Clone Information

BLAST Search Result

Clone Name	bags10i20
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	gb\|AC134346.3\| Oryza sativa (japonica cultivar-group) chromosome...	165	2e-37
2	dbj\|AP008211.1\| Oryza sativa (japonica cultivar-group) genomic D...	165	2e-37
3	dbj\|AK059071.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	133	8e-28
4	gb\|AC104271.2\| Oryza sativa (japonica cultivar-group) chromosome...	60	1e-05
5	gb\|CP000123.1\| Mycoplasma capricolum subsp. capricolum ATCC 2734...	46	0.15
6	emb\|AL359642.12\| Human DNA sequence from clone RP11-507F17 on ch...	44	0.58
7	emb\|CR854925.5\| Zebrafish DNA sequence from clone CH211-199I24 i...	44	0.58
8	emb\|AL935038.9\| Zebrafish DNA sequence from clone CH211-187I23 i...	44	0.58
9	emb\|AL929595.5\| Zebrafish DNA sequence from clone CH211-59N3 in ...	42	2.3
10	ref\|NM_073251.2\| Caenorhabditis elegans B0024.10 (B0024.10) mRNA...	42	2.3
11	emb\|BX649225.1\| Mouse DNA sequence from clone RP23-104N16 on chr...	42	2.3
12	emb\|Z71178.1\|CEB0024 Caenorhabditis elegans Cosmid B0024, comple...	42	2.3
13	ref\|NM_102004.2\| Arabidopsis thaliana calcium ion binding AT1G21...	40	9.1
14	gb\|AE017345.1\| Cryptococcus neoformans var. neoformans JEC21 chr...	40	9.1
15	gb\|AC151803.1\| Solanum demissum chromosome 5 BAC PGEC979H09 geno...	40	9.1
16	gb\|AC165358.3\| Mus musculus BAC clone RP23-122F14 from chromosom...	40	9.1
17	gb\|AF016443.1\| Caenorhabditis elegans cosmid C17E7, complete seq...	40	9.1
18	ref\|XM_653683.1\| Aspergillus nidulans FGSC A4 hypothetical prote...	40	9.1
19	gb\|AE017244.1\| Mycoplasma hyopneumoniae 7448, complete genome	40	9.1
20	gb\|AE017243.1\| Mycoplasma hyopneumoniae J, complete genome	40	9.1
21	emb\|CR974462.5\| Mouse DNA sequence from clone RP23-222K15 on chr...	40	9.1
22	gb\|AC126428.3\| Mus musculus BAC clone RP24-387B13 from chromosom...	40	9.1
23	gb\|AC123872.4\| Mus musculus BAC clone RP23-254P8 from 2, complet...	40	9.1
24	emb\|BX842590.1\| Rhesus DNA sequence from clone bRH-178N19, compl...	40	9.1
25	emb\|AL109824.24\|HSJ1181N3 Human DNA sequence from clone RP5-1181...	40	9.1
26	emb\|BX883051.1\| Rattus norvegicus chromosome 20, major histocomp...	40	9.1
27	emb\|AL662876.23\| Mouse DNA sequence from clone RP23-288K19 on ch...	40	9.1
28	emb\|AL009226.1\|MU11KLT Mus musculus DNA sequence from clone 11KL...	40	9.1
29	emb\|AL646093.9\| Mouse DNA sequence from clone RP23-55I2 on chrom...	40	9.1
30	gb\|AC103409.2\| Homo sapiens chromosome 8, clone RP11-1107H4, com...	40	9.1
31	gb\|AF361594.1\| Arabidopsis thaliana At1g21550/F24J8_7 mRNA, comp...	40	9.1
32	gb\|AC099049.2\| Homo sapiens chromosome 3 clone RP11-291P10, comp...	40	9.1
33	gb\|AC096627.28\| Mus musculus strain C57BL/6J clone rp23-77b23 ma...	40	9.1
34	gb\|AC159898.2\| Mus musculus BAC clone RP23-254N11 from chromosom...	40	9.1
35	gb\|AC162378.2\| Mus musculus BAC clone RP24-82K1 from chromosome ...	40	9.1
36	dbj\|AP008212.1\| Oryza sativa (japonica cultivar-group) genomic D...	40	9.1
37	emb\|AL954637.6\| Zebrafish DNA sequence from clone DKEY-149G8 in ...	40	9.1
38	gb\|AC055711.18\| Homo sapiens 3 BAC RP11-67E18 (Roswell Park Canc...	40	9.1
39	gb\|AC015447.8\|AC015447 Arabidopsis thaliana chromosome I BAC F24...	40	9.1
40	dbj\|AP006533.3\| Oryza sativa (japonica cultivar-group) genomic D...	40	9.1
41	gb\|AC131238.3\| Homo sapiens 12 BAC RP11-136L23 (Roswell Park Can...	40	9.1
42	emb\|AL121809.6\|CNS01DSK Human chromosome 14 DNA sequence BAC C-3...	40	9.1
43	gb\|AC004701.1\|AC004701 Homo sapiens chromosome 4 clone B331M8 ma...	40	9.1
44	dbj\|AP000777.4\| Homo sapiens genomic DNA, chromosome 11 clone:RP...	40	9.1
45	emb\|AL929533.12\| Zebrafish DNA sequence from clone DKEY-18E17 in...	40	9.1
46	gb\|AF100956.1\|AF100956 Mus musculus major histocompatibility loc...	40	9.1
47	gb\|AE017332.1\| Mycoplasma hyopneumoniae 232, complete genome	40	9.1
48	emb\|CT025624.11\| Mouse DNA sequence from clone RP24-212N20 on ch...	40	9.1
49	gb\|AC132105.3\| Mus musculus BAC clone RP24-224B9 from 16, comple...	40	9.1
50	emb\|AL928811.8\| Mouse DNA sequence from clone RP23-74P23 on chro...	40	9.1
51	dbj\|AP001986.4\| Homo sapiens genomic DNA, chromosome 11q, clone:...	40	9.1

>gb|AC134346.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0018A03,
             complete sequence
          Length = 146278

 Score =  165 bits (83), Expect = 2e-37
 Identities = 155/178 (87%), Gaps = 1/178 (0%)
 Strand = Plus / Minus

                                                                         
Query: 3     ccactttggacaggtcctcttcatgatnactc-ttcctcacagaaatgctaagcttggct 61
             |||||||||||||||||||| ||||||  | | ||||| || |||||| |||||||||| 
Sbjct: 73254 ccactttggacaggtcctctccatgataccaccttcctaactgaaatgttaagcttggca 73195

                                                                         
Query: 62    gtagaatggggatgggcacacacaagtgagaatggtgtcactttggaaaaacttcttggc 121
               |||||||||||||||| |||||| ||||||||||||| | || ||||||||||||| |
Sbjct: 73194 acagaatggggatgggcaaacacaattgagaatggtgtctcattagaaaaacttcttgac 73135

                                                                       
Query: 122   accatgattgaggaaagtgacccaaggttaccgcctggatatataagacttgatgagg 179
             || |||||||||||||| ||| ||||||| || ||||||||||| |||||||||||||
Sbjct: 73134 acaatgattgaggaaagcgactcaaggttgccccctggatatatcagacttgatgagg 73077



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                               
Query: 269   agattgccagccgagcaaaagttaactctccacc 302
             ||||||| ||||| |||||||| |||||||||||
Sbjct: 72972 agattgctagccgtgcaaaagtaaactctccacc 72939

to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  165 bits (83), Expect = 2e-37
 Identities = 155/178 (87%), Gaps = 1/178 (0%)
 Strand = Plus / Minus

                                                                            
Query: 3        ccactttggacaggtcctcttcatgatnactc-ttcctcacagaaatgctaagcttggct 61
                |||||||||||||||||||| ||||||  | | ||||| || |||||| |||||||||| 
Sbjct: 14922338 ccactttggacaggtcctctccatgataccaccttcctaactgaaatgttaagcttggca 14922279

                                                                            
Query: 62       gtagaatggggatgggcacacacaagtgagaatggtgtcactttggaaaaacttcttggc 121
                  |||||||||||||||| |||||| ||||||||||||| | || ||||||||||||| |
Sbjct: 14922278 acagaatggggatgggcaaacacaattgagaatggtgtctcattagaaaaacttcttgac 14922219

                                                                          
Query: 122      accatgattgaggaaagtgacccaaggttaccgcctggatatataagacttgatgagg 179
                || |||||||||||||| ||| ||||||| || ||||||||||| |||||||||||||
Sbjct: 14922218 acaatgattgaggaaagcgactcaaggttgccccctggatatatcagacttgatgagg 14922161



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 84/102 (82%)
 Strand = Plus / Plus

                                                                            
Query: 64       agaatggggatgggcacacacaagtgagaatggtgtcactttggaaaaacttcttggcac 123
                ||||| |||||||||| |||||| | |||| ||  ||||  | || ||| ||||||||||
Sbjct: 14283053 agaattgggatgggcaaacacaatttagaacggcatcacactagagaaaattcttggcac 14283112

                                                          
Query: 124      catgattgaggaaagtgacccaaggttaccgcctggatatat 165
                 || ||| ||||||||||| ||||||| || |||||||||||
Sbjct: 14283113 aattattcaggaaagtgactcaaggttgccacctggatatat 14283154



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                  
Query: 269      agattgccagccgagcaaaagttaactctccacc 302
                ||||||| ||||| |||||||| |||||||||||
Sbjct: 14922056 agattgctagccgtgcaaaagtaaactctccacc 14922023

to top

>dbj|AK059071.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-021-H06, full
           insert sequence
          Length = 685

 Score =  133 bits (67), Expect = 8e-28
 Identities = 103/115 (89%)
 Strand = Plus / Plus

                                                                       
Query: 64  agaatggggatgggcacacacaagtgagaatggtgtcactttggaaaaacttcttggcac 123
           |||||||||||||||| |||||| ||||||||||||| | || ||||||||||||| |||
Sbjct: 12  agaatggggatgggcaaacacaattgagaatggtgtctcattagaaaaacttcttgacac 71

                                                                  
Query: 124 catgattgaggaaagtgacccaaggttaccgcctggatatataagacttgatgag 178
            |||||||||||||| ||| ||||||| || ||||||||||| ||||||||||||
Sbjct: 72  aatgattgaggaaagcgactcaaggttgccccctggatatatcagacttgatgag 126



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 269 agattgccagccgagcaaaagttaactctccacc 302
           ||||||| ||||| |||||||| |||||||||||
Sbjct: 125 agattgctagccgtgcaaaagtaaactctccacc 158

to top

>gb|AC104271.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1308_D01,
             complete sequence
          Length = 117724

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 84/102 (82%)
 Strand = Plus / Plus

                                                                         
Query: 64    agaatggggatgggcacacacaagtgagaatggtgtcactttggaaaaacttcttggcac 123
             ||||| |||||||||| |||||| | |||| ||  ||||  | || ||| ||||||||||
Sbjct: 11839 agaattgggatgggcaaacacaatttagaacggcatcacactagagaaaattcttggcac 11898

                                                       
Query: 124   catgattgaggaaagtgacccaaggttaccgcctggatatat 165
              || ||| ||||||||||| ||||||| || |||||||||||
Sbjct: 11899 aattattcaggaaagtgactcaaggttgccacctggatatat 11940

to top

>gb|CP000123.1| Mycoplasma capricolum subsp. capricolum ATCC 27343, complete genome
          Length = 1010023

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 557    atttgcaaatataaaagtctttg 579
              |||||||||||||||||||||||
Sbjct: 132393 atttgcaaatataaaagtctttg 132415

to top

>emb|AL359642.12| Human DNA sequence from clone RP11-507F17 on chromosome 9 Contains a
             kertain pseudogene, complete sequence
          Length = 122613

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 566   tataaaagtctttgcatttttaggta 591
             ||||||| ||||||||||||||||||
Sbjct: 87539 tataaaattctttgcatttttaggta 87514

to top

>emb|CR854925.5| Zebrafish DNA sequence from clone CH211-199I24 in linkage group 13,
             complete sequence
          Length = 58279

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 501   ttgtttggattttggatgtaat 522
             ||||||||||||||||||||||
Sbjct: 52826 ttgtttggattttggatgtaat 52847

to top

>emb|AL935038.9| Zebrafish DNA sequence from clone CH211-187I23 in linkage group 18,
             complete sequence
          Length = 139077

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 550   gattgcaatttgcaaatataaa 571
             ||||||||||||||||||||||
Sbjct: 13572 gattgcaatttgcaaatataaa 13593

to top

>emb|AL929595.5| Zebrafish DNA sequence from clone CH211-59N3 in linkage group 18,
             complete sequence
          Length = 106248

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 551   attgcaatttgcaaatataaa 571
             |||||||||||||||||||||
Sbjct: 80207 attgcaatttgcaaatataaa 80187

to top

>ref|NM_073251.2| Caenorhabditis elegans B0024.10 (B0024.10) mRNA, complete cds
          Length = 1834

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 607 agcattttcagctttctatttgaca 631
           |||||||||||||||| ||||||||
Sbjct: 605 agcattttcagctttcaatttgaca 581

to top

>emb|BX649225.1| Mouse DNA sequence from clone RP23-104N16 on chromosome 2, complete
            sequence
          Length = 8223

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 92   aatggtgtcactttggaaaaa 112
            |||||||||||||||||||||
Sbjct: 2063 aatggtgtcactttggaaaaa 2043

to top

>emb|Z71178.1|CEB0024 Caenorhabditis elegans Cosmid B0024, complete sequence
          Length = 42154

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 607   agcattttcagctttctatttgaca 631
             |||||||||||||||| ||||||||
Sbjct: 30175 agcattttcagctttcaatttgaca 30199

to top

>ref|NM_102004.2| Arabidopsis thaliana calcium ion binding AT1G21550 mRNA, complete
           cds
          Length = 776

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 548 gtgattgcaatttgcaaata 567
           ||||||||||||||||||||
Sbjct: 635 gtgattgcaatttgcaaata 616

to top

>gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 5, complete
               sequence
          Length = 1507550

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                               
Query: 167     agacttgatgaggaatgccatggagttggaat 198
               ||||||||| || ||||||||||| |||||||
Sbjct: 1411528 agacttgataagaaatgccatggaattggaat 1411559

to top

>gb|AC151803.1| Solanum demissum chromosome 5 BAC PGEC979H09 genomic sequence, complete
             sequence
          Length = 110954

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 552   ttgcaatttgcaaatataaa 571
             ||||||||||||||||||||
Sbjct: 54152 ttgcaatttgcaaatataaa 54171

to top

>gb|AC165358.3| Mus musculus BAC clone RP23-122F14 from chromosome 1, complete sequence
          Length = 223166

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 455    tctctgttgtcttgaaagcatgcc 478
              ||||||||| ||||||||||||||
Sbjct: 122331 tctctgttgacttgaaagcatgcc 122354

to top

>gb|AF016443.1| Caenorhabditis elegans cosmid C17E7, complete sequence
          Length = 43254

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 103  tttggaaaaacttcttggca 122
            ||||||||||||||||||||
Sbjct: 3422 tttggaaaaacttcttggca 3403

to top

>ref|XM_653683.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN1171.2), mRNA
          Length = 2769

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 7    tttggacaggtcctcttcat 26
            ||||||||||||||||||||
Sbjct: 2190 tttggacaggtcctcttcat 2171

to top

>gb|AE017244.1| Mycoplasma hyopneumoniae 7448, complete genome
          Length = 920079

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 558    tttgcaaatataaaagtctt 577
              ||||||||||||||||||||
Sbjct: 553179 tttgcaaatataaaagtctt 553198

to top

>gb|AE017243.1| Mycoplasma hyopneumoniae J, complete genome
          Length = 897405

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 558    tttgcaaatataaaagtctt 577
              ||||||||||||||||||||
Sbjct: 529450 tttgcaaatataaaagtctt 529469

to top

>emb|CR974462.5| Mouse DNA sequence from clone RP23-222K15 on chromosome 17, complete
              sequence
          Length = 228057

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 233    ttgagtaaagtcaagctaaa 252
              ||||||||||||||||||||
Sbjct: 203357 ttgagtaaagtcaagctaaa 203338

to top

>gb|AC126428.3| Mus musculus BAC clone RP24-387B13 from chromosome 10, complete sequence
          Length = 225663

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 179    gaatgccatggagttggaat 198
              ||||||||||||||||||||
Sbjct: 142052 gaatgccatggagttggaat 142033

to top

>gb|AC123872.4| Mus musculus BAC clone RP23-254P8 from 2, complete sequence
          Length = 185953

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 449    tgggtatctctgttgtcttg 468
              ||||||||||||||||||||
Sbjct: 121508 tgggtatctctgttgtcttg 121489

to top

>emb|BX842590.1| Rhesus DNA sequence from clone bRH-178N19, complete sequence
          Length = 114431

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 337   ttaatttggaaatttatgattcat 360
             |||| |||||||||||||||||||
Sbjct: 57642 ttaagttggaaatttatgattcat 57665

to top

>emb|AL109824.24|HSJ1181N3 Human DNA sequence from clone RP5-1181N3 on chromosome 20 Contains the
             C20orf110 gene for chromosome 20 open reading frame 110,
             the NCOA6 gene for the thyroid hormone receptor binding
             protein (KIAA0181), the 5' end of a novel gene and CpG
             islands, complete sequence
          Length = 92196

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 101   actttggaaaaacttcttgg 120
             ||||||||||||||||||||
Sbjct: 34880 actttggaaaaacttcttgg 34861

to top

>emb|BX883051.1| Rattus norvegicus chromosome 20, major histocompatibility complex,
             assembled from 40 BACs, strain Brown Norway (BN/ssNHsd),
             RT1n haplotype; segment 10/11
          Length = 348946

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 180   aatgccatggagttggaata 199
             ||||||||||||||||||||
Sbjct: 94824 aatgccatggagttggaata 94805

to top

>emb|AL662876.23| Mouse DNA sequence from clone RP23-288K19 on chromosome 11 Contains the
             5' end of a novel gene, a pseudogene similar to human
             polymerase (RNA) II (DNA directed) polypeptide D POLR2D,
             two novel genes, the Xbp1 gene for X-box binding protein
             1, the gene for a novel ankyrin repeat containing protein
             and three CpG islands, complete sequence
          Length = 232225

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 66    aatggggatgggcacacaca 85
             ||||||||||||||||||||
Sbjct: 84289 aatggggatgggcacacaca 84308

to top

>emb|AL009226.1|MU11KLT Mus musculus DNA sequence from clone 11KLT on chromosome 17. Contains
            mouse RING3 gene, CpG Island
          Length = 11493

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 233  ttgagtaaagtcaagctaaa 252
            ||||||||||||||||||||
Sbjct: 9607 ttgagtaaagtcaagctaaa 9626

to top

>emb|AL646093.9| Mouse DNA sequence from clone RP23-55I2 on chromosome 11 Contains the
            Kcnj12 gene for potassium inwardly-rectifying channel
            subfamily J member 12, a ribosomal protein L27a (Rpl27a)
            pseudogene, the Tnfrsf13b gene for tumor necrosis factor
            receptor superfamily member 13b, the Usp22 gene for
            ubiquitin specific protease 22, a ribosomal protein S13
            (Rps13) pseudogene, the Aldh3a1 gene for aldehyde
            dehydrogenase family 3 subfamily A1, the 3' end of one
            variant of the Aldh3a2 gene for aldehyde dehydrogenase
            family 3 subfamily A2 and three CpG islands, complete
            sequence
          Length = 241400

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 441  tgaatttgtgggtatctctgttgt 464
            ||||| ||||||||||||||||||
Sbjct: 7378 tgaatgtgtgggtatctctgttgt 7401

to top

>gb|AC103409.2| Homo sapiens chromosome 8, clone RP11-1107H4, complete sequence
          Length = 210230

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 551    attgcaatttgcaaatataa 570
              ||||||||||||||||||||
Sbjct: 144979 attgcaatttgcaaatataa 144998

to top

>gb|AF361594.1| Arabidopsis thaliana At1g21550/F24J8_7 mRNA, complete cds
          Length = 777

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 548 gtgattgcaatttgcaaata 567
           ||||||||||||||||||||
Sbjct: 635 gtgattgcaatttgcaaata 616

to top

>gb|AC099049.2| Homo sapiens chromosome 3 clone RP11-291P10, complete sequence
          Length = 180339

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 199    atgtacttattaggatgtct 218
              ||||||||||||||||||||
Sbjct: 155231 atgtacttattaggatgtct 155250

to top

>gb|AC096627.28| Mus musculus strain C57BL/6J clone rp23-77b23 map 11, complete sequence
          Length = 264908

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 441    tgaatttgtgggtatctctgttgt 464
              ||||| ||||||||||||||||||
Sbjct: 184844 tgaatgtgtgggtatctctgttgt 184867

to top

>gb|AC159898.2| Mus musculus BAC clone RP23-254N11 from chromosome 16, complete
             sequence
          Length = 191677

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 513   tggatgtaatccatatgtgtatat 536
             ||||||||||||||| ||||||||
Sbjct: 25053 tggatgtaatccatacgtgtatat 25076

to top

>gb|AC162378.2| Mus musculus BAC clone RP24-82K1 from chromosome 16, complete sequence
          Length = 210112

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 513   tggatgtaatccatatgtgtatat 536
             ||||||||||||||| ||||||||
Sbjct: 23501 tggatgtaatccatacgtgtatat 23478

to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 360     tagaagaatatgcgtgtggc 379
               ||||||||||||||||||||
Sbjct: 2794418 tagaagaatatgcgtgtggc 2794399

to top

>emb|AL954637.6| Zebrafish DNA sequence from clone DKEY-149G8 in linkage group 6,
           complete sequence
          Length = 161867

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 559 ttgcaaatataaaagtcttt 578
           ||||||||||||||||||||
Sbjct: 575 ttgcaaatataaaagtcttt 556

to top

>gb|AC055711.18| Homo sapiens 3 BAC RP11-67E18 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 154850

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     cttcctcacagaaatgctaa 53
              ||||||||||||||||||||
Sbjct: 125598 cttcctcacagaaatgctaa 125579

to top

>gb|AC015447.8|AC015447 Arabidopsis thaliana chromosome I BAC F24J8 genomic sequence, complete
             sequence
          Length = 108365

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 548   gtgattgcaatttgcaaata 567
             ||||||||||||||||||||
Sbjct: 81278 gtgattgcaatttgcaaata 81297

to top

>dbj|AP006533.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBa0085L11
          Length = 148142

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 360   tagaagaatatgcgtgtggc 379
             ||||||||||||||||||||
Sbjct: 37899 tagaagaatatgcgtgtggc 37880

to top

>gb|AC131238.3| Homo sapiens 12 BAC RP11-136L23 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 60500

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 520   aatccatatgtgtatatcag 539
             ||||||||||||||||||||
Sbjct: 51416 aatccatatgtgtatatcag 51435

to top

>emb|AL121809.6|CNS01DSK Human chromosome 14 DNA sequence BAC C-3028N15 of library CalTech-D from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 213442

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 92     aatggtgtcactttggaaaaactt 115
              ||||||| ||||||||||||||||
Sbjct: 196946 aatggtggcactttggaaaaactt 196969

to top

>gb|AC004701.1|AC004701 Homo sapiens chromosome 4 clone B331M8 map 4q25, complete sequence
          Length = 143839

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 567   ataaaagtctttgcattttt 586
             ||||||||||||||||||||
Sbjct: 96260 ataaaagtctttgcattttt 96279

to top

>dbj|AP000777.4| Homo sapiens genomic DNA, chromosome 11 clone:RP11-804A23, complete
             sequence
          Length = 197856

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 331   aagatgttaatttggaaatt 350
             ||||||||||||||||||||
Sbjct: 40006 aagatgttaatttggaaatt 39987

to top

>emb|AL929533.12| Zebrafish DNA sequence from clone DKEY-18E17 in linkage group 5, complete
              sequence
          Length = 251370

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 79     acacacaagtgagaatggtg 98
              ||||||||||||||||||||
Sbjct: 166352 acacacaagtgagaatggtg 166333

to top

>gb|AF100956.1|AF100956 Mus musculus major histocompatibility locus class II region; Fas-binding
              protein Daxx (DAXX) gene, partial cds; Bing1 (BING1),
              tapasin (tapasin), RalGDS-like factor (RLF), KE2 (KE2),
              BING4 (BING4), beta1, 3-galactosyl transferase
              (beta1,3-galactosyl transferase), ribosomal protein subunit
              S18 (RPS18), Sacm21 (Sacm21), H2K1(b) (H2-K1(b)), RING1
              (RING1), KE6a (KE6a), KE4 (KE4), RXRbeta (RXRbeta),
              collagen alpha-2 (XI) (COLA11A2), H2-O alpha (H2-Oalpha),
              RING3 (RING3), H2-M alpha (H2-M alpha), H2-M beta 2 (H2-M
              beta2), and H2-M beta1 (H2-M beta1) genes, complete cds;
              and LMP 2 gene, partial cds
          Length = 273800

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 233    ttgagtaaagtcaagctaaa 252
              ||||||||||||||||||||
Sbjct: 196835 ttgagtaaagtcaagctaaa 196816

to top

>gb|AE017332.1| Mycoplasma hyopneumoniae 232, complete genome
          Length = 892758

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 558    tttgcaaatataaaagtctt 577
              ||||||||||||||||||||
Sbjct: 519882 tttgcaaatataaaagtctt 519901

to top

>emb|CT025624.11| Mouse DNA sequence from clone RP24-212N20 on chromosome 14, complete
              sequence
          Length = 198113

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 172    tgatgaggaatgccatggag 191
              ||||||||||||||||||||
Sbjct: 142732 tgatgaggaatgccatggag 142713

to top

>gb|AC132105.3| Mus musculus BAC clone RP24-224B9 from 16, complete sequence
          Length = 160757

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 513    tggatgtaatccatatgtgtatat 536
              ||||||||||||||| ||||||||
Sbjct: 111754 tggatgtaatccatacgtgtatat 111777

to top

>emb|AL928811.8| Mouse DNA sequence from clone RP23-74P23 on chromosome 2, complete
              sequence
          Length = 222061

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 449    tgggtatctctgttgtcttg 468
              ||||||||||||||||||||
Sbjct: 200899 tgggtatctctgttgtcttg 200918

to top

>dbj|AP001986.4| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-68H20, complete
             sequence
          Length = 74996

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 331   aagatgttaatttggaaatt 350
             ||||||||||||||||||||
Sbjct: 46606 aagatgttaatttggaaatt 46587


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,875,857
Number of Sequences: 3902068
Number of extensions: 6875857
Number of successful extensions: 130963
Number of sequences better than 10.0: 51
Number of HSP's better than 10.0 without gapping: 51
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 130727
Number of HSP's gapped (non-prelim): 234
length of query: 664
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 641
effective length of database: 17,143,297,704
effective search space: 10988853828264
effective search space used: 10988853828264
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result