ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags10p23
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC160458.4| Mus musculus chromosome 5, clone RP23-14C20, comp... 46 0.14
2gb|AC101004.6| Mus musculus, clone RP23-79E5, complete sequence 46 0.14
3emb|AL596171.1| Listeria innocua Clip11262 complete genome, segm... 40 8.6
4gb|AC090615.9| Homo sapiens chromosome 17, clone RP11-578C11, co... 40 8.6
5gb|AC106746.2| Homo sapiens chromosome 5 clone RP11-149E17, comp... 40 8.6
6gb|AC055825.8| Homo sapiens chromosome 17, clone RP11-22L4, comp... 40 8.6
7gb|AC092547.7| Homo sapiens 3q BAC RP11-371L14 (Roswell Park Can... 40 8.6
8dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.6
9dbj|AP003920.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.6
10dbj|AP005529.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.6
11gb|AC004592.1|AC004592 Homo sapiens PAC clone RP1-244J5 from 5q3... 40 8.6
12gb|AC007510.6|AC007510 Homo sapiens chromosome 17, clone hRPK.67... 40 8.6

>gb|AC160458.4| Mus musculus chromosome 5, clone RP23-14C20, complete sequence
          Length = 253338

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 586    tttcagactccaccacatatgca 608
              |||||||||||||||||||||||
Sbjct: 181517 tttcagactccaccacatatgca 181539



to top

>gb|AC101004.6| Mus musculus, clone RP23-79E5, complete sequence
          Length = 220468

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 586   tttcagactccaccacatatgca 608
             |||||||||||||||||||||||
Sbjct: 38694 tttcagactccaccacatatgca 38716



to top

>emb|AL596171.1| Listeria innocua Clip11262 complete genome, segment 9/12
          Length = 258650

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 482    aatgctaaatgattttttcg 501
              ||||||||||||||||||||
Sbjct: 157360 aatgctaaatgattttttcg 157379



to top

>gb|AC090615.9| Homo sapiens chromosome 17, clone RP11-578C11, complete sequence
          Length = 142895

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 370   caacagtggtcaggaaatta 389
             ||||||||||||||||||||
Sbjct: 59766 caacagtggtcaggaaatta 59747



to top

>gb|AC106746.2| Homo sapiens chromosome 5 clone RP11-149E17, complete sequence
          Length = 179868

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 185   cagacatcacaggtaaatgctccagatttagg 216
             ||||||| |||||||| | |||||||||||||
Sbjct: 98026 cagacatgacaggtaagtactccagatttagg 98057



to top

>gb|AC055825.8| Homo sapiens chromosome 17, clone RP11-22L4, complete sequence
          Length = 74126

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 580  tatggatttcagactccaccacat 603
            |||||||||| |||||||||||||
Sbjct: 3906 tatggatttctgactccaccacat 3883



to top

>gb|AC092547.7| Homo sapiens 3q BAC RP11-371L14 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 178328

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 580   tatggatttcagactccaccacat 603
             |||||||||| |||||||||||||
Sbjct: 51921 tatggatttctgactccaccacat 51944



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 515      ttggtccatcttatatcaat 534
                ||||||||||||||||||||
Sbjct: 26460563 ttggtccatcttatatcaat 26460582



to top

>dbj|AP003920.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OJ1789_C07
          Length = 138944

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 515    ttggtccatcttatatcaat 534
              ||||||||||||||||||||
Sbjct: 110115 ttggtccatcttatatcaat 110134



to top

>dbj|AP005529.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
            clone:P0702E04
          Length = 190948

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 515  ttggtccatcttatatcaat 534
            ||||||||||||||||||||
Sbjct: 9430 ttggtccatcttatatcaat 9449



to top

>gb|AC004592.1|AC004592 Homo sapiens PAC clone RP1-244J5 from 5q31, complete sequence
          Length = 130513

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 185   cagacatcacaggtaaatgctccagatttagg 216
             ||||||| |||||||| | |||||||||||||
Sbjct: 65719 cagacatgacaggtaagtactccagatttagg 65688



to top

>gb|AC007510.6|AC007510 Homo sapiens chromosome 17, clone hRPK.678_P_16, complete sequence
          Length = 156420

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 580    tatggatttcagactccaccacat 603
              |||||||||| |||||||||||||
Sbjct: 145513 tatggatttctgactccaccacat 145490


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,444,712
Number of Sequences: 3902068
Number of extensions: 4444712
Number of successful extensions: 75103
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 75069
Number of HSP's gapped (non-prelim): 34
length of query: 629
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 606
effective length of database: 17,143,297,704
effective search space: 10388838408624
effective search space used: 10388838408624
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top