ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags12d07
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_550297.1| Oryza sativa (japonica cultivar-group), mRNA 652 0.0
2dbj|AK071324.1| Oryza sativa (japonica cultivar-group) cDNA clon... 644 0.0
3dbj|AK104306.1| Oryza sativa (japonica cultivar-group) cDNA clon... 628 e-177
4gb|AY104448.1| Zea mays PCO064487 mRNA sequence 535 e-149
5dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 155 2e-34
6dbj|AP003215.3| Oryza sativa (japonica cultivar-group) genomic D... 155 2e-34
7gb|AY463018.1| Musa acuminata cytochrome b5 reductase mRNA, part... 151 3e-33
8ref|NM_122015.3| Arabidopsis thaliana cytochrome-b5 reductase/ o... 84 6e-13
9gb|BT024720.1| Arabidopsis thaliana At5g20080 mRNA, complete cds 84 6e-13
10emb|BX829612.1|CNS0A08D Arabidopsis thaliana Full-length cDNA Co... 84 6e-13
11gb|AY087280.1| Arabidopsis thaliana clone 33544 mRNA, complete s... 76 1e-10
12ref|XM_637359.1| Dictyostelium discoideum hypothetical protein (... 50 0.008
13ref|XM_750645.1| Aspergillus fumigatus Af293 NADH-cytochrome b5 ... 50 0.008
14ref|XM_750646.1| Aspergillus fumigatus Af293 hypothetical protei... 50 0.008
15gb|AF296836.1|F28I16 Arabidopsis thaliana BAC F28I16 50 0.008
16gb|AF274589.1|AF274589 Cucurbita maxima cytochrome b5 reductase ... 48 0.033
17gb|CP000117.1| Anabaena variabilis ATCC 29413 chromosome, comple... 46 0.13
18ref|XM_966964.1| PREDICTED: Tribolium castaneum similar to CG594... 46 0.13
19ref|XM_706374.1| Candida albicans SC5314 cytochrome b reductase ... 44 0.51
20ref|XM_706357.1| Candida albicans SC5314 cytochrome b reductase ... 44 0.51
21ref|XM_448811.1| Candida glabrata CBS138, CAGL0L00847g partial mRNA 44 0.51
22emb|CR380958.1| Candida glabrata strain CBS138 chromosome L comp... 44 0.51
23emb|BX832722.1|CNS09ZMI Arabidopsis thaliana Full-length cDNA Co... 44 0.51
24emb|AL935299.11| Zebrafish DNA sequence from clone DKEY-38M5, co... 44 0.51
25gb|AC168270.1| Mus musculus BAC clone RP23-173C15 from chromosom... 42 2.0
26ref|XM_385028.1| Gibberella zeae PH-1 chromosome 3 hypothetical ... 42 2.0
27ref|XM_780154.1| PREDICTED: Strongylocentrotus purpuratus simila... 42 2.0
28gb|AC115341.6| Rattus norvegicus 3 BAC CH230-248O1 (Children's H... 40 7.9
29gb|AC095688.7| Rattus norvegicus 2 BAC CH230-9C20 (Children's Ho... 40 7.9
30emb|Z83217.2|CEC10C6 Caenorhabditis elegans Cosmid C10C6, comple... 40 7.9
31ref|XM_797680.1| Trypanosoma cruzi strain CL Brener cytochrome-B... 40 7.9
32gb|AC132413.3| Mus musculus BAC clone RP23-375I11 from chromosom... 40 7.9
33ref|XM_810901.1| Trypanosoma cruzi strain CL Brener cytochrome-B... 40 7.9
34ref|XM_725955.1| Plasmodium yoelii yoelii str. 17XNL FAD/NAD-bin... 40 7.9
35emb|Z46861.1|SC9905 S.cerevisiae chromosome IX cosmid 9905 and l... 40 7.9
36emb|Z28365.1|SCCYTB5R S.cerevisiae (842) gene for cytochrome b5 ... 40 7.9
37emb|CR380959.1| Candida glabrata strain CBS138 chromosome M comp... 40 7.9
38emb|AL445066.1|TACID4 Thermoplasma acidophilum complete genome; ... 40 7.9
39gb|AC008682.6| Homo sapiens chromosome 5 clone CTB-54G2, complet... 40 7.9
40gb|AC024474.8| Homo sapiens chromosome 15, clone RP11-686I6, com... 40 7.9
41ref|NM_069762.2| Caenorhabditis elegans C10C6.3 (C10C6.3) mRNA, ... 40 7.9
42gb|AC026800.4|AC026800 Homo sapiens chromosome 5 clone CTD-2377N... 40 7.9
43gb|AC016991.5|AC016991 Homo sapiens BAC clone RP11-17E15 from Y,... 40 7.9
44emb|AJ325270.1|HSA325270 Homo sapiens genomic sequence surroundi... 40 7.9
45emb|AL732611.21| Mouse DNA sequence from clone RP23-135A21 on ch... 40 7.9
46emb|AL954388.5| Mouse DNA sequence from clone RP23-395P6 on chro... 40 7.9
47gb|AC127522.7| Homo sapiens chromosome 15, clone RP13-126C7, com... 40 7.9 
>ref|XM_550297.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1310

 Score =  652 bits (329), Expect = 0.0
 Identities = 479/529 (90%)
 Strand = Plus / Plus

                                                                       
Query: 56  tattcagattttcgtttgacccatctactaagctgggcctggatgttgcctcatgtctcg 115
           |||| ||||||||||||||||||||||||||| |||| || |||||||| ||||||||| 
Sbjct: 317 tatttagattttcgtttgacccatctactaagttgggtcttgatgttgcttcatgtctca 376

                                                                       
Query: 116 taacaagggcccccataggtcaggaagtggagggaagaagaaaatacgttattcgcccgt 175
           |||||||||| || |||||  |||||||||||||| |||||||||  || ||||||||||
Sbjct: 377 taacaagggctccaataggagaggaagtggagggaggaagaaaatttgtcattcgcccgt 436

                                                                       
Query: 176 acacgcctatctctgacccagattctaaaggacacttcgacctattaatcaaggtttatc 235
           |||| ||||||||||| ||||||||||||||| | || |||||  |||||||||||||||
Sbjct: 437 acacacctatctctgatccagattctaaaggatattttgacctgctaatcaaggtttatc 496

                                                                       
Query: 236 ctgatgggaaaatgagtcagcattttgctagtttgaagccaggagatgttctcgaagtca 295
           |||||||||||||||||||| |||| || ||| |||| |||||||||||| | || ||||
Sbjct: 497 ctgatgggaaaatgagtcagtatttcgcaagtctgaaaccaggagatgttgttgaggtca 556

                                                                       
Query: 296 aagggcccattgaaaagctcagatatagcccaaatatgaaaagacaaattggcatgattg 355
           |||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |
Sbjct: 557 aagggcccattgaaaagctcagatatagcccaaatatgaagaaacaaattggcatgatcg 616

                                                                       
Query: 356 ctggtggtactggcataacaccaatgctgcaagttgttagggccatcctgaaaaaccctg 415
           ||||||| ||||||||||||||||||||||| ||||| ||||| ||||| ||||||||||
Sbjct: 617 ctggtgggactggcataacaccaatgctgcaggttgtcagggctatcctaaaaaaccctg 676

                                                                       
Query: 416 atgataacactcaggtttccttgatttacgccaatgtgtcaccagatgatatcttgctga 475
           |||| ||||||||||||||||| ||||| |||||||||||||||||||||||||||||||
Sbjct: 677 atgacaacactcaggtttccttaatttatgccaatgtgtcaccagatgatatcttgctga 736

                                                                       
Query: 476 aaagggagttagatagacttgccagcagctatcctaatttcaaggtattttatacagttg 535
           ||||||| ||||||||||||||||| ||||||||||||||||||||||| || || || |
Sbjct: 737 aaagggaattagatagacttgccagtagctatcctaatttcaaggtattctacacggtgg 796

                                                            
Query: 536 ataaaccatcaagtgactggaggggtggtgttggctacatatcaaagga 584
           | |||||||||| ||| |||||||||||||||||||||||||| |||||
Sbjct: 797 acaaaccatcaaatgattggaggggtggtgttggctacatatccaagga 845
to top
>dbj|AK071324.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023089J04, full
           insert sequence
          Length = 1402

 Score =  644 bits (325), Expect = 0.0
 Identities = 478/529 (90%)
 Strand = Plus / Plus

                                                                       
Query: 56  tattcagattttcgtttgacccatctactaagctgggcctggatgttgcctcatgtctcg 115
           |||| ||||||||||||||||||||||||||| |||| || |||||||| ||||||||| 
Sbjct: 397 tatttagattttcgtttgacccatctactaagttgggtcttgatgttgcttcatgtctca 456

                                                                       
Query: 116 taacaagggcccccataggtcaggaagtggagggaagaagaaaatacgttattcgcccgt 175
           |||||||||| || |||||  |||||||||||||| |||||||||  || ||||||||||
Sbjct: 457 taacaagggctccaataggagaggaagtggagggaggaagaaaatttgtcattcgcccgt 516

                                                                       
Query: 176 acacgcctatctctgacccagattctaaaggacacttcgacctattaatcaaggtttatc 235
           |||| ||||||||||| ||||||||||||||| | || |||||  |||||||||||||||
Sbjct: 517 acacacctatctctgatccagattctaaaggatattttgacctgctaatcaaggtttatc 576

                                                                       
Query: 236 ctgatgggaaaatgagtcagcattttgctagtttgaagccaggagatgttctcgaagtca 295
           |||||||||||||||||||| |||| || ||| |||| |||||||||||| | || ||||
Sbjct: 577 ctgatgggaaaatgagtcagtatttcgcaagtctgaaaccaggagatgttgttgaggtca 636

                                                                       
Query: 296 aagggcccattgaaaagctcagatatagcccaaatatgaaaagacaaattggcatgattg 355
           |||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |
Sbjct: 637 aagggcccattgaaaagctcagatatagcccaaatatgaagaaacaaattggcatgatcg 696

                                                                       
Query: 356 ctggtggtactggcataacaccaatgctgcaagttgttagggccatcctgaaaaaccctg 415
           ||||||| ||||||||||||||||||||||| ||||| ||||| ||||| ||||||||||
Sbjct: 697 ctggtgggactggcataacaccaatgctgcaggttgtcagggctatcctaaaaaaccctg 756

                                                                       
Query: 416 atgataacactcaggtttccttgatttacgccaatgtgtcaccagatgatatcttgctga 475
           |||| |||||||| |||||||| ||||| |||||||||||||||||||||||||||||||
Sbjct: 757 atgacaacactcacgtttccttaatttatgccaatgtgtcaccagatgatatcttgctga 816

                                                                       
Query: 476 aaagggagttagatagacttgccagcagctatcctaatttcaaggtattttatacagttg 535
           ||||||| ||||||||||||||||| ||||||||||||||||||||||| || || || |
Sbjct: 817 aaagggaattagatagacttgccagtagctatcctaatttcaaggtattctacacggtgg 876

                                                            
Query: 536 ataaaccatcaagtgactggaggggtggtgttggctacatatcaaagga 584
           | |||||||||| ||| |||||||||||||||||||||||||| |||||
Sbjct: 877 acaaaccatcaaatgattggaggggtggtgttggctacatatccaagga 925
to top
>dbj|AK104306.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-012-E03, full
           insert sequence
          Length = 1310

 Score =  628 bits (317), Expect = e-177
 Identities = 476/529 (89%)
 Strand = Plus / Plus

                                                                       
Query: 56  tattcagattttcgtttgacccatctactaagctgggcctggatgttgcctcatgtctcg 115
           |||| ||||||||||||||||||||||||||| |||| || |||||||| ||||||||| 
Sbjct: 317 tatttagattttcgtttgacccatctactaagttgggtcttgatgttgcttcatgtctca 376

                                                                       
Query: 116 taacaagggcccccataggtcaggaagtggagggaagaagaaaatacgttattcgcccgt 175
           |||||||||| || |||||  |||||||||||||| |||||||||  || ||||||||||
Sbjct: 377 taacaagggctccaataggggaggaagtggagggaggaagaaaatttgtcattcgcccgt 436

                                                                       
Query: 176 acacgcctatctctgacccagattctaaaggacacttcgacctattaatcaaggtttatc 235
           |||| ||||||||||| ||||||||||||||| | || |||||  |||||||||||||||
Sbjct: 437 acacacctatctctgatccagattctaaaggatattttgacctgctaatcaaggtttatc 496

                                                                       
Query: 236 ctgatgggaaaatgagtcagcattttgctagtttgaagccaggagatgttctcgaagtca 295
           |||||||||||||||||||| |||| || ||| |||| |||||||||||| | || ||||
Sbjct: 497 ctgatgggaaaatgagtcagtatttcgcaagtctgaaaccaggagatgttgttgaggtca 556

                                                                       
Query: 296 aagggcccattgaaaagctcagatatagcccaaatatgaaaagacaaattggcatgattg 355
           |||||||||||||||||| ||||||||||||||||||||| | ||||||||||||||| |
Sbjct: 557 aagggcccattgaaaagcccagatatagcccaaatatgaagaaacaaattggcatgatcg 616

                                                                       
Query: 356 ctggtggtactggcataacaccaatgctgcaagttgttagggccatcctgaaaaaccctg 415
           ||||||| ||||||||||||||||||||||| ||||| ||||| ||||| ||||||||||
Sbjct: 617 ctggtgggactggcataacaccaatgctgcaggttgtcagggctatcctaaaaaaccctg 676

                                                                       
Query: 416 atgataacactcaggtttccttgatttacgccaatgtgtcaccagatgatatcttgctga 475
           |||| ||||||||||||||||| ||||| |||||||||||||||||||||||||||||||
Sbjct: 677 atgacaacactcaggtttccttaatttatgccaatgtgtcaccagatgatatcttgctga 736

                                                                       
Query: 476 aaagggagttagatagacttgccagcagctatcctaatttcaaggtattttatacagttg 535
           |||||||  |||||||||||||||| ||||| ||||||||||||||||| || || || |
Sbjct: 737 aaagggaactagatagacttgccagtagctaacctaatttcaaggtattctacacggtgg 796

                                                            
Query: 536 ataaaccatcaagtgactggaggggtggtgttggctacatatcaaagga 584
           | |||||||||| ||| |||||||||||||||||||||||||| |||||
Sbjct: 797 acaaaccatcaaatgattggaggggtggtgttggctacatatccaagga 845
to top
>gb|AY104448.1| Zea mays PCO064487 mRNA sequence
          Length = 1351

 Score =  535 bits (270), Expect = e-149
 Identities = 453/514 (88%)
 Strand = Plus / Plus

                                                                       
Query: 56  tattcagattttcgtttgacccatctactaagctgggcctggatgttgcctcatgtctcg 115
           ||||||| ||||| ||||| ||||| ||||| ||||| || ||||||||||| || ||| 
Sbjct: 345 tattcaggttttcatttgatccatcaactaaactgggacttgatgttgcctcgtgcctca 404

                                                                       
Query: 116 taacaagggcccccataggtcaggaagtggagggaagaagaaaatacgttattcgcccgt 175
           | |||||||| || |||||  ||||||  ||||||||||| ||||| || ||||||||||
Sbjct: 405 tcacaagggcacctataggcgaggaagctgagggaagaaggaaatatgtgattcgcccgt 464

                                                                       
Query: 176 acacgcctatctctgacccagattctaaaggacacttcgacctattaatcaaggtttatc 235
           |||| ||||||||||| ||||| ||||||||  | || |||||| | ||||||||||| |
Sbjct: 465 acacacctatctctgatccagactctaaagggtattttgacctactgatcaaggtttacc 524

                                                                       
Query: 236 ctgatgggaaaatgagtcagcattttgctagtttgaagccaggagatgttctcgaagtca 295
           ||||||| |||||||||||| ||||||| ||||||||||||||||||||| | |||||||
Sbjct: 525 ctgatggaaaaatgagtcagtattttgcaagtttgaagccaggagatgttgttgaagtca 584

                                                                       
Query: 296 aagggcccattgaaaagctcagatatagcccaaatatgaaaagacaaattggcatgattg 355
           ||||||||||||||||||||||||| | ||| || ||||||| ||||||||| ||||| |
Sbjct: 585 aagggcccattgaaaagctcagatacaacccgaacatgaaaaaacaaattgggatgatcg 644

                                                                       
Query: 356 ctggtggtactggcataacaccaatgctgcaagttgttagggccatcctgaaaaaccctg 415
           |||||||| |||| ||||||||||||||||| ||||| ||||| ||||| ||||||||| 
Sbjct: 645 ctggtggttctggtataacaccaatgctgcaggttgtcagggctatcctcaaaaacccta 704

                                                                       
Query: 416 atgataacactcaggtttccttgatttacgccaatgtgtcaccagatgatatcttgctga 475
           |||| ||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
Sbjct: 705 atgacaacactcaggtctccttaatttacgccaatgtgtcaccagatgatatcttgctca 764

                                                                       
Query: 476 aaagggagttagatagacttgccagcagctatcctaatttcaaggtattttatacagttg 535
           |||| ||  | |||||||||||||| ||||||||||| ||||||||||||||||||||||
Sbjct: 765 aaagagaactggatagacttgccagtagctatcctaacttcaaggtattttatacagttg 824

                                             
Query: 536 ataaaccatcaagtgactggaggggtggtgttgg 569
           ||||||| |||| |||||||||||||||||||||
Sbjct: 825 ataaaccgtcaactgactggaggggtggtgttgg 858
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score =  155 bits (78), Expect = 2e-34
 Identities = 90/94 (95%)
 Strand = Plus / Minus

                                                                           
Query: 428     aggtttccttgatttacgccaatgtgtcaccagatgatatcttgctgaaaagggagttag 487
               |||||||||| ||||| |||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 3820421 aggtttccttaatttatgccaatgtgtcaccagatgatatcttgctgaaaagggaattag 3820362

                                                 
Query: 488     atagacttgccagcagctatcctaatttcaaggt 521
               ||||||||||||| ||||||||||||||||||||
Sbjct: 3820361 atagacttgccagtagctatcctaatttcaaggt 3820328



 Score =  105 bits (53), Expect = 2e-19
 Identities = 71/77 (92%)
 Strand = Plus / Minus

                                                                           
Query: 355     gctggtggtactggcataacaccaatgctgcaagttgttagggccatcctgaaaaaccct 414
               |||||||| ||||||||||||||||||||||| ||||| ||||| ||||| |||||||||
Sbjct: 3820740 gctggtgggactggcataacaccaatgctgcaggttgtcagggctatcctaaaaaaccct 3820681

                                
Query: 415     gatgataacactcaggt 431
               ||||| |||||||||||
Sbjct: 3820680 gatgacaacactcaggt 3820664



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 51/53 (96%)
 Strand = Plus / Minus

                                                                    
Query: 299     ggcccattgaaaagctcagatatagcccaaatatgaaaagacaaattggcatg 351
               ||||||||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 3820937 ggcccattgaaaagctcagatatagcccaaatatgaagaaacaaattggcatg 3820885



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 59/64 (92%)
 Strand = Plus / Minus

                                                                           
Query: 60      cagattttcgtttgacccatctactaagctgggcctggatgttgcctcatgtctcgtaac 119
               |||||||||||||||||||||||||||| |||| || |||||||| ||||||||| ||||
Sbjct: 3821951 cagattttcgtttgacccatctactaagttgggtcttgatgttgcttcatgtctcataac 3821892

                   
Query: 120     aagg 123
               ||||
Sbjct: 3821891 aagg 3821888



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 66/74 (89%)
 Strand = Plus / Minus

                                                                           
Query: 227     aggtttatcctgatgggaaaatgagtcagcattttgctagtttgaagccaggagatgttc 286
               ||||||||||||||||||||||||||||| |||| || ||| |||| |||||||||||| 
Sbjct: 3821093 aggtttatcctgatgggaaaatgagtcagtatttcgcaagtctgaaaccaggagatgttg 3821034

                             
Query: 287     tcgaagtcaaaggg 300
               | || |||||||||
Sbjct: 3821033 ttgaggtcaaaggg 3821020



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                              
Query: 538     aaaccatcaagtgactggaggggtggtgttggctacatatcaaagga 584
               |||||||||| ||| |||||||||||||||||||||||||| |||||
Sbjct: 3820222 aaaccatcaaatgattggaggggtggtgttggctacatatccaagga 3820176



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                        
Query: 174     gtacacgcctatctctgacccagattctaaaggacacttcgacctattaatcaaggt 230
               |||||| ||||||||||| ||||||||||||||| | || |||||  ||||||||||
Sbjct: 3821270 gtacacacctatctctgatccagattctaaaggatattttgacctgctaatcaaggt 3821214



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                       
Query: 137     aggaagtggagggaagaagaaaatacgttattcgcccgta 176
               |||||||||||||| |||||||||  || |||||||||||
Sbjct: 3821408 aggaagtggagggaggaagaaaatttgtcattcgcccgta 3821369
to top
>dbj|AP003215.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OSJNBa0089K24
          Length = 154137

 Score =  155 bits (78), Expect = 2e-34
 Identities = 90/94 (95%)
 Strand = Plus / Minus

                                                                         
Query: 428   aggtttccttgatttacgccaatgtgtcaccagatgatatcttgctgaaaagggagttag 487
             |||||||||| ||||| |||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 93963 aggtttccttaatttatgccaatgtgtcaccagatgatatcttgctgaaaagggaattag 93904

                                               
Query: 488   atagacttgccagcagctatcctaatttcaaggt 521
             ||||||||||||| ||||||||||||||||||||
Sbjct: 93903 atagacttgccagtagctatcctaatttcaaggt 93870



 Score =  105 bits (53), Expect = 2e-19
 Identities = 71/77 (92%)
 Strand = Plus / Minus

                                                                         
Query: 355   gctggtggtactggcataacaccaatgctgcaagttgttagggccatcctgaaaaaccct 414
             |||||||| ||||||||||||||||||||||| ||||| ||||| ||||| |||||||||
Sbjct: 94282 gctggtgggactggcataacaccaatgctgcaggttgtcagggctatcctaaaaaaccct 94223

                              
Query: 415   gatgataacactcaggt 431
             ||||| |||||||||||
Sbjct: 94222 gatgacaacactcaggt 94206



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 51/53 (96%)
 Strand = Plus / Minus

                                                                  
Query: 299   ggcccattgaaaagctcagatatagcccaaatatgaaaagacaaattggcatg 351
             ||||||||||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 94479 ggcccattgaaaagctcagatatagcccaaatatgaagaaacaaattggcatg 94427



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 59/64 (92%)
 Strand = Plus / Minus

                                                                         
Query: 60    cagattttcgtttgacccatctactaagctgggcctggatgttgcctcatgtctcgtaac 119
             |||||||||||||||||||||||||||| |||| || |||||||| ||||||||| ||||
Sbjct: 95493 cagattttcgtttgacccatctactaagttgggtcttgatgttgcttcatgtctcataac 95434

                 
Query: 120   aagg 123
             ||||
Sbjct: 95433 aagg 95430



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 66/74 (89%)
 Strand = Plus / Minus

                                                                         
Query: 227   aggtttatcctgatgggaaaatgagtcagcattttgctagtttgaagccaggagatgttc 286
             ||||||||||||||||||||||||||||| |||| || ||| |||| |||||||||||| 
Sbjct: 94635 aggtttatcctgatgggaaaatgagtcagtatttcgcaagtctgaaaccaggagatgttg 94576

                           
Query: 287   tcgaagtcaaaggg 300
             | || |||||||||
Sbjct: 94575 ttgaggtcaaaggg 94562



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                            
Query: 538   aaaccatcaagtgactggaggggtggtgttggctacatatcaaagga 584
             |||||||||| ||| |||||||||||||||||||||||||| |||||
Sbjct: 93764 aaaccatcaaatgattggaggggtggtgttggctacatatccaagga 93718



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                      
Query: 174   gtacacgcctatctctgacccagattctaaaggacacttcgacctattaatcaaggt 230
             |||||| ||||||||||| ||||||||||||||| | || |||||  ||||||||||
Sbjct: 94812 gtacacacctatctctgatccagattctaaaggatattttgacctgctaatcaaggt 94756



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                     
Query: 137   aggaagtggagggaagaagaaaatacgttattcgcccgta 176
             |||||||||||||| |||||||||  || |||||||||||
Sbjct: 94950 aggaagtggagggaggaagaaaatttgtcattcgcccgta 94911
to top
>gb|AY463018.1| Musa acuminata cytochrome b5 reductase mRNA, partial cds
          Length = 571

 Score =  151 bits (76), Expect = 3e-33
 Identities = 211/256 (82%)
 Strand = Plus / Plus

                                                                       
Query: 227 aggtttatcctgatgggaaaatgagtcagcattttgctagtttgaagccaggagatgttc 286
           |||| ||||| || ||| ||||||||||||||||||| |  ||  |||| || |||||| 
Sbjct: 1   aggtatatccagaagggcaaatgagtcagcattttgcaaccttacagcctggcgatgttg 60

                                                                       
Query: 287 tcgaagtcaaagggcccattgaaaagctcagatatagcccaaatatgaaaagacaaattg 346
           | ||||| |||||||| ||||| ||||||||||||||||||||||||||||   | ||||
Sbjct: 61  ttgaagttaaagggccaattgagaagctcagatatagcccaaatatgaaaaaggacattg 120

                                                                       
Query: 347 gcatgattgctggtggtactggcataacaccaatgctgcaagttgttagggccatcctga 406
           | ||||| || || || || || || |||||||||||||| ||| | | ||| ||  |||
Sbjct: 121 gaatgatcgcagggggcacaggtattacaccaatgctgcaggttataaaggctattttga 180

                                                                       
Query: 407 aaaaccctgatgataacactcaggtttccttgatttacgccaatgtgtcaccagatgata 466
           | || |||||||||||||| ||||| ||||||||||| || ||  | |||||||||||||
Sbjct: 181 agaatcctgatgataacacccaggtatccttgatttatgctaacatatcaccagatgata 240

                           
Query: 467 tcttgctgaaaaggga 482
           ||||||||||| ||||
Sbjct: 241 tcttgctgaaagggga 256
to top
>ref|NM_122015.3| Arabidopsis thaliana cytochrome-b5 reductase/ oxidoreductase
           AT5G20080 mRNA, complete cds
          Length = 1426

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 192/242 (79%)
 Strand = Plus / Plus

                                                                       
Query: 226 aaggtttatcctgatgggaaaatgagtcagcattttgctagtttgaagccaggagatgtt 285
           ||||| |||||||| || |||||||||||||||||||| || || || || || ||||| 
Sbjct: 596 aaggtatatcctgacggaaaaatgagtcagcattttgccagcttaaaaccgggggatgtg 655

                                                                       
Query: 286 ctcgaagtcaaagggcccattgaaaagctcagatatagcccaaatatgaaaagacaaatt 345
            | ||||| ||||| ||| |||||||| ||| |||    || |||||||| | ||| |||
Sbjct: 656 ttggaagtaaaaggacccgttgaaaagttcaaatactcgccgaatatgaagaaacatatt 715

                                                                       
Query: 346 ggcatgattgctggtggtactggcataacaccaatgctgcaagttgttagggccatcctg 405
           ||||||||||| ||||| | ||| || || |||||||| || ||  ||   |||||  ||
Sbjct: 716 ggcatgattgccggtggaagtgggattactccaatgcttcaggtgattgatgccattgtg 775

                                                                       
Query: 406 aaaaaccctgatgataacactcaggtttccttgatttacgccaatgtgtcaccagatgat 465
           || || ||||| || ||||| ||| | || ||| |||| |||||||||||||||||||||
Sbjct: 776 aagaatcctgaggacaacacgcagatatcattgctttatgccaatgtgtcaccagatgat 835

             
Query: 466 at 467
           ||
Sbjct: 836 at 837
to top
>gb|BT024720.1| Arabidopsis thaliana At5g20080 mRNA, complete cds
          Length = 987

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 192/242 (79%)
 Strand = Plus / Plus

                                                                       
Query: 226 aaggtttatcctgatgggaaaatgagtcagcattttgctagtttgaagccaggagatgtt 285
           ||||| |||||||| || |||||||||||||||||||| || || || || || ||||| 
Sbjct: 454 aaggtatatcctgacggaaaaatgagtcagcattttgccagcttaaaaccgggggatgtg 513

                                                                       
Query: 286 ctcgaagtcaaagggcccattgaaaagctcagatatagcccaaatatgaaaagacaaatt 345
            | ||||| ||||| ||| |||||||| ||| |||    || |||||||| | ||| |||
Sbjct: 514 ttggaagtaaaaggacccgttgaaaagttcaaatactcgccgaatatgaagaaacatatt 573

                                                                       
Query: 346 ggcatgattgctggtggtactggcataacaccaatgctgcaagttgttagggccatcctg 405
           ||||||||||| ||||| | ||| || || |||||||| || ||  ||   |||||  ||
Sbjct: 574 ggcatgattgccggtggaagtgggattactccaatgcttcaggtgattgatgccattgtg 633

                                                                       
Query: 406 aaaaaccctgatgataacactcaggtttccttgatttacgccaatgtgtcaccagatgat 465
           || || ||||| || ||||| ||| | || ||| |||| |||||||||||||||||||||
Sbjct: 634 aagaatcctgaggacaacacgcagatatcattgctttatgccaatgtgtcaccagatgat 693

             
Query: 466 at 467
           ||
Sbjct: 694 at 695
to top
>emb|BX829612.1|CNS0A08D Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB24ZH04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1294

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 192/242 (79%)
 Strand = Plus / Plus

                                                                       
Query: 226 aaggtttatcctgatgggaaaatgagtcagcattttgctagtttgaagccaggagatgtt 285
           ||||| |||||||| || |||||||||||||||||||| || || || || || ||||| 
Sbjct: 464 aaggtatatcctgacggaaaaatgagtcagcattttgccagcttaaaaccgggggatgtg 523

                                                                       
Query: 286 ctcgaagtcaaagggcccattgaaaagctcagatatagcccaaatatgaaaagacaaatt 345
            | ||||| ||||| ||| |||||||| ||| |||    || |||||||| | ||| |||
Sbjct: 524 ttggaagtaaaaggacccgttgaaaagttcaaatactcgccgaatatgaagaaacatatt 583

                                                                       
Query: 346 ggcatgattgctggtggtactggcataacaccaatgctgcaagttgttagggccatcctg 405
           ||||||||||| ||||| | ||| || || |||||||| || ||  ||   |||||  ||
Sbjct: 584 ggcatgattgccggtggaagtgggattactccaatgcttcaggtgattgatgccattgtg 643

                                                                       
Query: 406 aaaaaccctgatgataacactcaggtttccttgatttacgccaatgtgtcaccagatgat 465
           || || ||||| || ||||| ||| | || ||| |||| |||||||||||||||||||||
Sbjct: 644 aagaatcctgaggacaacacgcagatatcattgctttatgccaatgtgtcaccagatgat 703

             
Query: 466 at 467
           ||
Sbjct: 704 at 705
to top
>gb|AY087280.1| Arabidopsis thaliana clone 33544 mRNA, complete sequence
          Length = 1287

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 191/242 (78%)
 Strand = Plus / Plus

                                                                       
Query: 226 aaggtttatcctgatgggaaaatgagtcagcattttgctagtttgaagccaggagatgtt 285
           ||||| |||||||| || |||||||||||||||||||| || || || || || ||||| 
Sbjct: 486 aaggtatatcctgacggaaaaatgagtcagcattttgccagcttaaaaccgggggatgtg 545

                                                                       
Query: 286 ctcgaagtcaaagggcccattgaaaagctcagatatagcccaaatatgaaaagacaaatt 345
            | ||||| ||||| ||| |||||||| ||| |||    || |||||||| | ||| |||
Sbjct: 546 ttggaagtaaaaggacccgttgaaaagttcaaatactcgccgaatatgaagaaacatatt 605

                                                                       
Query: 346 ggcatgattgctggtggtactggcataacaccaatgctgcaagttgttagggccatcctg 405
           ||||||||||| ||||| | ||| || || |||||||| || ||  ||   |||||  ||
Sbjct: 606 ggcatgattgccggtggaagtgggattactccaatgcttcaggtgattgatgccattgtg 665

                                                                       
Query: 406 aaaaaccctgatgataacactcaggtttccttgatttacgccaatgtgtcaccagatgat 465
           || || ||||| || ||||| ||| | || ||| |||| ||||||||||| |||||||||
Sbjct: 666 aagaatcctgaggacaacacgcagatatcattgctttatgccaatgtgtctccagatgat 725

             
Query: 466 at 467
           ||
Sbjct: 726 at 727
to top
>ref|XM_637359.1| Dictyostelium discoideum hypothetical protein (DDB0205543), partial
           mRNA
          Length = 1386

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 349 atgattgctggtggtactggcataacaccaatg 381
           |||||||||||||||||||| ||||| ||||||
Sbjct: 901 atgattgctggtggtactggtataactccaatg 933
to top
>ref|XM_750645.1| Aspergillus fumigatus Af293 NADH-cytochrome b5 reductase
           (Afu2g14060) partial mRNA
          Length = 1083

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 343 attggcatgattgctggtggtactggcat 371
           ||||| |||||||||||||||||||||||
Sbjct: 667 attggtatgattgctggtggtactggcat 695
to top
>ref|XM_750646.1| Aspergillus fumigatus Af293 hypothetical protein (Afu2g14050)
           partial mRNA
          Length = 576

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 343 attggcatgattgctggtggtactggcat 371
           ||||| |||||||||||||||||||||||
Sbjct: 288 attggtatgattgctggtggtactggcat 260
to top
>gb|AF296836.1|F28I16 Arabidopsis thaliana BAC F28I16
          Length = 84334

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                  
Query: 227   aggtttatcctgatgggaaaatgagtcagcattttgc 263
             |||| |||||||| || ||||||||||||||||||||
Sbjct: 73289 aggtatatcctgacggaaaaatgagtcagcattttgc 73325



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 440   tttacgccaatgtgtcaccagatgatat 467
             |||| |||||||||||||||||||||||
Sbjct: 74113 tttatgccaatgtgtcaccagatgatat 74140
to top
>gb|AF274589.1|AF274589 Cucurbita maxima cytochrome b5 reductase PP36 (PP36) mRNA, complete
           cds
          Length = 1337

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 111/140 (79%)
 Strand = Plus / Plus

                                                                       
Query: 244 aaaatgagtcagcattttgctagtttgaagccaggagatgttctcgaagtcaaagggccc 303
           ||||||| ||||||||||||||  ||||| || || |||   || ||||| ||||| |||
Sbjct: 518 aaaatgactcagcattttgctaaattgaaacctggtgataaacttgaagtgaaaggcccc 577

                                                                       
Query: 304 attgaaaagctcagatatagcccaaatatgaaaagacaaattggcatgattgctggtggt 363
           |||  |||||||| |||    ||||| ||||| | ||| ||||||||||| |||||||| 
Sbjct: 578 attcgaaagctcaaatactctccaaacatgaagaaacacattggcatgatcgctggtggc 637

                               
Query: 364 actggcataacaccaatgct 383
           || || || || ||||||||
Sbjct: 638 acaggaattactccaatgct 657
to top
>gb|CP000117.1| Anabaena variabilis ATCC 29413 chromosome, complete sequence
          Length = 6365727

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                              
Query: 350     tgattgctggtggtactggcataacaccaat 380
               ||||||||||||||| |||||| ||||||||
Sbjct: 3568491 tgattgctggtggtattggcatcacaccaat 3568461
to top
>ref|XM_966964.1| PREDICTED: Tribolium castaneum similar to CG5946-PB, isoform B
           (LOC660758), mRNA
          Length = 994

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 349 atgattgctggtggtactggcataacaccaatgct 383
           |||||||| |||||||||||||| ||||| |||||
Sbjct: 617 atgattgcgggtggtactggcattacacccatgct 651
to top
>ref|XM_706374.1| Candida albicans SC5314 cytochrome b reductase (CaO19.9367), mRNA
          Length = 885

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 344 ttggcatgattgctggtggtactggcataacaccaatg 381
           |||| |||||||||||||||||||| ||  ||||||||
Sbjct: 482 ttggtatgattgctggtggtactggtattgcaccaatg 519
to top
>ref|XM_706357.1| Candida albicans SC5314 cytochrome b reductase (CaO19.1801), mRNA
          Length = 885

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 344 ttggcatgattgctggtggtactggcataacaccaatg 381
           |||| |||||||||||||||||||| ||  ||||||||
Sbjct: 482 ttggtatgattgctggtggtactggtattgcaccaatg 519
to top
>ref|XM_448811.1| Candida glabrata CBS138, CAGL0L00847g partial mRNA
          Length = 858

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 348 catgattgctggtggtactggcataacaccaatg 381
           |||| |||||||||||||||| ||||| ||||||
Sbjct: 456 catggttgctggtggtactggtataactccaatg 489
to top
>emb|CR380958.1| Candida glabrata strain CBS138 chromosome L complete sequence
          Length = 1440588

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                
Query: 348    catgattgctggtggtactggcataacaccaatg 381
              |||| |||||||||||||||| ||||| ||||||
Sbjct: 104436 catggttgctggtggtactggtataactccaatg 104403
to top
>emb|BX832722.1|CNS09ZMI Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH92ZC09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1386

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 226 aaggtttatcctgatgggaaaatgagtcagcattttgc 263
           ||||| ||| |||| || ||||||||||||||||||||
Sbjct: 591 aaggtatatgctgacggaaaaatgagtcagcattttgc 628
to top
>emb|AL935299.11| Zebrafish DNA sequence from clone DKEY-38M5, complete sequence
          Length = 229574

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 555   gaggggtggtgttggctacata 576
             ||||||||||||||||||||||
Sbjct: 27798 gaggggtggtgttggctacata 27777
to top
>gb|AC168270.1| Mus musculus BAC clone RP23-173C15 from chromosome 3, complete sequence
          Length = 216449

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 144   ggagggaagaagaaaatacgt 164
             |||||||||||||||||||||
Sbjct: 57751 ggagggaagaagaaaatacgt 57731
to top
>ref|XM_385028.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG04852.1)
           partial mRNA
          Length = 1092

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 344 ttggcatgattgctggtggtactgg 368
           ||||||||||||||||||| |||||
Sbjct: 689 ttggcatgattgctggtggcactgg 713
to top
>ref|XM_780154.1| PREDICTED: Strongylocentrotus purpuratus similar to NADH-cytochrome
           b5 reductase (B5R) (Diaphorase 1) (LOC580078), mRNA
          Length = 1298

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 343 attggcatgattgctggtggtactggcataacaccaatgct 383
           ||||||||||| ||||||||||| || || || ||||||||
Sbjct: 730 attggcatgatcgctggtggtacaggtatcactccaatgct 770
to top
>gb|AC115341.6| Rattus norvegicus 3 BAC CH230-248O1 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 237425

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 546   aagtgactggaggggtggtg 565
             ||||||||||||||||||||
Sbjct: 33914 aagtgactggaggggtggtg 33895
to top
>gb|AC095688.7| Rattus norvegicus 2 BAC CH230-9C20 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 176590

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 134   gtcaggaagtggagggaagaagaa 157
             |||||| |||||||||||||||||
Sbjct: 22864 gtcaggcagtggagggaagaagaa 22887
to top
>emb|Z83217.2|CEC10C6 Caenorhabditis elegans Cosmid C10C6, complete sequence
          Length = 43789

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 135   tcaggaagtggagggaagaagaaa 158
             ||||||||||| ||||||||||||
Sbjct: 28406 tcaggaagtggtgggaagaagaaa 28383
to top
>ref|XM_797680.1| Trypanosoma cruzi strain CL Brener cytochrome-B5 reductase
           (Tc00.1047053503873.10) partial mRNA
          Length = 927

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 344 ttggcatgattgctggtggtactggcat 371
           |||||||||||| ||| |||||||||||
Sbjct: 449 ttggcatgattggtggcggtactggcat 476
to top
>gb|AC132413.3| Mus musculus BAC clone RP23-375I11 from chromosome 1, complete sequence
          Length = 191541

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 539   aaccatcaagtgactggagg 558
             ||||||||||||||||||||
Sbjct: 98100 aaccatcaagtgactggagg 98119
to top
>ref|XM_810901.1| Trypanosoma cruzi strain CL Brener cytochrome-B5 reductase
           (Tc00.1047053506821.210) partial mRNA
          Length = 927

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 344 ttggcatgattgctggtggtactggcat 371
           |||||||||||| ||| |||||||||||
Sbjct: 449 ttggcatgattggtggcggtactggcat 476
to top
>ref|XM_725955.1| Plasmodium yoelii yoelii str. 17XNL FAD/NAD-binding cytochrome
           reductase (PY03083) partial mRNA
          Length = 1071

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 349 atgattgctggtggtactgg 368
           ||||||||||||||||||||
Sbjct: 652 atgattgctggtggtactgg 671
to top
>emb|Z46861.1|SC9905 S.cerevisiae chromosome IX cosmid 9905 and lambda 6569
          Length = 33954

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 349  atgattgctggtggtactgg 368
            ||||||||||||||||||||
Sbjct: 9567 atgattgctggtggtactgg 9548
to top
>emb|Z28365.1|SCCYTB5R S.cerevisiae (842) gene for cytochrome b5 reductase
          Length = 1586

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 349 atgattgctggtggtactgg 368
           ||||||||||||||||||||
Sbjct: 949 atgattgctggtggtactgg 968
to top
>emb|CR380959.1| Candida glabrata strain CBS138 chromosome M complete sequence
          Length = 1400893

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 44     tgcattcagagctattcaga 63
              ||||||||||||||||||||
Sbjct: 783469 tgcattcagagctattcaga 783488
to top
>emb|AL445066.1|TACID4 Thermoplasma acidophilum complete genome; segment 4/5
          Length = 297750

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 110    gtctcgtaacaagggccccc 129
              ||||||||||||||||||||
Sbjct: 117798 gtctcgtaacaagggccccc 117779
to top
>gb|AC008682.6| Homo sapiens chromosome 5 clone CTB-54G2, complete sequence
          Length = 217221

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 244   aaaatgagtcagcattttgc 263
             ||||||||||||||||||||
Sbjct: 70907 aaaatgagtcagcattttgc 70926
to top
>gb|AC024474.8| Homo sapiens chromosome 15, clone RP11-686I6, complete sequence
          Length = 194973

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 464   atatcttgctgaaaagggagttag 487
             |||||||||||||||| |||||||
Sbjct: 84271 atatcttgctgaaaagtgagttag 84248
to top
>ref|NM_069762.2| Caenorhabditis elegans C10C6.3 (C10C6.3) mRNA, complete cds
          Length = 960

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 135 tcaggaagtggagggaagaagaaa 158
           ||||||||||| ||||||||||||
Sbjct: 508 tcaggaagtggtgggaagaagaaa 531
to top
>gb|AC026800.4|AC026800 Homo sapiens chromosome 5 clone CTD-2377N4, complete sequence
          Length = 146206

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 244   aaaatgagtcagcattttgc 263
             ||||||||||||||||||||
Sbjct: 62062 aaaatgagtcagcattttgc 62081
to top
>gb|AC016991.5|AC016991 Homo sapiens BAC clone RP11-17E15 from Y, complete sequence
          Length = 174402

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 392    ttagggccatcctgaaaaac 411
              ||||||||||||||||||||
Sbjct: 139740 ttagggccatcctgaaaaac 139759
to top
>emb|AJ325270.1|HSA325270 Homo sapiens genomic sequence surrounding NotI site, clone NB6-967R
          Length = 727

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 336 aagacaaattggcatgattg 355
           ||||||||||||||||||||
Sbjct: 464 aagacaaattggcatgattg 483
to top
>emb|AL732611.21| Mouse DNA sequence from clone RP23-135A21 on chromosome 4, complete
             sequence
          Length = 143036

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 327   aaatatgaaaagacaaattggcat 350
             |||||| |||||||||||||||||
Sbjct: 11827 aaatatcaaaagacaaattggcat 11850
to top
>emb|AL954388.5| Mouse DNA sequence from clone RP23-395P6 on chromosome 2, complete
              sequence
          Length = 131825

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 546    aagtgactggaggggtggtg 565
              ||||||||||||||||||||
Sbjct: 117265 aagtgactggaggggtggtg 117246
to top
>gb|AC127522.7| Homo sapiens chromosome 15, clone RP13-126C7, complete sequence
          Length = 166914

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 464   atatcttgctgaaaagggagttag 487
             |||||||||||||||| |||||||
Sbjct: 34381 atatcttgctgaaaagtgagttag 34358


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,556,688
Number of Sequences: 3902068
Number of extensions: 5556688
Number of successful extensions: 117570
Number of sequences better than 10.0: 47
Number of HSP's better than 10.0 without gapping: 46
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 117406
Number of HSP's gapped (non-prelim): 158
length of query: 584
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 561
effective length of database: 17,143,297,704
effective search space: 9617390011944
effective search space used: 9617390011944
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top