ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags11f14
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY770690.1| Hordeum vulgare horcolin gene, complete cds 153 9e-35
2gb|AY033628.1| Hordeum vulgare subsp. vulgare horcolin mRNA, com... 153 9e-35
3gb|AC004932.4| Homo sapiens PAC clone RP5-943F2 from 7, complete... 40 0.91
4emb|AL512510.13| Human DNA sequence from clone RP11-537P24 on ch... 38 3.6
5gb|AC148867.3| Monodelphis domestica clone VMRC6-379O2, complete... 38 3.6
6gb|DP000021.1| Monodelphis domestica target 1 genomic scaffold 38 3.6

>gb|AY770690.1| Hordeum vulgare horcolin gene, complete cds
          Length = 1338

 Score =  153 bits (77), Expect = 9e-35
 Identities = 84/85 (98%), Gaps = 1/85 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   atcgttgacgctattgcattcacctatgtgggcacctgataacgttcaacactcttccgg 60
           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 689 atcgttgacgctattgcattcacctatgtgggcacc-gataacgttcaacactcttccgg 747

                                    
Query: 61  catcaagtggggtggcactggcggc 85
           |||||||||||||||||||||||||
Sbjct: 748 catcaagtggggtggcactggcggc 772



to top

>gb|AY033628.1| Hordeum vulgare subsp. vulgare horcolin mRNA, complete cds
          Length = 665

 Score =  153 bits (77), Expect = 9e-35
 Identities = 84/85 (98%), Gaps = 1/85 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   atcgttgacgctattgcattcacctatgtgggcacctgataacgttcaacactcttccgg 60
           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 184 atcgttgacgctattgcattcacctatgtgggcacc-gataacgttcaacactcttccgg 242

                                    
Query: 61  catcaagtggggtggcactggcggc 85
           |||||||||||||||||||||||||
Sbjct: 243 catcaagtggggtggcactggcggc 267



to top

>gb|AC004932.4| Homo sapiens PAC clone RP5-943F2 from 7, complete sequence
          Length = 151183

 Score = 40.1 bits (20), Expect = 0.91
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 21    cacctatgtgggcacctgat 40
             ||||||||||||||||||||
Sbjct: 28911 cacctatgtgggcacctgat 28930



to top

>emb|AL512510.13| Human DNA sequence from clone RP11-537P24 on chromosome 6 Contains a
             CpG island, complete sequence
          Length = 170970

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 8     acgctattgcattcaccta 26
             |||||||||||||||||||
Sbjct: 13714 acgctattgcattcaccta 13696



to top

>gb|AC148867.3| Monodelphis domestica clone VMRC6-379O2, complete sequence
          Length = 162030

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 31    ggcacctgataacgttcaa 49
             |||||||||||||||||||
Sbjct: 97175 ggcacctgataacgttcaa 97157



to top

>gb|DP000021.1| Monodelphis domestica target 1 genomic scaffold
          Length = 1833844

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 31     ggcacctgataacgttcaa 49
              |||||||||||||||||||
Sbjct: 553136 ggcacctgataacgttcaa 553118


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 430,183
Number of Sequences: 3902068
Number of extensions: 430183
Number of successful extensions: 22428
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 22419
Number of HSP's gapped (non-prelim): 7
length of query: 85
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 64
effective length of database: 17,151,101,840
effective search space: 1097670517760
effective search space used: 1097670517760
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top