ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal8p20
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 466 e-128
2gb|AC135206.3| Oryza sativa (japonica cultivar-group) chromosome... 466 e-128
3dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 466 e-128
4dbj|AK121215.1| Oryza sativa (japonica cultivar-group) cDNA clon... 444 e-121
5ref|XM_755523.1| Ustilago maydis 521 hypothetical protein (UM044... 42 2.2
6gb|AY986977.1| Xanthomonas campestris pv. pelargonii phage Xp15,... 42 2.2
7gb|AY848949.1| Silene tatarica clone ST21 microsatellite sequence 40 8.8
8gb|AC141583.3| Rattus norvegicus 9 BAC CH230-486H15 (Children's ... 40 8.8
9gb|AC107179.5| Rattus norvegicus 9 BAC CH230-155P21 (Children's ... 40 8.8
10ref|XM_750905.1| Aspergillus fumigatus Af293 N,N-dimethylglycine... 40 8.8
11emb|Z81000.2|HS67D6 Human DNA sequence from clone CITF22-67D6 on... 40 8.8
12gb|CP000316.1| Polaromonas sp. JS666, complete genome 40 8.8
13gb|AC024230.5| Homo sapiens BAC clone RP11-96B10 from 4, complet... 40 8.8
14gb|AC154524.2| Mus musculus BAC clone RP24-68D23 from chromosome... 40 8.8
15gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome 40 8.8

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  466 bits (235), Expect = e-128
 Identities = 480/559 (85%), Gaps = 7/559 (1%)
 Strand = Plus / Minus

                                                                           
Query: 53      ggaacacatttggagaaccccaaaaagagcagcaccttagtttacaagagggcggggcag 112
               ||||||||||  || ||| || || ||| ||||||||||||||||||||||||     ||
Sbjct: 8654294 ggaacacattcagaaaactccgaacagaacagcaccttagtttacaagagggc-----ag 8654240

                                                                           
Query: 113     gagagctaactaggcatcttcacagctacaaaggggatacacaggttggtgctcaagaac 172
               |||| ||| ||||  |||||  || ||| ||||||||||||||| ||  ||||| || | 
Sbjct: 8654239 gaga-ctatctagagatctttgcacctagaaaggggatacacagattcatgctcgagcaa 8654181

                                                                           
Query: 173     tcggcgccgatgctcgaacaatcaagcatcagtttccagcttcttagaattcaaattaaa 232
               ||| | || | | |||||  |||||| ||||| ||| |||||||||||||  ||||||||
Sbjct: 8654180 tcgacaccaaagatcgaatgatcaagtatcagcttcgagcttcttagaatgtaaattaaa 8654121

                                                                           
Query: 233     gcacatgcacttgtctataagagcctccgattcgttgccgtattctttgaacctgtactc 292
               |||||||||||| || ||||||||||| || ||||| || ||||||||||||||||||||
Sbjct: 8654120 gcacatgcacttatcgataagagcctcagactcgttaccatattctttgaacctgtactc 8654061

                                                                           
Query: 293     ctccaacttgaaggccgatggaaccttcccttcactgtagcaacggttacacaagctgaa 352
                ||||||||||| || |||||||||||||||||||||||||| || || |||||||| ||
Sbjct: 8654060 atccaacttgaatgctgatggaaccttcccttcactgtagcatcgattgcacaagctaaa 8654001

                                                                           
Query: 353     ggagtgttttgtttccttgaaccgtgaaccgatgataggatatctgcatatggagcaggt 412
               |||||| ||||| |||||||| || ||||| ||||||||||||| ||| || ||||||||
Sbjct: 8654000 ggagtgctttgtctccttgaatcgggaaccaatgataggatatcggcaaattgagcaggt 8653941

                                                                           
Query: 413     gtggctgccgtggcgaacatgatcactgtcttcaagcttcaccaatgtggttagaattcc 472
               ||||| |||||| ||||  ||||| ||||| |||||||||||||||||| |||| |||||
Sbjct: 8653940 gtggcggccgtgacgaatgtgatcgctgtcctcaagcttcaccaatgtgcttaggattcc 8653881

                                                                           
Query: 473     aaatccccaatcaggatcattgaacatttcaaggaactctgtgtacgataccatggtagg 532
               |||||||||||| ||||||||||||||||| |||||||| ||||| |||||||| || ||
Sbjct: 8653880 aaatccccaatcgggatcattgaacatttcgaggaactccgtgtatgataccatagtggg 8653821

                                                                           
Query: 533     gtcagactctccatgcatttcaagcatgtcgctagccccatgtgtggggtatgtaaacag 592
               ||||||||| |||||||||||||||||||||||||||||||| || |||||| |||||||
Sbjct: 8653820 gtcagactccccatgcatttcaagcatgtcgctagccccatgggt-gggtatataaacag 8653762

                                  
Query: 593     cgcgaagaagtttaatgta 611
               | ||||||||||| |||||
Sbjct: 8653761 cacgaagaagtttgatgta 8653743



to top

>gb|AC135206.3| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1041F02,
              complete sequence
          Length = 137327

 Score =  466 bits (235), Expect = e-128
 Identities = 480/559 (85%), Gaps = 7/559 (1%)
 Strand = Plus / Minus

                                                                          
Query: 53     ggaacacatttggagaaccccaaaaagagcagcaccttagtttacaagagggcggggcag 112
              ||||||||||  || ||| || || ||| ||||||||||||||||||||||||     ||
Sbjct: 135266 ggaacacattcagaaaactccgaacagaacagcaccttagtttacaagagggc-----ag 135212

                                                                          
Query: 113    gagagctaactaggcatcttcacagctacaaaggggatacacaggttggtgctcaagaac 172
              |||| ||| ||||  |||||  || ||| ||||||||||||||| ||  ||||| || | 
Sbjct: 135211 gaga-ctatctagagatctttgcacctagaaaggggatacacagattcatgctcgagcaa 135153

                                                                          
Query: 173    tcggcgccgatgctcgaacaatcaagcatcagtttccagcttcttagaattcaaattaaa 232
              ||| | || | | |||||  |||||| ||||| ||| |||||||||||||  ||||||||
Sbjct: 135152 tcgacaccaaagatcgaatgatcaagtatcagcttcgagcttcttagaatgtaaattaaa 135093

                                                                          
Query: 233    gcacatgcacttgtctataagagcctccgattcgttgccgtattctttgaacctgtactc 292
              |||||||||||| || ||||||||||| || ||||| || ||||||||||||||||||||
Sbjct: 135092 gcacatgcacttatcgataagagcctcagactcgttaccatattctttgaacctgtactc 135033

                                                                          
Query: 293    ctccaacttgaaggccgatggaaccttcccttcactgtagcaacggttacacaagctgaa 352
               ||||||||||| || |||||||||||||||||||||||||| || || |||||||| ||
Sbjct: 135032 atccaacttgaatgctgatggaaccttcccttcactgtagcatcgattgcacaagctaaa 134973

                                                                          
Query: 353    ggagtgttttgtttccttgaaccgtgaaccgatgataggatatctgcatatggagcaggt 412
              |||||| ||||| |||||||| || ||||| ||||||||||||| ||| || ||||||||
Sbjct: 134972 ggagtgctttgtctccttgaatcgggaaccaatgataggatatcggcaaattgagcaggt 134913

                                                                          
Query: 413    gtggctgccgtggcgaacatgatcactgtcttcaagcttcaccaatgtggttagaattcc 472
              ||||| |||||| ||||  ||||| ||||| |||||||||||||||||| |||| |||||
Sbjct: 134912 gtggcggccgtgacgaatgtgatcgctgtcctcaagcttcaccaatgtgcttaggattcc 134853

                                                                          
Query: 473    aaatccccaatcaggatcattgaacatttcaaggaactctgtgtacgataccatggtagg 532
              |||||||||||| ||||||||||||||||| |||||||| ||||| |||||||| || ||
Sbjct: 134852 aaatccccaatcgggatcattgaacatttcgaggaactccgtgtatgataccatagtggg 134793

                                                                          
Query: 533    gtcagactctccatgcatttcaagcatgtcgctagccccatgtgtggggtatgtaaacag 592
              ||||||||| |||||||||||||||||||||||||||||||| || |||||| |||||||
Sbjct: 134792 gtcagactccccatgcatttcaagcatgtcgctagccccatgggt-gggtatataaacag 134734

                                 
Query: 593    cgcgaagaagtttaatgta 611
              | ||||||||||| |||||
Sbjct: 134733 cacgaagaagtttgatgta 134715



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  466 bits (235), Expect = e-128
 Identities = 480/559 (85%), Gaps = 7/559 (1%)
 Strand = Plus / Minus

                                                                           
Query: 53      ggaacacatttggagaaccccaaaaagagcagcaccttagtttacaagagggcggggcag 112
               ||||||||||  || ||| || || ||| ||||||||||||||||||||||||     ||
Sbjct: 8652129 ggaacacattcagaaaactccgaacagaacagcaccttagtttacaagagggc-----ag 8652075

                                                                           
Query: 113     gagagctaactaggcatcttcacagctacaaaggggatacacaggttggtgctcaagaac 172
               |||| ||| ||||  |||||  || ||| ||||||||||||||| ||  ||||| || | 
Sbjct: 8652074 gaga-ctatctagagatctttgcacctagaaaggggatacacagattcatgctcgagcaa 8652016

                                                                           
Query: 173     tcggcgccgatgctcgaacaatcaagcatcagtttccagcttcttagaattcaaattaaa 232
               ||| | || | | |||||  |||||| ||||| ||| |||||||||||||  ||||||||
Sbjct: 8652015 tcgacaccaaagatcgaatgatcaagtatcagcttcgagcttcttagaatgtaaattaaa 8651956

                                                                           
Query: 233     gcacatgcacttgtctataagagcctccgattcgttgccgtattctttgaacctgtactc 292
               |||||||||||| || ||||||||||| || ||||| || ||||||||||||||||||||
Sbjct: 8651955 gcacatgcacttatcgataagagcctcagactcgttaccatattctttgaacctgtactc 8651896

                                                                           
Query: 293     ctccaacttgaaggccgatggaaccttcccttcactgtagcaacggttacacaagctgaa 352
                ||||||||||| || |||||||||||||||||||||||||| || || |||||||| ||
Sbjct: 8651895 atccaacttgaatgctgatggaaccttcccttcactgtagcatcgattgcacaagctaaa 8651836

                                                                           
Query: 353     ggagtgttttgtttccttgaaccgtgaaccgatgataggatatctgcatatggagcaggt 412
               |||||| ||||| |||||||| || ||||| ||||||||||||| ||| || ||||||||
Sbjct: 8651835 ggagtgctttgtctccttgaatcgggaaccaatgataggatatcggcaaattgagcaggt 8651776

                                                                           
Query: 413     gtggctgccgtggcgaacatgatcactgtcttcaagcttcaccaatgtggttagaattcc 472
               ||||| |||||| ||||  ||||| ||||| |||||||||||||||||| |||| |||||
Sbjct: 8651775 gtggcggccgtgacgaatgtgatcgctgtcctcaagcttcaccaatgtgcttaggattcc 8651716

                                                                           
Query: 473     aaatccccaatcaggatcattgaacatttcaaggaactctgtgtacgataccatggtagg 532
               |||||||||||| ||||||||||||||||| |||||||| ||||| |||||||| || ||
Sbjct: 8651715 aaatccccaatcgggatcattgaacatttcgaggaactccgtgtatgataccatagtggg 8651656

                                                                           
Query: 533     gtcagactctccatgcatttcaagcatgtcgctagccccatgtgtggggtatgtaaacag 592
               ||||||||| |||||||||||||||||||||||||||||||| || |||||| |||||||
Sbjct: 8651655 gtcagactccccatgcatttcaagcatgtcgctagccccatgggt-gggtatataaacag 8651597

                                  
Query: 593     cgcgaagaagtttaatgta 611
               | ||||||||||| |||||
Sbjct: 8651596 cacgaagaagtttgatgta 8651578



to top

>dbj|AK121215.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023089O12, full
            insert sequence
          Length = 3172

 Score =  444 bits (224), Expect = e-121
 Identities = 478/559 (85%), Gaps = 9/559 (1%)
 Strand = Plus / Minus

                                                                        
Query: 53   ggaacacatttggagaaccccaaaaagagcagcaccttagtttacaagagggcggggcag 112
            ||||||||||  || ||| || || ||| ||||||||||||||||||||||||     ||
Sbjct: 2857 ggaacacattcagaaaactccgaacagaacagcaccttagtttacaagagggc-----ag 2803

                                                                        
Query: 113  gagagctaactaggcatcttcacagctacaaaggggatacacaggttggtgctcaagaac 172
            |||| ||| ||||  |||||  || ||| ||||||||||||||| ||  ||||| || | 
Sbjct: 2802 gaga-ctatctagagatctttgcacctagaaaggggatacacagattcatgctcgagcaa 2744

                                                                        
Query: 173  tcggcgccgatgctcgaacaatcaagcatcagtttccagcttcttagaattcaaattaaa 232
            ||| | || | | |||||  |||||| ||||| ||| |||||||||||||  ||||||||
Sbjct: 2743 tcgacaccaaagatcgaatgatcaagtatcagcttcgagcttcttagaatgtaaattaaa 2684

                                                                        
Query: 233  gcacatgcacttgtctataagagcctccgattcgttgccgtattctttgaacctgtactc 292
            |||||||||||| || ||||||||||| || ||||| || ||||||||||||||||||||
Sbjct: 2683 gcacatgcacttatcgataagagcctcagactcgttaccatattctttgaacctgtactc 2624

                                                                        
Query: 293  ctccaacttgaaggccgatggaaccttcccttcactgtagcaacggttacacaagctgaa 352
             ||||||||||| || |||||||||||||||||||||||||| || || |||||||| ||
Sbjct: 2623 atccaacttgaatgctgatggaaccttcccttcactgtagcatcgattgcacaagctaaa 2564

                                                                        
Query: 353  ggagtgttttgtttccttgaaccgtgaaccgatgataggatatctgcatatggagcaggt 412
            |||||| ||||| |||||||| || ||||| ||||||||||||| ||| || ||||||||
Sbjct: 2563 ggagtgctttgtctccttgaatcgggaaccaatgataggatatcggcaaattgagcaggt 2504

                                                                        
Query: 413  gtggctgccgtggcgaacatgatcactgtcttcaagcttcaccaatgtggttagaattcc 472
            ||||| |||||| ||||  ||||| ||||| |||||||||||||||||| |||| |||||
Sbjct: 2503 gtggcggccgtgacgaatgtgatcgctgtcctcaagcttcaccaatgtgcttaggattcc 2444

                                                                        
Query: 473  aaatccccaatcaggatcattgaacatttcaaggaactctgtgtacgataccatggtagg 532
            |||||||||||| ||||||||||||||||| |||||||| ||||| |||||||  ||  |
Sbjct: 2443 aaatccccaatcgggatcattgaacatttcgaggaactccgtgtatgatacca--gtgtg 2386

                                                                        
Query: 533  gtcagactctccatgcatttcaagcatgtcgctagccccatgtgtggggtatgtaaacag 592
            ||||||||| |||||||||||||||||||||||||||||||| || |||||| |||||||
Sbjct: 2385 gtcagactccccatgcatttcaagcatgtcgctagccccatgggt-gggtatataaacag 2327

                               
Query: 593  cgcgaagaagtttaatgta 611
            | ||||||||||| |||||
Sbjct: 2326 cacgaagaagtttgatgta 2308



to top

>ref|XM_755523.1| Ustilago maydis 521 hypothetical protein (UM04469.1) partial mRNA
          Length = 3231

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 616 agcgcatcactcctcctgatc 636
           |||||||||||||||||||||
Sbjct: 587 agcgcatcactcctcctgatc 607



to top

>gb|AY986977.1| Xanthomonas campestris pv. pelargonii phage Xp15, complete genome
          Length = 55770

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 172   ctcggcgccgatgctcgaaca 192
             |||||||||||||||||||||
Sbjct: 33649 ctcggcgccgatgctcgaaca 33629



to top

>gb|AY848949.1| Silene tatarica clone ST21 microsatellite sequence
          Length = 624

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 402 atggagcaggtgtggctgcc 421
           ||||||||||||||||||||
Sbjct: 253 atggagcaggtgtggctgcc 234



to top

>gb|AC141583.3| Rattus norvegicus 9 BAC CH230-486H15 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 132946

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 394   atctgcatatggagcaggtg 413
             ||||||||||||||||||||
Sbjct: 69289 atctgcatatggagcaggtg 69308



to top

>gb|AC107179.5| Rattus norvegicus 9 BAC CH230-155P21 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 204235

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 394    atctgcatatggagcaggtg 413
              ||||||||||||||||||||
Sbjct: 195957 atctgcatatggagcaggtg 195976



to top

>ref|XM_750905.1| Aspergillus fumigatus Af293 N,N-dimethylglycine oxidase
           (Afu2g16610) partial mRNA
          Length = 1197

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 250 taagagcctccgattcgttg 269
           ||||||||||||||||||||
Sbjct: 199 taagagcctccgattcgttg 180



to top

>emb|Z81000.2|HS67D6 Human DNA sequence from clone CITF22-67D6 on chromosome 22 Contains
             STSs and GSSs, complete sequence
          Length = 37160

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 35    agctaacagcatagggtcgg 54
             ||||||||||||||||||||
Sbjct: 14030 agctaacagcatagggtcgg 14011



to top

>gb|CP000316.1| Polaromonas sp. JS666, complete genome
          Length = 5200264

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 98      aagagggcggggcaggagag 117
               ||||||||||||||||||||
Sbjct: 2836930 aagagggcggggcaggagag 2836911



to top

>gb|AC024230.5| Homo sapiens BAC clone RP11-96B10 from 4, complete sequence
          Length = 160269

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 429   acatgatcactgtcttcaag 448
             ||||||||||||||||||||
Sbjct: 62367 acatgatcactgtcttcaag 62386



to top

>gb|AC154524.2| Mus musculus BAC clone RP24-68D23 from chromosome 16, complete sequence
          Length = 252926

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 395    tctgcatatggagcaggtgt 414
              ||||||||||||||||||||
Sbjct: 141100 tctgcatatggagcaggtgt 141119



to top

>gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome
          Length = 5224283

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 19     acttggaacgagcaatagct 38
              ||||||||||||||||||||
Sbjct: 953066 acttggaacgagcaatagct 953085


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,404,090
Number of Sequences: 3902068
Number of extensions: 5404090
Number of successful extensions: 104957
Number of sequences better than 10.0: 15
Number of HSP's better than 10.0 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 104834
Number of HSP's gapped (non-prelim): 118
length of query: 643
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 620
effective length of database: 17,143,297,704
effective search space: 10628844576480
effective search space used: 10628844576480
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top