ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal8p10
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|NM_188645.1| Oryza sativa (japonica cultivar-group), Ozsa824... 96 2e-16
2dbj|AK100714.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 4e-14
3gb|AY103910.1| Zea mays PCO104496 mRNA sequence 88 4e-14
4dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 64 6e-07
5dbj|AP002481.1| Oryza sativa (japonica cultivar-group) genomic D... 64 6e-07
6ref|NM_179887.1| Arabidopsis thaliana ubiquitin conjugating enzy... 42 2.1
7ref|NM_001030931.1| Gallus gallus signal transducer and activato... 42 2.1
8gb|AY641397.1| Gallus gallus signal transducer and activator of ... 42 2.1
9emb|Z81138.1|CEW05B2 Caenorhabditis elegans Cosmid W05B2, comple... 42 2.1
10emb|Z35639.1|CED2045 Caenorhabditis elegans Cosmid D2045, comple... 42 2.1
11gb|DQ249182.1| Homo sapiens isolate 541CLS41 haplotype HLA-B5001... 42 2.1
12gb|DQ249180.1| Homo sapiens isolate 495CLS44 haplotype HLA-B5701... 42 2.1
13gb|DQ249179.1| Homo sapiens isolate 495CLS7 haplotype HLA-B3801/... 42 2.1
14gb|DQ249177.1| Homo sapiens isolate 218CLS60 haplotype HLA-B1501... 42 2.1
15gb|DQ249175.1| Homo sapiens isolate 144CLS7 haplotype HLA-B3801/... 42 2.1
16gb|AY091326.1| Arabidopsis thaliana putative ubiquitin-conjugati... 42 2.1
17gb|AY074292.1| Arabidopsis thaliana putative E2, ubiquitin-conju... 42 2.1
18ref|NM_001031603.1| Gallus gallus similar to signal transducer a... 42 2.1
19emb|AJ851819.1| Gallus gallus mRNA for hypothetical protein, clo... 42 2.1
20emb|BX927178.8| Human DNA sequence from clone DAMA-387C9 on chro... 42 2.1
21emb|CR759828.5| Human DNA sequence from clone DAMC-153L10 on chr... 42 2.1
22emb|CR759814.6| Human DNA sequence from clone DADB-15N24 on chro... 42 2.1
23ref|NM_066907.1| Caenorhabditis elegans D2045.5 (D2045.5) mRNA, ... 42 2.1
24dbj|BA000041.2| Pan troglodytes DNA, major histocompatibility co... 42 2.1
25dbj|AB054536.1| Pan troglodytes LTB, TNF alpha, LTA, IKBL, ATP6G... 42 2.1
26gb|DQ027037.1| Arabidopsis thaliana ubiquitinating enzyme (At2g3... 42 2.1
27gb|AC136222.2| Oryza sativa (japonica cultivar-group) chromosome... 40 8.1
28gb|AC044805.4| Mus musculus strain C57BL6/J chromosome 5 clone R... 40 8.1
29gb|AC073336.6| Homo sapiens BAC clone RP11-476H24 from 7, comple... 40 8.1
30gb|DQ249181.1| Homo sapiens isolate 541CLS37 haplotype HLA-B0702... 40 8.1
31gb|DQ249176.1| Homo sapiens isolate 218CLS51 haplotype HLA-B1402... 40 8.1
32gb|DQ249174.1| Homo sapiens isolate 144CLS49 haplotype HLA-B0801... 40 8.1
33gb|DQ249173.1| Homo sapiens isolate 135CLS51 haplotype HLA-B1402... 40 8.1
34gb|DQ249172.1| Homo sapiens isolate 135CLS49 haplotype HLA-B0801... 40 8.1
35ref|NG_002397.2| Homo sapiens major histocompatibility complex, ... 40 8.1
36emb|BX248310.3| Human DNA sequence from clone DASS-311G1 on chro... 40 8.1
37emb|AL845443.3| Human DNA sequence from clone DAQB-48K1 on chrom... 40 8.1
38emb|AL845556.2| Human DNA sequence from clone XXbac-426A24 on ch... 40 8.1
39emb|AL671883.3| Human DNA sequence from clone XXbac-248L24 on ch... 40 8.1
40emb|BX530026.5| Zebrafish DNA sequence from clone DKEY-287G12 in... 40 8.1
41dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.1
42dbj|BA000025.2| Homo sapiens genomic DNA, chromosome 6p21.3, HLA... 40 8.1
43emb|AL807802.22| Mouse DNA sequence from clone RP23-351B24 on ch... 40 8.1
44gb|AC004205.1|AC004205 Homo sapiens clone UWGC:y3c071 from 6p21,... 40 8.1
45gb|AC004210.1|AC004210 Homo sapiens clone UWGC:y5c028 from 6p21,... 40 8.1
46gb|AC127263.4| Mus musculus BAC clone RP24-328P2 from 6, complet... 40 8.1
47gb|AC139186.4| Mus musculus BAC clone RP24-92D20 from 8, complet... 40 8.1
48gb|AC166825.3| Mus musculus BAC clone RP23-368D12 from chromosom... 40 8.1
49emb|AL732456.6| Mouse DNA sequence from clone RP23-405D18 on chr... 40 8.1
50gb|AC034192.5| Homo sapiens chromosome 3 clone RP11-416N8 map 3p... 40 8.1
51dbj|D84394.1| Homo sapiens genomic DNA, 237 kb segment from 6p21... 40 8.1 
>ref|NM_188645.1| Oryza sativa (japonica cultivar-group), Ozsa8248 predicted mRNA
          Length = 1080

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 147/180 (81%)
 Strand = Plus / Minus

                                                                       
Query: 418 tccaggatggctcgctcccgctcgtggaaatggtgcacgacaagggtctcaaaatgctta 477
           ||||||||| | ||||| ||||| ||||| ||| |  | ||||||| |||||||||||| 
Sbjct: 854 tccaggatgacgcgctcacgctcatggaagtggcgtgcaacaagggactcaaaatgcttt 795

                                                                       
Query: 478 ggaggcttacgaagtgaatacagcatagtcttgcatgatagaacaaacgcagtctgatta 537
           |||||||| ||||||||||||| ||| ||| |||| ||||| |  || ||||||||||||
Sbjct: 794 ggaggcttccgaagtgaatacatcattgtcctgcaggatagtaggaaggcagtctgatta 735

                                                                       
Query: 538 tatgccatggaatgcttttcaccaagaggtgtattaacagtgtttttgtagcctggctca 597
           || ||||  || | |||||| ||| ||| ||||||| | |  ||||||| ||||||||||
Sbjct: 734 taagccaacgagtacttttctccaggagctgtattagccgaatttttgttgcctggctca 675
to top
>dbj|AK100714.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023115K12, full
            insert sequence
          Length = 1696

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 146/180 (81%)
 Strand = Plus / Minus

                                                                        
Query: 418  tccaggatggctcgctcccgctcgtggaaatggtgcacgacaagggtctcaaaatgctta 477
            ||||||||| | ||||| ||||| ||||| ||| |  | ||||||| |||||||||||| 
Sbjct: 1172 tccaggatgacgcgctcacgctcatggaagtggcgtgcaacaagggactcaaaatgcttt 1113

                                                                        
Query: 478  ggaggcttacgaagtgaatacagcatagtcttgcatgatagaacaaacgcagtctgatta 537
            |||||||| ||||||||||||| ||| ||| |||| ||||| |   | ||||||||||||
Sbjct: 1112 ggaggcttccgaagtgaatacatcattgtcctgcaggatagtagggaggcagtctgatta 1053

                                                                        
Query: 538  tatgccatggaatgcttttcaccaagaggtgtattaacagtgtttttgtagcctggctca 597
            || ||||  || | |||||| ||| ||| ||||||| | |  ||||||| ||||||||||
Sbjct: 1052 taagccaacgagtacttttctccaggagctgtattagccgaatttttgttgcctggctca 993
to top
>gb|AY103910.1| Zea mays PCO104496 mRNA sequence
          Length = 1523

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Minus

                                                                        
Query: 409  ctgcatgcgtccaggatggctcgctcccgctcgtggaaatggtgcacgacaagggtctca 468
            ||||| ||||| |||||||| |||||  |||||||||| ||   ||  ||||||||||||
Sbjct: 1106 ctgcaagcgtcgaggatggcacgctcatgctcgtggaagtgccacaacacaagggtctca 1047

                                                            
Query: 469  aaatgcttaggaggcttacgaagtgaatacagcatagtcttgcatgat 516
            |||||| | |||||||| || |||||||||||||| ||||||||||||
Sbjct: 1046 aaatgcattggaggcttccggagtgaatacagcatcgtcttgcatgat 999
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 98/120 (81%)
 Strand = Plus / Plus

                                                                           
Query: 478     ggaggcttacgaagtgaatacagcatagtcttgcatgatagaacaaacgcagtctgatta 537
               |||||||| ||||||||||||| ||| ||| |||| ||||| |  || ||||||||||||
Sbjct: 7405061 ggaggcttccgaagtgaatacatcattgtcctgcaggatagtaggaaggcagtctgatta 7405120

                                                                           
Query: 538     tatgccatggaatgcttttcaccaagaggtgtattaacagtgtttttgtagcctggctca 597
               || ||||  || | |||||| ||| ||| ||||||| | |  ||||||| ||||||||||
Sbjct: 7405121 taagccaacgagtacttttctccaggagctgtattagccgaatttttgttgcctggctca 7405180
to top
>dbj|AP002481.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
             clone:P0702F03
          Length = 141111

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 98/120 (81%)
 Strand = Plus / Plus

                                                                         
Query: 478   ggaggcttacgaagtgaatacagcatagtcttgcatgatagaacaaacgcagtctgatta 537
             |||||||| ||||||||||||| ||| ||| |||| ||||| |  || ||||||||||||
Sbjct: 66089 ggaggcttccgaagtgaatacatcattgtcctgcaggatagtaggaaggcagtctgatta 66148

                                                                         
Query: 538   tatgccatggaatgcttttcaccaagaggtgtattaacagtgtttttgtagcctggctca 597
             || ||||  || | |||||| ||| ||| ||||||| | |  ||||||| ||||||||||
Sbjct: 66149 taagccaacgagtacttttctccaggagctgtattagccgaatttttgttgcctggctca 66208
to top
>ref|NM_179887.1| Arabidopsis thaliana ubiquitin conjugating enzyme AT2G33770 mRNA,
            complete cds
          Length = 4102

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 464  tctcaaaatgcttaggaggcttacg 488
            ||||||||||||| |||||||||||
Sbjct: 3652 tctcaaaatgctttggaggcttacg 3628
to top
>ref|NM_001030931.1| Gallus gallus signal transducer and activator of transcription 3
            (acute-phase response factor) (STAT3), mRNA
          Length = 2388

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 420  caggatggctcgctcccgctc 440
            |||||||||||||||||||||
Sbjct: 1812 caggatggctcgctcccgctc 1792
to top
>gb|AY641397.1| Gallus gallus signal transducer and activator of transcription 3
            mRNA, complete cds
          Length = 2388

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 420  caggatggctcgctcccgctc 440
            |||||||||||||||||||||
Sbjct: 1812 caggatggctcgctcccgctc 1792
to top
>emb|Z81138.1|CEW05B2 Caenorhabditis elegans Cosmid W05B2, complete sequence
          Length = 35530

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 323   tcttgaaaccggcaaagcact 343
             |||||||||||||||||||||
Sbjct: 13261 tcttgaaaccggcaaagcact 13281
to top
>emb|Z35639.1|CED2045 Caenorhabditis elegans Cosmid D2045, complete sequence
          Length = 37249

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 323   tcttgaaaccggcaaagcact 343
             |||||||||||||||||||||
Sbjct: 17288 tcttgaaaccggcaaagcact 17308
to top
>gb|DQ249182.1| Homo sapiens isolate 541CLS41 haplotype HLA-B5001/HLA-Cw0602 genomic
             sequence
          Length = 346809

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 528   agtctgattatatgccatgga 548
             |||||||||||||||||||||
Sbjct: 47718 agtctgattatatgccatgga 47698
to top
>gb|DQ249180.1| Homo sapiens isolate 495CLS44 haplotype HLA-B570101/HLA-Cw0602 genomic
             sequence
          Length = 265420

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 528   agtctgattatatgccatgga 548
             |||||||||||||||||||||
Sbjct: 50879 agtctgattatatgccatgga 50859
to top
>gb|DQ249179.1| Homo sapiens isolate 495CLS7 haplotype HLA-B3801/HLA-Cw120301 genomic
             sequence
          Length = 338517

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 528   agtctgattatatgccatgga 548
             |||||||||||||||||||||
Sbjct: 46899 agtctgattatatgccatgga 46879
to top
>gb|DQ249177.1| Homo sapiens isolate 218CLS60 haplotype HLA-B15010101/HLA-Cw030401
             genomic sequence
          Length = 351341

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 528   agtctgattatatgccatgga 548
             |||||||||||||||||||||
Sbjct: 52824 agtctgattatatgccatgga 52804
to top
>gb|DQ249175.1| Homo sapiens isolate 144CLS7 haplotype HLA-B3801/HLA-Cw120301 genomic
             sequence
          Length = 328871

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 528   agtctgattatatgccatgga 548
             |||||||||||||||||||||
Sbjct: 47883 agtctgattatatgccatgga 47863
to top
>gb|AY091326.1| Arabidopsis thaliana putative ubiquitin-conjugating enzyme E2
            (At2g33770) mRNA, complete cds
          Length = 2755

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 464  tctcaaaatgcttaggaggcttacg 488
            ||||||||||||| |||||||||||
Sbjct: 2500 tctcaaaatgctttggaggcttacg 2476
to top
>gb|AY074292.1| Arabidopsis thaliana putative E2, ubiquitin-conjugating enzyme
            (At2g33770) mRNA, complete cds
          Length = 4118

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 464  tctcaaaatgcttaggaggcttacg 488
            ||||||||||||| |||||||||||
Sbjct: 3652 tctcaaaatgctttggaggcttacg 3628
to top
>ref|NM_001031603.1| Gallus gallus similar to signal transducer and activator of
            transcription 3 isoform 2; acute-phase response factor;
            DNA-binding protein APRF (LOC431198), mRNA
          Length = 4436

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 420  caggatggctcgctcccgctc 440
            |||||||||||||||||||||
Sbjct: 1985 caggatggctcgctcccgctc 1965
to top
>emb|AJ851819.1| Gallus gallus mRNA for hypothetical protein, clone 38l20
          Length = 4436

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 420  caggatggctcgctcccgctc 440
            |||||||||||||||||||||
Sbjct: 1985 caggatggctcgctcccgctc 1965
to top
>emb|BX927178.8| Human DNA sequence from clone DAMA-387C9 on chromosome 6, complete
             sequence
          Length = 106199

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 528   agtctgattatatgccatgga 548
             |||||||||||||||||||||
Sbjct: 78916 agtctgattatatgccatgga 78936
to top
>emb|CR759828.5| Human DNA sequence from clone DAMC-153L10 on chromosome 6, complete
             sequence
          Length = 102821

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 528   agtctgattatatgccatgga 548
             |||||||||||||||||||||
Sbjct: 78201 agtctgattatatgccatgga 78221
to top
>emb|CR759814.6| Human DNA sequence from clone DADB-15N24 on chromosome 6, complete
             sequence
          Length = 63499

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 528   agtctgattatatgccatgga 548
             |||||||||||||||||||||
Sbjct: 50438 agtctgattatatgccatgga 50458
to top
>ref|NM_066907.1| Caenorhabditis elegans D2045.5 (D2045.5) mRNA, complete cds
          Length = 1056

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 323 tcttgaaaccggcaaagcact 343
           |||||||||||||||||||||
Sbjct: 859 tcttgaaaccggcaaagcact 839
to top
>dbj|BA000041.2| Pan troglodytes DNA, major histocompatibility complex class I region
          Length = 1750601

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 528    agtctgattatatgccatgga 548
              |||||||||||||||||||||
Sbjct: 153486 agtctgattatatgccatgga 153466
to top
>dbj|AB054536.1| Pan troglodytes LTB, TNF alpha, LTA, IKBL, ATP6G, BAT1, Patr-MIC and
              Patr-B genes, complete cds
          Length = 176284

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 528    agtctgattatatgccatgga 548
              |||||||||||||||||||||
Sbjct: 153486 agtctgattatatgccatgga 153466
to top
>gb|DQ027037.1| Arabidopsis thaliana ubiquitinating enzyme (At2g33770) mRNA, complete
            cds
          Length = 2724

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 464  tctcaaaatgcttaggaggcttacg 488
            ||||||||||||| |||||||||||
Sbjct: 2500 tctcaaaatgctttggaggcttacg 2476
to top
>gb|AC136222.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0088M05,
              complete sequence
          Length = 153368

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 307    tgtgcatcgagagacttcttgaaa 330
              ||||||||||||||||| ||||||
Sbjct: 112128 tgtgcatcgagagactttttgaaa 112105
to top
>gb|AC044805.4| Mus musculus strain C57BL6/J chromosome 5 clone RP23-282L6, complete
             sequence
          Length = 208526

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 573   aacagtgtttttgtagcctg 592
             ||||||||||||||||||||
Sbjct: 86506 aacagtgtttttgtagcctg 86487
to top
>gb|AC073336.6| Homo sapiens BAC clone RP11-476H24 from 7, complete sequence
          Length = 166261

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 66    aaccaattcatctacagtta 85
             ||||||||||||||||||||
Sbjct: 89588 aaccaattcatctacagtta 89569
to top
>gb|DQ249181.1| Homo sapiens isolate 541CLS37 haplotype HLA-B070201/HLA-Cw07020103
             genomic sequence
          Length = 341361

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 528   agtctgattatatgccatgg 547
             ||||||||||||||||||||
Sbjct: 36161 agtctgattatatgccatgg 36142
to top
>gb|DQ249176.1| Homo sapiens isolate 218CLS51 haplotype HLA-B140201/HLA-Cw0802 genomic
             sequence
          Length = 363675

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 528   agtctgattatatgccatgg 547
             ||||||||||||||||||||
Sbjct: 51900 agtctgattatatgccatgg 51881
to top
>gb|DQ249174.1| Homo sapiens isolate 144CLS49 haplotype HLA-B080101/HLA-Cw070101
             genomic sequence
          Length = 338544

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 528   agtctgattatatgccatgg 547
             ||||||||||||||||||||
Sbjct: 48937 agtctgattatatgccatgg 48918
to top
>gb|DQ249173.1| Homo sapiens isolate 135CLS51 haplotype HLA-B140201/HLA-Cw0802 genomic
             sequence
          Length = 336776

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 528   agtctgattatatgccatgg 547
             ||||||||||||||||||||
Sbjct: 31002 agtctgattatatgccatgg 30983
to top
>gb|DQ249172.1| Homo sapiens isolate 135CLS49 haplotype HLA-B080101/HLA-Cw070101
             genomic sequence
          Length = 342745

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 528   agtctgattatatgccatgg 547
             ||||||||||||||||||||
Sbjct: 29545 agtctgattatatgccatgg 29526
to top
>ref|NG_002397.2| Homo sapiens major histocompatibility complex, class I, BC (HLA-BC) on
             chromosome 6
          Length = 89417

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 528   agtctgattatatgccatgg 547
             ||||||||||||||||||||
Sbjct: 71878 agtctgattatatgccatgg 71897
to top
>emb|BX248310.3| Human DNA sequence from clone DASS-311G1 on chromosome 6, complete
             sequence
          Length = 116320

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 528   agtctgattatatgccatgg 547
             ||||||||||||||||||||
Sbjct: 77129 agtctgattatatgccatgg 77148
to top
>emb|AL845443.3| Human DNA sequence from clone DAQB-48K1 on chromosome 6 Contains the
             USP8P pseudogene for ubiquitin specific protease 8, the
             RPL3P2 pseudogene for ribosomal protein L3 pseudogene 2,
             the WASF5P pseudogene for WAS protein family, member 5,
             the HLA-B gene for major histocompatibility complex, class
             I, B, the DHFRP2 pseudogene for dihydrofolate reductase 2,
             the FGFR3P pseudogene for fibroblast growth factor
             receptor 3, the HLA-S gene for major histocompatibility
             complex, class I, S, the MICA gene for MHC class I
             polypeptide-related sequence A and 3 CpG islands, complete
             sequence
          Length = 148076

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 528   agtctgattatatgccatgg 547
             ||||||||||||||||||||
Sbjct: 68541 agtctgattatatgccatgg 68560
to top
>emb|AL845556.2| Human DNA sequence from clone XXbac-426A24 on chromosome 6, complete
             sequence
          Length = 43003

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 528   agtctgattatatgccatgg 547
             ||||||||||||||||||||
Sbjct: 32312 agtctgattatatgccatgg 32331
to top
>emb|AL671883.3| Human DNA sequence from clone XXbac-248L24 on chromosome 6 contains the
             HLA-C gene for major histocompatibility complex, class I,
             C, a ubiquitin specific protease 8 (USP8) pseudogene, a
             ribosomal protein L3 (RPL3) pseudogene, a WAS protein
             family, member 3 (WASF3) pseudogene, the HLA-B gene for
             major histocompatibility complex, class I, B, a
             dihydrofolate reductase pseudogene, a fibroblast growth
             factor receptor 3 (FGFR3) pseudogene and two CpG islands,
             complete sequence
          Length = 120197

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 528   agtctgattatatgccatgg 547
             ||||||||||||||||||||
Sbjct: 75325 agtctgattatatgccatgg 75344
to top
>emb|BX530026.5| Zebrafish DNA sequence from clone DKEY-287G12 in linkage group 12,
             complete sequence
          Length = 190980

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 258   cagtgcttgagctctgttct 277
             ||||||||||||||||||||
Sbjct: 64905 cagtgcttgagctctgttct 64886
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 307      tgtgcatcgagagacttcttgaaa 330
                ||||||||||||||||| ||||||
Sbjct: 18318916 tgtgcatcgagagactttttgaaa 18318893
to top
>dbj|BA000025.2| Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region
          Length = 2229817

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 528    agtctgattatatgccatgg 547
              ||||||||||||||||||||
Sbjct: 604051 agtctgattatatgccatgg 604032
to top
>emb|AL807802.22| Mouse DNA sequence from clone RP23-351B24 on chromosome 4, complete
              sequence
          Length = 186857

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 573    aacagtgtttttgtagcctg 592
              ||||||||||||||||||||
Sbjct: 140367 aacagtgtttttgtagcctg 140386
to top
>gb|AC004205.1|AC004205 Homo sapiens clone UWGC:y3c071 from 6p21, complete sequence
          Length = 41506

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 528  agtctgattatatgccatgg 547
            ||||||||||||||||||||
Sbjct: 1722 agtctgattatatgccatgg 1703
to top
>gb|AC004210.1|AC004210 Homo sapiens clone UWGC:y5c028 from 6p21, complete sequence
          Length = 42601

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 528  agtctgattatatgccatgg 547
            ||||||||||||||||||||
Sbjct: 5800 agtctgattatatgccatgg 5781
to top
>gb|AC127263.4| Mus musculus BAC clone RP24-328P2 from 6, complete sequence
          Length = 149105

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 573    aacagtgtttttgtagcctg 592
              ||||||||||||||||||||
Sbjct: 119326 aacagtgtttttgtagcctg 119345
to top
>gb|AC139186.4| Mus musculus BAC clone RP24-92D20 from 8, complete sequence
          Length = 206436

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 573   aacagtgtttttgtagcctg 592
             ||||||||||||||||||||
Sbjct: 71297 aacagtgtttttgtagcctg 71316
to top
>gb|AC166825.3| Mus musculus BAC clone RP23-368D12 from chromosome 6, complete sequence
          Length = 182232

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 573    aacagtgtttttgtagcctg 592
              ||||||||||||||||||||
Sbjct: 125703 aacagtgtttttgtagcctg 125684
to top
>emb|AL732456.6| Mouse DNA sequence from clone RP23-405D18 on chromosome X, complete
             sequence
          Length = 136482

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 533   gattatatgccatggaatgc 552
             ||||||||||||||||||||
Sbjct: 87222 gattatatgccatggaatgc 87203
to top
>gb|AC034192.5| Homo sapiens chromosome 3 clone RP11-416N8 map 3p, complete sequence
          Length = 176223

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 530   tctgattatatgccatggaa 549
             ||||||||||||||||||||
Sbjct: 52575 tctgattatatgccatggaa 52556
to top
>dbj|D84394.1| Homo sapiens genomic DNA, 237 kb segment from 6p21.3 region including
             HLA genes, complete sequence
          Length = 236822

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 528   agtctgattatatgccatgg 547
             ||||||||||||||||||||
Sbjct: 75221 agtctgattatatgccatgg 75202


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,983,043
Number of Sequences: 3902068
Number of extensions: 3983043
Number of successful extensions: 66929
Number of sequences better than 10.0: 52
Number of HSP's better than 10.0 without gapping: 52
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 66803
Number of HSP's gapped (non-prelim): 125
length of query: 597
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 574
effective length of database: 17,143,297,704
effective search space: 9840252882096
effective search space used: 9840252882096
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top