Clone Information

BLAST Search Result

Clone Name	bags10b10
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	dbj\|AK069115.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	153	8e-34
2	dbj\|AP008218.1\| Oryza sativa (japonica cultivar-group) genomic D...	90	1e-14
3	gb\|DP000011.1\| Oryza sativa (japonica cultivar-group) chromosome...	90	1e-14
4	emb\|AL731874.4\|CNS08C8E Oryza sativa chromosome 12, . BAC OSJNBb...	90	1e-14
5	gb\|AY574038.1\| Gossypium hirsutum cyclopropane fatty acid syntha...	56	1e-04
6	ref\|NM_113254.2\| Arabidopsis thaliana cyclopropane-fatty-acyl-ph...	54	6e-04
7	ref\|NM_113256.3\| Arabidopsis thaliana cyclopropane-fatty-acyl-ph...	54	6e-04
8	gb\|BT000811.1\| Arabidopsis thaliana At3g23520 mRNA sequence	54	6e-04
9	gb\|AY065013.1\| Arabidopsis thaliana AT3g23510/MEE5_5 mRNA, compl...	54	6e-04
10	gb\|AY064962.1\| Arabidopsis thaliana AT3g23510/MEE5_5 mRNA, compl...	54	6e-04
11	gb\|BT006344.1\| Arabidopsis thaliana At3g23510/MEE5_5 gene, compl...	54	6e-04
12	dbj\|AK176391.1\| Arabidopsis thaliana mRNA, complete cds, clone: ...	54	6e-04
13	dbj\|AK117243.1\| Arabidopsis thaliana At3g23510 mRNA for putative...	54	6e-04
14	gb\|BT001134.1\| Arabidopsis thaliana At3g23510/MEE5_5 mRNA, compl...	54	6e-04
15	gb\|AY574036.1\| Gossypium hirsutum cyclopropane fatty acid syntha...	48	0.035
16	ref\|XM_524253.1\| PREDICTED: Pan troglodytes similar to guanyl nu...	42	2.2
17	ref\|NM_170604.1\| Homo sapiens RAS guanyl releasing protein 4 (RA...	42	2.2
18	ref\|NM_170603.1\| Homo sapiens RAS guanyl releasing protein 4 (RA...	42	2.2
19	ref\|NM_170602.1\| Homo sapiens RAS guanyl releasing protein 4 (RA...	42	2.2
20	ref\|NM_052949.2\| Homo sapiens RAS guanyl releasing protein 4 (RA...	42	2.2
21	gb\|AC117994.12\| Mus musculus chromosome 6, clone RP23-25K2, comp...	42	2.2
22	gb\|AF448437.1\| Homo sapiens guanyl nucleotide releasing protein ...	42	2.2
23	gb\|AY048121.1\| Homo sapiens RAS guanyl releasing protein 4 varia...	42	2.2
24	gb\|AY048120.1\| Homo sapiens RAS guanyl releasing protein 4 varia...	42	2.2
25	gb\|AY048119.1\| Homo sapiens RAS guanyl releasing protein 4 (RASG...	42	2.2
26	gb\|AF470622.1\| Sterculia foetida cyclopropane synthase mRNA, com...	42	2.2
27	gb\|AC156397.5\| Mus musculus 6 BAC RP24-279P24 (Roswell Park Canc...	42	2.2
28	gb\|AC011469.6\|AC011469 Homo sapiens chromosome 19 clone CTC-475D...	42	2.2
29	gb\|AY769950.1\| Homo sapiens coagulation factor VIII, procoagulan...	40	8.5
30	gb\|AY574037.1\| Gossypium hirsutum cyclopropane fatty acid syntha...	40	8.5
31	gb\|AC138341.9\| Mus musculus chromosome 5, clone RP23-37N15, comp...	40	8.5
32	ref\|NG_005114.1\| Homo sapiens coagulation factor VIII region (F8...	40	8.5
33	emb\|CT025637.1\| Pan troglodytes chromosome X clone PTB-011B24 ma...	40	8.5
34	ref\|XM_844143.1\| PREDICTED: Canis familiaris similar to protein ...	40	8.5
35	emb\|AL136438.10\| Human DNA sequence from clone RP11-111G7 on chr...	40	8.5
36	emb\|AL021331.1\|HS366N23 Human DNA sequence from clone RP3-366N23...	40	8.5
37	gb\|AC010038.5\| Drosophila melanogaster 3L BAC RP98-14O14 (Roswel...	40	8.5
38	gb\|AC105264.3\| Drosophila melanogaster 3L BAC RP98-17K18 (Roswel...	40	8.5
39	gb\|AC093192.2\| Drosophila melanogaster 3L BAC RP98-48J18 (Roswel...	40	8.5
40	gb\|AC044782.6\| Homo sapiens chromosome 10 clone RP11-170M17, com...	40	8.5
41	dbj\|AP007167.1\| Aspergillus oryzae RIB40 genomic DNA, SC020	40	8.5
42	gb\|AC069543.5\| Homo sapiens chromosome 10 clone RP11-393H5, comp...	40	8.5
43	gb\|AC163771.5\| Pan troglodytes BAC clone CH251-57G17 from chromo...	40	8.5
44	emb\|BX085194.14\| Zebrafish DNA sequence from clone DKEY-242M13, ...	40	8.5
45	emb\|BX248232.11\| Zebrafish DNA sequence from clone CH211-232I5, ...	40	8.5
46	gb\|AC155241.2\| Mus musculus BAC clone RP24-485P18 from chromosom...	40	8.5
47	gb\|AC109993.4\| Homo sapiens chromosome X clone RP11-115M6 map q2...	40	8.5
48	gb\|AC160653.3\| Pan troglodytes BAC clone CH251-453K4 from chromo...	40	8.5
49	dbj\|BS000052.1\| Pan troglodytes chromosome 22 clone:RP43-049N07,...	40	8.5
50	emb\|AL953869.12\| Zebrafish DNA sequence from clone CH211-261J13 ...	40	8.5
51	gb\|AE003472.1\| Drosophila melanogaster chromosome 3L, section 6 ...	40	8.5
52	dbj\|AP003125.2\| Homo sapiens genomic DNA, chromosome 11q, clone:...	40	8.5
53	gb\|AC005557.1\|AC005557 Drosophila melanogaster, chromosome 3L, r...	40	8.5
54	emb\|AL645722.2\|HSA524G17 Homo sapiens chromosome X clone RP11-52...	40	8.5
55	gb\|AE009442.1\| Xylella fastidiosa Temecula1, complete genome	40	8.5
56	gb\|AC144779.3\| Mus musculus BAC clone RP23-331N18 from 5, comple...	40	8.5
57	dbj\|AP006711.1\| Lotus japonicus genomic DNA, chromosome 1, clone...	40	8.5
58	gb\|AC153930.2\| Mus musculus 10 BAC RP24-461H14 (Roswell Park Can...	40	8.5
59	gb\|AC161208.9\| Mus musculus chromosome 5, clone RP23-71M14, comp...	40	8.5

>dbj|AK069115.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023008H02, full
            insert sequence
          Length = 2846

 Score =  153 bits (77), Expect = 8e-34
 Identities = 338/425 (79%)
 Strand = Plus / Plus

                                                                        
Query: 154  tgttccggatcatgtactacttaaatggaatacaagccttcctgttccgtctgtggccgc 213
            |||||| ||||||||  | ||||| ||||||||||  | |  ||||||| ||||||| ||
Sbjct: 1160 tgttcctgatcatgtgttgcttaagtggaatacaaatcattttgttccgactgtggctgc 1219

                                                                        
Query: 214  ggcgaaggcttatcttcagcttcatcagatccagggaaagaggggaatatggttctgtgg 273
              | ||||||| |||| ||||| ||||||||||||| ||||| || ||||||||||| ||
Sbjct: 1220 ttcaaaggcttctcttgagcttgatcagatccagggcaagagaggtatatggttctgcgg 1279

                                                                        
Query: 274  ggcatatcaaggtcatggcttccatgaagacggattaaagtctgggaaagcagcggctca 333
            ||||||||||||   ||||||||||||||| |||||  || |||| |||||||| |||||
Sbjct: 1280 ggcatatcaaggatctggcttccatgaagatggattccaggctggcaaagcagcagctca 1339

                                                                        
Query: 334  aggtttgcttggaaagaaatgtgagcttctgctgaacccaaagaatatgattccatcatg 393
            | |||||||||| || ||   ||| |  |||  |||||||||| | ||| | |  |||||
Sbjct: 1340 aagtttgcttgggaacaagattgatcccctgacgaacccaaagcagatggtcctgtcatg 1399

                                                                        
Query: 394  gattgaggctggggcacgccttctagttgcaagatttttcaaccaatacatatccattgg 453
            ||  ||| |||||||||| ||||| ||   ||||||| |||| || ||||| ||  ||||
Sbjct: 1400 gacagagactggggcacgtcttctggtgttaagatttctcaaacagtacatctctgttgg 1459

                                                                        
Query: 454  taacttgatattggtcgaagaaggaggtagtgtgttcagctttggtaaagcttgcgacaa 513
             |||||||| ||| | |||||||| || | | ||||||| |||||| ||||||| || ||
Sbjct: 1460 caacttgatcttgtttgaagaaggtggcactatgttcagttttggtgaagcttgtgaaaa 1519

                                                                        
Query: 514  atgctgtgtaaaatctgtcatccaagttcatgaccccttgttttattggaaggttgcaat 573
            ||||  |  |||||||||  | |||||||| |||||  | ||||||||| ||||||||| 
Sbjct: 1520 atgcaataaaaaatctgttctgcaagttcaggacccactattttattggcaggttgcaac 1579

                 
Query: 574  agaag 578
            |||||
Sbjct: 1580 agaag 1584

to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 111/133 (83%)
 Strand = Plus / Plus

                                                                           
Query: 154     tgttccggatcatgtactacttaaatggaatacaagccttcctgttccgtctgtggccgc 213
               |||||| ||||||||  | ||||| ||||||||||  | |  ||||||| ||||||| ||
Sbjct: 9535955 tgttcctgatcatgtgttgcttaagtggaatacaaatcattttgttccgactgtggctgc 9536014

                                                                           
Query: 214     ggcgaaggcttatcttcagcttcatcagatccagggaaagaggggaatatggttctgtgg 273
                 | ||||||| |||| ||||| ||||||||||||| ||||| || ||||||||||| ||
Sbjct: 9536015 ttcaaaggcttctcttgagcttgatcagatccagggcaagagaggtatatggttctgcgg 9536074

                            
Query: 274     ggcatatcaaggt 286
               |||||||||||||
Sbjct: 9536075 ggcatatcaaggt 9536087

to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 111/133 (83%)
 Strand = Plus / Plus

                                                                           
Query: 154     tgttccggatcatgtactacttaaatggaatacaagccttcctgttccgtctgtggccgc 213
               |||||| ||||||||  | ||||| ||||||||||  | |  ||||||| ||||||| ||
Sbjct: 9535840 tgttcctgatcatgtgttgcttaagtggaatacaaatcattttgttccgactgtggctgc 9535899

                                                                           
Query: 214     ggcgaaggcttatcttcagcttcatcagatccagggaaagaggggaatatggttctgtgg 273
                 | ||||||| |||| ||||| ||||||||||||| ||||| || ||||||||||| ||
Sbjct: 9535900 ttcaaaggcttctcttgagcttgatcagatccagggcaagagaggtatatggttctgcgg 9535959

                            
Query: 274     ggcatatcaaggt 286
               |||||||||||||
Sbjct: 9535960 ggcatatcaaggt 9535972

to top

>emb|AL731874.4|CNS08C8E Oryza sativa chromosome 12, . BAC OSJNBb0077C18 of library OSJNBb from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 123766

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 111/133 (83%)
 Strand = Plus / Plus

                                                                          
Query: 154    tgttccggatcatgtactacttaaatggaatacaagccttcctgttccgtctgtggccgc 213
              |||||| ||||||||  | ||||| ||||||||||  | |  ||||||| ||||||| ||
Sbjct: 121179 tgttcctgatcatgtgttgcttaagtggaatacaaatcattttgttccgactgtggctgc 121238

                                                                          
Query: 214    ggcgaaggcttatcttcagcttcatcagatccagggaaagaggggaatatggttctgtgg 273
                | ||||||| |||| ||||| ||||||||||||| ||||| || ||||||||||| ||
Sbjct: 121239 ttcaaaggcttctcttgagcttgatcagatccagggcaagagaggtatatggttctgcgg 121298

                           
Query: 274    ggcatatcaaggt 286
              |||||||||||||
Sbjct: 121299 ggcatatcaaggt 121311

to top

>gb|AY574038.1| Gossypium hirsutum cyclopropane fatty acid synthase (CPA-FAS-3) mRNA,
            complete cds
          Length = 2912

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 82/100 (82%)
 Strand = Plus / Plus

                                                                        
Query: 221  gcttatcttcagcttcatcagatccagggaaagaggggaatatggttctgtggggcatat 280
            |||| |||| ||||| ||| ||| || || ||||| ||||| ||||| ||||| ||||| 
Sbjct: 1237 gcttctcttgagcttgatcggattcaagggaagagaggaatttggttttgtggagcatac 1296

                                                    
Query: 281  caaggtcatggcttccatgaagacggattaaagtctggga 320
            |  ||  |||||||||||||||| ||||||||| ||||||
Sbjct: 1297 ctgggctatggcttccatgaagatggattaaaggctggga 1336



 Score = 40.1 bits (20), Expect = 8.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 30   cagcatggagtgcgtggaatttccttgg 57
            ||||||||||||| |||||||| |||||
Sbjct: 1043 cagcatggagtgcatggaattttcttgg 1070

to top

>ref|NM_113254.2| Arabidopsis thaliana cyclopropane-fatty-acyl-phospholipid synthase/
            oxidoreductase AT3G23510 mRNA, complete cds
          Length = 3062

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                           
Query: 260  atatggttctgtggggcatatcaaggtcatggcttccatgaagacgg 306
            |||||||||||||| |||||||| ||  |||| ||||||||||||||
Sbjct: 1477 atatggttctgtggtgcatatcagggctatggtttccatgaagacgg 1523

to top

>ref|NM_113256.3| Arabidopsis thaliana cyclopropane-fatty-acyl-phospholipid synthase/
            oxidoreductase AT3G23530 mRNA, complete cds
          Length = 3148

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                       
Query: 260  atatggttctgtggggcatatcaaggtcatggcttccatgaagacggattaaagtctgg 318
            |||||||||||||| |||||||| ||  |||| ||||||||||| ||| ||||| ||||
Sbjct: 1498 atatggttctgtggtgcatatcagggctatggtttccatgaagatggactaaaggctgg 1556

to top

>gb|BT000811.1| Arabidopsis thaliana At3g23520 mRNA sequence
          Length = 3084

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                       
Query: 260  atatggttctgtggggcatatcaaggtcatggcttccatgaagacggattaaagtctgg 318
            |||||||||||||| |||||||| ||  |||| ||||||||||| ||| ||||| ||||
Sbjct: 1472 atatggttctgtggtgcatatcagggctatggtttccatgaagatggactaaaggctgg 1530

to top

>gb|AY065013.1| Arabidopsis thaliana AT3g23510/MEE5_5 mRNA, complete cds
          Length = 3149

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                       
Query: 260  atatggttctgtggggcatatcaaggtcatggcttccatgaagacggattaaagtctgg 318
            |||||||||||||| |||||||| ||  |||| ||||||||||| ||| ||||| ||||
Sbjct: 1498 atatggttctgtggtgcatatcagggctatggtttccatgaagatggactaaaggctgg 1556

to top

>gb|AY064962.1| Arabidopsis thaliana AT3g23510/MEE5_5 mRNA, complete cds
          Length = 2988

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                       
Query: 260  atatggttctgtggggcatatcaaggtcatggcttccatgaagacggattaaagtctgg 318
            |||||||||||||| |||||||| ||  |||| ||||||||||| ||| ||||| ||||
Sbjct: 1417 atatggttctgtggtgcatatcagggctatggtttccatgaagatggactaaaggctgg 1475

to top

>gb|BT006344.1| Arabidopsis thaliana At3g23510/MEE5_5 gene, complete cds
          Length = 2604

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                       
Query: 260  atatggttctgtggggcatatcaaggtcatggcttccatgaagacggattaaagtctgg 318
            |||||||||||||| |||||||| ||  |||| ||||||||||| ||| ||||| ||||
Sbjct: 1174 atatggttctgtggtgcatatcagggctatggtttccatgaagatggactaaaggctgg 1232

to top

>dbj|AK176391.1| Arabidopsis thaliana mRNA, complete cds, clone: RAFL24-10-D10
          Length = 2986

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                       
Query: 260  atatggttctgtggggcatatcaaggtcatggcttccatgaagacggattaaagtctgg 318
            |||||||||||||| |||||||| ||  |||| ||||||||||| ||| ||||| ||||
Sbjct: 1406 atatggttctgtggtgcatatcagggctatggtttccatgaagatggactaaaggctgg 1464

to top

>dbj|AK117243.1| Arabidopsis thaliana At3g23510 mRNA for putative
            cyclopropane-fatty-acyl-phospholipid synthase, complete
            cds, clone: RAFL16-79-F04
          Length = 3062

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                           
Query: 260  atatggttctgtggggcatatcaaggtcatggcttccatgaagacgg 306
            |||||||||||||| |||||||| ||  |||| ||||||||||||||
Sbjct: 1477 atatggttctgtggtgcatatcagggctatggtttccatgaagacgg 1523

to top

>gb|BT001134.1| Arabidopsis thaliana At3g23510/MEE5_5 mRNA, complete cds
          Length = 2604

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                       
Query: 260  atatggttctgtggggcatatcaaggtcatggcttccatgaagacggattaaagtctgg 318
            |||||||||||||| |||||||| ||  |||| ||||||||||| ||| ||||| ||||
Sbjct: 1174 atatggttctgtggtgcatatcagggctatggtttccatgaagatggactaaaggctgg 1232

to top

>gb|AY574036.1| Gossypium hirsutum cyclopropane fatty acid synthase (CPA-FAS-1) mRNA,
            complete cds
          Length = 2884

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                
Query: 238  tcagatccagggaaagaggggaatatggttctgtgg 273
            |||||| ||||||||||| ||||| |||||||||||
Sbjct: 1178 tcagattcagggaaagagaggaatctggttctgtgg 1213

to top

>ref|XM_524253.1| PREDICTED: Pan troglodytes similar to guanyl nucleotide releasing
           protein 4 (LOC468867), mRNA
          Length = 2268

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 281 caaggtcatggcttccatgaa 301
           |||||||||||||||||||||
Sbjct: 201 caaggtcatggcttccatgaa 221

to top

>ref|NM_170604.1| Homo sapiens RAS guanyl releasing protein 4 (RASGRP4), transcript
           variant 4, mRNA
          Length = 2436

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 281 caaggtcatggcttccatgaa 301
           |||||||||||||||||||||
Sbjct: 334 caaggtcatggcttccatgaa 354

to top

>ref|NM_170603.1| Homo sapiens RAS guanyl releasing protein 4 (RASGRP4), transcript
           variant 1, mRNA
          Length = 2634

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 281 caaggtcatggcttccatgaa 301
           |||||||||||||||||||||
Sbjct: 334 caaggtcatggcttccatgaa 354

to top

>ref|NM_170602.1| Homo sapiens RAS guanyl releasing protein 4 (RASGRP4), transcript
           variant 2, mRNA
          Length = 2592

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 281 caaggtcatggcttccatgaa 301
           |||||||||||||||||||||
Sbjct: 334 caaggtcatggcttccatgaa 354

to top

>ref|NM_052949.2| Homo sapiens RAS guanyl releasing protein 4 (RASGRP4), transcript
           variant 3, mRNA
          Length = 2749

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 281 caaggtcatggcttccatgaa 301
           |||||||||||||||||||||
Sbjct: 334 caaggtcatggcttccatgaa 354

to top

>gb|AC117994.12| Mus musculus chromosome 6, clone RP23-25K2, complete sequence
          Length = 237945

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 341    cttggaaagaaatgtgagctt 361
              |||||||||||||||||||||
Sbjct: 225527 cttggaaagaaatgtgagctt 225547

to top

>gb|AF448437.1| Homo sapiens guanyl nucleotide releasing protein 4 (RASGRP4) mRNA,
           complete cds
          Length = 2293

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 281 caaggtcatggcttccatgaa 301
           |||||||||||||||||||||
Sbjct: 191 caaggtcatggcttccatgaa 211

to top

>gb|AY048121.1| Homo sapiens RAS guanyl releasing protein 4 variant 2 (RASGRP4)
           mRNA, complete cds
          Length = 2592

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 281 caaggtcatggcttccatgaa 301
           |||||||||||||||||||||
Sbjct: 334 caaggtcatggcttccatgaa 354

to top

>gb|AY048120.1| Homo sapiens RAS guanyl releasing protein 4 variant 1 (RASGRP4)
           mRNA, complete cds
          Length = 2749

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 281 caaggtcatggcttccatgaa 301
           |||||||||||||||||||||
Sbjct: 334 caaggtcatggcttccatgaa 354

to top

>gb|AY048119.1| Homo sapiens RAS guanyl releasing protein 4 (RASGRP4) mRNA,
           complete cds
          Length = 2634

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 281 caaggtcatggcttccatgaa 301
           |||||||||||||||||||||
Sbjct: 334 caaggtcatggcttccatgaa 354

to top

>gb|AF470622.1| Sterculia foetida cyclopropane synthase mRNA, complete cds
          Length = 2977

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                 
Query: 237  atcagatccagggaaagaggggaatatggttctgtgg 273
            ||||||| ||||| ||||| ||||| |||||||||||
Sbjct: 1240 atcagattcaggggaagagaggaatctggttctgtgg 1276

to top

>gb|AC156397.5| Mus musculus 6 BAC RP24-279P24 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 166910

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 341   cttggaaagaaatgtgagctt 361
             |||||||||||||||||||||
Sbjct: 41924 cttggaaagaaatgtgagctt 41944

to top

>gb|AC011469.6|AC011469 Homo sapiens chromosome 19 clone CTC-475D23, complete sequence
          Length = 110569

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 281  caaggtcatggcttccatgaa 301
            |||||||||||||||||||||
Sbjct: 8293 caaggtcatggcttccatgaa 8273

to top

>gb|AY769950.1| Homo sapiens coagulation factor VIII, procoagulant component (hemophilia
              A) (F8) gene, complete cds
          Length = 192029

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 75     tttctattacttactggcta 94
              ||||||||||||||||||||
Sbjct: 176025 tttctattacttactggcta 176006

to top

>gb|AY574037.1| Gossypium hirsutum cyclopropane fatty acid synthase (CPA-FAS-2) mRNA,
            complete cds
          Length = 2827

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                
Query: 238  tcagatccagggaaagaggggaatatggttctgtgg 273
            |||||| ||||| ||||| ||||| |||||||||||
Sbjct: 1161 tcagattcaggggaagagaggaatctggttctgtgg 1196

to top

>gb|AC138341.9| Mus musculus chromosome 5, clone RP23-37N15, complete sequence
          Length = 176410

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 255 ggggaatatggttctgtggg 274
           ||||||||||||||||||||
Sbjct: 845 ggggaatatggttctgtggg 826

to top

>ref|NG_005114.1| Homo sapiens coagulation factor VIII region (F8@) on chromosome X
          Length = 652898

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 75    tttctattacttactggcta 94
             ||||||||||||||||||||
Sbjct: 14538 tttctattacttactggcta 14557

to top

>emb|CT025637.1| Pan troglodytes chromosome X clone PTB-011B24 map Xq28, complete sequence
          Length = 261577

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 75     tttctattacttactggcta 94
              ||||||||||||||||||||
Sbjct: 129018 tttctattacttactggcta 129037

to top

>ref|XM_844143.1| PREDICTED: Canis familiaris similar to protein tyrosine phosphatase,
            non-receptor type 14, transcript variant 1 (LOC490293),
            mRNA
          Length = 3564

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 280  tcaaggtcatggcttccatg 299
            ||||||||||||||||||||
Sbjct: 1975 tcaaggtcatggcttccatg 1956

to top

>emb|AL136438.10| Human DNA sequence from clone RP11-111G7 on chromosome 13q11-12.3
              Contains part of the ATP8A2 gene for ATPase,
              aminophospholipid transporter-like, Class I, type 8A,
              member 2 (ML-1 protein)(IB, ATP, ML-1, ATPIB,
              DKFZP434B1913), complete sequence
          Length = 178319

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 584    atgggcttggcagaatccta 603
              ||||||||||||||||||||
Sbjct: 116693 atgggcttggcagaatccta 116712

to top

>emb|AL021331.1|HS366N23 Human DNA sequence from clone RP3-366N23 on chromosome 6q27 Contains
             the UNC93A gene for unc-93 homolog A (C. elegans), the
             gene for NYD-TSPG protein,  a Mitotic Feedback Control
             Protein MADP2 Homolog LIKE pseudogene and the 3' end  of
             the TCP10 gene for t-complex 10 (mouse), complete sequence
          Length = 98517

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 519   gtgtaaaatctgtcatccaa 538
             ||||||||||||||||||||
Sbjct: 95146 gtgtaaaatctgtcatccaa 95127

to top

>gb|AC010038.5| Drosophila melanogaster 3L BAC RP98-14O14 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 172175

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 431   ttcaaccaatacatatccat 450
             ||||||||||||||||||||
Sbjct: 30347 ttcaaccaatacatatccat 30328

to top

>gb|AC105264.3| Drosophila melanogaster 3L BAC RP98-17K18 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 177583

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 431   ttcaaccaatacatatccat 450
             ||||||||||||||||||||
Sbjct: 78666 ttcaaccaatacatatccat 78685

to top

>gb|AC093192.2| Drosophila melanogaster 3L BAC RP98-48J18 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 166862

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 431    ttcaaccaatacatatccat 450
              ||||||||||||||||||||
Sbjct: 164407 ttcaaccaatacatatccat 164426

to top

>gb|AC044782.6| Homo sapiens chromosome 10 clone RP11-170M17, complete sequence
          Length = 149041

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 448   cattggtaacttgatattgg 467
             ||||||||||||||||||||
Sbjct: 78360 cattggtaacttgatattgg 78379

to top

>dbj|AP007167.1| Aspergillus oryzae RIB40 genomic DNA, SC020
          Length = 1824958

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 227     cttcagcttcatcagatcca 246
               ||||||||||||||||||||
Sbjct: 1236680 cttcagcttcatcagatcca 1236699

to top

>gb|AC069543.5| Homo sapiens chromosome 10 clone RP11-393H5, complete sequence
          Length = 179789

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 448    cattggtaacttgatattgg 467
              ||||||||||||||||||||
Sbjct: 128966 cattggtaacttgatattgg 128947

to top

>gb|AC163771.5| Pan troglodytes BAC clone CH251-57G17 from chromosome unknown, complete
              sequence
          Length = 179603

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 75     tttctattacttactggcta 94
              ||||||||||||||||||||
Sbjct: 143285 tttctattacttactggcta 143266

to top

>emb|BX085194.14| Zebrafish DNA sequence from clone DKEY-242M13, complete sequence
          Length = 169865

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 221  gcttatcttcagcttcatcagatc 244
            ||||||||||||||||| ||||||
Sbjct: 2405 gcttatcttcagcttcagcagatc 2382

to top

>emb|BX248232.11| Zebrafish DNA sequence from clone CH211-232I5, complete sequence
          Length = 152609

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 221   gcttatcttcagcttcatcagatc 244
             ||||||||||||||||| ||||||
Sbjct: 11024 gcttatcttcagcttcagcagatc 11047

to top

>gb|AC155241.2| Mus musculus BAC clone RP24-485P18 from chromosome 12, complete
             sequence
          Length = 144320

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 547   ccccttgttttattggaagg 566
             ||||||||||||||||||||
Sbjct: 62200 ccccttgttttattggaagg 62219

to top

>gb|AC109993.4| Homo sapiens chromosome X clone RP11-115M6 map q28, complete sequence
          Length = 178498

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 75     tttctattacttactggcta 94
              ||||||||||||||||||||
Sbjct: 163814 tttctattacttactggcta 163833

to top

>gb|AC160653.3| Pan troglodytes BAC clone CH251-453K4 from chromosome unknown, complete
              sequence
          Length = 178835

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 75     tttctattacttactggcta 94
              ||||||||||||||||||||
Sbjct: 106011 tttctattacttactggcta 106030

to top

>dbj|BS000052.1| Pan troglodytes chromosome 22 clone:RP43-049N07, map 22, complete
              sequences
          Length = 180152

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 80     attacttactggctaaacca 99
              ||||||||||||||||||||
Sbjct: 132911 attacttactggctaaacca 132892

to top

>emb|AL953869.12| Zebrafish DNA sequence from clone CH211-261J13 in linkage group 7,
              complete sequence
          Length = 171417

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 518    tgtgtaaaatctgtcatcca 537
              ||||||||||||||||||||
Sbjct: 135239 tgtgtaaaatctgtcatcca 135220

to top

>gb|AE003472.1| Drosophila melanogaster chromosome 3L, section 6 of 83 of the complete
              sequence
          Length = 303191

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 431    ttcaaccaatacatatccat 450
              ||||||||||||||||||||
Sbjct: 155794 ttcaaccaatacatatccat 155813

to top

>dbj|AP003125.2| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-642E8, complete
              sequence
          Length = 180711

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 224    tatcttcagcttcatcagat 243
              ||||||||||||||||||||
Sbjct: 176094 tatcttcagcttcatcagat 176113

to top

>gb|AC005557.1|AC005557 Drosophila melanogaster, chromosome 3L, region 62A10-62B5, P1 clones
             DS02777, DS03222, DS02345, and DS04808, complete sequence
          Length = 257867

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 431   ttcaaccaatacatatccat 450
             ||||||||||||||||||||
Sbjct: 78960 ttcaaccaatacatatccat 78979

to top

>emb|AL645722.2|HSA524G17 Homo sapiens chromosome X clone RP11-524G17 map Xq28, complete sequence
          Length = 189940

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 75     tttctattacttactggcta 94
              ||||||||||||||||||||
Sbjct: 145762 tttctattacttactggcta 145743

to top

>gb|AE009442.1| Xylella fastidiosa Temecula1, complete genome
          Length = 2519802

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 379    tatgattccatcatggattg 398
              ||||||||||||||||||||
Sbjct: 553603 tatgattccatcatggattg 553622

to top

>gb|AC144779.3| Mus musculus BAC clone RP23-331N18 from 5, complete sequence
          Length = 168358

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 337   tttgcttggaaagaaatgtgagcttctg 364
             |||| |||||||||||||| ||||||||
Sbjct: 85794 tttgtttggaaagaaatgttagcttctg 85767

to top

>dbj|AP006711.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT09H02, TM0593b,
            complete sequence
          Length = 10381

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 294  tccatgaagacggattaaag 313
            ||||||||||||||||||||
Sbjct: 5666 tccatgaagacggattaaag 5685

to top

>gb|AC153930.2| Mus musculus 10 BAC RP24-461H14 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 186915

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 374    aagaatatgattccatcatg 393
              ||||||||||||||||||||
Sbjct: 110625 aagaatatgattccatcatg 110606

to top

>gb|AC161208.9| Mus musculus chromosome 5, clone RP23-71M14, complete sequence
          Length = 211079

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 255    ggggaatatggttctgtggg 274
              ||||||||||||||||||||
Sbjct: 190956 ggggaatatggttctgtggg 190937


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,798,621
Number of Sequences: 3902068
Number of extensions: 5798621
Number of successful extensions: 107974
Number of sequences better than 10.0: 59
Number of HSP's better than 10.0 without gapping: 59
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 107768
Number of HSP's gapped (non-prelim): 206
length of query: 626
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 603
effective length of database: 17,143,297,704
effective search space: 10337408515512
effective search space used: 10337408515512
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result