  | || || || ||||||||||||
Sbjct: 423 ggcgctctcgggtgcgtattcccggagcttcttgcgaggaatggagtaaagttcggtgag 482

                                                                       
Query: 396 gctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggc 455
           || || ||||||||||| ||| ||||||||||||||||||| || ||||||||||| || 
Sbjct: 483 gcggtgtggttcaaggcgggagctcagatcttcagcgagggagggcttgactacctaggg 542

                                                                       
Query: 456 aacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctc 515
           | ||||    |  | ||||||||||| || |||||||| ||||| || |||||  | |||
Sbjct: 543 agcccacagttgatccacgcccagagcattcttgccatctgggcatgccaggtcatcctc 602

                                  
Query: 516 atgggtgccgttgagggttaccg 538
           ||||||||| | ||||| |||||
Sbjct: 603 atgggtgccatcgagggctaccg 625

---

>emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding protein
          Length = 2774

 Score =  168 bits (85), Expect = 1e-38
 Identities = 271/333 (81%)
 Strand = Plus / Plus

                                                                        
Query: 204  gagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctgga 263
            |||||||| |||||||| || || ||||||||||| ||||| || |||||||||||||| 
Sbjct: 1765 gagcccccaagctaccttactggagagttccccggagactatggatgggacaccgctggt 1824

                                                                        
Query: 264  ctgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgt 323
            || || |||||||| ||||| ||||| |  ||||| ||||| || || ||||| ||| | 
Sbjct: 1825 ctatcagctgaccccgagactttcgctagaaaccgtgagctagaagttatccactgcaga 1884

                                                                        
Query: 324  tgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgtt 383
            ||||||||||| || || || ||||| || ||||| |||||  | || || ||||| || 
Sbjct: 1885 tgggccatgctcggagccctaggttgcgttttccctgagctattggctcgtaacggagtc 1944

                                                                        
Query: 384  aagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggcctt 443
            |||||||| || || |||||||||||||| || || |||||||||||||| || || |||
Sbjct: 1945 aagttcggagaagcggtttggttcaaggccggttcacagatcttcagcgaaggaggactt 2004

                                                                        
Query: 444  gactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgt 503
            |||||| | |||||||||||| | || ||||| ||||| ||| | |||||||||||   |
Sbjct: 2005 gactacttgggcaacccaagcttggtccacgctcagagcatcttagccatttgggccact 2064

                                             
Query: 504  caggttgtgctcatgggtgccgttgagggttac 536
            |||||  | |||||||| || ||||||||||||
Sbjct: 2065 caggtgatcctcatgggagctgttgagggttac 2097

---

>gb|AY617091.1| Pinus strobus chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score =  168 bits (85), Expect = 1e-38
 Identities = 271/333 (81%)
 Strand = Plus / Plus

                                                                       
Query: 215 ctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctga 274
           |||| |||||||||||||||| |||||||||||||||||||| || || || ||||| ||
Sbjct: 221 ctacttgaccggtgagttcccgggtgactacgggtgggacacggcggggctttcggcgga 280

                                                                       
Query: 275 cccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgct 334
            || ||||| || || |||||| | || || || ||||||||  |||| ||||| |||||
Sbjct: 281 tccggagacatttgcgaagaacagagaactggaagtgatccacagccggtgggcaatgct 340

                                                                       
Query: 335 tggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtga 394
            ||||| || ||||| || ||||| ||||| || ||    || || || |||||||| ||
Sbjct: 341 gggcgctctgggttgcgttttcccggagcttctggcgaaaaatggagtaaagttcggmga 400

                                                                       
Query: 395 ggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcgg 454
           ||| || ||||||||||| ||| ||||||| ||||||||||| || ||||||||||| ||
Sbjct: 401 ggcagtgtggttcaaggcgggagctcagattttcagcgagggagggcttgactacctggg 460

                                                                       
Query: 455 caacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgct 514
            ||||| |||||| | ||||| ||||| || ||||| || ||||| || |||||  | ||
Sbjct: 461 aaaccctagccttatccacgcgcagagcattcttgcaatctgggcatgccaggtcatcct 520

                                            
Query: 515 catgggtgccgttgagggttaccgcattgctgg 547
           |||||| ||||| ||||||||||| ||||||||
Sbjct: 521 catgggcgccgtggagggttaccgtattgctgg 553

---

>gb|AY617090.1| Pinus monticola chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score =  168 bits (85), Expect = 1e-38
 Identities = 271/333 (81%)
 Strand = Plus / Plus

                                                                       
Query: 215 ctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctga 274
           |||| |||||||||||||||| |||||||||||||||||||| || || || ||||| ||
Sbjct: 221 ctacttgaccggtgagttcccgggtgactacgggtgggacacggcggggctttcggcgga 280

                                                                       
Query: 275 cccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgct 334
            || ||||| || || |||||| | || || || ||||||||  |||| ||||| |||||
Sbjct: 281 tccggagacatttgcgaagaacagagaactggaagtgatccacagccggtgggcaatgct 340

                                                                       
Query: 335 tggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtga 394
            ||||| || ||||| || ||||| ||||| || ||    || || || |||||||| ||
Sbjct: 341 gggcgctctgggttgcgttttcccggagcttctggcgaaaaatggagtaaagttcgggga 400

                                                                       
Query: 395 ggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcgg 454
           ||| || ||||||||||| ||| ||||||| ||||||||||| || ||||||||||| ||
Sbjct: 401 ggcagtgtggttcaaggcgggagctcagattttcagcgagggagggcttgactaccttgg 460

                                                                       
Query: 455 caacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgct 514
            ||||| |||||| | ||||| ||||| || ||||| || ||||| || |||||  | ||
Sbjct: 461 aaaccctagccttatccacgcgcagagcattcttgcaatctgggcatgccaggtcatcct 520

                                            
Query: 515 catgggtgccgttgagggttaccgcattgctgg 547
           |||||| ||||| ||||||||||| ||||||||
Sbjct: 521 catgggcgccgtggagggttaccgtattgctgg 553

---

>gb|AY617089.1| Pinus lambertiana chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score =  168 bits (85), Expect = 1e-38
 Identities = 271/333 (81%)
 Strand = Plus / Plus

                                                                       
Query: 215 ctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctga 274
           |||| |||||||||||||||| |||||||||||||||||||| || || || ||||| ||
Sbjct: 221 ctacttgaccggtgagttcccgggtgactacgggtgggacacggcggggctttcggcgga 280

                                                                       
Query: 275 cccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgct 334
            || ||||| || || |||||| | || || || ||||||||  |||| ||||| |||||
Sbjct: 281 tccggagacatttgcgaagaacagagaactggaagtgatccacagccggtgggcaatgct 340

                                                                       
Query: 335 tggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtga 394
            ||||| || ||||| || ||||| ||||| || ||    || || || |||||||| ||
Sbjct: 341 gggcgcyctgggttgcgttttcccggagcttctggcgaaaaatggagtaaagttcgggga 400

                                                                       
Query: 395 ggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcgg 454
           ||| || ||||||||||| ||| ||||||| ||||||||||| || ||||||||||| ||
Sbjct: 401 ggcagtgtggttcaaggcgggagctcagattttcagcgagggagggcttgactaccttgg 460

                                                                       
Query: 455 caacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgct 514
            ||||| |||||| | ||||| ||||| || ||||| || ||||| || |||||  | ||
Sbjct: 461 aaaccctagccttatccacgcgcagagcattcttgcaatctgggcatgccaggtcatcct 520

                                            
Query: 515 catgggtgccgttgagggttaccgcattgctgg 547
           |||||| ||||| ||||||||||| ||||||||
Sbjct: 521 catgggcgccgtggagggttaccgtattgctgg 553

---

>gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score =  168 bits (85), Expect = 1e-38
 Identities = 271/333 (81%)
 Strand = Plus / Plus

                                                                       
Query: 215 ctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctga 274
           |||| |||||||||||||||| |||||||||||||||||||| || || || ||||| ||
Sbjct: 221 ctacttgaccggtgagttcccgggtgactacgggtgggacacggcggggctttcggcaga 280

                                                                       
Query: 275 cccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgct 334
            || ||||| || || |||||| | || || || ||||||||  |||| ||||| |||||
Sbjct: 281 tccggagacatttgcgaagaacagagaactggaagtgatccacagccggtgggcaatgct 340

                                                                       
Query: 335 tggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtga 394
            ||||| || ||||| || ||||| ||||| || ||    || || || |||||||| ||
Sbjct: 341 gggcgctctgggttgcgttttcccggagcttctggcgaaaaatggagtaaagttcgggga 400

                                                                       
Query: 395 ggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcgg 454
           ||| || ||||||||||| ||| ||||||| ||||||||||| || ||||||||||| ||
Sbjct: 401 ggcagtgtggttcaaggcgggagctcagattttcagcgagggagggcttgactaccttgg 460

                                                                       
Query: 455 caacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgct 514
            ||||| |||||| | ||||| ||||| || ||||| || ||||| || |||||  | ||
Sbjct: 461 aaaccctagccttatccacgcgcagagcattcttgcaatctgggcatgccaggtcatcct 520

                                            
Query: 515 catgggtgccgttgagggttaccgcattgctgg 547
           |||||| ||||| ||||||||||| ||||||||
Sbjct: 521 catgggcgccgtggagggttaccgtattgctgg 553

---

>emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b-binding polypeptide
          Length = 2775

 Score =  168 bits (85), Expect = 1e-38
 Identities = 271/333 (81%)
 Strand = Plus / Plus

                                                                        
Query: 204  gagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctgga 263
            |||||||| |||||||| || || ||||||||||| ||||| || |||||||||||||| 
Sbjct: 1766 gagcccccaagctaccttactggagagttccccggagactatggatgggacaccgctggt 1825

                                                                        
Query: 264  ctgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgt 323
            || || |||||||| ||||| ||||| |  ||||| ||||| || || ||||| ||| | 
Sbjct: 1826 ctatcagctgaccccgagactttcgctagaaaccgtgagctagaagttatccactgcaga 1885

                                                                        
Query: 324  tgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgtt 383
            ||||||||||| || || || ||||| || ||||| |||||  | || || ||||| || 
Sbjct: 1886 tgggccatgctcggagccctaggttgcgttttccctgagctattggctcgtaacggagtc 1945

                                                                        
Query: 384  aagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggcctt 443
            |||||||| || || |||||||||||||| || || |||||||||||||| || || |||
Sbjct: 1946 aagttcggagaagcggtttggttcaaggccggttcacagatcttcagcgaaggaggactt 2005

                                                                        
Query: 444  gactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgt 503
            |||||| | |||||||||||| | || ||||| ||||| ||| | |||||||||||   |
Sbjct: 2006 gactacttgggcaacccaagcttggtccacgctcagagcatcttagccatttgggccact 2065

                                             
Query: 504  caggttgtgctcatgggtgccgttgagggttac 536
            |||||  | |||||||| || ||||||||||||
Sbjct: 2066 caggtgatcctcatgggagctgttgagggttac 2098

---

>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b-
           binding protein ( LHCP )
          Length = 1030

 Score =  168 bits (85), Expect = 1e-38
 Identities = 265/325 (81%)
 Strand = Plus / Plus

                                                                       
Query: 215 ctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctga 274
           |||||||||||| ||||||||||| ||||||||||||||||| || || ||    || ||
Sbjct: 378 ctacctgaccggcgagttccccggagactacgggtgggacacggccgggctcagcgccga 437

                                                                       
Query: 275 cccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgct 334
           ||| |||||||||||||||||||| ||||| |||||||||||  | || ||||| |||||
Sbjct: 438 ccccgagaccttcgccaagaaccgcgagctggaggtgatccacgggcgctgggcgatgct 497

                                                                       
Query: 335 tggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtga 394
            || |||||||| || |||||||| ||||| |||||||| ||||| || ||||| || ||
Sbjct: 498 gggggcgctcgggtgcgtcttcccggagctcctcgcccggaacggcgtcaagtttggcga 557

                                                                       
Query: 395 ggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcgg 454
           ||| || |||||||||   || || |||||||| |||||||| || ||  | ||||| ||
Sbjct: 558 ggccgtgtggttcaagaagggttcccagatctttagcgagggcgggctgcagtacctggg 617

                                                                       
Query: 455 caacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgct 514
            |||||   ||| || ||||| ||||| ||||| ||||| ||||| || ||||| || ||
Sbjct: 618 gaacccctccctggtccacgcgcagagcatcctggccatctgggcctgccaggtggtcct 677

                                    
Query: 515 catgggtgccgttgagggttaccgc 539
           |||||||||||| || || ||||||
Sbjct: 678 catgggtgccgtcgaaggctaccgc 702

---

>gb|M16887.1|SIPCAB White campion chlorophyll a/b-binding protein precursor (CAB) mRNA,
           partial cds
          Length = 642

 Score =  168 bits (85), Expect = 1e-38
 Identities = 250/305 (81%)
 Strand = Plus / Plus

                                                                       
Query: 216 tacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgac 275
           ||||| || ||||| ||||||||||| ||||| |||||||| |||||||| || ||||||
Sbjct: 226 taccttacaggtgaattccccggtgattacggttgggacactgctggactctcagctgac 285

                                                                       
Query: 276 ccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgctt 335
           ||||| || ||||| |||||||| ||||| ||||||||||| ||| | ||||| ||||||
Sbjct: 286 ccagaaacattcgctaagaaccgtgagctagaggtgatccactgcagatgggcaatgctt 345

                                                                       
Query: 336 ggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgag 395
           || || || || || || ||||||||||| || ||    ||||| || || || || |||
Sbjct: 346 ggtgcccttggatgcgttttccccgagctcctggctaagaacggagtcaaatttggagag 405

                                                                       
Query: 396 gctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggc 455
           || |||||||||||||| || |||||||| |||   |||||||| ||||||||||| |||
Sbjct: 406 gcagtttggttcaaggcagggtctcagatattccaagagggtggtcttgactaccttggc 465

                                                                       
Query: 456 aacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctc 515
           ||||||| ||| || || || ||||| || || ||||| |||||||| || ||||| |||
Sbjct: 466 aacccaaacctggtccatgctcagagcattctagccatctgggcttgccaagttgtcctc 525

                
Query: 516 atggg 520
           |||||
Sbjct: 526 atggg 530

---

>gb|AF162200.1|AF162200 Lactuca sativa light-harvesting chlorophyll a/b binding protein
           mRNA, complete sequence; nuclear gene for chloroplast
           product
          Length = 643

 Score =  167 bits (84), Expect = 5e-38
 Identities = 207/248 (83%)
 Strand = Plus / Plus

                                                                       
Query: 216 tacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgac 275
           ||||||||||||| |||||||||||||||||| |||||||| ||||| || || ||||| 
Sbjct: 33  tacctgaccggtgggttccccggtgactacggttgggacactgctgggctctctgctgat 92

                                                                       
Query: 276 ccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgctt 335
           || || || |||||||||||||| ||||| ||||| |||||  || | ||||||||||| 
Sbjct: 93  cctgaaacattcgccaagaaccgtgagcttgaggtcatccacagcagatgggccatgctc 152

                                                                       
Query: 336 ggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgag 395
           || || || || || ||||||||||| ||  | || || || ||||| ||||| ||||||
Sbjct: 153 ggagctcttgggtgcgtcttccccgaactcttggcgcgtaatggtgtcaagtttggtgag 212

                                                                       
Query: 396 gctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggc 455
           ||||| ||||||||||||||||| |||||||| || |||| ||| ||||||||| | || 
Sbjct: 213 gctgtatggttcaaggctggatcccagatctttagtgaggatggtcttgactacttgggg 272

                   
Query: 456 aacccaag 463
           ||||||||
Sbjct: 273 aacccaag 280



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 73/86 (84%), Gaps = 1/86 (1%)
 Strand = Plus / Plus

                                                                       
Query: 516 atgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgaccca 575
           |||||||| ||||| |||||| | |||||||||||||| ||||||||| | || ||||||
Sbjct: 333 atgggtgcagttgaaggttacagaattgctggtggacctcttggtgaggtagttgaccca 392

                                     
Query: 576 ttataccccgggtggcagcttcgacc 601
            | || ||| ||||| ||||||||||
Sbjct: 393 cttta-ccctggtggtagcttcgacc 417

---

>dbj|AB006081.1| Fagus crenata mRNA for chlorophyll a/b-binding protein, complete
           cds
          Length = 1010

 Score =  167 bits (84), Expect = 5e-38
 Identities = 228/276 (82%)
 Strand = Plus / Plus

                                                                       
Query: 189 ggcccactttctggtgagcccccgagctacctgaccggtgagttccccggtgactacggg 248
           |||||| | ||||||||||||||    ||||| || ||||| ||||| |||||||| || 
Sbjct: 219 ggcccattctctggtgagcccccatcttaccttactggtgaattccctggtgactatggc 278

                                                                       
Query: 249 tgggacaccgctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgag 308
           |||||||| ||||| || || ||||||||||| ||||| || |||||||| ||||| || 
Sbjct: 279 tgggacactgctgggctatcagctgacccagaaacctttgctaagaaccgtgagcttgaa 338

                                                                       
Query: 309 gtgatccattgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctc 368
           |||||||| | | | |||||||||||||| || || || ||||||||||| |||||  | 
Sbjct: 339 gtgatccactccagatgggccatgcttggagctcttgggtgtgtcttccctgagctcttg 398

                                                                       
Query: 369 gcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttc 428
           ||||| ||||| |||||||| |||||||| |||||||||||||||||| | || || |||
Sbjct: 399 gcccgtaacggggttaagtttggtgaggccgtttggttcaaggctggagcccaaattttc 458

                                               
Query: 429 agcgagggtggccttgactacctcggcaacccaagc 464
           || || ||||| ||||||||| | || |||||||||
Sbjct: 459 agtgaaggtgggcttgactacttgggtaacccaagc 494



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                           
Query: 516 atgggtgccgttgagggttaccgcattgctggtggaccacttggtgag 563
           |||||||| |||||||||||||| ||||||||||| ||||||||||||
Sbjct: 546 atgggtgctgttgagggttaccgtattgctggtgggccacttggtgag 593



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                        
Query: 24  accatgtccctctcttccccagcctttgccggcaaggtagtgaag 68
           |||||| | |||||||||||| |  |||||||||||| |||||||
Sbjct: 60  accatggctctctcttccccatctcttgccggcaaggcagtgaag 104

---

>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.3 mRNA, complete cds
          Length = 3299

 Score =  165 bits (83), Expect = 2e-37
 Identities = 233/283 (82%)
 Strand = Plus / Minus

                                                                        
Query: 151  gcagcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccc 210
            ||||||| |||||||| |||||||| |||   ||| | || ||| | || || |||||||
Sbjct: 3110 gcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccc 3051

                                                                        
Query: 211  cgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcgg 270
            |||||||||| |||||||||||||||||||||||||| |||||||||||||| || || |
Sbjct: 3050 cgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccg 2991

                                                                        
Query: 271  ctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcca 330
            | ||||||||||||||||||| |||||| ||||| || || |||||  || | |||||||
Sbjct: 2990 ccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcca 2931

                                                                        
Query: 331  tgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcg 390
            |||| || || || || || || ||||| |||||  | ||  | ||||| || |||||||
Sbjct: 2930 tgctcggagccctaggctgcgttttccctgagctattggctaggaacggagtgaagttcg 2871

                                                       
Query: 391  gtgaggctgtttggttcaaggctggatctcagatcttcagcga 433
            | || || |||||||||||||| || || ||||||||||||||
Sbjct: 2870 gagaagcggtttggttcaaggccggttcacagatcttcagcga 2828

---

>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant
           AT2G34420.2 mRNA, complete cds
          Length = 1312

 Score =  165 bits (83), Expect = 2e-37
 Identities = 233/283 (82%)
 Strand = Plus / Plus

                                                                       
Query: 151 gcagcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccc 210
           ||||||| |||||||| |||||||| |||   ||| | || ||| | || || |||||||
Sbjct: 189 gcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccc 248

                                                                       
Query: 211 cgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcgg 270
           |||||||||| |||||||||||||||||||||||||| |||||||||||||| || || |
Sbjct: 249 cgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccg 308

                                                                       
Query: 271 ctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcca 330
           | ||||||||||||||||||| |||||| ||||| || || |||||  || | |||||||
Sbjct: 309 ccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcca 368

                                                                       
Query: 331 tgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcg 390
           |||| || || || || || || ||||| |||||  | ||  | ||||| || |||||||
Sbjct: 369 tgctcggagccctaggctgcgttttccctgagctattggctaggaacggagtgaagttcg 428

                                                      
Query: 391 gtgaggctgtttggttcaaggctggatctcagatcttcagcga 433
           | || || |||||||||||||| || || ||||||||||||||
Sbjct: 429 gagaagcggtttggttcaaggccggttcacagatcttcagcga 471

---

>gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/b binding protein
           (CipLhcb1) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 975

 Score =  165 bits (83), Expect = 2e-37
 Identities = 344/431 (79%)
 Strand = Plus / Plus

                                                                       
Query: 133 ccaagaaggttgcctccagcagcccgtggtacggctctgaccgggtcctctacctcggcc 192
           ||||| ||||| ||||| | ||||| ||||||||| | ||||| |||   ||| | ||||
Sbjct: 171 ccaagcaggtttcctccggaagcccatggtacggcccagaccgtgtcaagtacttgggcc 230

                                                                       
Query: 193 cactttctggtgagcccccgagctacctgaccggtgagttccccggtgactacgggtggg 252
           || | || || |||||||||  |||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 231 cattctccggcgagcccccgtcctacctcaccggcgagttcccaggtgactacggttggg 290

                                                                       
Query: 253 acaccgctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtga 312
           |||| ||||| || || |||||||||||||||||||||| |||||| ||| | || || |
Sbjct: 291 acactgctgggctttccgctgacccagagaccttcgccaggaaccgtgagttggaagtca 350

                                                                       
Query: 313 tccattgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgccc 372
           |||| | | | ||||||||||| || ||  | ||    ||||||||||| |   |  |||
Sbjct: 351 tccactccaggtgggccatgctgggagccttgggcatcgtcttccccgaacccttgtccc 410

                                                                       
Query: 373 gcaacggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcg 432
           |||||||||| || ||||| ||||| || |||||||| || || || |||||||||||||
Sbjct: 411 gcaacggtgtgaaattcggcgaggccgtctggttcaaagccggttcccagatcttcagcg 470

                                                                       
Query: 433 agggtggccttgactacctcggcaacccaagccttgtgcacgcccagagtatccttgcca 492
           ||||||| || |||||| | ||||||||||||||  | ||||| ||||| ||||| ||||
Sbjct: 471 agggtgggctcgactacttgggcaacccaagcctcatccacgctcagagcatcctcgcca 530

                                                                       
Query: 493 tttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggtggac 552
           | |||||    || ||  | |||||||| ||||| ||||||||||| ||||| ||||| |
Sbjct: 531 tctgggccacccaagtcatcctcatgggcgccgtcgagggttaccgtattgccggtgggc 590

                      
Query: 553 cacttggtgag 563
           | || ||||||
Sbjct: 591 ctctcggtgag 601

---

>dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene for light-harvesting
            chlorophyll a/b-binding protein 2, complete cds
          Length = 3125

 Score =  165 bits (83), Expect = 2e-37
 Identities = 161/187 (86%)
 Strand = Plus / Plus

                                                                        
Query: 377  cggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgaggg 436
            |||||| ||||||||||| ||||| ||||||||||| ||| |||| ||||||||||||||
Sbjct: 2589 cggtgtgaagttcggtgaagctgtgtggttcaaggccggagctcaaatcttcagcgaggg 2648

                                                                        
Query: 437  tggccttgactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttg 496
            ||| ||||| ||| | |||||||| |||||||||||||| ||||| ||||| ||||| ||
Sbjct: 2649 tggtcttgattacttgggcaaccccagccttgtgcacgctcagagcatcctggccatctg 2708

                                                                        
Query: 497  ggcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggtggaccact 556
            |||||| |||||| | || ||||| || ||||||||||||||  |||| ||||||||| |
Sbjct: 2709 ggcttgccaggttatccttatgggagctgttgagggttaccgtgttgccggtggaccatt 2768

                   
Query: 557  tggtgag 563
             ||||||
Sbjct: 2769 gggtgag 2775



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Plus

                                                                        
Query: 224  cggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgacccagagac 283
            |||||||||| | ||||||||||| ||||||||||||||||| ||  | ||||| |||||
Sbjct: 2436 cggtgagttcgctggtgactacggatgggacaccgctggactctcctccgaccccgagac 2495

               
Query: 284  ctt 286
            |||
Sbjct: 2496 ctt 2498

---

>emb|BX814757.1|CNS0AEAM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB92ZG04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 409

 Score =  163 bits (82), Expect = 8e-37
 Identities = 193/230 (83%)
 Strand = Plus / Minus

                                                                       
Query: 204 gagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctgga 263
           ||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| 
Sbjct: 231 gagcccccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggt 172

                                                                       
Query: 264 ctgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgt 323
           || || || ||||||||||||||||||| |||||| ||||| || || |||||  || | 
Sbjct: 171 ctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcaga 112

                                                                       
Query: 324 tgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgtt 383
           ||||||||||| || || || || || || ||||| |||||  | ||  | ||||| || 
Sbjct: 111 tgggccatgctcggagccctaggctgcgttttccctgagctattggctaggaacggagtg 52

                                                             
Query: 384 aagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcga 433
           |||||||| || || |||||||||||||| || || ||||||||||||||
Sbjct: 51  aagttcggagaagcggtttggttcaaggccggttcacagatcttcagcga 2

---

>gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score =  161 bits (81), Expect = 3e-36
 Identities = 270/333 (81%)
 Strand = Plus / Plus

                                                                       
Query: 215 ctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctga 274
           |||| |||||||||||||||| |||||||||||||||||||| || || || ||||| ||
Sbjct: 221 ctacttgaccggtgagttcccgggtgactacgggtgggacacggcggggctttcggcgga 280

                                                                       
Query: 275 cccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgct 334
            || ||||| || || |||||| | || || || ||||||||  |||| ||||| |||||
Sbjct: 281 tccggagacatttgcgaagaacagagaactggaagtgatccacagccggtgggcaatgct 340

                                                                       
Query: 335 tggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtga 394
            ||||| || ||||| || ||||| ||||| || ||    || || || |||||||| ||
Sbjct: 341 gggcgctctgggttgcgttttcccggagcttctggcgaaaaatggagtaaagttcgggga 400

                                                                       
Query: 395 ggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcgg 454
           ||| || ||||||||||| ||| ||||||| ||||||||||| || |||||| |||| ||
Sbjct: 401 ggcagtgtggttcaaggcgggagctcagattttcagcgagggagggcttgaccaccttgg 460

                                                                       
Query: 455 caacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgct 514
            ||||| |||||| | ||||| ||||| || ||||| || ||||| || |||||  | ||
Sbjct: 461 aaaccctagccttatccacgcgcagagcattcttgcaatctgggcatgccaggtcatcct 520

                                            
Query: 515 catgggtgccgttgagggttaccgcattgctgg 547
           |||||| ||||| ||||||||||| ||||||||
Sbjct: 521 catgggcgccgtggagggttaccgtattgctgg 553

---

>dbj|AB012639.1| Nicotiana sylvestris Lhcb1*7 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3663

 Score =  159 bits (80), Expect = 1e-35
 Identities = 278/344 (80%)
 Strand = Plus / Plus

                                                                        
Query: 220  tgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgacccag 279
            |||| ||||| || || ||||| || || ||||| || |||||||| ||||| || ||||
Sbjct: 2757 tgactggtgaatttcctggtgattatggttgggatactgctggactttcggccgatccag 2816

                                                                        
Query: 280  agaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgcttggcg 339
            | || || ||||| ||||| ||||| ||||| || || ||| | |||||||||||||| |
Sbjct: 2817 aaacttttgccaaaaaccgtgagctagaggttattcactgcagatgggccatgcttggag 2876

                                                                        
Query: 340  cgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgaggctg 399
            | || ||||| ||||| || |||||  | ||||| |||||||| || |||||||| ||||
Sbjct: 2877 ctcttggttgcgtctttcctgagctcttagcccgtaacggtgtcaaattcggtgaagctg 2936

                                                                        
Query: 400  tttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggcaacc 459
            | |||||||| |||||||| ||||| || || |||||||| ||||||||  | |||||||
Sbjct: 2937 tatggttcaaagctggatcacagatttttagtgagggtggacttgactatttgggcaacc 2996

                                                                        
Query: 460  caagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctcatgg 519
            ||||  | || ||||| || || ||| | || ||||||||||| || |||||| | ||||
Sbjct: 2997 caagtttggtccacgcacaaagcatcttggcaatttgggcttgccaagttgtgttgatgg 3056

                                                        
Query: 520  gtgccgttgagggttaccgcattgctggtggaccacttggtgag 563
            | ||||| |||||||||||  |||||||||| || |||||||||
Sbjct: 3057 gagccgtcgagggttaccgtgttgctggtgggcctcttggtgag 3100

---

>gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosystem II chlorophyll
           A/B-binding protein gene, complete cds
          Length = 1260

 Score =  157 bits (79), Expect = 5e-35
 Identities = 277/343 (80%)
 Strand = Plus / Plus

                                                                       
Query: 220 tgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgacccag 279
           |||||||||||||||| |||||||| || |||||||| |||||||| || ||||| || |
Sbjct: 400 tgaccggtgagttccctggtgactatggttgggacactgctggactctcagctgatcccg 459

                                                                       
Query: 280 agaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgcttggcg 339
           ||||||| || | |||||| |||||||| || || || ||| | ||||||||| | || |
Sbjct: 460 agacctttgctaggaaccgtgagctcgaagtcattcactgcagatgggccatgttgggag 519

                                                                       
Query: 340 cgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgaggctg 399
           | || || ||||| ||||| |||||| | ||  | |||||||| ||||||||||| ||||
Sbjct: 520 ctcttgggtgtgttttccctgagctgttggctaggaacggtgtcaagttcggtgaagctg 579

                                                                       
Query: 400 tttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggcaacc 459
           | ||||||||||| || ||||| |||||||| |||||||| ||||||||| | || ||||
Sbjct: 580 tatggttcaaggccgggtctcaaatcttcagtgagggtggacttgactacttgggtaacc 639

                                                                       
Query: 460 caagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctcatgg 519
           ||||| |  | || || || || ||  | ||||| |||||||| || ||| |  | ||||
Sbjct: 640 caagcttgatccatgctcaaagcattttggccatctgggcttgccaagttatcttgatgg 699

                                                      
Query: 520 gtgccgttgagggttaccgcattgctggtggaccacttggtga 562
           | ||||| ||||| ||||| ||||| ||||||||||| |||||
Sbjct: 700 gagccgtcgagggctaccgtattgccggtggaccactcggtga 742

---

>emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL5ZG08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 911

 Score =  155 bits (78), Expect = 2e-34
 Identities = 264/326 (80%)
 Strand = Plus / Plus

                                                                       
Query: 204 gagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctgga 263
           ||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| 
Sbjct: 222 gagcccccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggt 281

                                                                       
Query: 264 ctgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgt 323
           || || || |||||||| |||||||||| |||||| ||||  || || |||||  || | 
Sbjct: 282 ctatccgccgacccagaaaccttcgccaggaaccgtgagcgagaagttatccacagcaga 341

                                                                       
Query: 324 tgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgtt 383
           ||||||||||| || || || || || || ||||| |||||  | ||  | ||||| || 
Sbjct: 342 tgggccatgctcggagccctaggctgcgttttccctgagctattggctaggaacggagtg 401

                                                                       
Query: 384 aagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggcctt 443
           |||||||| || || |||||||||||||| || || |||||||||||||| || ||  | 
Sbjct: 402 aagttcggagaagcggtttggttcaaggccggttcacagatcttcagcgacggaggattg 461

                                                                       
Query: 444 gactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgt 503
           |||||| | |||||||| ||| | || ||||| ||||| |||   ||||||||||||  |
Sbjct: 462 gactacttgggcaacccgagcttggtccacgctcagagcatctgagccatttgggctact 521

                                     
Query: 504 caggttgtgctcatgggtgccgttga 529
           || ||| | |||||||| || |||||
Sbjct: 522 caagttatcctcatgggcgctgttga 547

---

>emb|AJ234428.1|HVU234428 Hordeum vulgare partial mRNA; clone cMWG0701.rev
          Length = 326

 Score =  155 bits (78), Expect = 2e-34
 Identities = 148/170 (87%), Gaps = 1/170 (0%)
 Strand = Plus / Minus

                                                                       
Query: 432 gagggtggccttgactacctcggcaacccaagccttgtgcacgcccagagtatccttgcc 491
           ||||||||||| |||||||||||||| || ||| | || |||||  |||| |||||||||
Sbjct: 326 gagggtggcctcgactacctcggcaatcctagcttggtccacgcggagagcatccttgcc 267

                                                                       
Query: 492 atttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggtgga 551
           || |||||||| ||||| ||||||||||| || || ||||| |||||| |||||||||| 
Sbjct: 266 atctgggcttgccaggtcgtgctcatgggcgctgtcgaggggtaccgcgttgctggtggc 207

                                                             
Query: 552 ccacttggtgagatcgtcgacccattataccccgggtggcagcttcgacc 601
           ||||| || ||||||||||||||| |||||||| ||||||||||||||||
Sbjct: 206 ccactcggagagatcgtcgacccactatacccc-ggtggcagcttcgacc 158

---

>gb|DQ018376.1| Pinus krempfii chloroplast putative light harvesting chlorophyll
           a/b binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 752

 Score =  153 bits (77), Expect = 8e-34
 Identities = 269/333 (80%)
 Strand = Plus / Plus

                                                                       
Query: 215 ctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctga 274
           |||| |||||||||||||||| |||||||||||||||||||| || || || ||||| ||
Sbjct: 218 ctacttgaccggtgagttcccaggtgactacgggtgggacacggcggggctttcggcgga 277

                                                                       
Query: 275 cccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgct 334
            || ||||| || || | |||| | || || || ||||||||  |||| ||||| |||||
Sbjct: 278 tccggagacttttgcgaggaacagagaactggaagtgatccacagccggtgggcaatgct 337

                                                                       
Query: 335 tggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtga 394
            ||||| || ||||| || ||||| ||||| || ||  | || || || |||||||| ||
Sbjct: 338 gggcgccctgggttgcgttttcccggagcttctggcgagaaatggagtaaagttcggaga 397

                                                                       
Query: 395 ggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcgg 454
           ||| || ||||||||||| ||| ||||||| ||||||||||| || ||||||||||| ||
Sbjct: 398 ggcagtgtggttcaaggcgggagctcagattttcagcgagggagggcttgactacctggg 457

                                                                       
Query: 455 caacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgct 514
            ||||| |||||| | ||||| ||||| || ||||| || |||||  | |||||  | ||
Sbjct: 458 aaaccctagccttatccacgcgcagagcattcttgcaatctgggcaagccaggtcatcct 517

                                            
Query: 515 catgggtgccgttgagggttaccgcattgctgg 547
           |||||| ||||| |||||||| || ||||||||
Sbjct: 518 catgggcgccgtggagggttatcgtattgctgg 550

---

>emb|Z75663.1|AGCHLABBP A.graveolens mRNA for chlorophyll a/b binding protein
          Length = 963

 Score =  153 bits (77), Expect = 8e-34
 Identities = 206/249 (82%)
 Strand = Plus / Plus

                                                                       
Query: 216 tacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgac 275
           ||||| || |||||||| || |||||||| || |||||||| ||||| || |||||||||
Sbjct: 241 taccttactggtgagtttccaggtgactatggctgggacactgctgggctttcggctgac 300

                                                                       
Query: 276 ccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgctt 335
           || ||||| || ||||||||||| || || || |||||||| | | | ||||||||||||
Sbjct: 301 cctgagacttttgccaagaaccgtgaacttgaagtgatccactccagatgggccatgctt 360

                                                                       
Query: 336 ggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgag 395
           || || || || ||||||||||| |||||  | || || || ||||| ||||| || |||
Sbjct: 361 ggagcccttgggtgtgtcttccctgagctcttggctcgtaatggtgtcaagtttggcgag 420

                                                                       
Query: 396 gctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggc 455
           || || ||||| ||||||||||| || ||||||||||||||||| ||||||||| | || 
Sbjct: 421 gcagtgtggtttaaggctggatcacaaatcttcagcgagggtggacttgactacttgggt 480

                    
Query: 456 aacccaagc 464
           |||||||||
Sbjct: 481 aacccaagc 489



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 516 atgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgaccc 574
           ||||| || ||||||||||||||  |||||||||||||||| || || || ||||||||
Sbjct: 541 atgggcgcagttgagggttaccgtgttgctggtggaccactaggggaaattgtcgaccc 599

---

>gb|M64619.1|PEACAB66 Pea cab gene, complete cds
          Length = 1666

 Score =  153 bits (77), Expect = 8e-34
 Identities = 233/285 (81%)
 Strand = Plus / Plus

                                                                        
Query: 215  ctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctga 274
            |||| |||| || |||||||||||||||||||| |||||||| || ||||| || |||||
Sbjct: 922  ctacttgacaggagagttccccggtgactacggttgggacactgccggactctctgctga 981

                                                                        
Query: 275  cccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgct 334
            ||||||||| ||| |||||||||| ||||| || || ||||| | | | ||||| ||| |
Sbjct: 982  cccagagacattctccaagaaccgtgagcttgaagtcatccactccagatgggctatgtt 1041

                                                                        
Query: 335  tggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtga 394
             || ||  | || ||||||||||| |||||  |  | |||||||||||||| ||||| ||
Sbjct: 1042 gggagctttgggatgtgtcttcccagagcttttgtctcgcaacggtgttaaattcggcga 1101

                                                                        
Query: 395  ggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcgg 454
             ||||| ||||||||||| |||||||| ||||| || |||||||| ||||| ||| | ||
Sbjct: 1102 agctgtgtggttcaaggcaggatctcaaatctttagtgagggtggacttgattacttggg 1161

                                                         
Query: 455  caacccaagccttgtgcacgcccagagtatccttgccatttgggc 499
            |||||||||| | || || || || || ||||||||||| |||||
Sbjct: 1162 caacccaagcttggtccatgctcaaagcatccttgccatatgggc 1206

---

>gb|K02067.1|PEACAB80 Pea (P.sativum) gene AB80 encoding major light-harvesting chlorophyll
            a/b-binding protein (polypeptide 15) complex precursor,
            complete coding sequence
          Length = 1993

 Score =  153 bits (77), Expect = 8e-34
 Identities = 233/285 (81%)
 Strand = Plus / Plus

                                                                        
Query: 215  ctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctga 274
            |||| |||| || |||||||||||||||||||| |||||||| || ||||| || |||||
Sbjct: 1223 ctacttgactggagagttccccggtgactacggttgggacactgccggactctctgctga 1282

                                                                        
Query: 275  cccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgct 334
            ||||||||| ||| |||||||||| ||||| || || ||||| | | | ||||| ||| |
Sbjct: 1283 cccagagacattctccaagaaccgtgagcttgaagtcatccactccagatgggctatgtt 1342

                                                                        
Query: 335  tggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtga 394
             || ||  | || ||||||||||| |||||  |  | |||||||||||||| ||||| ||
Sbjct: 1343 gggtgctttgggatgtgtcttcccagagcttttgtctcgcaacggtgttaaattcggcga 1402

                                                                        
Query: 395  ggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcgg 454
             ||||| ||||||||||| |||||||| ||||| || |||||||| ||||| ||| | ||
Sbjct: 1403 agctgtgtggttcaaggcaggatctcaaatctttagtgagggtggacttgattacttggg 1462

                                                         
Query: 455  caacccaagccttgtgcacgcccagagtatccttgccatttgggc 499
            |||||||||| | || || || || || ||||||||||| |||||
Sbjct: 1463 caacccaagcttggtccatgctcaaagcatccttgccatatgggc 1507

---

>emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL46ZF04 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 959

 Score =  149 bits (75), Expect = 1e-32
 Identities = 303/379 (79%)
 Strand = Plus / Plus

                                                                       
Query: 151 gcagcccgtggtacggctctgaccgggtcctctacctcggcccactttctggtgagcccc 210
           ||||||| |||||||| |||||||| |||   ||| | || ||| | || || |||||||
Sbjct: 176 gcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagcccc 235

                                                                       
Query: 211 cgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcgg 270
           |||||||||| |||||||||||||||||||||||||| |||||||||||||| || || |
Sbjct: 236 cgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccg 295

                                                                       
Query: 271 ctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcca 330
           | |||||||| |||||||||| |||||| ||||| || || |||||  || | |||||||
Sbjct: 296 ccgacccagaaaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcca 355

                                                                       
Query: 331 tgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcg 390
           |||| || || || || || || ||||| |||||  | ||  | ||||| || |||||||
Sbjct: 356 tgctcggagccctaggctgcgttttccctgagctattggctaggaacggagtaaagttcg 415

                                                                       
Query: 391 gtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacc 450
           | || || |||||||||||||| ||  | |||| || |||||| || ||  | |||||| 
Sbjct: 416 gagaagcggtttggttcaaggccggtacacagaactacagcgacggaggattggactact 475

                                                                       
Query: 451 tcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttg 510
           | |||||||| ||| | || ||||| ||||| ||| | ||||||||||||  ||| ||| 
Sbjct: 476 tgggcaacccgagcttggtccacgctcagagcatcttagccatttgggctactcaagtta 535

                              
Query: 511 tgctcatgggtgccgttga 529
           | |||||||| || |||||
Sbjct: 536 tcctcatgggagctgttga 554

---

>emb|X16535.1|GMCAB4 G.max DNA for Cab4
          Length = 1470

 Score =  149 bits (75), Expect = 1e-32
 Identities = 300/375 (80%)
 Strand = Plus / Plus

                                                                       
Query: 189 ggcccactttctggtgagcccccgagctacctgaccggtgagttccccggtgactacggg 248
           |||||| | ||||||||||||||   |||||| || ||||| ||||| |||||||| || 
Sbjct: 502 ggcccattctctggtgagcccccatcctacctcactggtgaattcccaggtgactatggt 561

                                                                       
Query: 249 tgggacaccgctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgag 308
           |||||||| ||||| || || ||||||||||||||||| ||||| ||||| || || || 
Sbjct: 562 tgggacactgctgggctttctgctgacccagagacctttgccaaaaaccgtgaactggaa 621

                                                                       
Query: 309 gtgatccattgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctc 368
           || ||||| | | | ||||||||| | || ||  | || ||||| ||||| || ||  | 
Sbjct: 622 gtcatccactccagatgggccatgttgggagccttgggctgtgttttccctgaactcttg 681

                                                                       
Query: 369 gcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttc 428
            |||||||||| || ||||| |||||||| || ||||||||||| || |||||||| |||
Sbjct: 682 tcccgcaacggagtcaagtttggtgaggccgtgtggttcaaggccgggtctcagatattc 741

                                                                       
Query: 429 agcgagggtggccttgactacctcggcaacccaagccttgtgcacgcccagagtatcctt 488
           || ||||| || ||||||||| | ||||||||||||||  | || || || || || |||
Sbjct: 742 agtgagggcgggcttgactacttgggcaacccaagcctgatccatgcacaaagcattctt 801

                                                                       
Query: 489 gccatttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggt 548
           ||||| |||||    || ||| |  | |||||||| |||||||||||||| |||||||||
Sbjct: 802 gccatctgggccacccaagttatcttgatgggtgcagttgagggttaccgtattgctggt 861

                          
Query: 549 ggaccacttggtgag 563
           || || |||||||||
Sbjct: 862 gggcctcttggtgag 876

---

>gb|DQ471302.1| Carya cathayensis putative chloroplast chlorophyll a/b-binding
           protein (ABC) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 993

 Score =  147 bits (74), Expect = 5e-32
 Identities = 176/210 (83%)
 Strand = Plus / Plus

                                                                       
Query: 240 gactacgggtgggacaccgctggactgtcggctgacccagagaccttcgccaagaaccgg 299
           ||||| || |||||||| || ||||| || |||||||| ||||| ||||| |||||||| 
Sbjct: 232 gactatggttgggacactgccggactctcagctgacccggagacattcgctaagaaccgt 291

                                                                       
Query: 300 gagctcgaggtgatccattgccgttgggccatgcttggcgcgctcggttgtgtcttcccc 359
           |||||||| ||||||||||  || |||||||||||||| || || |||||||| ||||||
Sbjct: 292 gagctcgaagtgatccattcacgatgggccatgcttggggctcttggttgtgttttcccc 351

                                                                       
Query: 360 gagctgctcgcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatct 419
           || ||  | || ||||| || |||||||| ||||||||||| ||||||||||||||| ||
Sbjct: 352 gaacttttggctcgcaatggagttaagtttggtgaggctgtctggttcaaggctggagct 411

                                         
Query: 420 cagatcttcagcgagggtggccttgactac 449
           || ||||| || || ||||| || ||||||
Sbjct: 412 caaatctttagtgaaggtgggctggactac 441



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                           
Query: 516 atgggtgccgttgagggttaccgcattgctggtggaccacttggtgag 563
           |||||||| || ||||| ||||| ||||||||||| ||||||||||||
Sbjct: 508 atgggtgcagtcgagggctaccgtattgctggtgggccacttggtgag 555

---

>emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/b binding protein
          Length = 983

 Score =  147 bits (74), Expect = 5e-32
 Identities = 293/366 (80%)
 Strand = Plus / Plus

                                                                       
Query: 198 tctggtgagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacacc 257
           |||||||||||||||   ||| |||| || |||||||| |||||||| || |||||||| 
Sbjct: 201 tctggtgagcccccgtcgtacttgactggagagttcccaggtgactatggttgggacact 260

                                                                       
Query: 258 gctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccat 317
           ||||| || || |||||||||||||| || || || ||||| || || ||||| ||||| 
Sbjct: 261 gctgggctttctgctgacccagagacatttgcgaaaaaccgtgaactggaggtaatccac 320

                                                                       
Query: 318 tgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaac 377
            || | ||||| ||| | || ||  | || ||||| ||||| |||||  |  |||| || 
Sbjct: 321 agcaggtgggctatgttgggagcattgggatgtgtgttcccagagcttttgtcccgaaat 380

                                                                       
Query: 378 ggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggt 437
           |||||||| |||||||| ||||| ||||||||||||||||| || ||||| || ||||||
Sbjct: 381 ggtgttaaattcggtgaagctgtatggttcaaggctggatcacaaatctttagtgagggt 440

                                                                       
Query: 438 ggccttgactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgg 497
           || ||||||||| | || ||||||||  | || || || || ||||||||||| || |||
Sbjct: 441 ggacttgactacttgggtaacccaagtttggtccatgctcaaagtatccttgctatatgg 500

                                                                       
Query: 498 gcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggtggaccactt 557
           |||   || |||||  | |||||||| ||||| |||||||| ||||||||||| || |||
Sbjct: 501 gctacccaagttgttttgatgggtgctgttgaaggttaccgtattgctggtgggcctctt 560

                 
Query: 558 ggtgag 563
           ||||||
Sbjct: 561 ggtgag 566

---

>emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chlorophyll a/b-binding
           protein
          Length = 1126

 Score =  145 bits (73), Expect = 2e-31
 Identities = 247/305 (80%)
 Strand = Plus / Plus

                                                                       
Query: 216 tacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgac 275
           ||||||||||| ||||||||||| |||||||||||||| ||||| ||  | ||||| |||
Sbjct: 232 tacctgaccggcgagttccccggcgactacgggtgggagaccgccggcgtctcggccgac 291

                                                                       
Query: 276 ccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgctt 335
           || ||||| |||||    ||||||||||| ||||||||||| | ||| ||||| ||||| 
Sbjct: 292 ccggagacattcgcgcgcaaccgggagctggaggtgatccactcccggtgggcgatgctg 351

                                                                       
Query: 336 ggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgag 395
           |||||||| || || || ||||| ||| | || |||   ||||| || |||||||| |||
Sbjct: 352 ggcgcgctgggctgcgtgttcccggagatcctggccaagaacggcgtcaagttcggcgag 411

                                                                       
Query: 396 gctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggc 455
           || || ||||||||||| ||  | |||||||||   ||||| || || |||||||| || 
Sbjct: 412 gcggtgtggttcaaggccggcgcgcagatcttctcggagggcgggctggactacctgggg 471

                                                                       
Query: 456 aacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctc 515
           ||||| | ||| |||||||| ||||| ||||| ||||| ||||| || ||||| ||||||
Sbjct: 472 aaccccaacctggtgcacgcacagagcatcctggccatctgggcgtgccaggtggtgctc 531

                
Query: 516 atggg 520
           |||||
Sbjct: 532 atggg 536

---

>emb|X04966.1|PHCAB37 Petunia Cab gene for chlorophyll a/b binding protein
          Length = 1470

 Score =  145 bits (73), Expect = 2e-31
 Identities = 238/293 (81%)
 Strand = Plus / Plus

                                                                       
Query: 228 gagttccccggtgactacgggtgggacaccgctggactgtcggctgacccagagaccttc 287
           |||||||| |||||||| || ||||| || |||||||| || || ||||| || || || 
Sbjct: 562 gagttccctggtgactatggatgggatactgctggactctcagccgaccctgaaacattt 621

                                                                       
Query: 288 gccaagaaccgggagctcgaggtgatccattgccgttgggccatgcttggcgcgctcggt 347
           |||| |||||| ||||| ||||||||||||||||||||||| |||||||| ||  | || 
Sbjct: 622 gccaggaaccgtgagcttgaggtgatccattgccgttgggcaatgcttggtgctttggga 681

                                                                       
Query: 348 tgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgaggctgtttggttc 407
           ||||| ||||| ||  | ||  ||   || |||||||  ||||||||||| |||||||||
Sbjct: 682 tgtgttttccctgaaatcctttccaagaatggtgttacattcggtgaggcagtttggttc 741

                                                                       
Query: 408 aaggctggatctcagatcttcagcgagggtggccttgactacctcggcaacccaagcctt 467
           |||||||||||||| || |||   || ||||| ||||||||||| |||||||||| ||||
Sbjct: 742 aaggctggatctcaaattttctcagaaggtggtcttgactaccttggcaacccaaacctt 801

                                                                
Query: 468 gtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctcatggg 520
            | || || ||||| || ||||||||||||||    || ||||||||||||||
Sbjct: 802 atccatgctcagagcattcttgccatttgggcagcccaagttgtgctcatggg 854

---

>gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence
          Length = 762

 Score =  143 bits (72), Expect = 8e-31
 Identities = 186/224 (83%)
 Strand = Plus / Plus

                                                                       
Query: 210 ccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcg 269
           ||||||||||| ||||| ||||||||||| |||||||| ||||||||||||||||| || 
Sbjct: 157 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 216

                                                                       
Query: 270 gctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcc 329
           ||||| || ||||| ||||| | |||||| ||||| || || |||||  || | ||||||
Sbjct: 217 gctgatcccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggcc 276

                                                                       
Query: 330 atgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttc 389
           ||||| || || || || || |||||||| |||||  | ||| | ||||| || ||||| 
Sbjct: 277 atgctcggagccctaggctgcgtcttccctgagcttttggccaggaacggagtcaagttt 336

                                                       
Query: 390 ggtgaggctgtttggttcaaggctggatctcagatcttcagcga 433
           || ||||| ||||||||||||||||| || ||||||||||||||
Sbjct: 337 ggagaggcagtttggttcaaggctggttcacagatcttcagcga 380

---

>gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/b-binding protein
           (CipLhcb1*2) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 932

 Score =  141 bits (71), Expect = 3e-30
 Identities = 269/335 (80%)
 Strand = Plus / Plus

                                                                       
Query: 216 tacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgac 275
           |||||||| || || ||||| |||||||| ||||||||||| || || || |||||||||
Sbjct: 255 tacctgacgggggaattcccaggtgactatgggtgggacactgccgggctttcggctgac 314

                                                                       
Query: 276 ccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgctt 335
           || ||||| || ||   |||||| || || || |||||||| |  || ||||| ||| | 
Sbjct: 315 ccggagacatttgctcggaaccgtgaactggaagtgatccactctcgatgggcgatgttg 374

                                                                       
Query: 336 ggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgag 395
           || ||  | || ||||| ||||| || ||| | ||||| |||||||| |||||||| |||
Sbjct: 375 ggggctttggggtgtgtgttccctgaactgttggcccggaacggtgtgaagttcggggag 434

                                                                       
Query: 396 gctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggc 455
           || || |||||||||||||| |||||||| ||||| |||||||| ||||||||| | |||
Sbjct: 435 gcggtgtggttcaaggctgggtctcagatattcagtgagggtgggcttgactacttgggc 494

                                                                       
Query: 456 aacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctc 515
           |||||||||||  | || || ||||| ||||||||||| |||||    |||||  |  | 
Sbjct: 495 aacccaagcctgatccatgcacagagcatccttgccatctgggccacacaggtgatattg 554

                                              
Query: 516 atgggtgccgttgagggttaccgcattgctggtgg 550
           |||||||| || ||||||||||||||||| |||||
Sbjct: 555 atgggtgcagtggagggttaccgcattgccggtgg 589

---

>gb|AF133340.1|AF133340 Phalaenopsis sp. 'KCbutterfly' putative chlorophyll a/b-binding
           protein mRNA, complete cds
          Length = 1118

 Score =  141 bits (71), Expect = 3e-30
 Identities = 191/231 (82%)
 Strand = Plus / Plus

                                                                       
Query: 215 ctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctga 274
           |||||| || || |||||||||||||| ||||| |||||||| |||||  ||||||| ||
Sbjct: 290 ctacctcactggcgagttccccggtgattacggctgggacactgctggcttgtcggcgga 349

                                                                       
Query: 275 cccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgct 334
           |||||| |||||||| ||||| |||||||| ||||| ||||| |  || ||||||||| |
Sbjct: 350 cccagaaaccttcgctaagaatcgggagctggaggtcatccactcacggtgggccatgtt 409

                                                                       
Query: 335 tggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtga 394
            || || || |||||  ||||||| |||||  | || ||||| || || ||||| || ||
Sbjct: 410 gggtgcactgggttgcatcttcccagagcttttggctcgcaatggcgtaaagtttggcga 469

                                                              
Query: 395 ggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttga 445
           ||| || |||||||| ||||| ||||||||||||||||||||||| |||||
Sbjct: 470 ggcggtgtggttcaaagctggttctcagatcttcagcgagggtgggcttga 520

---

>gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting complex II protein
           (Lhcb) mRNA, complete cds; nuclear gene for chloroplast
           product
          Length = 1024

 Score =  137 bits (69), Expect = 5e-29
 Identities = 228/281 (81%)
 Strand = Plus / Plus

                                                                       
Query: 199 ctggtgagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacaccg 258
           |||| |||||||||||||||||||| || |||||||||||||||||||| ||||||||||
Sbjct: 181 ctggcgagcccccgagctacctgactggcgagttccccggtgactacggctgggacaccg 240

                                                                       
Query: 259 ctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccatt 318
           | || ||||| |||||||| |||||||||       |||| ||||| ||| |||||||  
Sbjct: 241 ccggtctgtccgctgacccggagaccttcaagcgctaccgcgagctggagctgatccacg 300

                                                                       
Query: 319 gccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacg 378
            ||| ||||||||||| ||||| || || ||  |||||||||||||||| | |  | |||
Sbjct: 301 cccgctgggccatgctcggcgctctgggctgcatcttccccgagctgctgggctcctacg 360

                                                                       
Query: 379 gtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtg 438
           | ||    ||||| ||||| || ||||||||||||||  |||||||||||   ||||| |
Sbjct: 361 gcgtgcccttcggcgaggccgtgtggttcaaggctggtgctcagatcttccaggagggcg 420

                                                    
Query: 439 gccttgactacctcggcaacccaagccttgtgcacgcccag 479
           | || |||||||| |||||||| | ||| ||||||||||||
Sbjct: 421 gtctggactacctgggcaaccccaacctggtgcacgcccag 461

---

>dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-4, complete cds
          Length = 988

 Score =  137 bits (69), Expect = 5e-29
 Identities = 228/281 (81%)
 Strand = Plus / Plus

                                                                       
Query: 199 ctggtgagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacaccg 258
           |||| |||||||||||||||||||| || |||||||||||||||||||| ||||||||||
Sbjct: 165 ctggcgagcccccgagctacctgactggcgagttccccggtgactacggctgggacaccg 224

                                                                       
Query: 259 ctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccatt 318
           | || ||||| |||||||| |||||||||       |||| ||||| ||| |||||||  
Sbjct: 225 ccggtctgtccgctgacccggagaccttcaagcgctaccgcgagctggagctgatccacg 284

                                                                       
Query: 319 gccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacg 378
            ||| ||||||||||| ||||| || || ||  |||||||||||||||| | |  | |||
Sbjct: 285 cccgctgggccatgctcggcgctctgggctgcatcttccccgagctgctgggctcctacg 344

                                                                       
Query: 379 gtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtg 438
           | ||    ||||| ||||| || ||||||||||||||  |||||||||||   ||||| |
Sbjct: 345 gcgtgcccttcggcgaggccgtgtggttcaaggctggtgctcagatcttccaggagggcg 404

                                                    
Query: 439 gccttgactacctcggcaacccaagccttgtgcacgcccag 479
           | || |||||||| |||||||| | ||| ||||||||||||
Sbjct: 405 gtctggactacctgggcaaccccaacctggtgcacgcccag 445

---

>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1)
           mRNA, complete cds
          Length = 1008

 Score =  135 bits (68), Expect = 2e-28
 Identities = 266/332 (80%)
 Strand = Plus / Plus

                                                                       
Query: 201 ggtgagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgct 260
           |||||||| ||||||||||| || || |||||||||||||| |||||||||||||| || 
Sbjct: 249 ggtgagcctccgagctacctcactggagagttccccggtgattacgggtgggacactgcc 308

                                                                       
Query: 261 ggactgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgc 320
           || || || || || || ||||||||||| | |||||| ||||| || || |||||  ||
Sbjct: 309 ggtctatccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagc 368

                                                                       
Query: 321 cgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggt 380
            | ||||||||||| || || || || || || ||||| |||||  | ||  | ||||| 
Sbjct: 369 agatgggccatgctcggagccctaggctgcgttttccctgagctattggctaggaacgga 428

                                                                       
Query: 381 gttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggc 440
           || |||||||| || || ||||||||||||||||| || |||||||||||||| || || 
Sbjct: 429 gtgaagttcggagaagcggtttggttcaaggctggttcacagatcttcagcgacggagga 488

                                                                       
Query: 441 cttgactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggct 500
            | |||||| | |||||||| ||| | || ||||| ||||| ||| | ||||||||||||
Sbjct: 489 ttggactacttgggcaacccgagcttggtccacgctcagagcatcttagccatttgggct 548

                                           
Query: 501 tgtcaggttgtgctcatgggtgccgttgaggg 532
             ||| ||| | |||||||| || ||||||||
Sbjct: 549 actcaagttatcctcatgggagctgttgaggg 580

---

>gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence
          Length = 775

 Score =  135 bits (68), Expect = 2e-28
 Identities = 238/296 (80%)
 Strand = Plus / Plus

                                                                       
Query: 204 gagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctgga 263
           ||||| ||||||||||| ||||| ||||||||||||||||| || ||||||||||| || 
Sbjct: 21  gagccaccgagctaccttaccggagagttccccggtgactatggatgggacaccgccggt 80

                                                                       
Query: 264 ctgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgt 323
           || || ||||| |||||||||||||||| |||||| ||||| || || |||||  || | 
Sbjct: 81  ctatccgctgatccagagaccttcgccaggaaccgtgagctagaagttatccacagcaga 140

                                                                       
Query: 324 tgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgtt 383
           ||||||||||| || || || || || || ||||| |||||  | ||  | ||||| || 
Sbjct: 141 tgggccatgctcggagccctaggctgcgttttccctgagctcttggctaggaacggagtg 200

                                                                       
Query: 384 aagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggcctt 443
           ||||| || || || |||||||||||| | || || |||||||||||||| || ||  | 
Sbjct: 201 aagttyggagaagcggtttggttcaagrccggttcacagatcttcagcgacggaggattg 260

                                                                   
Query: 444 gactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggc 499
           |||||| | |||||||| ||| | || ||||| ||||| ||| | |||||||||||
Sbjct: 261 gactacttgggcaacccgagcttggtccacgctcagagcatcttagccatttgggc 316

---

>gb|AF339687.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 851

 Score =  135 bits (68), Expect = 2e-28
 Identities = 266/332 (80%)
 Strand = Plus / Plus

                                                                       
Query: 201 ggtgagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgct 260
           |||||||| ||||||||||| || || |||||||||||||| |||||||||||||| || 
Sbjct: 187 ggtgagcctccgagctacctcactggagagttccccggtgattacgggtgggacactgcc 246

                                                                       
Query: 261 ggactgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgc 320
           || || || || || || ||||||||||| | |||||| ||||| || || |||||  ||
Sbjct: 247 ggtctatccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagc 306

                                                                       
Query: 321 cgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggt 380
            | ||||||||||| || || || || || || ||||| |||||  | ||  | ||||| 
Sbjct: 307 agatgggccatgctcggagccctaggctgcgttttccctgagctattggctaggaacgga 366

                                                                       
Query: 381 gttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggc 440
           || |||||||| || || ||||||||||||||||| || |||||||||||||| || || 
Sbjct: 367 gtgaagttcggagaagcggtttggttcaaggctggttcacagatcttcagcgacggagga 426

                                                                       
Query: 441 cttgactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggct 500
            | |||||| | |||||||| ||| | || ||||| ||||| ||| | ||||||||||||
Sbjct: 427 ttggactacttgggcaacccgagcttggtccacgctcagagcatcttagccatttgggct 486

                                           
Query: 501 tgtcaggttgtgctcatgggtgccgttgaggg 532
             ||| ||| | |||||||| || ||||||||
Sbjct: 487 actcaagttatcctcatgggagctgttgaggg 518

---

>gb|AF326864.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 1019

 Score =  135 bits (68), Expect = 2e-28
 Identities = 266/332 (80%)
 Strand = Plus / Plus

                                                                       
Query: 201 ggtgagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgct 260
           |||||||| ||||||||||| || || |||||||||||||| |||||||||||||| || 
Sbjct: 249 ggtgagcctccgagctacctcactggagagttccccggtgattacgggtgggacactgcc 308

                                                                       
Query: 261 ggactgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgc 320
           || || || || || || ||||||||||| | |||||| ||||| || || |||||  ||
Sbjct: 309 ggtctatccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagc 368

                                                                       
Query: 321 cgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggt 380
            | ||||||||||| || || || || || || ||||| |||||  | ||  | ||||| 
Sbjct: 369 agatgggccatgctcggagccctaggctgcgttttccctgagctattggctaggaacgga 428

                                                                       
Query: 381 gttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggc 440
           || |||||||| || || ||||||||||||||||| || |||||||||||||| || || 
Sbjct: 429 gtgaagttcggagaagcggtttggttcaaggctggttcacagatcttcagcgacggagga 488

                                                                       
Query: 441 cttgactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggct 500
            | |||||| | |||||||| ||| | || ||||| ||||| ||| | ||||||||||||
Sbjct: 489 ttggactacttgggcaacccgagcttggtccacgctcagagcatcttagccatttgggct 548

                                           
Query: 501 tgtcaggttgtgctcatgggtgccgttgaggg 532
             ||| ||| | |||||||| || ||||||||
Sbjct: 549 actcaagttatcctcatgggagctgttgaggg 580

---

>gb|AY120776.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 1003

 Score =  135 bits (68), Expect = 2e-28
 Identities = 266/332 (80%)
 Strand = Plus / Plus

                                                                       
Query: 201 ggtgagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgct 260
           |||||||| ||||||||||| || || |||||||||||||| |||||||||||||| || 
Sbjct: 249 ggtgagcctccgagctacctcactggagagttccccggtgattacgggtgggacactgcc 308

                                                                       
Query: 261 ggactgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgc 320
           || || || || || || ||||||||||| | |||||| ||||| || || |||||  ||
Sbjct: 309 ggtctatccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagc 368

                                                                       
Query: 321 cgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggt 380
            | ||||||||||| || || || || || || ||||| |||||  | ||  | ||||| 
Sbjct: 369 agatgggccatgctcggagccctaggctgcgttttccctgagctattggctaggaacgga 428

                                                                       
Query: 381 gttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggc 440
           || |||||||| || || ||||||||||||||||| || |||||||||||||| || || 
Sbjct: 429 gtgaagttcggagaagcggtttggttcaaggctggttcacagatcttcagcgacggagga 488

                                                                       
Query: 441 cttgactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggct 500
            | |||||| | |||||||| ||| | || ||||| ||||| ||| | ||||||||||||
Sbjct: 489 ttggactacttgggcaacccgagcttggtccacgctcagagcatcttagccatttgggct 548

                                           
Query: 501 tgtcaggttgtgctcatgggtgccgttgaggg 532
             ||| ||| | |||||||| || ||||||||
Sbjct: 549 actcaagttatcctcatgggagctgttgaggg 580

---

>gb|DQ355993.1| Brassica napus chlorophyll a/b binding protein (LHB1B2) mRNA,
           partial cds
          Length = 226

 Score =  135 bits (68), Expect = 2e-28
 Identities = 176/212 (83%)
 Strand = Plus / Plus

                                                                       
Query: 204 gagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctgga 263
           ||||||||||||||||| ||||| ||||||||||| |||||||| ||||||||||| || 
Sbjct: 7   gagcccccgagctacctcaccggagagttccccggagactacggatgggacaccgccggt 66

                                                                       
Query: 264 ctgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgt 323
           || || |||||||| ||||||||||||| |||||| ||||| || || ||||| ||| | 
Sbjct: 67  ctctccgctgaccccgagaccttcgccaggaaccgtgagctagaagttatccactgcaga 126

                                                                       
Query: 324 tgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgtt 383
           ||||||||||| || || || || || || ||||| |||||  | ||  | ||||| || 
Sbjct: 127 tgggccatgctcggagccctaggctgcgttttccctgagcttttggctaggaacggagtg 186

                                           
Query: 384 aagttcggtgaggctgtttggttcaaggctgg 415
           |||||||| || || |||||||||||||||||
Sbjct: 187 aagttcggagaagcggtttggttcaaggctgg 218

---

>emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II type I chlorophyll a/b
           binding protein
          Length = 1301

 Score =  135 bits (68), Expect = 2e-28
 Identities = 266/332 (80%)
 Strand = Plus / Plus

                                                                       
Query: 201 ggtgagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgct 260
           |||||||| ||||||||||| || || |||||||||||||| |||||||||||||| || 
Sbjct: 487 ggtgagcctccgagctacctcactggagagttccccggtgattacgggtgggacactgcc 546

                                                                       
Query: 261 ggactgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgc 320
           || || || || || || ||||||||||| | |||||| ||||| || || |||||  ||
Sbjct: 547 ggtctatccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagc 606

                                                                       
Query: 321 cgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggt 380
            | ||||||||||| || || || || || || ||||| |||||  | ||  | ||||| 
Sbjct: 607 agatgggccatgctcggagccctaggctgcgttttccctgagctattggctaggaacgga 666

                                                                       
Query: 381 gttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggc 440
           || |||||||| || || ||||||||||||||||| || |||||||||||||| || || 
Sbjct: 667 gtgaagttcggagaagcggtttggttcaaggctggttcacagatcttcagcgacggagga 726

                                                                       
Query: 441 cttgactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggct 500
            | |||||| | |||||||| ||| | || ||||| ||||| ||| | ||||||||||||
Sbjct: 727 ttggactacttgggcaacccgagcttggtccacgctcagagcatcttagccatttgggct 786

                                           
Query: 501 tgtcaggttgtgctcatgggtgccgttgaggg 532
             ||| ||| | |||||||| || ||||||||
Sbjct: 787 actcaagttatcctcatgggagctgttgaggg 818

---

>gb|BT002103.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 853

 Score =  135 bits (68), Expect = 2e-28
 Identities = 266/332 (80%)
 Strand = Plus / Plus

                                                                       
Query: 201 ggtgagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgct 260
           |||||||| ||||||||||| || || |||||||||||||| |||||||||||||| || 
Sbjct: 187 ggtgagcctccgagctacctcactggagagttccccggtgattacgggtgggacactgcc 246

                                                                       
Query: 261 ggactgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgc 320
           || || || || || || ||||||||||| | |||||| ||||| || || |||||  ||
Sbjct: 247 ggtctatccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagc 306

                                                                       
Query: 321 cgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggt 380
            | ||||||||||| || || || || || || ||||| |||||  | ||  | ||||| 
Sbjct: 307 agatgggccatgctcggagccctaggctgcgttttccctgagctattggctaggaacgga 366

                                                                       
Query: 381 gttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggc 440
           || |||||||| || || ||||||||||||||||| || |||||||||||||| || || 
Sbjct: 367 gtgaagttcggagaagcggtttggttcaaggctggttcacagatcttcagcgacggagga 426

                                                                       
Query: 441 cttgactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggct 500
            | |||||| | |||||||| ||| | || ||||| ||||| ||| | ||||||||||||
Sbjct: 427 ttggactacttgggcaacccgagcttggtccacgctcagagcatcttagccatttgggct 486

                                           
Query: 501 tgtcaggttgtgctcatgggtgccgttgaggg 532
             ||| ||| | |||||||| || ||||||||
Sbjct: 487 actcaagttatcctcatgggagctgttgaggg 518

---

>gb|AF279250.1|AF279250 Vigna radiata LHCII type I chlorophyll a/b-binding protein
           (CipLhcb1*3) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 941

 Score =  133 bits (67), Expect = 7e-28
 Identities = 163/195 (83%)
 Strand = Plus / Plus

                                                                       
Query: 369 gcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttc 428
           ||||| |||||||| |||||||| |||||||| ||||| ||||||||||||||||| |||
Sbjct: 407 gcccgtaacggtgtgaagttcggcgaggctgtgtggtttaaggctggatctcagatattc 466

                                                                       
Query: 429 agcgagggtggccttgactacctcggcaacccaagccttgtgcacgcccagagtatcctt 488
           || |||||||| ||||||||| | ||||| ||||||||  | || || ||||| ||||| 
Sbjct: 467 agtgagggtggacttgactacttgggcaatccaagcctgattcatgcacagagcatcctg 526

                                                                       
Query: 489 gccatttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggt 548
           || |||||||| | ||| ||| |  | ||||||||||| ||||||||||| ||||| |||
Sbjct: 527 gctatttgggcctctcaagttattttgatgggtgccgtggagggttaccgtattgccggt 586

                          
Query: 549 ggaccacttggtgag 563
           || || || ||||||
Sbjct: 587 gggcctctcggtgag 601

---

>gb|U01964.1|GMU01964 Glycine max cv. Dare photosystem II type I chlorophyll a/b-binding
            protein (lhcb1*7) gene, complete cds
          Length = 1882

 Score =  133 bits (67), Expect = 7e-28
 Identities = 289/363 (79%)
 Strand = Plus / Plus

                                                                        
Query: 201  ggtgagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgct 260
            |||||||||||   ||| || || ||||| ||||| |||||||| || |||||||| |||
Sbjct: 941  ggtgagcccccctcctatctcactggtgaattcccaggtgactatggttgggacactgct 1000

                                                                        
Query: 261  ggactgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgc 320
            || || || |||||||||||||| || ||||| ||||| || || || || ||||| | |
Sbjct: 1001 gggctttctgctgacccagagacttttgccaaaaaccgtgaactggaagtcatccactcc 1060

                                                                        
Query: 321  cgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggt 380
             | ||||||||| | || ||  | || ||||| ||||| || ||  |  |||||||||| 
Sbjct: 1061 agatgggccatgttgggagccttgggctgtgttttccctgaactcttgtcccgcaacgga 1120

                                                                        
Query: 381  gttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggc 440
            || ||||| || ||||| || ||||||||||| || |||||||| ||||| |||||||| 
Sbjct: 1121 gtcaagtttggcgaggccgtgtggttcaaggccgggtctcagatattcagtgagggtggg 1180

                                                                        
Query: 441  cttgactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggct 500
            ||||||||| | ||||||||||||||  | || || || || || |||||||| ||||| 
Sbjct: 1181 cttgactacttgggcaacccaagcctgatccatgcacaaagcattcttgccatctgggcc 1240

                                                                        
Query: 501  tgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggtggaccacttggt 560
               || ||| |  | ||||||||||||||||||||||| ||||||||||| || ||||||
Sbjct: 1241 acccaagttatcttgatgggtgccgttgagggttaccgtattgctggtgggcctcttggt 1300

               
Query: 561  gag 563
            |||
Sbjct: 1301 gag 1303

---

>gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b-binding protein
           mRNA, partial cds
          Length = 575

 Score =  131 bits (66), Expect = 3e-27
 Identities = 135/158 (85%)
 Strand = Plus / Plus

                                                                       
Query: 342 ctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgaggctgtt 401
           ||||| || |||||||||||||| |||||||||||||| || |||||||| ||||| || 
Sbjct: 2   ctcggctgcgtcttccccgagctcctcgcccgcaacggcgtgaagttcggcgaggcggtc 61

                                                                       
Query: 402 tggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggcaaccca 461
           ||||||||||| ||| | ||||||||||||||||| ||  | |||||||| |||||||| 
Sbjct: 62  tggttcaaggccggagcccagatcttcagcgagggcggattggactacctgggcaacccc 121

                                                 
Query: 462 agccttgtgcacgcccagagtatccttgccatttgggc 499
           ||||| || ||||| ||||| ||||| ||||| |||||
Sbjct: 122 agcctcgtccacgcgcagagcatcctggccatctgggc 159

---

>gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II chlorophyll a/b binding
           protein (CABII) mRNA, partial cds
          Length = 714

 Score =  131 bits (66), Expect = 3e-27
 Identities = 231/286 (80%)
 Strand = Plus / Plus

                                                                       
Query: 235 ccggtgactacgggtgggacaccgctggactgtcggctgacccagagaccttcgccaaga 294
           |||| ||||||||||||||||| || || |||||||| ||||| ||||| |||||   ||
Sbjct: 1   ccggcgactacgggtgggacacggcggggctgtcggcggacccggagacgttcgcgcgga 60

                                                                       
Query: 295 accgggagctcgaggtgatccattgccgttgggccatgcttggcgcgctcggttgtgtct 354
           |||| ||||| ||||||||||| |  || ||||| ||||| |||||||| || || || |
Sbjct: 61  accgcgagctggaggtgatccactcgcggtgggcgatgctgggcgcgctggggtgcgtgt 120

                                                                       
Query: 355 tccccgagctgctcgcccgcaacggtgttaagttcggtgaggctgtttggttcaaggctg 414
           |||| ||| | || |||   ||||| || |||||||| ||||| || ||||||||||| |
Sbjct: 121 tcccggagatcctggccaagaacggcgtcaagttcggcgaggcggtgtggttcaaggccg 180

                                                                       
Query: 415 gatctcagatcttcagcgagggtggccttgactacctcggcaacccaagccttgtgcacg 474
           |  | |||||||||   ||||| || || |||||||| |||||||| | ||| |||||||
Sbjct: 181 gcgcgcagatcttctcggagggcgggctggactacctgggcaacccgaacctggtgcacg 240

                                                         
Query: 475 cccagagtatccttgccatttgggcttgtcaggttgtgctcatggg 520
           | ||||| ||||| ||||| ||||| || ||||| |||||||||||
Sbjct: 241 cgcagagcatcctggccatctgggcgtgccaggtcgtgctcatggg 286

---

>gb|L36064.1|PRULHP Prunus persica (clone pAB19) light harvesting chlorophyll a/b
           binding protein (Lhcb-Pp1) gene, complete cds
          Length = 1912

 Score =  131 bits (66), Expect = 3e-27
 Identities = 192/234 (82%)
 Strand = Plus / Plus

                                                                       
Query: 231 ttccccggtgactacgggtgggacaccgctggactgtcggctgacccagagaccttcgcc 290
           ||||| ||||| ||||| |||||||| ||||| || || ||||||||||||||||| |||
Sbjct: 558 ttccctggtgattacggttgggacactgctgggctctcagctgacccagagacctttgcc 617

                                                                       
Query: 291 aagaaccgggagctcgaggtgatccattgccgttgggccatgcttggcgcgctcggttgt 350
           |||||||| ||||| || || |||||||   | |||||||||||||| || || || || 
Sbjct: 618 aagaaccgtgagcttgaagttatccattcaagatgggccatgcttggtgctctgggctgc 677

                                                                       
Query: 351 gtcttccccgagctgctcgcccgcaacggtgttaagttcggtgaggctgtttggttcaag 410
           || ||||| || ||  |  |||| ||||| || ||||||||||||||||| |||||||||
Sbjct: 678 gttttccctgaactcttgtcccgtaacggggtcaagttcggtgaggctgtatggttcaag 737

                                                                 
Query: 411 gctggatctcagatcttcagcgagggtggccttgactacctcggcaacccaagc 464
           |||||  | ||||| ||||| |||||||| || |||||| | || |||||||||
Sbjct: 738 gctggcgcccagatattcagtgagggtgggctagactacttgggaaacccaagc 791

---

>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete
             sequence
          Length = 139771

 Score =  129 bits (65), Expect = 1e-26
 Identities = 245/305 (80%)
 Strand = Plus / Minus

                                                                         
Query: 216   tacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgac 275
             ||||||||||| |||||||| || ||||||||||||||||| || || || ||||| |||
Sbjct: 79568 tacctgaccggagagttcccgggagactacgggtgggacacggcggggctatcggccgac 79509

                                                                         
Query: 276   ccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgctt 335
             || ||||| ||||| | |||| ||||||| ||||||||||| |  || ||||| ||||| 
Sbjct: 79508 ccggagacgttcgcgaggaacagggagctggaggtgatccactcgcggtgggcgatgctg 79449

                                                                         
Query: 336   ggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgag 395
             || ||||| || || |||||||| ||| | ||  ||   ||||| || |||||||| |||
Sbjct: 79448 ggggcgctgggctgcgtcttcccggagatcctgtccaagaacggggtgaagttcggggag 79389

                                                                         
Query: 396   gctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggc 455
             || || ||||||||||| ||  | |||||||||  |||||| || || |||||||| || 
Sbjct: 79388 gcggtgtggttcaaggccggcgcgcagatcttctccgagggggggctcgactacctgggg 79329

                                                                         
Query: 456   aacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctc 515
             ||||| | ||| |||||||| ||||| ||||| ||||| |||||    ||||| ||||||
Sbjct: 79328 aaccccaacctggtgcacgcgcagagcatcctcgccatctgggcggtccaggtggtgctc 79269

                  
Query: 516   atggg 520
             |||||
Sbjct: 79268 atggg 79264

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  129 bits (65), Expect = 1e-26
 Identities = 245/305 (80%)
 Strand = Plus / Plus

                                                                            
Query: 216      tacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgac 275
                ||||||||||| |||||||| || ||||||||||||||||| || || || ||||| |||
Sbjct: 21808248 tacctgaccggagagttcccgggagactacgggtgggacacggcggggctatcggccgac 21808307

                                                                            
Query: 276      ccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgctt 335
                || ||||| ||||| | |||| ||||||| ||||||||||| |  || ||||| ||||| 
Sbjct: 21808308 ccggagacgttcgcgaggaacagggagctggaggtgatccactcgcggtgggcgatgctg 21808367

                                                                            
Query: 336      ggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgag 395
                || ||||| || || |||||||| ||| | ||  ||   ||||| || |||||||| |||
Sbjct: 21808368 ggggcgctgggctgcgtcttcccggagatcctgtccaagaacggggtgaagttcggggag 21808427

                                                                            
Query: 396      gctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggc 455
                || || ||||||||||| ||  | |||||||||  |||||| || || |||||||| || 
Sbjct: 21808428 gcggtgtggttcaaggccggcgcgcagatcttctccgagggggggctcgactacctgggg 21808487

                                                                            
Query: 456      aacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctc 515
                ||||| | ||| |||||||| ||||| ||||| ||||| |||||    ||||| ||||||
Sbjct: 21808488 aaccccaacctggtgcacgcgcagagcatcctcgccatctgggcggtccaggtggtgctc 21808547

                     
Query: 516      atggg 520
                |||||
Sbjct: 21808548 atggg 21808552



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 287      cgccaagaaccgggagctcg 306
                ||||||||||||||||||||
Sbjct: 13137113 cgccaagaaccgggagctcg 13137094

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  129 bits (65), Expect = 1e-26
 Identities = 245/305 (80%)
 Strand = Plus / Plus

                                                                            
Query: 216      tacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgac 275
                ||||||||||| |||||||| || ||||||||||||||||| || || || ||||| |||
Sbjct: 21801277 tacctgaccggagagttcccgggagactacgggtgggacacggcggggctatcggccgac 21801336

                                                                            
Query: 276      ccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgctt 335
                || ||||| ||||| | |||| ||||||| ||||||||||| |  || ||||| ||||| 
Sbjct: 21801337 ccggagacgttcgcgaggaacagggagctggaggtgatccactcgcggtgggcgatgctg 21801396

                                                                            
Query: 336      ggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgag 395
                || ||||| || || |||||||| ||| | ||  ||   ||||| || |||||||| |||
Sbjct: 21801397 ggggcgctgggctgcgtcttcccggagatcctgtccaagaacggggtgaagttcggggag 21801456

                                                                            
Query: 396      gctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggc 455
                || || ||||||||||| ||  | |||||||||  |||||| || || |||||||| || 
Sbjct: 21801457 gcggtgtggttcaaggccggcgcgcagatcttctccgagggggggctcgactacctgggg 21801516

                                                                            
Query: 456      aacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctc 515
                ||||| | ||| |||||||| ||||| ||||| ||||| |||||    ||||| ||||||
Sbjct: 21801517 aaccccaacctggtgcacgcgcagagcatcctcgccatctgggcggtccaggtggtgctc 21801576

                     
Query: 516      atggg 520
                |||||
Sbjct: 21801577 atggg 21801581



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 287      cgccaagaaccgggagctcg 306
                ||||||||||||||||||||
Sbjct: 13133888 cgccaagaaccgggagctcg 13133869

---

>emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL87ZD09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 949

 Score =  129 bits (65), Expect = 1e-26
 Identities = 92/101 (91%)
 Strand = Plus / Plus

                                                                       
Query: 204 gagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctgga 263
           ||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| | 
Sbjct: 217 gagcccccgagctaccttaccggtgagttccccggtgactacggatgggacaccgcttgt 276

                                                    
Query: 264 ctgtcggctgacccagagaccttcgccaagaaccgggagct 304
           || || || ||||||||||||||||||| |||||| |||||
Sbjct: 277 ctatccgccgacccagagaccttcgccaggaaccgtgagct 317



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 62/75 (82%)
 Strand = Plus / Plus

                                                                       
Query: 386 gttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttga 445
           |||||| || || |||| ||||||||| || || |||||||||||||| || ||  ||||
Sbjct: 401 gttcggagaagcggttttgttcaaggccgggtcacagatcttcagcgacggaggatttga 460

                          
Query: 446 ctacctcggcaaccc 460
           |||| | ||||||||
Sbjct: 461 ctactttggcaaccc 475

---

>emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophyll a/b binding protein
          Length = 999

 Score =  129 bits (65), Expect = 1e-26
 Identities = 182/221 (82%)
 Strand = Plus / Plus

                                                                       
Query: 213 agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
           |||||||| ||||| |||||||| || |||||||| |||||||| ||||| || || |||
Sbjct: 347 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 406

                                                                       
Query: 273 gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
           ||||| ||||| ||||| | |||||| ||||| || || |||||  || | |||||||||
Sbjct: 407 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 466

                                                                       
Query: 333 cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
           || || || || || || |||||||| |||||  | ||| | ||||| || ||||| || 
Sbjct: 467 ctcggagccctaggctgcgtcttccctgagcttttggccaggaacggagtcaagtttgga 526

                                                    
Query: 393 gaggctgtttggttcaaggctggatctcagatcttcagcga 433
           ||||||||||||||||||||||| || ||||||||||||||
Sbjct: 527 gaggctgtttggttcaaggctggttcacagatcttcagcga 567

---

>gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding protein (RCABP89) mRNA,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 1027

 Score =  129 bits (65), Expect = 1e-26
 Identities = 245/305 (80%)
 Strand = Plus / Plus

                                                                       
Query: 216 tacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgac 275
           ||||||||||| |||||||| || ||||||||||||||||| || || || ||||| |||
Sbjct: 236 tacctgaccggagagttcccgggagactacgggtgggacacggcggggctatcggccgac 295

                                                                       
Query: 276 ccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgctt 335
           || ||||| ||||| | |||| ||||||| ||||||||||| |  || ||||| ||||| 
Sbjct: 296 ccggagacgttcgcgaggaacagggagctggaggtgatccactcgcggtgggcgatgctg 355

                                                                       
Query: 336 ggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgag 395
           || ||||| || || |||||||| ||| | ||  ||   ||||| || |||||||| |||
Sbjct: 356 ggggcgctgggctgcgtcttcccggagatcctgtccaagaacggggtgaagttcggggag 415

                                                                       
Query: 396 gctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggc 455
           || || ||||||||||| ||  | |||||||||  |||||| || || |||||||| || 
Sbjct: 416 gcggtgtggttcaaggccggcgcgcagatcttctccgagggggggctcgactacctgggg 475

                                                                       
Query: 456 aacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctc 515
           ||||| | ||| |||||||| ||||| ||||| ||||| |||||    ||||| ||||||
Sbjct: 476 aaccccaacctggtgcacgcgcagagcatcctcgccatctgggcggtccaggtggtgctc 535

                
Query: 516 atggg 520
           |||||
Sbjct: 536 atggg 540

---

>ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BINDING PROTEIN 1);
           chlorophyll binding AT1G29930 (CAB1) mRNA, complete cds
          Length = 1044

 Score =  127 bits (64), Expect = 5e-26
 Identities = 184/224 (82%)
 Strand = Plus / Plus

                                                                       
Query: 210 ccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcg 269
           ||||||||||| ||||| ||||||||||| |||||||| ||||||||||| ||||| || 
Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324

                                                                       
Query: 270 gctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcc 329
           |||||||| ||||| ||||| | |||||| || || || || |||||  || | ||||||
Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384

                                                                       
Query: 330 atgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttc 389
           ||||| || || || || || |||||||| |||||  | ||  | ||||| || ||||||
Sbjct: 385 atgctcggagccctaggctgcgtcttccctgagcttttggctagaaacggagtcaagttc 444

                                                       
Query: 390 ggtgaggctgtttggttcaaggctggatctcagatcttcagcga 433
           || ||||| |||||||||||||| || || ||||||||||||||
Sbjct: 445 ggagaggcggtttggttcaaggccggttcacagatcttcagcga 488

---

>gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein
           (At1g29930) mRNA, complete cds
          Length = 835

 Score =  127 bits (64), Expect = 5e-26
 Identities = 184/224 (82%)
 Strand = Plus / Plus

                                                                       
Query: 210 ccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcg 269
           ||||||||||| ||||| ||||||||||| |||||||| ||||||||||| ||||| || 
Sbjct: 199 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 258

                                                                       
Query: 270 gctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcc 329
           |||||||| ||||| ||||| | |||||| || || || || |||||  || | ||||||
Sbjct: 259 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 318

                                                                       
Query: 330 atgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttc 389
           ||||| || || || || || |||||||| |||||  | ||  | ||||| || ||||||
Sbjct: 319 atgctcggagccctaggctgcgtcttccctgagcttttggctagaaacggagtcaagttc 378

                                                       
Query: 390 ggtgaggctgtttggttcaaggctggatctcagatcttcagcga 433
           || ||||| |||||||||||||| || || ||||||||||||||
Sbjct: 379 ggagaggcggtttggttcaaggccggttcacagatcttcagcga 422

---

>gb|AY050935.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At1g29930) mRNA, complete cds
          Length = 1014

 Score =  127 bits (64), Expect = 5e-26
 Identities = 184/224 (82%)
 Strand = Plus / Plus

                                                                       
Query: 210 ccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcg 269
           ||||||||||| ||||| ||||||||||| |||||||| ||||||||||| ||||| || 
Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324

                                                                       
Query: 270 gctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcc 329
           |||||||| ||||| ||||| | |||||| || || || || |||||  || | ||||||
Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384

                                                                       
Query: 330 atgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttc 389
           ||||| || || || || || |||||||| |||||  | ||  | ||||| || ||||||
Sbjct: 385 atgctcggagccctaggctgcgtcttccctgagcttttggctagaaacggagtcaagttc 444

                                                       
Query: 390 ggtgaggctgtttggttcaaggctggatctcagatcttcagcga 433
           || ||||| |||||||||||||| || || ||||||||||||||
Sbjct: 445 ggagaggcggtttggttcaaggccggttcacagatcttcagcga 488

---

>gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1019

 Score =  127 bits (64), Expect = 5e-26
 Identities = 184/224 (82%)
 Strand = Plus / Plus

                                                                       
Query: 210 ccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcg 269
           ||||||||||| ||||| ||||||||||| |||||||| ||||||||||| ||||| || 
Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324

                                                                       
Query: 270 gctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcc 329
           |||||||| ||||| ||||| | |||||| || || || || |||||  || | ||||||
Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384

                                                                       
Query: 330 atgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttc 389
           ||||| || || || || || |||||||| |||||  | ||  | ||||| || ||||||
Sbjct: 385 atgctcggagccctaggctgcgtcttccctgagcttttggctagaaacggagtcaagttc 444

                                                       
Query: 390 ggtgaggctgtttggttcaaggctggatctcagatcttcagcga 433
           || ||||| |||||||||||||| || || ||||||||||||||
Sbjct: 445 ggagaggcggtttggttcaaggccggttcacagatcttcagcga 488

---

>gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1045

 Score =  127 bits (64), Expect = 5e-26
 Identities = 184/224 (82%)
 Strand = Plus / Plus

                                                                       
Query: 210 ccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcg 269
           ||||||||||| ||||| ||||||||||| |||||||| ||||||||||| ||||| || 
Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324

                                                                       
Query: 270 gctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcc 329
           |||||||| ||||| ||||| | |||||| || || || || |||||  || | ||||||
Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384

                                                                       
Query: 330 atgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttc 389
           ||||| || || || || || |||||||| |||||  | ||  | ||||| || ||||||
Sbjct: 385 atgctcggagccctaggctgcgtcttccctgagcttttggctagaaacggagtcaagttc 444

                                                       
Query: 390 ggtgaggctgtttggttcaaggctggatctcagatcttcagcga 433
           || ||||| |||||||||||||| || || ||||||||||||||
Sbjct: 445 ggagaggcggtttggttcaaggccggttcacagatcttcagcga 488

---

>gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 999

 Score =  127 bits (64), Expect = 5e-26
 Identities = 184/224 (82%)
 Strand = Plus / Plus

                                                                       
Query: 210 ccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcg 269
           ||||||||||| ||||| ||||||||||| |||||||| ||||||||||| ||||| || 
Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324

                                                                       
Query: 270 gctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcc 329
           |||||||| ||||| ||||| | |||||| || || || || |||||  || | ||||||
Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384

                                                                       
Query: 330 atgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttc 389
           ||||| || || || || || |||||||| |||||  | ||  | ||||| || ||||||
Sbjct: 385 atgctcggagccctaggctgcgtcttccctgagcttttggctagaaacggagtcaagttc 444

                                                       
Query: 390 ggtgaggctgtttggttcaaggctggatctcagatcttcagcga 433
           || ||||| |||||||||||||| || || ||||||||||||||
Sbjct: 445 ggagaggcggtttggttcaaggccggttcacagatcttcagcga 488

---

>emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS89ZA03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 930

 Score =  127 bits (64), Expect = 5e-26
 Identities = 184/224 (82%)
 Strand = Plus / Plus

                                                                       
Query: 210 ccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcg 269
           ||||||||||| ||||| ||||||||||| |||||||| ||||||||||| ||||| || 
Sbjct: 234 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 293

                                                                       
Query: 270 gctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcc 329
           |||||||| ||||| ||||| | |||||| || || || || |||||  || | ||||||
Sbjct: 294 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 353

                                                                       
Query: 330 atgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttc 389
           ||||| || || || || || |||||||| |||||  | ||  | ||||| || ||||||
Sbjct: 354 atgctcggagccctaggctgcgtcttccctgagcttttggctagaaacggagtcaagttc 413

                                                       
Query: 390 ggtgaggctgtttggttcaaggctggatctcagatcttcagcga 433
           || ||||| |||||||||||||| || || ||||||||||||||
Sbjct: 414 ggagaggcggtttggttcaaggccggttcacagatcttcagcga 457

---

>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence,
           complete sequence
          Length = 82053

 Score =  127 bits (64), Expect = 5e-26
 Identities = 184/224 (82%)
 Strand = Plus / Plus

                                                                       
Query: 210 ccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcg 269
           ||||||||||| ||||| ||||||||||| |||||||| ||||||||||| ||||| || 
Sbjct: 145 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 204

                                                                       
Query: 270 gctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcc 329
           |||||||| ||||| ||||| | |||||| || || || || |||||  || | ||||||
Sbjct: 205 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 264

                                                                       
Query: 330 atgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttc 389
           ||||| || || || || || |||||||| |||||  | ||  | ||||| || ||||||
Sbjct: 265 atgctcggagccctaggctgcgtcttccctgagcttttggctagaaacggagtcaagttc 324

                                                       
Query: 390 ggtgaggctgtttggttcaaggctggatctcagatcttcagcga 433
           || ||||| |||||||||||||| || || ||||||||||||||
Sbjct: 325 ggagaggcggtttggttcaaggccggttcacagatcttcagcga 368

---

>gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N18 genomic sequence, complete
             sequence
          Length = 101075

 Score =  127 bits (64), Expect = 5e-26
 Identities = 184/224 (82%)
 Strand = Plus / Minus

                                                                         
Query: 210   ccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcg 269
             ||||||||||| ||||| ||||||||||| |||||||| ||||||||||| ||||| || 
Sbjct: 16716 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 16657

                                                                         
Query: 270   gctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcc 329
             |||||||| ||||| ||||| | |||||| || || || || |||||  || | ||||||
Sbjct: 16656 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 16597

                                                                         
Query: 330   atgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttc 389
             ||||| || || || || || |||||||| |||||  | ||  | ||||| || ||||||
Sbjct: 16596 atgctcggagccctaggctgcgtcttccctgagcttttggctagaaacggagtcaagttc 16537

                                                         
Query: 390   ggtgaggctgtttggttcaaggctggatctcagatcttcagcga 433
             || ||||| |||||||||||||| || || ||||||||||||||
Sbjct: 16536 ggagaggcggtttggttcaaggccggttcacagatcttcagcga 16493



 Score =  121 bits (61), Expect = 3e-24
 Identities = 181/221 (81%)
 Strand = Plus / Plus

                                                                         
Query: 213   agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
             |||||||| ||||| |||||||| || |||||||| |||||||| ||||| || || |||
Sbjct: 19294 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 19353

                                                                         
Query: 273   gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
             ||||| ||||| ||||| | |||||| ||||| || || |||||  || | |||||||||
Sbjct: 19354 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 19413

                                                                         
Query: 333   cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
             || || || || || || |||||||| |||||  | ||| | ||||| || ||||| || 
Sbjct: 19414 ctcggagccctaggctgcgtcttccctgagcttttggccaggaacggagtcaagtttgga 19473

                                                      
Query: 393   gaggctgtttggttcaaggctggatctcagatcttcagcga 433
             ||||| ||||||||||||||||| || ||||||||||||||
Sbjct: 19474 gaggcagtttggttcaaggctggttcacagatcttcagcga 19514



 Score =  119 bits (60), Expect = 1e-23
 Identities = 183/224 (81%)
 Strand = Plus / Plus

                                                                         
Query: 210   ccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcg 269
             ||||||||||| ||||| ||||||||||| |||||||| ||||||||||||||||| || 
Sbjct: 21937 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 21996

                                                                         
Query: 270   gctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcc 329
             ||||| || ||||| ||||| | |||||| ||||| || || |||||  || | ||||| 
Sbjct: 21997 gctgatcccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggct 22056

                                                                         
Query: 330   atgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttc 389
             ||||| || || || || || |||||||| |||||  | ||  | ||||| || ||||||
Sbjct: 22057 atgctcggagccctaggctgcgtcttccctgagcttttggctaggaacggagtcaagttc 22116

                                                         
Query: 390   ggtgaggctgtttggttcaaggctggatctcagatcttcagcga 433
             || ||||| |||||||||||||| || || |||||||| |||||
Sbjct: 22117 ggagaggcggtttggttcaaggccggttcacagatctttagcga 22160

---

>gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete sequence
          Length = 979

 Score =  127 bits (64), Expect = 5e-26
 Identities = 265/332 (79%)
 Strand = Plus / Plus

                                                                       
Query: 201 ggtgagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgct 260
           |||||||| ||||||||||| || || |||||||||||||| |||||||||||||| || 
Sbjct: 249 ggtgagcctccgagctacctcactggagagttccccggtgattacgggtgggacactgcc 308

                                                                       
Query: 261 ggactgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgc 320
           || || || || || || ||||||||||| | |||||| ||||| || || |||||  ||
Sbjct: 309 ggtctatccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagc 368

                                                                       
Query: 321 cgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggt 380
            | ||||||||||| || || || || || || ||||| |||||  | ||  | ||||| 
Sbjct: 369 agatgggccatgctcggagccctaggctgcgttttccctgagctattggctaggaacgga 428

                                                                       
Query: 381 gttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggc 440
           ||  ||||||| || || ||||||||||||||||| || |||||||||||||| || || 
Sbjct: 429 gtagagttcggagaagcggtttggttcaaggctggttcacagatcttcagcgacggagga 488

                                                                       
Query: 441 cttgactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggct 500
            | |||||| | |||||||| ||| | || ||||| ||||| ||| | ||||||||||||
Sbjct: 489 ttggactacttgggcaacccgagcttggtccacgctcagagcatcttagccatttgggct 548

                                           
Query: 501 tgtcaggttgtgctcatgggtgccgttgaggg 532
             ||| ||| | |||||||| || ||||||||
Sbjct: 549 actcaagttatcctcatgggagctgttgaggg 580

---

>gb|M97171.1|SOYCAB6A Glycine max chlorophyll a/b binding protein type II (Cab-6) gene,
           complete cds; nuclear gene for chloroplast product
          Length = 1322

 Score =  123 bits (62), Expect = 7e-25
 Identities = 107/122 (87%)
 Strand = Plus / Plus

                                                                       
Query: 216 tacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgac 275
           ||||||||||| || ||||||||||||||||| |||||||| |||||||| || ||||||
Sbjct: 517 tacctgaccggagaattccccggtgactacggatgggacactgctggactatcagctgac 576

                                                                       
Query: 276 ccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgctt 335
           || || |||||||||| |||||||||||| |||||||| ||  || | ||||||||||||
Sbjct: 577 ccggaaaccttcgccaggaaccgggagctggaggtgattcacagcagatgggccatgctt 636

             
Query: 336 gg 337
           ||
Sbjct: 637 gg 638



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 150/185 (81%)
 Strand = Plus / Plus

                                                                       
Query: 378 ggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggt 437
           ||||| || ||||| ||||| || |||||||||||||| || |||||||||   ||||| 
Sbjct: 679 ggtgtgaaattcggcgaggccgtgtggttcaaggctggttcacagatcttctcggaggga 738

                                                                       
Query: 438 ggccttgactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgg 497
           || ||||||||| | |||||||||| |||  | || || || || ||||||||||| |||
Sbjct: 739 ggacttgactacttgggcaacccaaacctgatccatgctcaaagcatccttgccatctgg 798

                                                                       
Query: 498 gcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggtggaccactt 557
           |||  |||||||||||||||||||   ||||| |||||| |  ||| ||| ||||| |||
Sbjct: 799 gctgttcaggttgtgctcatgggttttgttgaaggttacagagttggtggaggacccctt 858

                
Query: 558 ggtga 562
           |||||
Sbjct: 859 ggtga 863

---

>emb|Z35160.1|STCHLABP S.tuberosum gene for chlorophyll a/b binding protein type I
          Length = 3529

 Score =  123 bits (62), Expect = 7e-25
 Identities = 104/118 (88%)
 Strand = Plus / Plus

                                                                        
Query: 220  tgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgacccag 279
            |||| ||||||||||| ||||||||||| |||||||| |||||||| || |||||||| |
Sbjct: 2317 tgactggtgagttccctggtgactacggatgggacactgctggactctcagctgaccctg 2376

                                                                      
Query: 280  agaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgcttgg 337
            |||| || || | ||||| |||||| |||||||||||||| |||||||||||||||||
Sbjct: 2377 agacatttgctaggaacctggagcttgaggtgatccattgtcgttgggccatgcttgg 2434



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 103/122 (84%)
 Strand = Plus / Plus

                                                                        
Query: 378  ggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggt 437
            |||||||  |||||||| |||||||||||||||||||||||||| || |||  ||| || 
Sbjct: 2475 ggtgttacattcggtgaagctgtttggttcaaggctggatctcaaattttctccgaaggc 2534

                                                                        
Query: 438  ggccttgactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgg 497
            || ||||||||||| || ||||||| |||| | || || ||||| || ||||||||||||
Sbjct: 2535 ggtcttgactaccttggtaacccaaaccttatccatgctcagagcattcttgccatttgg 2594

              
Query: 498  gc 499
            ||
Sbjct: 2595 gc 2596

---

>emb|X12980.1|GMCAB2 Soybean Cab2 gene for minor PSII LHCII chlorophyll a/b binding
           protein
          Length = 1354

 Score =  123 bits (62), Expect = 7e-25
 Identities = 236/294 (80%)
 Strand = Plus / Plus

                                                                       
Query: 270 gctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcc 329
           ||||| |||||||| || ||||| ||||| || ||||| || ||||| | | | ||||||
Sbjct: 479 gctgatccagagacttttgccaaaaaccgagaactcgaagtcatccactccagatgggcc 538

                                                                       
Query: 330 atgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttc 389
           ||| | || || || || ||||| |||||||| ||  | |||||||| ||||| ||||| 
Sbjct: 539 atgttgggagccctgggctgtgttttccccgaactcttggcccgcaatggtgtcaagttt 598

                                                                       
Query: 390 ggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactac 449
           || ||||| || ||||||||||| || |||||||| ||||| |||||||| |||||||||
Sbjct: 599 ggagaggccgtatggttcaaggccgggtctcagatattcagtgagggtgggcttgactac 658

                                                                       
Query: 450 ctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggtt 509
            | ||||||||||||||  | || || || || || |||||||| |||||    || |||
Sbjct: 659 ttgggcaacccaagcctgatccatgcacaaagcattcttgccatctgggccacccaagtt 718

                                                                 
Query: 510 gtgctcatgggtgccgttgagggttaccgcattgctggtggaccacttggtgag 563
            |  | ||||||||||||||||||||||| ||||| ||||| || |||||||||
Sbjct: 719 atcttgatgggtgccgttgagggttaccgtattgcaggtgggcctcttggtgag 772

---

>gb|M86906.1|PEACHLROPH Pea (subclone AB9) Cab9 gene, 3' end
          Length = 1919

 Score =  123 bits (62), Expect = 7e-25
 Identities = 291/366 (79%), Gaps = 1/366 (0%)
 Strand = Plus / Plus

                                                                       
Query: 231 ttccccggtgactacgggtgggacaccgctggactgtcggctgacccagagaccttcgcc 290
           ||||||||||||||||| |||||||| |||||||| || ||||| |||||||| ||  ||
Sbjct: 4   ttccccggtgactacggttgggacactgctggactttctgctgatccagagactttttcc 63

                                                                       
Query: 291 aagaaccgggagctcgaggtgatccattgccgttgggccatgcttggcgcgctcggttgt 350
           || || || || || ||||| |||||| || | ||||| ||| | || ||  | || || 
Sbjct: 64  aaaaatcgtgaactagaggtcatccatagcaggtgggctatgttgggagccttagggtgc 123

                                                                       
Query: 351 gtcttccccgagctgctcgcccgcaacggtgttaagttcggtgaggctgtttggttcaag 410
           || ||||| |||||  | || ||||||||||| || || || ||||| || |||||||||
Sbjct: 124 gttttcccggagctcttggctcgcaacggtgtcaaatttggcgaggcagtgtggttcaag 183

                                                                       
Query: 411 gctggatctcagatcttcagcgagggtggccttgactacctcggcaacccaagccttgtg 470
           || ||||| || |||||||| |||||||| ||||||||| | || |||||||||||||| 
Sbjct: 184 gcaggatcacaaatcttcagtgagggtggacttgactacttgggtaacccaagccttgtc 243

                                                                       
Query: 471 cacgcccagagtatccttgccatttgggcttgtcaggttgtgctcatgggtgccgttgag 530
           ||||| ||||| || ||| |  | |||||   ||| ||| |  | ||||| || || || 
Sbjct: 244 cacgcacagagcattcttacggtatgggcaactcaagttatcttaatgggagcagtggaa 303

                                                                       
Query: 531 ggttaccgcattgctggtggaccacttggtgagatcgtcgacccattataccccgggtgg 590
           |||||||||||||| |||||||| ||||||||| | || || ||||| || |||||||||
Sbjct: 304 ggttaccgcattgccggtggacctcttggtgaggtggttgatccattgta-cccgggtgg 362

                 
Query: 591 cagctt 596
            |||||
Sbjct: 363 tagctt 368

---

>ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding AT1G29920 (CAB2)
           mRNA, complete cds
          Length = 1176

 Score =  121 bits (61), Expect = 3e-24
 Identities = 181/221 (81%)
 Strand = Plus / Plus

                                                                       
Query: 213 agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
           |||||||| ||||| |||||||| || |||||||| |||||||| ||||| || || |||
Sbjct: 269 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 328

                                                                       
Query: 273 gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
           ||||| ||||| ||||| | |||||| ||||| || || |||||  || | |||||||||
Sbjct: 329 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 388

                                                                       
Query: 333 cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
           || || || || || || |||||||| |||||  | ||| | ||||| || ||||| || 
Sbjct: 389 ctcggagccctaggctgcgtcttccctgagcttttggccaggaacggagtcaagtttgga 448

                                                    
Query: 393 gaggctgtttggttcaaggctggatctcagatcttcagcga 433
           ||||| ||||||||||||||||| || ||||||||||||||
Sbjct: 449 gaggcagtttggttcaaggctggttcacagatcttcagcga 489

---

>gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472) putative
           photosystem II type I chlorophyll a /b binding protein
           (At1g29920) mRNA, complete cds
          Length = 1044

 Score =  121 bits (61), Expect = 3e-24
 Identities = 181/221 (81%)
 Strand = Plus / Plus

                                                                       
Query: 213 agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
           |||||||| ||||| |||||||| || |||||||| |||||||| ||||| || || |||
Sbjct: 255 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 314

                                                                       
Query: 273 gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
           ||||| ||||| ||||| | |||||| ||||| || || |||||  || | |||||||||
Sbjct: 315 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 374

                                                                       
Query: 333 cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
           || || || || || || |||||||| |||||  | ||| | ||||| || ||||| || 
Sbjct: 375 ctcggagccctaggctgcgtcttccctgagcttttggccaggaacggagtcaagtttgga 434

                                                    
Query: 393 gaggctgtttggttcaaggctggatctcagatcttcagcga 433
           ||||| ||||||||||||||||| || ||||||||||||||
Sbjct: 435 gaggcagtttggttcaaggctggttcacagatcttcagcga 475

---

>gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 1042

 Score =  121 bits (61), Expect = 3e-24
 Identities = 238/297 (80%)
 Strand = Plus / Plus

                                                                       
Query: 204 gagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctgga 263
           ||||| ||||||||||| |||||  |||||||||| |||||||| ||||||||||| || 
Sbjct: 265 gagccaccgagctaccttaccggacagttccccggagactacggatgggacaccgcaggt 324

                                                                       
Query: 264 ctgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgt 323
           || || || |  || ||||| ||||  | |||||| ||||| || || ||||| ||| | 
Sbjct: 325 ctctcagccgtacccgagacgttcgtgaggaaccgtgagctagaagttatccactgcagg 384

                                                                       
Query: 324 tgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgtt 383
           ||||||||||| || || || || || |||||||| |||||| | ||| | ||||| || 
Sbjct: 385 tgggccatgctcggtgccctaggctgcgtcttcccggagctgttggccaggaacggagtc 444

                                                                       
Query: 384 aagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggcctt 443
           |||||||| ||||| |||||||||||||| || || |||||||||||||| || || |||
Sbjct: 445 aagttcggagaggcggtttggttcaaggccggttcgcagatcttcagcgaaggaggactt 504

                                                                    
Query: 444 gactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgggct 500
           || ||| | || ||||| ||| | || ||||| ||||| ||| | || |||||||||
Sbjct: 505 gattacttgggaaaccctagcttggttcacgctcagagcatcttggctatttgggct 561

---

>gb|AY128345.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein, putative (At1g29920) mRNA, complete cds
          Length = 994

 Score =  121 bits (61), Expect = 3e-24
 Identities = 181/221 (81%)
 Strand = Plus / Plus

                                                                       
Query: 213 agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
           |||||||| ||||| |||||||| || |||||||| |||||||| ||||| || || |||
Sbjct: 255 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 314

                                                                       
Query: 273 gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
           ||||| ||||| ||||| | |||||| ||||| || || |||||  || | |||||||||
Sbjct: 315 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 374

                                                                       
Query: 333 cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
           || || || || || || |||||||| |||||  | ||| | ||||| || ||||| || 
Sbjct: 375 ctcggagccctaggctgcgtcttccctgagcttttggccaggaacggagtcaagtttgga 434

                                                    
Query: 393 gaggctgtttggttcaaggctggatctcagatcttcagcga 433
           ||||| ||||||||||||||||| || ||||||||||||||
Sbjct: 435 gaggcagtttggttcaaggctggttcacagatcttcagcga 475

---

>gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920)
           mRNA, complete cds
          Length = 898

 Score =  121 bits (61), Expect = 3e-24
 Identities = 181/221 (81%)
 Strand = Plus / Plus

                                                                       
Query: 213 agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
           |||||||| ||||| |||||||| || |||||||| |||||||| ||||| || || |||
Sbjct: 202 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 261

                                                                       
Query: 273 gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
           ||||| ||||| ||||| | |||||| ||||| || || |||||  || | |||||||||
Sbjct: 262 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 321

                                                                       
Query: 333 cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
           || || || || || || |||||||| |||||  | ||| | ||||| || ||||| || 
Sbjct: 322 ctcggagccctaggctgcgtcttccctgagcttttggccaggaacggagtcaagtttgga 381

                                                    
Query: 393 gaggctgtttggttcaaggctggatctcagatcttcagcga 433
           ||||| ||||||||||||||||| || ||||||||||||||
Sbjct: 382 gaggcagtttggttcaaggctggttcacagatcttcagcga 422

---

>gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920;
           F1N18.4) mRNA, complete cds
          Length = 1007

 Score =  121 bits (61), Expect = 3e-24
 Identities = 181/221 (81%)
 Strand = Plus / Plus

                                                                       
Query: 213 agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
           |||||||| ||||| |||||||| || |||||||| |||||||| ||||| || || |||
Sbjct: 254 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 313

                                                                       
Query: 273 gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
           ||||| ||||| ||||| | |||||| ||||| || || |||||  || | |||||||||
Sbjct: 314 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 373

                                                                       
Query: 333 cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
           || || || || || || |||||||| |||||  | ||| | ||||| || ||||| || 
Sbjct: 374 ctcggagccctaggctgcgtcttccctgagcttttggccaggaacggagtcaagtttgga 433

                                                    
Query: 393 gaggctgtttggttcaaggctggatctcagatcttcagcga 433
           ||||| ||||||||||||||||| || ||||||||||||||
Sbjct: 434 gaggcagtttggttcaaggctggttcacagatcttcagcga 474

---

>gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 804

 Score =  121 bits (61), Expect = 3e-24
 Identities = 181/221 (81%)
 Strand = Plus / Plus

                                                                       
Query: 213 agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
           |||||||| ||||| |||||||| || |||||||| |||||||| ||||| || || |||
Sbjct: 202 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 261

                                                                       
Query: 273 gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
           ||||| ||||| ||||| | |||||| ||||| || || |||||  || | |||||||||
Sbjct: 262 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 321

                                                                       
Query: 333 cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
           || || || || || || |||||||| |||||  | ||| | ||||| || ||||| || 
Sbjct: 322 ctcggagccctaggctgcgtcttccctgagcttttggccaggaacggagtcaagtttgga 381

                                                    
Query: 393 gaggctgtttggttcaaggctggatctcagatcttcagcga 433
           ||||| ||||||||||||||||| || ||||||||||||||
Sbjct: 382 gaggcagtttggttcaaggctggttcacagatcttcagcga 422

---

>gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 1027

 Score =  121 bits (61), Expect = 3e-24
 Identities = 181/221 (81%)
 Strand = Plus / Plus

                                                                       
Query: 213 agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
           |||||||| ||||| |||||||| || |||||||| |||||||| ||||| || || |||
Sbjct: 248 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 307

                                                                       
Query: 273 gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
           ||||| ||||| ||||| | |||||| ||||| || || |||||  || | |||||||||
Sbjct: 308 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 367

                                                                       
Query: 333 cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
           || || || || || || |||||||| |||||  | ||| | ||||| || ||||| || 
Sbjct: 368 ctcggagccctaggctgcgtcttccctgagcttttggccaggaacggagtcaagtttgga 427

                                                    
Query: 393 gaggctgtttggttcaaggctggatctcagatcttcagcga 433
           ||||| ||||||||||||||||| || ||||||||||||||
Sbjct: 428 gaggcagtttggttcaaggctggttcacagatcttcagcga 468

---

>gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 1027

 Score =  121 bits (61), Expect = 3e-24
 Identities = 181/221 (81%)
 Strand = Plus / Plus

                                                                       
Query: 213 agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
           |||||||| ||||| |||||||| || |||||||| |||||||| ||||| || || |||
Sbjct: 254 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 313

                                                                       
Query: 273 gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
           ||||| ||||| ||||| | |||||| ||||| || || |||||  || | |||||||||
Sbjct: 314 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 373

                                                                       
Query: 333 cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
           || || || || || || |||||||| |||||  | ||| | ||||| || ||||| || 
Sbjct: 374 ctcggagccctaggctgcgtcttccctgagcttttggccaggaacggagtcaagtttgga 433

                                                    
Query: 393 gaggctgtttggttcaaggctggatctcagatcttcagcga 433
           ||||| ||||||||||||||||| || ||||||||||||||
Sbjct: 434 gaggcagtttggttcaaggctggttcacagatcttcagcga 474

---

>emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS93ZB12 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 972

 Score =  121 bits (61), Expect = 3e-24
 Identities = 181/221 (81%)
 Strand = Plus / Plus

                                                                       
Query: 213 agctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggct 272
           |||||||| ||||| |||||||| || |||||||| |||||||| ||||| || || |||
Sbjct: 240 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 299

                                                                       
Query: 273 gacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatg 332
           ||||| ||||| ||||| | |||||| ||||| || || |||||  || | |||||||||
Sbjct: 300 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 359

                                                                       
Query: 333 cttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggt 392
           || || || || || || |||||||| |||||  | ||| | ||||| || ||||| || 
Sbjct: 360 ctcggagccctaggctgcgtcttccctgagcttttggccaggaacggagtcaagtttgga 419

                                                    
Query: 393 gaggctgtttggttcaaggctggatctcagatcttcagcga 433
           ||||| ||||||||||||||||| || ||||||||||||||
Sbjct: 420 gaggcagtttggttcaaggctggttcacagatcttcagcga 460

---

>dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075I09, full
           insert sequence
          Length = 1106

 Score =  121 bits (61), Expect = 3e-24
 Identities = 244/305 (80%)
 Strand = Plus / Plus

                                                                       
Query: 216 tacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgac 275
           ||||||||||| |||||||| || |||||| |||||||||| || || || ||||| |||
Sbjct: 247 tacctgaccggagagttcccgggagactacaggtgggacacggcggggctatcggccgac 306

                                                                       
Query: 276 ccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgctt 335
           || ||||| ||||| | |||| ||||||| ||||||||||| |  || ||||| ||||| 
Sbjct: 307 ccggagacgttcgcgaggaacagggagctggaggtgatccactcgcggtgggcgatgctg 366

                                                                       
Query: 336 ggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgag 395
           || ||||| || || |||||||| ||| | ||  ||   ||||| || |||||||| |||
Sbjct: 367 ggggcgctgggctgcgtcttcccggagatcctgtccaagaacggggtgaagttcggggag 426

                                                                       
Query: 396 gctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggc 455
           || || ||||||||||| ||  | |||||||||  |||||| || || |||||||| || 
Sbjct: 427 gcggtgtggttcaaggccggcgcgcagatcttctccgagggggggctcgactacctgggg 486

                                                                       
Query: 456 aacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctc 515
           ||||| | ||| |||||||| ||||| ||||| ||||| |||||    ||||| ||||||
Sbjct: 487 aaccccaacctggtgcacgcgcagagcatcctcgccatctgggcggtccaggtggtgctc 546

                
Query: 516 atggg 520
           |||||
Sbjct: 547 atggg 551

---

>dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRNA for type II
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 989

 Score =  121 bits (61), Expect = 3e-24
 Identities = 244/305 (80%)
 Strand = Plus / Plus

                                                                       
Query: 216 tacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgac 275
           ||||||||||| |||||||| || ||||||||||||||||| || || || ||||| |||
Sbjct: 228 tacctgaccggagagttcccgggagactacgggtgggacacggcggggctatcggccgac 287

                                                                       
Query: 276 ccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgctt 335
           || ||||| ||||| | |||| ||||||| ||| ||||||| |  || ||||| ||||| 
Sbjct: 288 ccggagacgttcgcgaggaacagggagctggagttgatccactcgcggtgggcgatgctg 347

                                                                       
Query: 336 ggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgag 395
           || ||||| || || |||||||| ||| | ||  ||   ||||| || |||||||| |||
Sbjct: 348 ggggcgctgggctgcgtcttcccggagatcctgtccaagaacggggtgaagttcggggag 407

                                                                       
Query: 396 gctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggc 455
           || || ||||||||||| ||  | |||||||||  |||||| || || |||||||| || 
Sbjct: 408 gcggtgtggttcaaggccggcgcgcagatcttctccgagggggggctcgactacctgggg 467

                                                                       
Query: 456 aacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctc 515
           ||||| | ||| |||||||| ||||| ||||| ||||| |||||    ||||| ||||||
Sbjct: 468 aaccccaacctggtgcacgcgcagagcatcctcgccatctgggcggtccaggtggtgctc 527

                
Query: 516 atggg 520
           |||||
Sbjct: 528 atggg 532

---

>ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BINDING PROTEIN 3);
           chlorophyll binding AT1G29910 (CAB3) mRNA, complete cds
          Length = 1020

 Score =  119 bits (60), Expect = 1e-23
 Identities = 183/224 (81%)
 Strand = Plus / Plus

                                                                       
Query: 210 ccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcg 269
           ||||||||||| ||||| ||||||||||| |||||||| ||||||||||||||||| || 
Sbjct: 252 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 311

                                                                       
Query: 270 gctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcc 329
           ||||| || ||||| ||||| | |||||| ||||| || || |||||  || | ||||| 
Sbjct: 312 gctgatcccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggct 371

                                                                       
Query: 330 atgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttc 389
           ||||| || || || || || |||||||| |||||  | ||  | ||||| || ||||||
Sbjct: 372 atgctcggagccctaggctgcgtcttccctgagcttttggctaggaacggagtcaagttc 431

                                                       
Query: 390 ggtgaggctgtttggttcaaggctggatctcagatcttcagcga 433
           || ||||| |||||||||||||| || || |||||||| |||||
Sbjct: 432 ggagaggcggtttggttcaaggccggttcacagatctttagcga 475

---

>gb|AC139600.16| Medicago truncatula clone mth2-20m4, complete sequence
          Length = 124732

 Score =  119 bits (60), Expect = 1e-23
 Identities = 168/204 (82%)
 Strand = Plus / Minus

                                                                        
Query: 372  cgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagc 431
            ||||| ||||| || |||||||||||||| ||||| ||||| |||||||| ||||| || 
Sbjct: 9011 cgcaatggtgtgaaattcggtgaggctgtgtggtttaaggcaggatctcaaatctttagt 8952

                                                                        
Query: 432  gagggtggccttgactacctcggcaacccaagccttgtgcacgcccagagtatccttgcc 491
            |||||||| ||||||||| | || ||||||||||| || || || || || |||||||| 
Sbjct: 8951 gagggtggacttgactacttgggtaacccaagcctagtccatgcacaaagcatccttgct 8892

                                                                        
Query: 492  atttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggtgga 551
            |||||||||   || ||| |  | ||||| || ||||| |||||||| ||||| ||||||
Sbjct: 8891 atttgggctgtccaagttatcttaatgggagctgttgaaggttaccgtattgccggtgga 8832

                                    
Query: 552  ccacttggtgagatcgtcgaccca 575
            || ||||||||| | |||||||||
Sbjct: 8831 cctcttggtgaggtagtcgaccca 8808



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                        
Query: 516  atgggtgccgttgagggttaccgcattgctggtggaccacttggtgagatcgtcgaccca 575
            ||||| || |||||||||||||| ||||| | |||||| ||||||||| | ||||| |||
Sbjct: 1777 atgggagctgttgagggttaccgtattgccgatggacctcttggtgaggtagtcgatcca 1836

                       
Query: 576  ttataccccgg 586
             | ||||||||
Sbjct: 1837 ctctaccccgg 1847



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 49/58 (84%)
 Strand = Plus / Plus

                                                                      
Query: 441  cttgactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttggg 498
            ||||||||| | || ||||||||||| || ||||| || || |||||||| |||||||
Sbjct: 1702 cttgactacttgggtaacccaagcctagtccacgcacaaagcatccttgctatttggg 1759

---

>gb|DQ418483.1| Zingiber officinale chloroplast chlorophyll a/b-binding protein
           mRNA, partial cds; nuclear gene for chloroplast product
          Length = 393

 Score =  119 bits (60), Expect = 1e-23
 Identities = 156/188 (82%)
 Strand = Plus / Plus

                                                                       
Query: 351 gtcttccccgagctgctcgcccgcaacggtgttaagttcggtgaggctgtttggttcaag 410
           |||||||| ||||| ||| |||||||||| || |||||||| ||||| ||||||||||||
Sbjct: 69  gtcttcccggagctcctctcccgcaacggcgtcaagttcggcgaggcggtttggttcaag 128

                                                                       
Query: 411 gctggatctcagatcttcagcgagggtggccttgactacctcggcaacccaagccttgtg 470
           || || || |||||||||  |||||| || || || |||||||||||||| |||||  | 
Sbjct: 129 gccgggtcgcagatcttctccgagggcggactcgattacctcggcaaccccagcctgatc 188

                                                                       
Query: 471 cacgcccagagtatccttgccatttgggcttgtcaggttgtgctcatgggtgccgttgag 530
           ||||| ||||| ||||| ||||| ||||| |  ||||| ||||| ||||| ||||| |||
Sbjct: 189 cacgcgcagagcatcctggccatatgggcgtcccaggtggtgctgatgggcgccgtggag 248

                   
Query: 531 ggttaccg 538
           || |||||
Sbjct: 249 gggtaccg 256

---

>gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910)
           mRNA, complete cds
          Length = 870

 Score =  119 bits (60), Expect = 1e-23
 Identities = 183/224 (81%)
 Strand = Plus / Plus

                                                                       
Query: 210 ccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcg 269
           ||||||||||| ||||| ||||||||||| |||||||| ||||||||||||||||| || 
Sbjct: 199 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 258

                                                                       
Query: 270 gctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcc 329
           ||||| || ||||| ||||| | |||||| ||||| || || |||||  || | ||||| 
Sbjct: 259 gctgatcccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggct 318

                                                                       
Query: 330 atgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttc 389
           ||||| || || || || || |||||||| |||||  | ||  | ||||| || ||||||
Sbjct: 319 atgctcggagccctaggctgcgtcttccctgagcttttggctaggaacggagtcaagttc 378

                                                       
Query: 390 ggtgaggctgtttggttcaaggctggatctcagatcttcagcga 433
           || ||||| |||||||||||||| || || |||||||| |||||
Sbjct: 379 ggagaggcggtttggttcaaggccggttcacagatctttagcga 422

---

>gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910;
           F1N18.5) mRNA, complete cds
          Length = 1019

 Score =  119 bits (60), Expect = 1e-23
 Identities = 183/224 (81%)
 Strand = Plus / Plus

                                                                       
Query: 210 ccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcg 269
           ||||||||||| ||||| ||||||||||| |||||||| ||||||||||||||||| || 
Sbjct: 252 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 311

                                                                       
Query: 270 gctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcc 329
           ||||| || ||||| ||||| | |||||| ||||| || || |||||  || | ||||| 
Sbjct: 312 gctgatcccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggct 371

                                                                       
Query: 330 atgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttc 389
           ||||| || || || || || |||||||| |||||  | ||  | ||||| || ||||||
Sbjct: 372 atgctcggagccctaggctgcgtcttccctgagcttttggctaggaacggagtcaagttc 431

                                                       
Query: 390 ggtgaggctgtttggttcaaggctggatctcagatcttcagcga 433
           || ||||| |||||||||||||| || || |||||||| |||||
Sbjct: 432 ggagaggcggtttggttcaaggccggttcacagatctttagcga 475

---

>emb|BX817619.1|CNS0AAVV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL33ZA06 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 994

 Score =  119 bits (60), Expect = 1e-23
 Identities = 183/224 (81%)
 Strand = Plus / Plus

                                                                       
Query: 210 ccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcg 269
           ||||||||||| ||||| ||||||||||| |||||||| ||||||||||| ||||| || 
Sbjct: 249 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 308

                                                                       
Query: 270 gctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcc 329
           |||||||| ||||| ||||| | |||||| || || || || |||||  || | ||||||
Sbjct: 309 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 368

                                                                       
Query: 330 atgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttc 389
           ||||| || || || || || |||||||| |||||  | ||  | ||||  || ||||||
Sbjct: 369 atgctcggagccctaggctgcgtcttccctgagcttttggctagaaacgtagtcaagttc 428

                                                       
Query: 390 ggtgaggctgtttggttcaaggctggatctcagatcttcagcga 433
           || ||||| |||||||||||||| || || ||||||||||||||
Sbjct: 429 ggagaggcggtttggttcaaggccggttcacagatcttcagcga 472

---

>emb|X74731.1|AHLHCB A.hypochondriacus Lhcb1*Ah1 mRNA
          Length = 699

 Score =  119 bits (60), Expect = 1e-23
 Identities = 264/332 (79%)
 Strand = Plus / Plus

                                                                       
Query: 252 gacaccgctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtg 311
           ||||| ||||||||||| |||||||| || || || || |||||||| ||| | || |||
Sbjct: 1   gacactgctggactgtcagctgaccctgaaacttttgctaagaaccgtgagttggaagtg 60

                                                                       
Query: 312 atccattgccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcc 371
           ||||| ||| | ||||| ||| | || ||  | || ||||| ||||| ||  || | |||
Sbjct: 61  atccactgcagatgggctatgttgggtgctttgggctgtgttttcccggaattgttggcc 120

                                                                       
Query: 372 cgcaacggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagc 431
           || ||||||||||| |||||||| || |||||||||||||| ||||| || || || || 
Sbjct: 121 cgaaacggtgttaaattcggtgaagccgtttggttcaaggcaggatcacaaatttttagt 180

                                                                       
Query: 432 gagggtggccttgactacctcggcaacccaagccttgtgcacgcccagagtatccttgcc 491
           || ||||| ||||| ||| | || ||||||||| |  | || ||||| ||||||||||| 
Sbjct: 181 gaaggtgggcttgattacttgggtaacccaagcttgatccatgcccaaagtatccttgca 240

                                                                       
Query: 492 atttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggtgga 551
           || ||||| ||||| ||  |  | |||||||| || || |||||||| ||||||||||| 
Sbjct: 241 atatgggcctgtcaagtaatcttgatgggtgcagtggaaggttaccgtattgctggtggc 300

                                           
Query: 552 ccacttggtgagatcgtcgacccattataccc 583
           |||||||||||| | || |||||| |||||||
Sbjct: 301 ccacttggtgaggtggttgacccactataccc 332

---

>emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophyll a/b binding protein
          Length = 1109

 Score =  119 bits (60), Expect = 1e-23
 Identities = 183/224 (81%)
 Strand = Plus / Plus

                                                                       
Query: 210 ccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcg 269
           ||||||||||| ||||| ||||||||||| |||||||| ||||||||||| ||||| || 
Sbjct: 416 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 475

                                                                       
Query: 270 gctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcc 329
           |||||||| ||||| ||||| | |||||| || || || || |||||  || | ||||| 
Sbjct: 476 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggct 535

                                                                       
Query: 330 atgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttc 389
           ||||| || || || || || |||||||| |||||  | ||  | ||||| || ||||||
Sbjct: 536 atgctcggagccctaggctgcgtcttccctgagcttttggctagaaacggagtcaagttc 595

                                                       
Query: 390 ggtgaggctgtttggttcaaggctggatctcagatcttcagcga 433
           || ||||| |||||||||||||| || || ||||||||||||||
Sbjct: 596 ggagaggcggtttggttcaaggccggttcacagatcttcagcga 639

---

>emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophyll a/b binding protein
          Length = 1060

 Score =  119 bits (60), Expect = 1e-23
 Identities = 183/224 (81%)
 Strand = Plus / Plus

                                                                       
Query: 210 ccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcg 269
           ||||||||||| ||||| ||||||||||| |||||||| ||||||||||||||||| || 
Sbjct: 405 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 464

                                                                       
Query: 270 gctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggcc 329
           ||||| || ||||| ||||| | |||||| ||||| || || |||||  || | ||||| 
Sbjct: 465 gctgatcccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggct 524

                                                                       
Query: 330 atgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttc 389
           ||||| || || || || || |||||||| |||||  | ||  | ||||| || ||||||
Sbjct: 525 atgctcggagccctaggctgcgtcttccctgagcttttggctaggaacggagtcaagttc 584

                                                       
Query: 390 ggtgaggctgtttggttcaaggctggatctcagatcttcagcga 433
           || ||||| |||||||||||||| || || |||||||| |||||
Sbjct: 585 ggagaggcggtttggttcaaggccggttcacagatctttagcga 628

---

>dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene for light-harvesting
            chlorophyll a/b-binding protein 1, complete cds
          Length = 1975

 Score =  117 bits (59), Expect = 4e-23
 Identities = 257/323 (79%)
 Strand = Plus / Plus

                                                                        
Query: 216  tacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgac 275
            ||||||| |||||||||| | || |||||||| ||||||||||| ||||| ||| | |||
Sbjct: 1256 tacctgaacggtgagttcgctggagactacggctgggacaccgccggactctcgtcggac 1315

                                                                        
Query: 276  ccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgctt 335
            || ||||||||||||   ||| ||||| | ||||| |||||   ||| ||||||||||| 
Sbjct: 1316 cccgagaccttcgcccgcaacagggagttggaggtcatccacgcccgctgggccatgctc 1375

                                                                        
Query: 336  ggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgag 395
            || || || || ||  |   ||| |||||||| |||   | |||||| |||||||| |||
Sbjct: 1376 ggagctctggggtgcctgacccctgagctgctggccaagagcggtgtgaagttcggcgag 1435

                                                                        
Query: 396  gctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggc 455
            || || ||||||||||| ||| | ||||||||||||||||| ||  | |||||| | |||
Sbjct: 1436 gccgtgtggttcaaggccggagcccagatcttcagcgagggaggtttggactacttaggc 1495

                                                                        
Query: 456  aacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctc 515
            ||||| |||||||||||||| ||||| ||  | ||||| ||||| || |||||  | || 
Sbjct: 1496 aaccctagccttgtgcacgctcagagcattttggccatctgggcctgccaggtgatcctg 1555

                                   
Query: 516  atgggtgccgttgagggttaccg 538
            ||||| ||||| ||||| |||||
Sbjct: 1556 atgggagccgtggaggggtaccg 1578



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 97  aggctcgcgtcaccatgcgcaagac 121
           |||||||||||||||||||||||||
Sbjct: 762 aggctcgcgtcaccatgcgcaagac 786

---

>gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence
          Length = 827

 Score =  115 bits (58), Expect = 2e-22
 Identities = 187/230 (81%)
 Strand = Plus / Plus

                                                                       
Query: 204 gagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacaccgctgga 263
           ||||| ||||||||||| || || ||||||||||| |||||||| |||||||| ||||| 
Sbjct: 21  gagccaccgagctacctcacaggagagttccccggagactacggatgggacacagctggc 80

                                                                       
Query: 264 ctgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgt 323
           || || |||||||| ||||| || || | |||||| ||||| || || |||||  || | 
Sbjct: 81  ctatccgctgaccccgagacatttgcaaggaaccgtgagctagaagttatccacagcagg 140

                                                                       
Query: 324 tgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgtt 383
           ||||||||||| || || || || || |||||||| |||||  | ||| | ||||| || 
Sbjct: 141 tgggccatgctcggagccctaggctgcgtcttccctgagcttttggccaggaacggagtc 200

                                                             
Query: 384 aagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcga 433
           |||||||| ||||| |||||||||||||| || || || |||||||||||
Sbjct: 201 aagttcggagaggcggtttggttcaaggcaggttcacaaatcttcagcga 250

---

>emb|AJ000765.1|CRAJ765 Chlamydomonas reinhardtii mRNA for calreticulin
          Length = 2336

 Score =  115 bits (58), Expect = 2e-22
 Identities = 187/230 (81%)
 Strand = Plus / Minus

                                                                       
Query: 199 ctggtgagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacaccg 258
           |||| |||||||||||||||||||| || |||||||||||||||||||| ||||||||||
Sbjct: 241 ctggcgagcccccgagctacctgactggcgagttccccggtgactacggctgggacaccg 182

                                                                       
Query: 259 ctggactgtcggctgacccagagaccttcgccaagaaccgggagctcgaggtgatccatt 318
           | || ||||| |||||||| |||||||||       |||| ||||| ||| |||||||  
Sbjct: 181 ccggcctgtccgctgacccggagaccttcaagcgctaccgcgagctggagctgatccacg 122

                                                                       
Query: 319 gccgttgggccatgcttggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacg 378
            ||| ||||||||||| ||||| || || ||  |||||||||||||||| | |  | |||
Sbjct: 121 cccgctgggccatgctcggcgctctgggctgcatcttccccgagctgctgggctcctacg 62

                                                             
Query: 379 gtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttc 428
           | ||    ||||| ||||| || ||||||||||||||  |||||||||||
Sbjct: 61  gcgtgcccttcggcgaggccgtgtggttcaaggctggtgctcagatcttc 12

---

>gb|AF195221.1|AF195221 Pyrus pyrifolia strain Whangkeumbae chlorophyll a/b-binding protein
           (ChBP) mRNA, complete cds
          Length = 411

 Score =  115 bits (58), Expect = 2e-22
 Identities = 278/350 (79%), Gaps = 1/350 (0%)
 Strand = Plus / Plus

                                                                       
Query: 216 tacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgac 275
           ||||| ||||| | |||||| ||||||||||| |||||||| ||||| || || || |||
Sbjct: 33  tacctaaccggagggttccctggtgactacggatgggacactgctgggctatcagcagac 92

                                                                       
Query: 276 ccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgctt 335
           || || ||||| ||||||||||| || || || || || || |   | ||||| ||||||
Sbjct: 93  cccgaaacctttgccaagaaccgtgaacttgaagtcattcactcaagatgggcaatgctt 152

                                                                       
Query: 336 ggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgag 395
           || ||  | || ||||| ||||| ||||| ||| || | ||||| || ||||| || || 
Sbjct: 153 ggtgctttgggctgtgttttcccggagctcctctccaggaacggagtcaagtttggagaa 212

                                                                       
Query: 396 gctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggc 455
           || || ||||| || || ||| |||| ||||||||||| ||||||||||  ||||| || 
Sbjct: 213 gcagtgtggtttaaagcaggagctcaaatcttcagcgaaggtggccttggttaccttgga 272

                                                                       
Query: 456 aacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctc 515
           ||||||||||| || || || ||||| || || || || |||||    ||||| || |||
Sbjct: 273 aacccaagcctagttcatgcacagagcattctagcaatctgggcaacccaggtggttctc 332

                                                             
Query: 516 atgggtgccgttgagggttaccgcattgctggtggaccacttggtgagat 565
           |||||||| |||||||||||||||||||| || ||||| |||||||||||
Sbjct: 333 atgggtgctgttgagggttaccgcattgccggaggacc-cttggtgagat 381

---

>dbj|AP008949.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT44M23, TM1572a,
             complete sequence
          Length = 48924

 Score =  115 bits (58), Expect = 2e-22
 Identities = 106/122 (86%)
 Strand = Plus / Plus

                                                                         
Query: 216   tacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgac 275
             |||||||| ||||| ||||| ||||||||||| |||||||| |||||| | || ||||||
Sbjct: 40107 tacctgactggtgaattccctggtgactacggatgggacacagctggattatcagctgac 40166

                                                                         
Query: 276   ccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgctt 335
             || || ||||||||||||||||| |||||||||||||| ||  || | ||||||||||||
Sbjct: 40167 cccgaaaccttcgccaagaaccgtgagctcgaggtgattcacagcagatgggccatgctt 40226

               
Query: 336   gg 337
             ||
Sbjct: 40227 gg 40228



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 119/143 (83%)
 Strand = Plus / Plus

                                                                         
Query: 378   ggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggt 437
             ||||| || ||||||||||| || ||||||||||||||  | |||||||||   ||||||
Sbjct: 40269 ggtgtcaaattcggtgaggcagtgtggttcaaggctggtgcccagatcttctctgagggt 40328

                                                                         
Query: 438   ggccttgactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttgg 497
             |||||||||||  | |||||||||| |||  | || || ||||| |||||||| || |||
Sbjct: 40329 ggccttgactatttaggcaacccaaacctgatccatgctcagagcatccttgcaatctgg 40388

                                    
Query: 498   gcttgtcaggttgtgctcatggg 520
             |||  ||||||||||||||||||
Sbjct: 40389 gctactcaggttgtgctcatggg 40411

---

>gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m10 (Lhcbm10) mRNA, complete cds
          Length = 1077

 Score =  113 bits (57), Expect = 7e-22
 Identities = 81/89 (91%)
 Strand = Plus / Plus

                                                                       
Query: 199 ctggtgagcccccgagctacctgaccggtgagttccccggtgactacgggtgggacaccg 258
           |||| |||||||||||||||||||| || |||||||||||||||||||| ||||||||||
Sbjct: 179 ctggcgagcccccgagctacctgactggcgagttccccggtgactacggctgggacaccg 238

                                        
Query: 259 ctggactgtcggctgacccagagaccttc 287
           | || ||||| |||||||| |||||||||
Sbjct: 239 ccggtctgtccgctgacccggagaccttc 267



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 385 agttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttg 444
           ||||||| |||||||| ||||||||||| ||  | |||||||||   ||||| ||||| |
Sbjct: 365 agttcggcgaggctgtctggttcaaggccggcgcccagatcttctctgagggcggcctgg 424

                                               
Query: 445 actacctcggcaacccaagccttgtgcacgcccaga 480
           ||||||| ||||||||   ||| |||||||||||||
Sbjct: 425 actacctgggcaacccctccctggtgcacgcccaga 460

---

>gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding protein mRNA, complete cds
          Length = 1100

 Score =  113 bits (57), Expect = 7e-22
 Identities = 243/305 (79%)
 Strand = Plus / Plus

                                                                       
Query: 216 tacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctgac 275
           |||||||||||  ||||||| || ||||||||||||||||| || || || ||||| |||
Sbjct: 243 tacctgaccggaaagttcccgggagactacgggtgggacacggcggggctatcggccgac 302

                                                                       
Query: 276 ccagagaccttcgccaagaaccgggagctcgaggtgatccattgccgttgggccatgctt 335
           || ||||| ||||| | |||| ||||||| ||||||||||| | ||| ||||| ||||| 
Sbjct: 303 ccggagacgttcgcgaggaacagggagctggaggtgatccactcccggtgggcaatgctg 362

                                                                       
Query: 336 ggcgcgctcggttgtgtcttccccgagctgctcgcccgcaacggtgttaagttcggtgag 395
           || ||||| || ||  ||||||||||| | ||  ||   ||||| ||||| ||||| |||
Sbjct: 363 ggggcgctgggctgcttcttccccgagatcctgtccaagaacggggttaatttcggggag 422

                                                                       
Query: 396 gctgtttggttcaaggctggatctcagatcttcagcgagggtggccttgactacctcggc 455
           || || ||||||||||| ||  | |||||||||  |||||| || || |||||||| || 
Sbjct: 423 gcggtgtggttcaaggccggcgcgcagatcttctccgagggggggctcgactacctgggg 482

                                                                       
Query: 456 aacccaagccttgtgcacgcccagagtatccttgccatttgggcttgtcaggttgtgctc 515
           |||||   ||| |||| | ||||||| ||||| ||||| |||||    ||||| ||||||
Sbjct: 483 aaccccgccctggtgcgcccccagagcatcctcgccatctgggcggtccaggtggtgctc 542

                
Query: 516 atggg 520
           |||||
Sbjct: 543 atggg 547

---

>gb|M30616.1|TOMCBPC2 Tomato chlorophyll a/b-binding protein Cab-1A gene , 3' end
          Length = 351

 Score =  113 bits (57), Expect = 7e-22
 Identities = 100/113 (88%), Gaps = 1/113 (0%)
 Strand = Plus / Plus

                                                                       
Query: 489 gccatttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgcattgctggt 548
           ||||| |||||||| || |||||| | ||||| ||||||||||| |||||||||||||||
Sbjct: 28  gccatctgggcttgccaagttgtgttgatgggagccgttgagggataccgcattgctggt 87

                                                                
Query: 549 ggaccacttggtgagatcgtcgacccattataccccgggtggcagcttcgacc 601
           ||||| ||||||||| | ||||||||| | |||||| ||||||||||||||||
Sbjct: 88  ggacctcttggtgaggttgtcgacccactctacccc-ggtggcagcttcgacc 139

---

>gb|K00973.1|PETCAB3 Petunia major chlorophyll a/b binding protein (Cab) clone pCab3, 3'
           end and flank
          Length = 511

 Score =  111 bits (56), Expect = 3e-21
 Identities = 122/144 (84%)
 Strand = Plus / Plus

                                                                       
Query: 420 cagatcttcagcgagggtggccttgactacctcggcaacccaagccttgtgcacgcccag 479
           ||||| |||||||||||||  ||||||||| | ||||||||||| ||  | ||||| || 
Sbjct: 19  cagattttcagcgagggtgaacttgactacttgggcaacccaagtctgatccacgcacaa 78

                                                                       
Query: 480 agtatccttgccatttgggcttgtcaggttgtgctcatgggtgccgttgagggttaccgc 539
           |||||| | ||| |||||||||| || |||||| | ||||| || |||||||||||||||
Sbjct: 79  agtatcttggccgtttgggcttgccaagttgtgttgatgggagctgttgagggttaccgc 138

                                   
Query: 540 attgctggtggaccacttggtgag 563
            ||||||||||||| |||||||||
Sbjct: 139 gttgctggtggacctcttggtgag 162

---

>emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putative chlorophyll A-B binding
           protein type I
          Length = 684

 Score =  109 bits (55), Expect = 1e-20
 Identities = 229/287 (79%)
 Strand = Plus / Plus

                                                                       
Query: 234 cccggtgactacgggtgggacaccgctggactgtcggctgacccagagaccttcgccaag 293
           ||||| |||||||||||||||||||| || || ||||| ||||| |||||||||||||| 
Sbjct: 12  cccggagactacgggtgggacaccgccgggctctcggccgaccccgagaccttcgccaaa 71

                                                                       
Query: 294 aaccgggagctcgaggtgatccattgccgttgggccatgcttggcgcgctcggttgtgtc 353
           ||  | ||||| ||||||||||| ||| | ||||||||| | || |||||||| || || 
Sbjct: 72  aatagagagctggaggtgatccactgcagatgggccatgttgggggcgctcggctgcgtt 131

                                                                       
Query: 354 ttccccgagctgctcgcccgcaacggtgttaagttcggtgaggctgtttggttcaaggct 413
           ||||| |||||| | |||   ||||| || || || || || || || ||||||||||| 
Sbjct: 132 ttcccggagctgttggccaaaaacggggtgaaatttggggaagccgtgtggttcaaggcc 191

                                                                       
Query: 414 ggatctcagatcttcagcgagggtggccttgactacctcggcaacccaagccttgtgcac 473
           ||  | ||||| |||   ||||| ||||| |||||||| || ||||| | |||  | |||
Sbjct: 192 ggggcgcagatattctcagagggaggcctcgactacctggggaaccctaacctgattcac 251

                                                          
Query: 474 gcccagagtatccttgccatttgggcttgtcaggttgtgctcatggg 520
           || ||||| || || ||||| ||||| || |||||||||||||||||
Sbjct: 252 gcacagagcatactcgccatctgggcctgccaggttgtgctcatggg 298

---

>emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b binding protein
          Length = 1011

 Score =  107 bits (54), Expect = 4e-20
 Identities = 90/102 (88%)
 Strand = Plus / Plus

                                                                       
Query: 215 ctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctga 274
           |||||||||||| |||||||||||||||||||| |||||||| ||||| ||||| |||||
Sbjct: 203 ctacctgaccggcgagttccccggtgactacggctgggacactgctggtctgtccgctga 262

                                                     
Query: 275 cccagagaccttcgccaagaaccgggagctcgaggtgatcca 316
           ||| |||||||||   ||| |||| ||||| |||||||||||
Sbjct: 263 ccccgagaccttcaagaagtaccgtgagctggaggtgatcca 304



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                       
Query: 377 cggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgaggg 436
           |||||| |||||||| ||| | || ||||||||||| ||  | |||||||||  ||||||
Sbjct: 368 cggtgtcaagttcggcgagcccgtgtggttcaaggccggtgcccagatcttctccgaggg 427

                               
Query: 437 tggccttgactacctcggca 456
           |||||| |||||||| ||||
Sbjct: 428 tggcctggactacctgggca 447

---

>gb|M23532.1|PCPCBP P.patens major chlorophyll binding protein gene, complete cds
          Length = 2544

 Score =  107 bits (54), Expect = 4e-20
 Identities = 135/162 (83%)
 Strand = Plus / Plus

                                                                        
Query: 377  cggtgttaagttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgaggg 436
            |||||| |||||||| ||||| || ||||||||||| ||| |||||||||||||||||||
Sbjct: 2008 cggtgtgaagttcggcgaggcggtgtggttcaaggccggagctcagatcttcagcgaggg 2067

                                                                        
Query: 437  tggccttgactacctcggcaacccaagccttgtgcacgcccagagtatccttgccatttg 496
             ||  | |||||||| |||||||| ||||| |||||||| ||||| ||  | || || ||
Sbjct: 2068 ggggttggactacctgggcaaccccagcctggtgcacgctcagagcattttggcgatctg 2127

                                                      
Query: 497  ggcttgtcaggttgtgctcatgggtgccgttgagggttaccg 538
            ||| || ||||| ||||| ||||| ||||| ||||| |||||
Sbjct: 2128 ggcatgccaggtggtgctgatgggagccgtggaggggtaccg 2169



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 77/89 (86%)
 Strand = Plus / Plus

                                                                        
Query: 228  gagttccccggtgactacgggtgggacaccgctggactgtcggctgacccagagaccttc 287
            |||||| |||| |||||||| ||||||||||||||||||||| | ||||| ||||| |||
Sbjct: 1859 gagttcgccggcgactacggatgggacaccgctggactgtcgtcagacccggagacgttc 1918

                                         
Query: 288  gccaagaaccgggagctcgaggtgatcca 316
            |||  |||| ||||||| ||||| |||||
Sbjct: 1919 gcccggaacagggagctggaggtcatcca 1947

---

>gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvesting chlorophyll-a/b
           binding protein (LhcII-1.3) mRNA, complete cds; nuclear
           gene for chloroplast product
          Length = 1100

 Score =  105 bits (53), Expect = 2e-19
 Identities = 68/73 (93%)
 Strand = Plus / Plus

                                                                       
Query: 215 ctacctgaccggtgagttccccggtgactacgggtgggacaccgctggactgtcggctga 274
           |||||||||||| |||||||||||||||||||| ||||||||||| || |||||||||||
Sbjct: 189 ctacctgaccggcgagttccccggtgactacggctgggacaccgccggcctgtcggctga 248

                        
Query: 275 cccagagaccttc 287
           ||| |||||||||
Sbjct: 249 cccggagaccttc 261



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 65/76 (85%)
 Strand = Plus / Plus

                                                                       
Query: 385 agttcggtgaggctgtttggttcaaggctggatctcagatcttcagcgagggtggccttg 444
           ||||||| |||||||| ||||||||||| ||  | |||||||||  |||||| ||||| |
Sbjct: 359 agttcggcgaggctgtctggttcaaggccggcgcccagatcttctccgagggcggcctgg 418

                           
Query: 445 actacctcggcaaccc 460
           ||||||| ||||||||
Sbjct: 419 actacctgggcaaccc 434


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,370,496
Number of Sequences: 3902068
Number of extensions: 3370496
Number of successful extensions: 61784
Number of sequences better than 10.0: 412
Number of HSP's better than 10.0 without gapping: 416
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 60439
Number of HSP's gapped (non-prelim): 1205
length of query: 601
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 578
effective length of database: 17,143,297,704
effective search space: 9908826072912
effective search space used: 9908826072912
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---