| Clone Name | bags12j22 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY677177.1| Hordeum vulgare UDP-D-glucuronate decarboxylase (UXS1) mRNA, complete cds Length = 1433 Score = 79.8 bits (40), Expect = 3e-13 Identities = 40/40 (100%) Strand = Plus / Plus Query: 1 agtaacttcattgctcaggccatacgtggtgaagccctga 40 |||||||||||||||||||||||||||||||||||||||| Sbjct: 736 agtaacttcattgctcaggccatacgtggtgaagccctga 775
>dbj|AB079064.1| Oryza sativa (japonica cultivar-group) UXS-3 mRNA for UDP-glucuronic acid decarboxylase, complete cds Length = 1053 Score = 50.1 bits (25), Expect = 3e-04 Identities = 28/29 (96%) Strand = Plus / Plus Query: 1 agtaacttcattgctcaggccatacgtgg 29 ||||||||||||||||||||| ||||||| Sbjct: 664 agtaacttcattgctcaggccgtacgtgg 692
>dbj|AK100908.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132F05, full insert sequence Length = 1811 Score = 50.1 bits (25), Expect = 3e-04 Identities = 28/29 (96%) Strand = Plus / Plus Query: 1 agtaacttcattgctcaggccatacgtgg 29 ||||||||||||||||||||| ||||||| Sbjct: 1152 agtaacttcattgctcaggccgtacgtgg 1180
>dbj|AK060031.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-303-H02, full insert sequence Length = 1411 Score = 50.1 bits (25), Expect = 3e-04 Identities = 28/29 (96%) Strand = Plus / Plus Query: 1 agtaacttcattgctcaggccatacgtgg 29 ||||||||||||||||||||| ||||||| Sbjct: 763 agtaacttcattgctcaggccgtacgtgg 791
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 44.1 bits (22), Expect = 0.018 Identities = 25/26 (96%) Strand = Plus / Plus Query: 1 agtaacttcattgctcaggccatacg 26 ||||||||||||||||||||| |||| Sbjct: 9411514 agtaacttcattgctcaggccgtacg 9411539
>gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0002D01, from chromosome 3, complete sequence Length = 187589 Score = 44.1 bits (22), Expect = 0.018 Identities = 25/26 (96%) Strand = Plus / Plus Query: 1 agtaacttcattgctcaggccatacg 26 ||||||||||||||||||||| |||| Sbjct: 108914 agtaacttcattgctcaggccgtacg 108939
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 44.1 bits (22), Expect = 0.018 Identities = 25/26 (96%) Strand = Plus / Plus Query: 1 agtaacttcattgctcaggccatacg 26 ||||||||||||||||||||| |||| Sbjct: 9409635 agtaacttcattgctcaggccgtacg 9409660
>emb|AL445164.14| Human DNA sequence from clone RP4-736G20 on chromosome Xq23-24 Contains part of a novel gene (KIAA1495), complete sequence Length = 31200 Score = 36.2 bits (18), Expect = 4.4 Identities = 21/22 (95%) Strand = Plus / Plus Query: 4 aacttcattgctcaggccatac 25 ||||||||||||||| |||||| Sbjct: 10121 aacttcattgctcagtccatac 10142
>emb|AL590448.1|CNS07EGF chromosome VIII of strain GB-M1 of Encephalitozoon cuniculi (Microspora) Length = 238147 Score = 36.2 bits (18), Expect = 4.4 Identities = 18/18 (100%) Strand = Plus / Plus Query: 17 aggccatacgtggtgaag 34 |||||||||||||||||| Sbjct: 145351 aggccatacgtggtgaag 145368 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 213,585 Number of Sequences: 3902068 Number of extensions: 213585 Number of successful extensions: 48960 Number of sequences better than 10.0: 9 Number of HSP's better than 10.0 without gapping: 9 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 48927 Number of HSP's gapped (non-prelim): 33 length of query: 40 length of database: 17,233,045,268 effective HSP length: 20 effective length of query: 20 effective length of database: 17,155,003,908 effective search space: 343100078160 effective search space used: 343100078160 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)