ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd3p21
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC107819.8| Mus musculus chromosome 9, clone RP23-158E1, comp... 44 0.51
2gb|AC090133.6| Homo sapiens chromosome 8, clone RP11-813L8, comp... 44 0.51
3gb|AC123777.4| Homo sapiens chromosome 8, clone RP11-252C15, com... 44 0.51
4gb|AC154394.6| Mus musculus chromosome 18, clone RP23-315M1, com... 44 0.51
5gb|AC159901.2| Mus musculus BAC clone RP23-100I17 from chromosom... 44 0.51
6gb|AC109222.14| Mus musculus chromosome 18, clone RP23-251L6, co... 44 0.51
7gb|AY345016.1| Philine aperta cytochrome oxidase subunit I gene,... 44 0.51
8gb|AC161005.4| Pan troglodytes BAC clone CH251-668M6 from chromo... 42 2.0
9emb|AL445586.6| Human DNA sequence from clone RP11-352F21 on chr... 42 2.0
10ref|XM_683893.1| PREDICTED: Danio rerio similar to B230312I18Rik... 42 2.0
11emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome 42 2.0
12gb|AF474373.1| Hordeum vulgare subsp. vulgare BAC 259I16, comple... 40 7.9
13gb|AE017131.1| Yersinia pestis biovar Medievalis str. 91001 sect... 40 7.9
14gb|AC005142.2| Arabidopsis thaliana BAC T5L23 from chromosome IV... 40 7.9
15gb|AC116875.10| Mus musculus chromosome 8, clone RP24-426B21, co... 40 7.9
16gb|AC122941.3| Mus musculus BAC clone RP23-1E3 from chromosome 8... 40 7.9
17gb|AE009952.1| Yersinia pestis KIM, complete genome 40 7.9
18gb|DQ175857.1| Hordeum vulgare clone DsC28 Ds insertion site fla... 40 7.9
19gb|DQ175832.1| Hordeum vulgare clone DsB30 Ds insertion site fla... 40 7.9
20gb|DQ175829.1| Hordeum vulgare clone DsB25 Ds insertion site fla... 40 7.9
21gb|AC135362.3| Mus musculus BAC clone RP23-286J13 from chromosom... 40 7.9
22gb|AC003088.2| Homo sapiens BAC clone CTB-119P24 from 7, complet... 40 7.9
23gb|AC091297.3| Sus scrofa clone RP44-52N13, complete sequence 40 7.9
24emb|Z98046.1|HS14O9 Human DNA sequence from clone RP1-14O9 on ch... 40 7.9
25emb|AL357127.17| Human DNA sequence from clone RP11-282I1 on chr... 40 7.9
26emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, comp... 40 7.9
27emb|AL161497.2|ATCHRIV9 Arabidopsis thaliana DNA chromosome 4, c... 40 7.9
28emb|AJ010592.2|GTAJ10592 Guillardia theta DNA for complete seque... 40 7.9
29gb|AC010573.4| Drosophila melanogaster 3L BAC RP98-2M13 (Roswell... 40 7.9
30gb|AC069457.5| Drosophila melanogaster 3L BAC RP98-16J19 (Roswel... 40 7.9
31gb|AE010140.1| Pyrococcus furiosus DSM 3638, section 15 of 173 o... 40 7.9
32gb|AY008692.1| Hordeum vulgare transcription factor GAMyb (Gamyb... 40 7.9
33emb|BX897665.7| Zebrafish DNA sequence from clone DKEY-27K7 in l... 40 7.9
34emb|CT572999.10| Mouse DNA sequence from clone RP23-6C18 on chro... 40 7.9
35gb|AE003535.3| Drosophila melanogaster chromosome 3L, section 50... 40 7.9
36gb|AC115835.6| Mus musculus chromosome 3, clone RP24-184C18, com... 40 7.9
37emb|AJ414148.1| Yersinia pestis strain CO92 complete genome; seg... 40 7.9
38gb|AF071527.1| Arabidopsis thaliana BAC F9H3, from chromosome IV... 40 7.9
39emb|AL672130.14| Mouse DNA sequence from clone RP24-74N4 on chro... 40 7.9 
>gb|AC107819.8| Mus musculus chromosome 9, clone RP23-158E1, complete sequence
          Length = 172309

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 17     atgtatatcgcttcacattctt 38
              ||||||||||||||||||||||
Sbjct: 146425 atgtatatcgcttcacattctt 146404
to top
>gb|AC090133.6| Homo sapiens chromosome 8, clone RP11-813L8, complete sequence
          Length = 201279

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 97     gcaaactctatgacaaaaatta 118
              ||||||||||||||||||||||
Sbjct: 175965 gcaaactctatgacaaaaatta 175944
to top
>gb|AC123777.4| Homo sapiens chromosome 8, clone RP11-252C15, complete sequence
          Length = 175943

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 97     gcaaactctatgacaaaaatta 118
              ||||||||||||||||||||||
Sbjct: 119165 gcaaactctatgacaaaaatta 119144
to top
>gb|AC154394.6| Mus musculus chromosome 18, clone RP23-315M1, complete sequence
          Length = 246033

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 105    tatgacaaaaattatatttgca 126
              ||||||||||||||||||||||
Sbjct: 182763 tatgacaaaaattatatttgca 182784
to top
>gb|AC159901.2| Mus musculus BAC clone RP23-100I17 from chromosome 9, complete sequence
          Length = 200181

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 17     atgtatatcgcttcacattctt 38
              ||||||||||||||||||||||
Sbjct: 151192 atgtatatcgcttcacattctt 151213
to top
>gb|AC109222.14| Mus musculus chromosome 18, clone RP23-251L6, complete sequence
          Length = 201310

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 105  tatgacaaaaattatatttgca 126
            ||||||||||||||||||||||
Sbjct: 7488 tatgacaaaaattatatttgca 7509
to top
>gb|AY345016.1| Philine aperta cytochrome oxidase subunit I gene, partial cds; and
           tRNA-Val and large subunit ribosomal RNA genes, complete
           sequence; mitochondrial
          Length = 2434

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 259 tcacagcttttcttctccttct 280
           ||||||||||||||||||||||
Sbjct: 523 tcacagcttttcttctccttct 544
to top
>gb|AC161005.4| Pan troglodytes BAC clone CH251-668M6 from chromosome 7, complete
              sequence
          Length = 217746

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 103    tctatgacaaaaattatattt 123
              |||||||||||||||||||||
Sbjct: 147739 tctatgacaaaaattatattt 147719
to top
>emb|AL445586.6| Human DNA sequence from clone RP11-352F21 on chromosome 9, complete
             sequence
          Length = 198498

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 256   ttttcacagcttttcttctccttct 280
             ||||||||| |||||||||||||||
Sbjct: 56402 ttttcacaggttttcttctccttct 56378
to top
>ref|XM_683893.1| PREDICTED: Danio rerio similar to B230312I18Rik protein
           (LOC560487), mRNA
          Length = 1338

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 252 aaacttttcacagcttttctt 272
           |||||||||||||||||||||
Sbjct: 122 aaacttttcacagcttttctt 102
to top
>emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome
          Length = 2595221

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 414    ctccggcgtcggcaaaactcagacg 438
              |||||||||||||||||| ||||||
Sbjct: 355601 ctccggcgtcggcaaaacgcagacg 355577
to top
>gb|AF474373.1| Hordeum vulgare subsp. vulgare BAC 259I16, complete sequence
          Length = 124050

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 528   ctaaataattatagttgaaa 547
             ||||||||||||||||||||
Sbjct: 20318 ctaaataattatagttgaaa 20299
to top
>gb|AE017131.1| Yersinia pestis biovar Medievalis str. 91001 section 5 of 16 of the
              complete genome
          Length = 291847

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 48     catctctttcatgggatgac 67
              ||||||||||||||||||||
Sbjct: 139890 catctctttcatgggatgac 139871
to top
>gb|AC005142.2| Arabidopsis thaliana BAC T5L23 from chromosome IV, near 19 cM, complete
             sequence
          Length = 116448

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 257   tttcacagcttttcttctccttct 280
             ||||||| ||||||||||||||||
Sbjct: 19138 tttcacatcttttcttctccttct 19161
to top
>gb|AC116875.10| Mus musculus chromosome 8, clone RP24-426B21, complete sequence
          Length = 188938

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 468   aagggcatttatttagaaag 487
             ||||||||||||||||||||
Sbjct: 25899 aagggcatttatttagaaag 25918
to top
>gb|AC122941.3| Mus musculus BAC clone RP23-1E3 from chromosome 8, complete sequence
          Length = 244220

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 253    aacttttcacagcttttctt 272
              ||||||||||||||||||||
Sbjct: 233958 aacttttcacagcttttctt 233977
to top
>gb|AE009952.1| Yersinia pestis KIM, complete genome
          Length = 4600755

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 48      catctctttcatgggatgac 67
               ||||||||||||||||||||
Sbjct: 3072686 catctctttcatgggatgac 3072667
to top
>gb|DQ175857.1| Hordeum vulgare clone DsC28 Ds insertion site flanking region
           genomic sequence
          Length = 838

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 528 ctaaataattatagttgaaa 547
           ||||||||||||||||||||
Sbjct: 446 ctaaataattatagttgaaa 465
to top
>gb|DQ175832.1| Hordeum vulgare clone DsB30 Ds insertion site flanking region
           genomic sequence
          Length = 806

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 528 ctaaataattatagttgaaa 547
           ||||||||||||||||||||
Sbjct: 547 ctaaataattatagttgaaa 566
to top
>gb|DQ175829.1| Hordeum vulgare clone DsB25 Ds insertion site flanking region
           genomic sequence
          Length = 892

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 528 ctaaataattatagttgaaa 547
           ||||||||||||||||||||
Sbjct: 278 ctaaataattatagttgaaa 259
to top
>gb|AC135362.3| Mus musculus BAC clone RP23-286J13 from chromosome 8, complete sequence
          Length = 173357

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 253   aacttttcacagcttttctt 272
             ||||||||||||||||||||
Sbjct: 19515 aacttttcacagcttttctt 19496
to top
>gb|AC003088.2| Homo sapiens BAC clone CTB-119P24 from 7, complete sequence
          Length = 79204

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 523   tgtagctaaataattatagt 542
             ||||||||||||||||||||
Sbjct: 59828 tgtagctaaataattatagt 59847
to top
>gb|AC091297.3| Sus scrofa clone RP44-52N13, complete sequence
          Length = 142057

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 266    ttttcttctccttctattat 285
              ||||||||||||||||||||
Sbjct: 125273 ttttcttctccttctattat 125254
to top
>emb|Z98046.1|HS14O9 Human DNA sequence from clone RP1-14O9 on chromosome Xp11.1-11.4,
             complete sequence
          Length = 77781

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 267   tttcttctccttctattatt 286
             ||||||||||||||||||||
Sbjct: 15493 tttcttctccttctattatt 15512
to top
>emb|AL357127.17| Human DNA sequence from clone RP11-282I1 on chromosome 10 Contains the 3'
              end of a novel gene and a novel gene, complete sequence
          Length = 124343

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 192    cagtgtaattccttgcaagagaga 215
              ||||| ||||||||||||||||||
Sbjct: 114547 cagtggaattccttgcaagagaga 114570
to top
>emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, complete sequence
          Length = 4744671

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 48      catctctttcatgggatgac 67
               ||||||||||||||||||||
Sbjct: 1698670 catctctttcatgggatgac 1698689
to top
>emb|AL161497.2|ATCHRIV9 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 9
          Length = 159629

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 257   tttcacagcttttcttctccttct 280
             ||||||| ||||||||||||||||
Sbjct: 40415 tttcacatcttttcttctccttct 40438
to top
>emb|AJ010592.2|GTAJ10592 Guillardia theta DNA for complete sequence of nucleomorph chromosome 2
          Length = 180915

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 161    tcgcttgtgtgggacaacaa 180
              ||||||||||||||||||||
Sbjct: 159927 tcgcttgtgtgggacaacaa 159946
to top
>gb|AC010573.4| Drosophila melanogaster 3L BAC RP98-2M13 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 181927

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 106    atgacaaaaattatatttgc 125
              ||||||||||||||||||||
Sbjct: 107300 atgacaaaaattatatttgc 107281
to top
>gb|AC069457.5| Drosophila melanogaster 3L BAC RP98-16J19 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 160366

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 106   atgacaaaaattatatttgc 125
             ||||||||||||||||||||
Sbjct: 38500 atgacaaaaattatatttgc 38481
to top
>gb|AE010140.1| Pyrococcus furiosus DSM 3638, section 15 of 173 of the complete genome
          Length = 14818

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 267   tttcttctccttctattatt 286
             ||||||||||||||||||||
Sbjct: 14330 tttcttctccttctattatt 14349
to top
>gb|AY008692.1| Hordeum vulgare transcription factor GAMyb (Gamyb) gene, complete cds
          Length = 6228

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 514  tacttcctctgtagctaaataattatagttga 545
            |||||| ||| || ||||||||||||||||||
Sbjct: 3056 tacttcttctctacctaaataattatagttga 3025
to top
>emb|BX897665.7| Zebrafish DNA sequence from clone DKEY-27K7 in linkage group 4,
             complete sequence
          Length = 129995

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 266   ttttcttctccttctattat 285
             ||||||||||||||||||||
Sbjct: 22037 ttttcttctccttctattat 22056
to top
>emb|CT572999.10| Mouse DNA sequence from clone RP23-6C18 on chromosome 12, complete
              sequence
          Length = 176044

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 478    atttagaaagccaggcatag 497
              ||||||||||||||||||||
Sbjct: 109636 atttagaaagccaggcatag 109617
to top
>gb|AE003535.3| Drosophila melanogaster chromosome 3L, section 50 of 83 of the complete
             sequence
          Length = 278708

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 106   atgacaaaaattatatttgc 125
             ||||||||||||||||||||
Sbjct: 89897 atgacaaaaattatatttgc 89878
to top
>gb|AC115835.6| Mus musculus chromosome 3, clone RP24-184C18, complete sequence
          Length = 172025

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 138   aaaatctatagaactaaaag 157
             ||||||||||||||||||||
Sbjct: 29555 aaaatctatagaactaaaag 29574
to top
>emb|AJ414148.1| Yersinia pestis strain CO92 complete genome; segment 8/20
          Length = 210050

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 48    catctctttcatgggatgac 67
             ||||||||||||||||||||
Sbjct: 47052 catctctttcatgggatgac 47071
to top
>gb|AF071527.1| Arabidopsis thaliana BAC F9H3, from chromosome IV near 18.8 cM,
             complete sequence
          Length = 95519

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 257   tttcacagcttttcttctccttct 280
             ||||||| ||||||||||||||||
Sbjct: 12646 tttcacatcttttcttctccttct 12623
to top
>emb|AL672130.14| Mouse DNA sequence from clone RP24-74N4 on chromosome 2, complete
             sequence
          Length = 60892

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 226   caagagtgaagagatgtgca 245
             ||||||||||||||||||||
Sbjct: 27409 caagagtgaagagatgtgca 27428


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,250,047
Number of Sequences: 3902068
Number of extensions: 5250047
Number of successful extensions: 100613
Number of sequences better than 10.0: 39
Number of HSP's better than 10.0 without gapping: 39
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 100418
Number of HSP's gapped (non-prelim): 195
length of query: 581
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 558
effective length of database: 17,143,297,704
effective search space: 9565960118832
effective search space used: 9565960118832
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top