| Clone Name | rbasd2h06 |
|---|---|
| Clone Library Name | barley_pub |
>emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA Length = 705 Score = 569 bits (287), Expect = e-159 Identities = 295/299 (98%) Strand = Plus / Minus Query: 144 atatatatcccacatgaagataatatgagagcatttattcatatatatgtatgtatgtgt 203 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 520 atatatatcccacatgaagataatatgagagcatttattcatatatatgtatgtatgtgt 461 Query: 204 gacctcaacgtactcagcgtcgattgctggggctataggcagcaagtggttgatcagcga 263 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 460 gacctcaacgtactcagcgtcgattgctggggctataggcagcaagtggttgatcagcga 401 Query: 264 atcttanagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggag 323 |||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| Sbjct: 400 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 341 Query: 324 gggatgccggcggccttgccagcgtttagcccaccagcagcgctcttgatgcacttgcac 383 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 340 gggatgccggcggccttgccagcgtttagcccaccagcagcgctcttgatgcacttgcac 281 Query: 384 gccgcttgtttgtcannggtgctctgggcagcgccggccagtctcttgacgccgctgca 442 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Sbjct: 280 gccgcttgtttgtcagcggtgctctgggcagcgccggccagtctcttgacgccgctgca 222 Score = 240 bits (121), Expect = 3e-60 Identities = 121/121 (100%) Strand = Plus / Minus Query: 1 tgcacatggtacaaaatacaataaactcttgggtcccctcaaagggagtgaaggaacaac 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 663 tgcacatggtacaaaatacaataaactcttgggtcccctcaaagggagtgaaggaacaac 604 Query: 61 caaacatggatagaacagtatggccggccatgcagaactggctcaacatagatactccgt 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 603 caaacatggatagaacagtatggccggccatgcagaactggctcaacatagatactccgt 544 Query: 121 c 121 | Sbjct: 543 c 543
>emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene Length = 1567 Score = 468 bits (236), Expect = e-129 Identities = 281/296 (94%), Gaps = 1/296 (0%) Strand = Plus / Minus Query: 147 tatatcccacatgaagataatatgagagcatttattcatatatatgtatgtatgtgtgac 206 ||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| Sbjct: 1121 tatatcccacatgaagataatatt-gtgcatttattcatatatatgtatgtatgtgtgac 1063 Query: 207 ctcaacgtactcagcgtcgattgctggggctataggcagcaagtggttgatcagcgaatc 266 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 1062 ctcaacgtactcagcgtcgatcgctggggctataggcagcaagtggttgatcagcgaatc 1003 Query: 267 ttanagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggagggg 326 ||| ||||||| |||||||| ||||||||||| ||||||||||||||||||||||||||| Sbjct: 1002 ttagagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggagggg 943 Query: 327 atgccggcggccttgccagcgtttagcccaccagcagcgctcttgatgcacttgcacgcc 386 || ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 942 attccggcggccttgccagcgtttagcccacccgcagcgctcttgatgcacttgcacgcc 883 Query: 387 gcttgtttgtcannggtgctctgggcagcgccggccagtctcttgacgccgctgca 442 ||||| |||||| |||||||||||| |||||||||||||||||||| |||||||| Sbjct: 882 gcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacaccgctgca 827 Score = 170 bits (86), Expect = 2e-39 Identities = 104/110 (94%) Strand = Plus / Minus Query: 1 tgcacatggtacaaaatacaataaactcttgggtcccctcaaagggagtgaaggaacaac 60 |||||||| |||||| |||||||||||| | ||||||||||||||||||||||||||||| Sbjct: 1249 tgcacatgttacaaagtacaataaactcataggtcccctcaaagggagtgaaggaacaac 1190 Query: 61 caaacatggatagaacagtatggccggccatgcagaactggctcaacata 110 ||||||| ||||| |||||||||||||||||||||||||||||||||||| Sbjct: 1189 caaacatcgatagtacagtatggccggccatgcagaactggctcaacata 1140
>gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt4.9) gene, complete cds Length = 3238 Score = 468 bits (236), Expect = e-129 Identities = 281/296 (94%), Gaps = 1/296 (0%) Strand = Plus / Minus Query: 147 tatatcccacatgaagataatatgagagcatttattcatatatatgtatgtatgtgtgac 206 ||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| Sbjct: 2517 tatatcccacatgaagataatatt-gtgcatttattcatatatatgtatgtatgtgtgac 2459 Query: 207 ctcaacgtactcagcgtcgattgctggggctataggcagcaagtggttgatcagcgaatc 266 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 2458 ctcaacgtactcagcgtcgatcgctggggctataggcagcaagtggttgatcagcgaatc 2399 Query: 267 ttanagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggagggg 326 ||| ||||||| |||||||| ||||||||||| ||||||||||||||||||||||||||| Sbjct: 2398 ttagagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggagggg 2339 Query: 327 atgccggcggccttgccagcgtttagcccaccagcagcgctcttgatgcacttgcacgcc 386 || ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 2338 attccggcggccttgccagcgtttagcccacccgcagcgctcttgatgcacttgcacgcc 2279 Query: 387 gcttgtttgtcannggtgctctgggcagcgccggccagtctcttgacgccgctgca 442 ||||| |||||| |||||||||||| |||||||||||||||||||| |||||||| Sbjct: 2278 gcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacaccgctgca 2223 Score = 170 bits (86), Expect = 2e-39 Identities = 104/110 (94%) Strand = Plus / Minus Query: 1 tgcacatggtacaaaatacaataaactcttgggtcccctcaaagggagtgaaggaacaac 60 |||||||| |||||| |||||||||||| | ||||||||||||||||||||||||||||| Sbjct: 2645 tgcacatgttacaaagtacaataaactcataggtcccctcaaagggagtgaaggaacaac 2586 Query: 61 caaacatggatagaacagtatggccggccatgcagaactggctcaacata 110 ||||||| ||||| |||||||||||||||||||||||||||||||||||| Sbjct: 2585 caaacatcgatagtacagtatggccggccatgcagaactggctcaacata 2536
>emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene Length = 1862 Score = 333 bits (168), Expect = 3e-88 Identities = 191/200 (95%) Strand = Plus / Minus Query: 243 cagcaagtggttgatcagcgaatcttanagcagtcgacggaagcgctgatggcgtanggg 302 ||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| ||| Sbjct: 1391 cagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggg 1332 Query: 303 acgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagcccaccagca 362 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| Sbjct: 1331 acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 1272 Query: 363 gcgctcttgatgcacttgcacgccgcttgtttgtcannggtgctctgggcagcgccggcc 422 ||||||||||||||||||||||||||||| |||||| |||||||||||| ||||||||| Sbjct: 1271 gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 1212 Query: 423 agtctcttgacgccgctgca 442 |||||||||||||||||||| Sbjct: 1211 agtctcttgacgccgctgca 1192 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/55 (90%), Gaps = 2/55 (3%) Strand = Plus / Minus Query: 151 tcccacatgaagataatat--gagagcatttattcatatatatgtatgtatgtgt 203 ||||||||| ||||||||| |||||||||||||||||||||||| ||| ||||| Sbjct: 1514 tcccacatggagataatatatgagagcatttattcatatatatgtgtgtgtgtgt 1460 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 83 gccggccatgcagaactggctcaac 107 |||||||||||||| |||||||||| Sbjct: 1566 gccggccatgcagagctggctcaac 1542 Score = 40.1 bits (20), Expect = 5.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 1 tgcacatggtacaaaatacaataaactc 28 ||||||||||||||| ||||| |||||| Sbjct: 1647 tgcacatggtacaaagtacaacaaactc 1620
>emb|Z37115.1|HVLTPPB H.vulgare (clone pKG285) mRNA for lipid transfer protein precursor Length = 691 Score = 325 bits (164), Expect = 7e-86 Identities = 190/200 (95%) Strand = Plus / Minus Query: 243 cagcaagtggttgatcagcgaatcttanagcagtcgacggaagcgctgatggcgtanggg 302 ||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| ||| Sbjct: 376 cagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggg 317 Query: 303 acgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagcccaccagca 362 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 316 acgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagcccacccgca 257 Query: 363 gcgctcttgatgcacttgcacgccgcttgtttgtcannggtgctctgggcagcgccggcc 422 ||||||||||||||||||||||||||||| |||||| ||||||||| || ||||||||| Sbjct: 256 gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgcgctgcgccggcc 197 Query: 423 agtctcttgacgccgctgca 442 | |||||||||||||||||| Sbjct: 196 aatctcttgacgccgctgca 177 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/56 (91%), Gaps = 2/56 (3%) Strand = Plus / Minus Query: 151 tcccacatgaagataatat--gagagcatttattcatatatatgtatgtatgtgtg 204 ||||||||| ||||||||| |||||||||||||||||||||||| ||| |||||| Sbjct: 512 tcccacatggagataatatatgagagcatttattcatatatatgtgtgtgtgtgtg 457 Score = 44.1 bits (22), Expect = 0.38 Identities = 31/34 (91%) Strand = Plus / Minus Query: 216 ctcagcgtcgattgctggggctataggcagcaag 249 |||||| ||||| ||||| ||||||||||||||| Sbjct: 415 ctcagcatcgatagctggagctataggcagcaag 382 Score = 40.1 bits (20), Expect = 5.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 1 tgcacatggtacaaaatacaataaactc 28 ||||||||||||||| ||||| |||||| Sbjct: 645 tgcacatggtacaaagtacaacaaactc 618 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 205 acctcaacgtactcagcgtc 224 |||||||||||||||||||| Sbjct: 434 acctcaacgtactcagcgtc 415
>gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer protein precursor gene, complete cds Length = 573 Score = 274 bits (138), Expect = 2e-70 Identities = 185/202 (91%) Strand = Plus / Minus Query: 241 ggcagcaagtggttgatcagcgaatcttanagcagtcgacggaagcgctgatggcgtang 300 ||||||||||||| |||||| |||||||| ||||||||||||||| |||||||| ||| | Sbjct: 449 ggcagcaagtggtcgatcagtgaatcttagagcagtcgacggaagtgctgatggagtagg 390 Query: 301 ggacgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagcccaccag 360 ||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| | | Sbjct: 389 ggacgctgacgccgcacttggaggggatgccggcggccttgccagcgtttaacccagcgg 330 Query: 361 cagcgctcttgatgcacttgcacgccgcttgtttgtcannggtgctctgggcagcgccgg 420 ||||||||||||||||||||||| ||||||| |||||| ||||||||| || ||||||| Sbjct: 329 cagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctctgcgctgcgccgg 270 Query: 421 ccagtctcttgacgccgctgca 442 ||| |||||||||||||||||| Sbjct: 269 ccaatctcttgacgccgctgca 248 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 166 atatgagagcatttattcatatatatgtatgtatgtgtg 204 |||||||| ||||||||||||||||||| ||| |||||| Sbjct: 564 atatgagatcatttattcatatatatgtgtgtgtgtgtg 526 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 205 acctcaacgtactcagcgtc 224 |||||||||||||||||||| Sbjct: 505 acctcaacgtactcagcgtc 486
>emb|AJ784903.1| Triticum turgidum subsp. durum partial mRNA for type 1 non-specific lipid transfer protein precursor (ltp9.2 gene) Length = 604 Score = 226 bits (114), Expect = 5e-56 Identities = 179/202 (88%) Strand = Plus / Minus Query: 241 ggcagcaagtggttgatcagcgaatcttanagcagtcgacggaagcgctgatggcgtang 300 ||||||||||| | ||||||||||||||| |||||||||| |||| |||||||||||| | Sbjct: 329 ggcagcaagtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgtaag 270 Query: 301 ggacgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagcccaccag 360 ||||||| ||||||||| | | ||||||||||||||||||||||||||| |||||| ||| Sbjct: 269 ggacgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcccagcag 210 Query: 361 cagcgctcttgatgcacttgcacgccgcttgtttgtcannggtgctctgggcagcgccgg 420 ||||||||||||||||||||||||||||||| |||||| ||||||| |||| | || || Sbjct: 209 cagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctccgggctgagctgg 150 Query: 421 ccagtctcttgacgccgctgca 442 | || ||| | ||||||||||| Sbjct: 149 ctagactcctaacgccgctgca 128 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 44 gggagtgaaggaacaaccaaacatggatagaacagtatggccggccatgcaga 96 ||||||| | |||||||||||||| |||| |||||| |||||||||||||||| Sbjct: 535 gggagtggaagaacaaccaaacatcgatacaacagtgtggccggccatgcaga 483 Score = 61.9 bits (31), Expect = 2e-06 Identities = 31/31 (100%) Strand = Plus / Minus Query: 161 agataatatgagagcatttattcatatatat 191 ||||||||||||||||||||||||||||||| Sbjct: 442 agataatatgagagcatttattcatatatat 412
>emb|AJ852555.1| Triticum aestivum ltp9.2c gene for type 1 non specific lipid transfer protein precursor Length = 2122 Score = 226 bits (114), Expect = 5e-56 Identities = 179/202 (88%) Strand = Plus / Minus Query: 241 ggcagcaagtggttgatcagcgaatcttanagcagtcgacggaagcgctgatggcgtang 300 ||||||||||| | ||||||||||||||| |||||||||| |||| |||||||||||| | Sbjct: 1633 ggcagcaagtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgtagg 1574 Query: 301 ggacgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagcccaccag 360 ||||||| ||||||||| | | ||||||||||||||||||||||||||| |||||| ||| Sbjct: 1573 ggacgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcccagcag 1514 Query: 361 cagcgctcttgatgcacttgcacgccgcttgtttgtcannggtgctctgggcagcgccgg 420 ||||||||||||||||||||||||||||||| |||||| ||||||| |||| | || || Sbjct: 1513 cagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctccgggctgagctgg 1454 Query: 421 ccagtctcttgacgccgctgca 442 | || ||| | ||||||||||| Sbjct: 1453 ctagactcctaacgccgctgca 1432 Score = 73.8 bits (37), Expect = 4e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 44 gggagtgaaggaacaaccaaacatggatagaacagtatggccggccatgcaga 96 ||||||| |||||||||||||||| |||| |||||| |||||||||||||||| Sbjct: 1838 gggagtggaggaacaaccaaacatcgatacaacagtgtggccggccatgcaga 1786 Score = 54.0 bits (27), Expect = 4e-04 Identities = 30/31 (96%) Strand = Plus / Minus Query: 161 agataatatgagagcatttattcatatatat 191 |||||||||||||||||||||||||| |||| Sbjct: 1750 agataatatgagagcatttattcataaatat 1720
>emb|AJ784901.1| Triticum aestivum mRNA for type 1 non-specific lipid transfer protein precursor (ltp9.2 gene) Length = 708 Score = 202 bits (102), Expect = 7e-49 Identities = 176/202 (87%) Strand = Plus / Minus Query: 241 ggcagcaagtggttgatcagcgaatcttanagcagtcgacggaagcgctgatggcgtang 300 ||||||| ||| | ||||||||||||||| |||||||||| |||| |||||||||||| | Sbjct: 430 ggcagcatgtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgtagg 371 Query: 301 ggacgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagcccaccag 360 ||| ||| ||||||||| | | ||||||||||||||||||||||||||| |||||| ||| Sbjct: 370 ggatgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcccagcag 311 Query: 361 cagcgctcttgatgcacttgcacgccgcttgtttgtcannggtgctctgggcagcgccgg 420 ||||||||||||| ||||||||||||||||| |||||| ||||||| |||| | || || Sbjct: 310 cagcgctcttgatacacttgcacgccgcttgcttgtcagcggtgctccgggctgagctgg 251 Query: 421 ccagtctcttgacgccgctgca 442 | || ||| | ||||||||||| Sbjct: 250 ctagactcctaacgccgctgca 229 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 44 gggagtgaaggaacaaccaaacatggatagaacagtatggccggccatgcaga 96 ||||||| | |||||||||||||| |||| |||||| |||||||||||||||| Sbjct: 638 gggagtggaagaacaaccaaacatcgatacaacagtgtggccggccatgcaga 586 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 166 atatgagagcatttattcatatatat 191 |||||||||||||||||||||||||| Sbjct: 540 atatgagagcatttattcatatatat 515
>emb|AJ852556.1| Triticum aestivum ltp9.2d gene for type 1 non specific lipid transfer protein precursor Length = 2087 Score = 202 bits (102), Expect = 7e-49 Identities = 176/202 (87%) Strand = Plus / Minus Query: 241 ggcagcaagtggttgatcagcgaatcttanagcagtcgacggaagcgctgatggcgtang 300 ||||||||||| | |||||| |||||||| |||||||||| |||| |||||||||||| | Sbjct: 1621 ggcagcaagtgctcgatcagtgaatcttagagcagtcgaccgaagagctgatggcgtagg 1562 Query: 301 ggacgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagcccaccag 360 ||||||| ||||||||| | | |||||||||||||||||||||||| || |||||| ||| Sbjct: 1561 ggacgctaacgccgcactttgtggggatgccggcggccttgccagcattgagcccagcag 1502 Query: 361 cagcgctcttgatgcacttgcacgccgcttgtttgtcannggtgctctgggcagcgccgg 420 ||||||||||||||||||||||| ||||||| |||||| ||||||| |||| | || || Sbjct: 1501 cagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctccgggctgagctgg 1442 Query: 421 ccagtctcttgacgccgctgca 442 | || ||| | ||||||||||| Sbjct: 1441 ctagactcctaacgccgctgca 1420 Score = 73.8 bits (37), Expect = 4e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 44 gggagtgaaggaacaaccaaacatggatagaacagtatggccggccatgcaga 96 ||||||| |||||||||||||||| |||| |||||| |||||||||||||||| Sbjct: 1826 gggagtggaggaacaaccaaacatcgatataacagtgtggccggccatgcaga 1774 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 161 agataatatgagagcatttattcatatatatgtatgtatgtg 202 ||||||||||||||||||||||||||||||||| ||| |||| Sbjct: 1738 agataatatgagagcatttattcatatatatgtgtgtgtgtg 1697
>gb|DQ465676.1| Triticum aestivum clone Lt10F9 non-specific lipid transfer protein 1 precursor, mRNA, complete cds Length = 348 Score = 194 bits (98), Expect = 2e-46 Identities = 163/186 (87%) Strand = Plus / Minus Query: 257 tcagcgaatcttanagcagtcgacggaagcgctgatggcgtangggacgctgacgccgca 316 ||||||||||||| |||||||||| |||| |||||||||||| |||||||| |||||||| Sbjct: 348 tcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgca 289 Query: 317 catggaggggatgccggcggccttgccagcgtttagcccaccagcagcgctcttgatgca 376 | | | ||||||||| ||||||||||||||||| |||||| |||||||||||||||| || Sbjct: 288 ctttgtggggatgcccgcggccttgccagcgttgagcccagcagcagcgctcttgataca 229 Query: 377 cttgcacgccgcttgtttgtcannggtgctctgggcagcgccggccagtctcttgacgcc 436 ||||||||||||||| |||||| ||||||| |||| | || ||| || ||| | ||||| Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacgcc 169 Query: 437 gctgca 442 |||||| Sbjct: 168 gctgca 163
>gb|DQ465678.1| Triticum aestivum clone Lt10E10 non-specific lipid transfer protein 1 precursor, mRNA, complete cds Length = 348 Score = 194 bits (98), Expect = 2e-46 Identities = 163/186 (87%) Strand = Plus / Minus Query: 257 tcagcgaatcttanagcagtcgacggaagcgctgatggcgtangggacgctgacgccgca 316 ||||||||||||| |||||||||| |||| |||||||||||| |||||||| |||||||| Sbjct: 348 tcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgca 289 Query: 317 catggaggggatgccggcggccttgccagcgtttagcccaccagcagcgctcttgatgca 376 | | | ||||||||| ||||||||||||||||| |||||| |||||||||||||||| || Sbjct: 288 ctttgtggggatgcccgcggccttgccagcgttgagcccagcagcagcgctcttgataca 229 Query: 377 cttgcacgccgcttgtttgtcannggtgctctgggcagcgccggccagtctcttgacgcc 436 ||||||||||||||| |||||| ||||||| |||| | || ||| || ||| | ||||| Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacgcc 169 Query: 437 gctgca 442 |||||| Sbjct: 168 gctgca 163
>gb|DQ465679.1| Triticum aestivum clone Lt19C10 non-specific lipid transfer protein 1 precursor, mRNA, complete cds Length = 348 Score = 194 bits (98), Expect = 2e-46 Identities = 163/186 (87%) Strand = Plus / Minus Query: 257 tcagcgaatcttanagcagtcgacggaagcgctgatggcgtangggacgctgacgccgca 316 ||||||||||||| ||||||| ||||| | ||| |||||||| |||| |||||||||||| Sbjct: 348 tcagcgaatcttagagcagtccacggatgagctaatggcgtaggggatgctgacgccgca 289 Query: 317 catggaggggatgccggcggccttgccagcgtttagcccaccagcagcgctcttgatgca 376 | ||||||||||||| |||||||| |||||||| |||||||||||||| ||||| ||||| Sbjct: 288 cttggaggggatgcctgcggcctttccagcgttgagcccaccagcagcactcttaatgca 229 Query: 377 cttgcacgccgcttgtttgtcannggtgctctgggcagcgccggccagtctcttgacgcc 436 ||||||||||||||| |||||| ||||||| | || ||||||||||| ||| |||| || Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgcgctgcgccggccagactcctgacacc 169 Query: 437 gctgca 442 ||||| Sbjct: 168 actgca 163
>gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) gene, complete cds Length = 3448 Score = 113 bits (57), Expect = 5e-22 Identities = 121/143 (84%) Strand = Plus / Minus Query: 255 gatcagcgaatcttanagcagtcgacggaagcgctgatggcgtangggacgctgacgccg 314 |||||| | |||||| ||||||| ||||| |||||||||| ||| |||| |||||||||| Sbjct: 3206 gatcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccg 3147 Query: 315 cacatggaggggatgccggcggccttgccagcgtttagcccaccagcagcgctcttgatg 374 ||| |||||||||| | || ||||| || | ||| |||||||| ||||| ||||||||| Sbjct: 3146 cacttggaggggatacttgcagcctttccggggttgagcccaccggcagcactcttgatg 3087 Query: 375 cacttgcacgccgcttgtttgtc 397 ||| |||| |||||||| ||||| Sbjct: 3086 cacctgcatgccgcttgcttgtc 3064 Score = 50.1 bits (25), Expect = 0.006 Identities = 49/57 (85%) Strand = Plus / Minus Query: 184 atatatatgtatgtatgtgtgacctcaacgtactcagcgtcgattgctggggctata 240 |||||||| | ||| |||||||||||||||||||| || || || ||||| |||||| Sbjct: 3289 atatatatatgtgtgtgtgtgacctcaacgtactcggcatctatcgctggagctata 3233 Score = 48.1 bits (24), Expect = 0.024 Identities = 36/40 (90%) Strand = Plus / Minus Query: 154 cacatgaagataatatgagagcatttattcatatatatgt 193 |||||| |||| |||| ||||||||||||||| ||||||| Sbjct: 3339 cacatggagatcatatcagagcatttattcatgtatatgt 3300 Score = 40.1 bits (20), Expect = 5.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 38 ctcaaagggagtgaaggaacaaccaaac 65 ||||||||||||||| |||||| ||||| Sbjct: 3436 ctcaaagggagtgaacgaacaatcaaac 3409
>gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein precursor (LTP1) mRNA, complete cds Length = 737 Score = 113 bits (57), Expect = 5e-22 Identities = 121/143 (84%) Strand = Plus / Minus Query: 255 gatcagcgaatcttanagcagtcgacggaagcgctgatggcgtangggacgctgacgccg 314 |||||| | |||||| ||||||| ||||| |||||||||| ||| |||| |||||||||| Sbjct: 410 gatcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccg 351 Query: 315 cacatggaggggatgccggcggccttgccagcgtttagcccaccagcagcgctcttgatg 374 ||| |||||||||| | || ||||| || | ||| |||||||| ||||| ||||||||| Sbjct: 350 cacttggaggggatacttgcagcctttccggggttgagcccaccggcagcactcttgatg 291 Query: 375 cacttgcacgccgcttgtttgtc 397 ||| |||| |||||||| ||||| Sbjct: 290 cacctgcatgccgcttgcttgtc 268 Score = 50.1 bits (25), Expect = 0.006 Identities = 55/65 (84%) Strand = Plus / Minus Query: 1 tgcacatggtacaaaatacaataaactcttgggtcccctcaaagggagtgaaggaacaac 60 ||||||||||||||| ||||| |||||| | || ||||||||||||||| |||||| Sbjct: 677 tgcacatggtacaaagtacaacaaactcccgtctctgctcaaagggagtgaacgaacaat 618 Query: 61 caaac 65 ||||| Sbjct: 617 caaac 613 Score = 50.1 bits (25), Expect = 0.006 Identities = 49/57 (85%) Strand = Plus / Minus Query: 184 atatatatgtatgtatgtgtgacctcaacgtactcagcgtcgattgctggggctata 240 |||||||| | ||| |||||||||||||||||||| || || || ||||| |||||| Sbjct: 493 atatatatatgtgtgtgtgtgacctcaacgtactcggcatctatcgctggagctata 437 Score = 48.1 bits (24), Expect = 0.024 Identities = 36/40 (90%) Strand = Plus / Minus Query: 154 cacatgaagataatatgagagcatttattcatatatatgt 193 |||||| |||| |||| ||||||||||||||| ||||||| Sbjct: 543 cacatggagatcatatcagagcatttattcatgtatatgt 504
>gb|AY796184.1| Triticum aestivum lipid transfer protein (LTP1) mRNA, complete cds Length = 348 Score = 111 bits (56), Expect = 2e-21 Identities = 114/134 (85%) Strand = Plus / Minus Query: 264 atcttanagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggag 323 |||||| ||||||| ||||| |||||||||| ||| |||| ||||||||||||| ||||| Sbjct: 341 atcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccgcacttggag 282 Query: 324 gggatgccggcggccttgccagcgtttagcccaccagcagcgctcttgatgcacttgcac 383 ||||| | || ||||| || | ||| |||||||| ||||| |||||||||||| |||| Sbjct: 281 gggatacttgcagcctttccggggttgagcccaccggcagcactcttgatgcacctgcat 222 Query: 384 gccgcttgtttgtc 397 |||||||| ||||| Sbjct: 221 gccgcttgcttgtc 208
>emb|X68656.1|HVCW19 H.vulgare Cw-19 mRNA Length = 660 Score = 111 bits (56), Expect = 2e-21 Identities = 72/78 (92%) Strand = Plus / Minus Query: 365 gctcttgatgcacttgcacgccgcttgtttgtcannggtgctctgggcagcgccggccag 424 |||||||| |||| ||||||||||||| |||||| |||||||||||| ||||||||||| Sbjct: 285 gctcttgaggcacctgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccag 226 Query: 425 tctcttgacgccgctgca 442 |||||||||||||||||| Sbjct: 225 tctcttgacgccgctgca 208
>emb|X56547.1|HSBLT4 H. vulgare BLT4 mRNA Length = 724 Score = 111 bits (56), Expect = 2e-21 Identities = 151/183 (82%), Gaps = 4/183 (2%) Strand = Plus / Minus Query: 171 agagcatttattcatatatatgtatgtatgtgt----gacctcaacgtactcagcgtcga 226 |||| |||||||||| ||||||||| ||||||| ||||||||| ||| |||||||| Sbjct: 508 agaggatttattcatgtatatgtatatatgtgtatgtgacctcaacctaccaagcgtcga 449 Query: 227 ttgctggggctataggcagcaagtggttgatcagcgaatcttanagcagtcgacggaagc 286 | ||||| | ||| || |||| ||| | |||||| | |||||| |||||||||| || Sbjct: 448 tcgctggagatatggggagcacgtgttcgatcagtggatcttagagcagtcgacactggc 389 Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||| | ||| |||||||||||||||||| ||||||||||||| |||||| |||| || Sbjct: 388 gctgatcgtgtaggggacgctgacgccgcacctggaggggatgcctgcggccctgccggc 329 Query: 347 gtt 349 ||| Sbjct: 328 gtt 326
>gb|AC135561.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0086N07 map S790A, complete sequence Length = 178523 Score = 107 bits (54), Expect = 3e-20 Identities = 77/85 (90%) Strand = Plus / Plus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 ||||||||| |||||||||||||| ||| |||||||||||||||||| |||||||||||| Sbjct: 94024 agcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatgc 94083 Query: 331 cggcggccttgccagcgtttagccc 355 |||||| ||||| ||||| ||||| Sbjct: 94084 tggcggcgttgccggcgttgagccc 94108
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 107 bits (54), Expect = 3e-20 Identities = 77/85 (90%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 ||||||||| |||||||||||||| ||| |||||||||||||||||| |||||||||||| Sbjct: 736742 agcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatgc 736683 Query: 331 cggcggccttgccagcgtttagccc 355 |||||| ||||| ||||| ||||| Sbjct: 736682 tggcggcgttgccggcgttgagccc 736658 Score = 79.8 bits (40), Expect = 7e-12 Identities = 69/79 (87%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||||| Sbjct: 732615 agcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatgc 732556 Query: 331 cggcggccttgccagcgtt 349 |||||| ||||| ||||| Sbjct: 732555 tggcggcattgccggcgtt 732537 Score = 67.9 bits (34), Expect = 3e-08 Identities = 57/65 (87%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 |||||||| ||||| |||||| ||||| |||| | ||||||||||| |||||||||||| Sbjct: 722726 agcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatgc 722667 Query: 331 cggcg 335 ||||| Sbjct: 722666 cggcg 722662 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 185 tatatatgtatgtatgtgtg 204 |||||||||||||||||||| Sbjct: 9389648 tatatatgtatgtatgtgtg 9389667 Score = 40.1 bits (20), Expect = 5.9 Identities = 32/36 (88%) Strand = Plus / Minus Query: 302 gacgctgacgccgcacatggaggggatgccggcggc 337 |||| ||||||||||| || ||||||||||||||| Sbjct: 745555 gacgttgacgccgcacttgccggggatgccggcggc 745520
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 107 bits (54), Expect = 3e-20 Identities = 77/85 (90%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 ||||||||| |||||||||||||| ||| |||||||||||||||||| |||||||||||| Sbjct: 13090056 agcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatgc 13089997 Query: 331 cggcggccttgccagcgtttagccc 355 |||||| ||||| ||||| ||||| Sbjct: 13089996 tggcggcgttgccggcgttgagccc 13089972 Score = 99.6 bits (50), Expect = 7e-18 Identities = 76/85 (89%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 ||||||||| |||||||||||||| ||| |||||||||||||||||| | |||||||||| Sbjct: 702440 agcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatgc 702381 Query: 331 cggcggccttgccagcgtttagccc 355 |||||| ||||| ||||| ||||| Sbjct: 702380 tggcggcgttgccggcgttgagccc 702356 Score = 79.8 bits (40), Expect = 7e-12 Identities = 69/79 (87%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||||| Sbjct: 692763 agcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatgc 692704 Query: 331 cggcggccttgccagcgtt 349 |||||| ||||| ||||| Sbjct: 692703 tggcggcattgccggcgtt 692685 Score = 67.9 bits (34), Expect = 3e-08 Identities = 57/65 (87%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 |||||||| ||||| |||||||||||| |||| | ||||| ||||| |||||||||||| Sbjct: 679468 agcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatgc 679409 Query: 331 cggcg 335 ||||| Sbjct: 679408 cggcg 679404 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 atatatatgtatgtatgtgtg 204 ||||||||||||||||||||| Sbjct: 2482379 atatatatgtatgtatgtgtg 2482399 Score = 40.1 bits (20), Expect = 5.9 Identities = 32/36 (88%) Strand = Plus / Minus Query: 302 gacgctgacgccgcacatggaggggatgccggcggc 337 |||| ||||||||||| || ||||||||||||||| Sbjct: 714845 gacgttgacgccgcacttgccggggatgccggcggc 714810
>emb|X83435.1|OSLTPA15 O.sativa mRNA for lipid transfer protein, a15 Length = 511 Score = 107 bits (54), Expect = 3e-20 Identities = 77/85 (90%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 ||||||||| |||||||||||||| ||| |||||||||||||||||| |||||||||||| Sbjct: 412 agcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatgc 353 Query: 331 cggcggccttgccagcgtttagccc 355 |||||| ||||| ||||| ||||| Sbjct: 352 tggcggcgttgccggcgttgagccc 328
>dbj|AK071260.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086A05, full insert sequence Length = 843 Score = 107 bits (54), Expect = 3e-20 Identities = 77/85 (90%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 ||||||||| |||||||||||||| ||| |||||||||||||||||| |||||||||||| Sbjct: 456 agcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatgc 397 Query: 331 cggcggccttgccagcgtttagccc 355 |||||| ||||| ||||| ||||| Sbjct: 396 tggcggcgttgccggcgttgagccc 372
>dbj|AK061288.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-H12, full insert sequence Length = 846 Score = 107 bits (54), Expect = 3e-20 Identities = 77/85 (90%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 ||||||||| |||||||||||||| ||| |||||||||||||||||| |||||||||||| Sbjct: 455 agcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatgc 396 Query: 331 cggcggccttgccagcgtttagccc 355 |||||| ||||| ||||| ||||| Sbjct: 395 tggcggcgttgccggcgttgagccc 371
>dbj|AK059808.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-A04, full insert sequence Length = 995 Score = 107 bits (54), Expect = 3e-20 Identities = 77/85 (90%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 ||||||||| |||||||||||||| ||| |||||||||||||||||| |||||||||||| Sbjct: 669 agcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatgc 610 Query: 331 cggcggccttgccagcgtttagccc 355 |||||| ||||| ||||| ||||| Sbjct: 609 tggcggcgttgccggcgttgagccc 585
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 107 bits (54), Expect = 3e-20 Identities = 77/85 (90%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 ||||||||| |||||||||||||| ||| |||||||||||||||||| |||||||||||| Sbjct: 13170235 agcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatgc 13170176 Query: 331 cggcggccttgccagcgtttagccc 355 |||||| ||||| ||||| ||||| Sbjct: 13170175 tggcggcgttgccggcgttgagccc 13170151 Score = 99.6 bits (50), Expect = 7e-18 Identities = 76/85 (89%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 ||||||||| |||||||||||||| ||| |||||||||||||||||| | |||||||||| Sbjct: 702440 agcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatgc 702381 Query: 331 cggcggccttgccagcgtttagccc 355 |||||| ||||| ||||| ||||| Sbjct: 702380 tggcggcgttgccggcgttgagccc 702356 Score = 79.8 bits (40), Expect = 7e-12 Identities = 69/79 (87%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||||| Sbjct: 692763 agcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatgc 692704 Query: 331 cggcggccttgccagcgtt 349 |||||| ||||| ||||| Sbjct: 692703 tggcggcattgccggcgtt 692685 Score = 67.9 bits (34), Expect = 3e-08 Identities = 57/65 (87%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 |||||||| ||||| |||||||||||| |||| | ||||| ||||| |||||||||||| Sbjct: 679468 agcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatgc 679409 Query: 331 cggcg 335 ||||| Sbjct: 679408 cggcg 679404 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 atatatatgtatgtatgtgtg 204 ||||||||||||||||||||| Sbjct: 2491453 atatatatgtatgtatgtgtg 2491473 Score = 40.1 bits (20), Expect = 5.9 Identities = 32/36 (88%) Strand = Plus / Minus Query: 302 gacgctgacgccgcacatggaggggatgccggcggc 337 |||| ||||||||||| || ||||||||||||||| Sbjct: 714845 gacgttgacgccgcacttgccggggatgccggcggc 714810
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 107 bits (54), Expect = 3e-20 Identities = 77/85 (90%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 ||||||||| |||||||||||||| ||| |||||||||||||||||| |||||||||||| Sbjct: 736742 agcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatgc 736683 Query: 331 cggcggccttgccagcgtttagccc 355 |||||| ||||| ||||| ||||| Sbjct: 736682 tggcggcgttgccggcgttgagccc 736658 Score = 79.8 bits (40), Expect = 7e-12 Identities = 69/79 (87%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||||| Sbjct: 732615 agcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatgc 732556 Query: 331 cggcggccttgccagcgtt 349 |||||| ||||| ||||| Sbjct: 732555 tggcggcattgccggcgtt 732537 Score = 67.9 bits (34), Expect = 3e-08 Identities = 57/65 (87%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 |||||||| ||||| |||||| ||||| |||| | ||||||||||| |||||||||||| Sbjct: 722726 agcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatgc 722667 Query: 331 cggcg 335 ||||| Sbjct: 722666 cggcg 722662 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 185 tatatatgtatgtatgtgtg 204 |||||||||||||||||||| Sbjct: 9389533 tatatatgtatgtatgtgtg 9389552 Score = 40.1 bits (20), Expect = 5.9 Identities = 32/36 (88%) Strand = Plus / Minus Query: 302 gacgctgacgccgcacatggaggggatgccggcggc 337 |||| ||||||||||| || ||||||||||||||| Sbjct: 745555 gacgttgacgccgcacttgccggggatgccggcggc 745520
>emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136_E08 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 118211 Score = 107 bits (54), Expect = 3e-20 Identities = 77/85 (90%) Strand = Plus / Plus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 ||||||||| |||||||||||||| ||| |||||||||||||||||| |||||||||||| Sbjct: 42392 agcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatgc 42451 Query: 331 cggcggccttgccagcgtttagccc 355 |||||| ||||| ||||| ||||| Sbjct: 42452 tggcggcgttgccggcgttgagccc 42476 Score = 79.8 bits (40), Expect = 7e-12 Identities = 69/79 (87%) Strand = Plus / Plus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||||| Sbjct: 46519 agcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatgc 46578 Query: 331 cggcggccttgccagcgtt 349 |||||| ||||| ||||| Sbjct: 46579 tggcggcattgccggcgtt 46597 Score = 67.9 bits (34), Expect = 3e-08 Identities = 57/65 (87%) Strand = Plus / Plus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 |||||||| ||||| |||||| ||||| |||| | ||||||||||| |||||||||||| Sbjct: 56408 agcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatgc 56467 Query: 331 cggcg 335 ||||| Sbjct: 56468 cggcg 56472 Score = 40.1 bits (20), Expect = 5.9 Identities = 32/36 (88%) Strand = Plus / Plus Query: 302 gacgctgacgccgcacatggaggggatgccggcggc 337 |||| ||||||||||| || ||||||||||||||| Sbjct: 33579 gacgttgacgccgcacttgccggggatgccggcggc 33614
>gb|DQ465677.1| Triticum aestivum clone Lt10B6 non-specific lipid transfer protein 1 precursor, mRNA, complete cds Length = 348 Score = 103 bits (52), Expect = 5e-19 Identities = 113/134 (84%) Strand = Plus / Minus Query: 264 atcttanagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggag 323 |||||| |||| || ||||| |||||||||| ||| |||| ||||||||||||| ||||| Sbjct: 341 atcttagagcaatccacggatgcgctgatggagtaggggatgctgacgccgcacttggag 282 Query: 324 gggatgccggcggccttgccagcgtttagcccaccagcagcgctcttgatgcacttgcac 383 ||||| | || ||||| || | ||| |||||||| ||||| |||||||||||| |||| Sbjct: 281 gggatacttgcagcctttccggggttgagcccaccggcagcactcttgatgcacctgcat 222 Query: 384 gccgcttgtttgtc 397 |||||||| ||||| Sbjct: 221 gccgcttgcttgtc 208
>gb|AY335485.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LT1 mRNA, complete cds Length = 530 Score = 99.6 bits (50), Expect = 7e-18 Identities = 76/85 (89%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 ||||||||| |||||||||||||| ||| |||||||||||||||||| | |||||||||| Sbjct: 425 agcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatgc 366 Query: 331 cggcggccttgccagcgtttagccc 355 |||||| ||||| ||||| ||||| Sbjct: 365 tggcggcgttgccggcgttgagccc 341
>emb|Y08691.1|OSLPI O.sativa mRNA for lipid transfer protein Length = 799 Score = 99.6 bits (50), Expect = 7e-18 Identities = 76/85 (89%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 |||| |||| |||||||||||||| ||| |||||||||||||||||| |||||||||||| Sbjct: 437 agcaatcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatgc 378 Query: 331 cggcggccttgccagcgtttagccc 355 |||||| ||||| ||||| ||||| Sbjct: 377 tggcggcgttgccggcgttgagccc 353
>dbj|AK070414.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023053H09, full insert sequence Length = 2882 Score = 99.6 bits (50), Expect = 7e-18 Identities = 76/85 (89%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 ||||||||| |||||||||||||| ||| |||||||||||||||||| | |||||||||| Sbjct: 2444 agcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatgc 2385 Query: 331 cggcggccttgccagcgtttagccc 355 |||||| ||||| ||||| ||||| Sbjct: 2384 tggcggcgttgccggcgttgagccc 2360
>dbj|AK058805.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-003-B09, full insert sequence Length = 551 Score = 99.6 bits (50), Expect = 7e-18 Identities = 76/85 (89%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 ||||||||| |||||||||||||| ||| |||||||||||||||||| | |||||||||| Sbjct: 321 agcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatgc 262 Query: 331 cggcggccttgccagcgtttagccc 355 |||||| ||||| ||||| ||||| Sbjct: 261 tggcggcgttgccggcgttgagccc 237
>emb|BX000512.1|CNS08CE2 Oryza sativa chromosome 11, . BAC OSJNBa0025K19 of library OSJNBa from chromosome 11 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 181322 Score = 99.6 bits (50), Expect = 7e-18 Identities = 76/85 (89%) Strand = Plus / Plus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 ||||||||| |||||||||||||| ||| |||||||||||||||||| | |||||||||| Sbjct: 40532 agcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatgc 40591 Query: 331 cggcggccttgccagcgtttagccc 355 |||||| ||||| ||||| ||||| Sbjct: 40592 tggcggcgttgccggcgttgagccc 40616 Score = 79.8 bits (40), Expect = 7e-12 Identities = 69/79 (87%) Strand = Plus / Plus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||||| Sbjct: 50209 agcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatgc 50268 Query: 331 cggcggccttgccagcgtt 349 |||||| ||||| ||||| Sbjct: 50269 tggcggcattgccggcgtt 50287 Score = 67.9 bits (34), Expect = 3e-08 Identities = 57/65 (87%) Strand = Plus / Plus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 |||||||| ||||| |||||||||||| |||| | ||||| ||||| |||||||||||| Sbjct: 63504 agcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatgc 63563 Query: 331 cggcg 335 ||||| Sbjct: 63564 cggcg 63568 Score = 40.1 bits (20), Expect = 5.9 Identities = 32/36 (88%) Strand = Plus / Plus Query: 302 gacgctgacgccgcacatggaggggatgccggcggc 337 |||| ||||||||||| || ||||||||||||||| Sbjct: 28127 gacgttgacgccgcacttgccggggatgccggcggc 28162
>gb|U77295.1|OSU77295 Oryza sativa lipid transfer protein (LTP) mRNA, complete cds Length = 799 Score = 99.6 bits (50), Expect = 7e-18 Identities = 76/85 (89%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 |||| |||| |||||||||||||| ||| |||||||||||||||||| |||||||||||| Sbjct: 437 agcaatcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatgc 378 Query: 331 cggcggccttgccagcgtttagccc 355 |||||| ||||| ||||| ||||| Sbjct: 377 tggcggcgttgccggcgttgagccc 353
>gb|AF017360.1|AF017360 Oryza sativa lipid transfer protein LPT III mRNA, complete cds Length = 805 Score = 97.6 bits (49), Expect = 3e-17 Identities = 77/85 (90%), Gaps = 1/85 (1%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 ||||||||| |||||||||||||| ||| |||||||||||||||||| |||||||||||| Sbjct: 411 agcagtcgatggaagcgctgatggtgta-gggacgctgacgccgcacttggaggggatgc 353 Query: 331 cggcggccttgccagcgtttagccc 355 |||||| ||||| ||||| ||||| Sbjct: 352 tggcggcgttgccggcgttgagccc 328
>gb|AF017361.1|AF017361 Oryza sativa lipid transfer protein LPT IV mRNA, complete cds Length = 507 Score = 91.7 bits (46), Expect = 2e-15 Identities = 75/85 (88%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 |||||| || |||||||||||||| ||| |||||||||||||||||| | |||||||||| Sbjct: 372 agcagtggatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatgc 313 Query: 331 cggcggccttgccagcgtttagccc 355 |||||| ||||| ||||| ||||| Sbjct: 312 tggcggcgttgccggcgttgagccc 288
>gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein precursor (LTP2) mRNA, complete cds Length = 730 Score = 89.7 bits (45), Expect = 7e-15 Identities = 76/87 (87%) Strand = Plus / Minus Query: 255 gatcagcgaatcttanagcagtcgacggaagcgctgatggcgtangggacgctgacgccg 314 |||||| | |||||| ||||||| ||||| |||||||| | ||| ||||||||||||||| Sbjct: 429 gatcagtggatcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccg 370 Query: 315 cacatggaggggatgccggcggccttg 341 ||| ||||||| ||||| ||||||||| Sbjct: 369 cacttggagggaatgcctgcggccttg 343 Score = 61.9 bits (31), Expect = 2e-06 Identities = 63/74 (85%), Gaps = 6/74 (8%) Strand = Plus / Minus Query: 154 cacatgaagataatatgagagcatttattcatatatatgtatgtatgtgtg------acc 207 |||||| |||| |||| ||||||||||||||| ||||||||| |||||||| ||| Sbjct: 548 cacatggagatcatatcagagcatttattcatgtatatgtatatatgtgtgtgtgagacc 489 Query: 208 tcaacgtactcagc 221 |||||||||||||| Sbjct: 488 tcaacgtactcagc 475 Score = 40.1 bits (20), Expect = 5.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 38 ctcaaagggagtgaaggaacaaccaaac 65 ||||||||||||||| |||||| ||||| Sbjct: 645 ctcaaagggagtgaacgaacaatcaaac 618
>emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non specific lipid transfer protein precursor Length = 496 Score = 89.7 bits (45), Expect = 7e-15 Identities = 76/87 (87%) Strand = Plus / Minus Query: 255 gatcagcgaatcttanagcagtcgacggaagcgctgatggcgtangggacgctgacgccg 314 |||||| | |||||| ||||||| ||||| |||||||| | ||| ||||||||||||||| Sbjct: 370 gatcagtggatcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccg 311 Query: 315 cacatggaggggatgccggcggccttg 341 ||| ||||||| ||||| ||||||||| Sbjct: 310 cacttggagggaatgcctgcggccttg 284 Score = 61.9 bits (31), Expect = 2e-06 Identities = 63/74 (85%), Gaps = 6/74 (8%) Strand = Plus / Minus Query: 154 cacatgaagataatatgagagcatttattcatatatatgtatgtatgtgtg------acc 207 |||||| |||| |||| ||||||||||||||| ||||||||| |||||||| ||| Sbjct: 489 cacatggagatcatatcagagcatttattcatgtatatgtatatatgtgtgtgtgagacc 430 Query: 208 tcaacgtactcagc 221 |||||||||||||| Sbjct: 429 tcaacgtactcagc 416
>gb|AY754742.1| Triticum aestivum lipid transfer protein (LTP2) mRNA, complete cds Length = 348 Score = 87.7 bits (44), Expect = 3e-14 Identities = 69/78 (88%) Strand = Plus / Minus Query: 264 atcttanagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggag 323 |||||| ||||||| ||||| |||||||| | ||| |||||||||||||||||| ||||| Sbjct: 341 atcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccgcacttggag 282 Query: 324 gggatgccggcggccttg 341 || ||||| ||||||||| Sbjct: 281 ggaatgcctgcggccttg 264
>gb|AY327042.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LPT1 mRNA, complete cds Length = 647 Score = 79.8 bits (40), Expect = 7e-12 Identities = 69/79 (87%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||||| Sbjct: 468 agcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatgc 409 Query: 331 cggcggccttgccagcgtt 349 |||||| ||||| ||||| Sbjct: 408 tggcggcattgccggcgtt 390
>emb|Z23271.1|OSLPTPRA O.sativa lipid transfer protein gene, complete CDS Length = 1485 Score = 79.8 bits (40), Expect = 7e-12 Identities = 69/79 (87%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||||| Sbjct: 700 agcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatgc 641 Query: 331 cggcggccttgccagcgtt 349 |||||| ||||| ||||| Sbjct: 640 tggcggcattgccggcgtt 622
>emb|X71669.1|SVTLP1R S.vulgare ltp1 mRNA Length = 717 Score = 79.8 bits (40), Expect = 7e-12 Identities = 57/63 (90%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||||||||||||||||| |||||||||||| |||||| ||||| || Sbjct: 277 gctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcggcgttgccggc 218 Query: 347 gtt 349 ||| Sbjct: 217 gtt 215
>emb|X71667.1|SVLTP1 S.vulgare ltp1 gene Length = 1499 Score = 79.8 bits (40), Expect = 7e-12 Identities = 57/63 (90%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||||||||||||||||| |||||||||||| |||||| ||||| || Sbjct: 980 gctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcggcgttgccggc 921 Query: 347 gtt 349 ||| Sbjct: 920 gtt 918
>emb|X83434.1|OSLTPB1 O.sativa mRNA for lipid transfer protein, b1 Length = 692 Score = 79.8 bits (40), Expect = 7e-12 Identities = 69/79 (87%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||||| Sbjct: 330 agcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatgc 271 Query: 331 cggcggccttgccagcgtt 349 |||||| ||||| ||||| Sbjct: 270 tggcggcattgccggcgtt 252
>dbj|AK059819.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-C07, full insert sequence Length = 1003 Score = 79.8 bits (40), Expect = 7e-12 Identities = 69/79 (87%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||||| Sbjct: 653 agcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatgc 594 Query: 331 cggcggccttgccagcgtt 349 |||||| ||||| ||||| Sbjct: 593 tggcggcattgccggcgtt 575
>dbj|AK058896.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-G08, full insert sequence Length = 840 Score = 79.8 bits (40), Expect = 7e-12 Identities = 69/79 (87%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||||| Sbjct: 436 agcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatgc 377 Query: 331 cggcggccttgccagcgtt 349 |||||| ||||| ||||| Sbjct: 376 tggcggcattgccggcgtt 358
>gb|AF017359.1|AF017359 Oryza sativa lipid transfer protein LPT II mRNA, complete cds Length = 845 Score = 79.8 bits (40), Expect = 7e-12 Identities = 69/79 (87%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||||| Sbjct: 418 agcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatgc 359 Query: 331 cggcggccttgccagcgtt 349 |||||| ||||| ||||| Sbjct: 358 tggcggcattgccggcgtt 340
>gb|AF017358.1|AF017358 Oryza sativa lipid transfer protein mRNA, complete cds Length = 695 Score = 79.8 bits (40), Expect = 7e-12 Identities = 63/71 (88%) Strand = Plus / Minus Query: 282 gaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttg 341 |||| |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| ||| Sbjct: 325 gaagggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattg 266 Query: 342 ccagcgtttag 352 || |||||||| Sbjct: 265 ccggcgtttag 255
>emb|Z37114.1|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid transfer protein precursor Length = 627 Score = 75.8 bits (38), Expect = 1e-10 Identities = 58/65 (89%) Strand = Plus / Minus Query: 285 gcgctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgcca 344 |||||||| | ||| |||||||||||||||||| ||||||||||||| |||||| |||| Sbjct: 322 gcgctgatcgtgtaggggacgctgacgccgcacctggaggggatgcctgcggccctgccg 263 Query: 345 gcgtt 349 ||||| Sbjct: 262 gcgtt 258
>emb|X71668.1|SVLTP2 S.vulgare ltp2 gene Length = 1800 Score = 75.8 bits (38), Expect = 1e-10 Identities = 52/57 (91%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgcc 343 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||||||||| Sbjct: 948 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggccttgcc 892
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 75.8 bits (38), Expect = 1e-10 Identities = 58/65 (89%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 |||||||| ||||| |||||||||||| |||| | ||||||||||| |||||||||||| Sbjct: 14437063 agcagtcggtggaagggctgatggcgtaggggatgttgacgccgcacttggaggggatgc 14437004 Query: 331 cggcg 335 ||||| Sbjct: 14437003 cggcg 14436999 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 178 ttattcatatatatgtatgtatgt 201 |||| ||||||||||||||||||| Sbjct: 13185988 ttatacatatatatgtatgtatgt 13186011
>dbj|AP004134.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1116_C12 Length = 116758 Score = 75.8 bits (38), Expect = 1e-10 Identities = 58/65 (89%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 |||||||| ||||| |||||||||||| |||| | ||||||||||| |||||||||||| Sbjct: 45561 agcagtcggtggaagggctgatggcgtaggggatgttgacgccgcacttggaggggatgc 45502 Query: 331 cggcg 335 ||||| Sbjct: 45501 cggcg 45497
>dbj|AK107447.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-128-C01, full insert sequence Length = 718 Score = 71.9 bits (36), Expect = 2e-09 Identities = 56/63 (88%) Strand = Plus / Plus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| ||||| || Sbjct: 97 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggc 156 Query: 347 gtt 349 ||| Sbjct: 157 gtt 159
>gb|U66105.1|ZMU66105 Zea mays phospholipid transfer protein mRNA, complete cds Length = 770 Score = 71.9 bits (36), Expect = 2e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| ||||| || Sbjct: 406 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggc 347 Query: 347 gtt 349 ||| Sbjct: 346 gtt 344
>gb|DQ147213.1| Zea diploperennis isolate d7B phospholipid transfer protein 1 (plt1) gene, partial cds Length = 698 Score = 71.9 bits (36), Expect = 2e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| ||||| || Sbjct: 316 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggc 257 Query: 347 gtt 349 ||| Sbjct: 256 gtt 254
>gb|DQ147210.1| Zea diploperennis isolate d4 phospholipid transfer protein 1 (plt1) gene, partial cds Length = 514 Score = 71.9 bits (36), Expect = 2e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| ||||| || Sbjct: 308 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggc 249 Query: 347 gtt 349 ||| Sbjct: 248 gtt 246
>gb|DQ147209.1| Zea diploperennis isolate d4a phospholipid transfer protein 1 (plt1) gene, partial cds Length = 514 Score = 71.9 bits (36), Expect = 2e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| ||||| || Sbjct: 308 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggc 249 Query: 347 gtt 349 ||| Sbjct: 248 gtt 246
>gb|DQ147205.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 804 Score = 71.9 bits (36), Expect = 2e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| ||||| || Sbjct: 417 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggc 358 Query: 347 gtt 349 ||| Sbjct: 357 gtt 355
>gb|DQ147193.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 831 Score = 71.9 bits (36), Expect = 2e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| ||||| || Sbjct: 434 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggc 375 Query: 347 gtt 349 ||| Sbjct: 374 gtt 372
>gb|DQ147192.1| Zea diploperennis isolate d8L phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 71.9 bits (36), Expect = 2e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| ||||| || Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggc 268 Query: 347 gtt 349 ||| Sbjct: 267 gtt 265
>gb|DQ147191.1| Zea diploperennis isolate d7 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 71.9 bits (36), Expect = 2e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| ||||| || Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggc 268 Query: 347 gtt 349 ||| Sbjct: 267 gtt 265
>gb|DQ147190.1| Zea diploperennis isolate d5b phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 71.9 bits (36), Expect = 2e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| ||||| || Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggc 268 Query: 347 gtt 349 ||| Sbjct: 267 gtt 265
>gb|DQ147189.1| Zea diploperennis isolate d5 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 71.9 bits (36), Expect = 2e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| ||||| || Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggc 268 Query: 347 gtt 349 ||| Sbjct: 267 gtt 265
>gb|DQ147188.1| Zea diploperennis isolate d6 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 71.9 bits (36), Expect = 2e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| ||||| || Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggc 268 Query: 347 gtt 349 ||| Sbjct: 267 gtt 265
>gb|DQ147187.1| Zea diploperennis isolate d4 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 71.9 bits (36), Expect = 2e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| ||||| || Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggc 268 Query: 347 gtt 349 ||| Sbjct: 267 gtt 265
>gb|DQ147186.1| Zea diploperennis isolate d3b phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 71.9 bits (36), Expect = 2e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| ||||| || Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggc 268 Query: 347 gtt 349 ||| Sbjct: 267 gtt 265
>gb|DQ147185.1| Zea diploperennis isolate d3a phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 71.9 bits (36), Expect = 2e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| ||||| || Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggc 268 Query: 347 gtt 349 ||| Sbjct: 267 gtt 265
>gb|DQ147184.1| Zea diploperennis isolate d2 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 71.9 bits (36), Expect = 2e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| ||||| || Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggc 268 Query: 347 gtt 349 ||| Sbjct: 267 gtt 265
>gb|DQ147183.1| Zea diploperennis isolate d1b phospholipid transfer protein 2 (plt2) gene, partial cds Length = 613 Score = 71.9 bits (36), Expect = 2e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| ||||| || Sbjct: 301 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggc 242 Query: 347 gtt 349 ||| Sbjct: 241 gtt 239
>gb|DQ147182.1| Zea diploperennis isolate d1a phospholipid transfer protein 2 (pl2) gene, partial cds Length = 613 Score = 71.9 bits (36), Expect = 2e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| ||||| || Sbjct: 301 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggc 242 Query: 347 gtt 349 ||| Sbjct: 241 gtt 239
>gb|DQ147181.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 826 Score = 71.9 bits (36), Expect = 2e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| ||||| || Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggc 339 Query: 347 gtt 349 ||| Sbjct: 338 gtt 336
>gb|DQ147180.1| Zea mays subsp. parviglumis isolate p14 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 822 Score = 71.9 bits (36), Expect = 2e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| ||||| || Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggc 339 Query: 347 gtt 349 ||| Sbjct: 338 gtt 336
>gb|DQ147179.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 829 Score = 71.9 bits (36), Expect = 2e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| ||||| || Sbjct: 397 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggc 338 Query: 347 gtt 349 ||| Sbjct: 337 gtt 335
>gb|DQ147178.1| Zea mays subsp. parviglumis isolate p12G phospholipid transfer protein 2 (plt2) gene, complete cds Length = 816 Score = 71.9 bits (36), Expect = 2e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| ||||| || Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggc 339 Query: 347 gtt 349 ||| Sbjct: 338 gtt 336
>gb|DQ147177.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 71.9 bits (36), Expect = 2e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| ||||| || Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggc 339 Query: 347 gtt 349 ||| Sbjct: 338 gtt 336
>gb|DQ147176.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 826 Score = 71.9 bits (36), Expect = 2e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| ||||| || Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggc 339 Query: 347 gtt 349 ||| Sbjct: 338 gtt 336
>gb|DQ147175.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 818 Score = 71.9 bits (36), Expect = 2e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| ||||| || Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggc 339 Query: 347 gtt 349 ||| Sbjct: 338 gtt 336
>gb|DQ147174.1| Zea mays subsp. parviglumis isolate p6U phospholipid transfer protein 2 (plt2) gene, complete cds Length = 822 Score = 71.9 bits (36), Expect = 2e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| ||||| || Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggc 339 Query: 347 gtt 349 ||| Sbjct: 338 gtt 336
>gb|DQ147173.1| Zea mays subsp. parviglumis isolate p6L phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 71.9 bits (36), Expect = 2e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| ||||| || Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggc 339 Query: 347 gtt 349 ||| Sbjct: 338 gtt 336
>gb|DQ147171.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 832 Score = 71.9 bits (36), Expect = 2e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| ||||| || Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggc 339 Query: 347 gtt 349 ||| Sbjct: 338 gtt 336
>gb|DQ147170.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 820 Score = 71.9 bits (36), Expect = 2e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| ||||| || Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggc 339 Query: 347 gtt 349 ||| Sbjct: 338 gtt 336
>gb|DQ147169.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 71.9 bits (36), Expect = 2e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| ||||| || Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggc 339 Query: 347 gtt 349 ||| Sbjct: 338 gtt 336
>dbj|AK104981.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-125-E10, full insert sequence Length = 793 Score = 67.9 bits (34), Expect = 3e-08 Identities = 57/65 (87%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 |||||||| ||||| |||||| ||||| |||| | ||||||||||| |||||||||||| Sbjct: 429 agcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatgc 370 Query: 331 cggcg 335 ||||| Sbjct: 369 cggcg 365
>dbj|AK102455.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033094A19, full insert sequence Length = 3876 Score = 67.9 bits (34), Expect = 3e-08 Identities = 57/65 (87%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 |||||||| ||||| |||||| ||||| |||| | ||||||||||| |||||||||||| Sbjct: 3515 agcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatgc 3456 Query: 331 cggcg 335 ||||| Sbjct: 3455 cggcg 3451
>dbj|AK073466.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044B21, full insert sequence Length = 792 Score = 67.9 bits (34), Expect = 3e-08 Identities = 57/65 (87%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 |||||||| ||||| |||||| ||||| |||| | ||||||||||| |||||||||||| Sbjct: 431 agcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatgc 372 Query: 331 cggcg 335 ||||| Sbjct: 371 cggcg 367
>dbj|AK063683.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-119-E10, full insert sequence Length = 745 Score = 67.9 bits (34), Expect = 3e-08 Identities = 57/65 (87%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 |||||||| ||||| |||||||||||| |||| | ||||| ||||| |||||||||||| Sbjct: 433 agcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatgc 374 Query: 331 cggcg 335 ||||| Sbjct: 373 cggcg 369
>gb|AY789644.1| Triticum aestivum lipid transfer protein 4 (LTP4) mRNA, complete cds Length = 345 Score = 63.9 bits (32), Expect = 4e-07 Identities = 79/95 (83%) Strand = Plus / Minus Query: 296 gtangggacgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagccc 355 ||| ||||||||||||| |||| |||||||||| | |||||| |||| | || | ||| Sbjct: 309 gtaggggacgctgacgcggcacttggaggggatctctgcggccgtgccttctttgacccc 250 Query: 356 accagcagcgctcttgatgcacttgcacgccgctt 390 ||| ||||| |||||||||||| ||||||||||| Sbjct: 249 accggcagcactcttgatgcacaggcacgccgctt 215
>gb|BT018347.1| Zea mays clone EL01T0403E02.c mRNA sequence Length = 827 Score = 63.9 bits (32), Expect = 4e-07 Identities = 46/51 (90%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggc 337 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| Sbjct: 417 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 367
>gb|U31766.1|OSU31766 Oryza sativa lipid transfer protein precursor (LTP2) mRNA, complete cds Length = 840 Score = 63.9 bits (32), Expect = 4e-07 Identities = 67/79 (84%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 ||||||||| ||| | |||||||| ||| |||| ||||||||||| |||||||||||| Sbjct: 413 agcagtcgatggaggggctgatggtgtaggggatcgtgacgccgcacttggaggggatgc 354 Query: 331 cggcggccttgccagcgtt 349 |||||| ||||| ||||| Sbjct: 353 tggcggcattgccggcgtt 335
>gb|DQ147207.1| Zea diploperennis isolate d2 phospholipid transfer protein 1 (plt1) gene, partial cds Length = 699 Score = 63.9 bits (32), Expect = 4e-07 Identities = 55/63 (87%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||| ||||||||||||| ||||||| |||| |||||| ||||| || Sbjct: 301 gctgatggtgtaggggatgctgacgccgcacttggagggtatgctggcggcgttgccggc 242 Query: 347 gtt 349 ||| Sbjct: 241 gtt 239
>gb|DQ147204.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 780 Score = 63.9 bits (32), Expect = 4e-07 Identities = 46/51 (90%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggc 337 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| Sbjct: 399 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 349
>gb|DQ147203.1| Zea mays subsp. parviglumis isolate p12 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 714 Score = 63.9 bits (32), Expect = 4e-07 Identities = 46/51 (90%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggc 337 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| Sbjct: 324 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 274
>gb|DQ147202.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 648 Score = 63.9 bits (32), Expect = 4e-07 Identities = 46/51 (90%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggc 337 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| Sbjct: 423 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 373
>gb|DQ147201.1| Zea mays subsp. parviglumis isolate p11a phospholipid transfer protein 1 (plt1) gene, complete cds Length = 829 Score = 63.9 bits (32), Expect = 4e-07 Identities = 46/51 (90%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggc 337 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| Sbjct: 436 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 386
>gb|DQ147199.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 831 Score = 63.9 bits (32), Expect = 4e-07 Identities = 46/51 (90%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggc 337 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| Sbjct: 438 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 388
>gb|DQ147198.1| Zea mays subsp. parviglumis isolate p6 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 821 Score = 63.9 bits (32), Expect = 4e-07 Identities = 46/51 (90%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggc 337 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| Sbjct: 433 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 383
>gb|DQ147197.1| Zea mays subsp. parviglumis isolate p5 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 832 Score = 63.9 bits (32), Expect = 4e-07 Identities = 46/51 (90%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggc 337 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| Sbjct: 436 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 386
>gb|DQ147196.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 835 Score = 63.9 bits (32), Expect = 4e-07 Identities = 46/51 (90%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggc 337 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| Sbjct: 433 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 383
>gb|DQ147194.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 814 Score = 63.9 bits (32), Expect = 4e-07 Identities = 46/51 (90%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggc 337 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| Sbjct: 433 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 383
>gb|DQ147172.1| Zea mays subsp. parviglumis isolate p5_U phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 63.9 bits (32), Expect = 4e-07 Identities = 55/63 (87%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||| ||||||||||||| |||| ||||||| |||||| ||||| || Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggacgggatgctggcggcgttgccggc 339 Query: 347 gtt 349 ||| Sbjct: 338 gtt 336
>gb|DQ147168.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 63.9 bits (32), Expect = 4e-07 Identities = 55/63 (87%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggccttgccagc 346 |||||||| ||| |||| ||||||||||||| |||| ||||||| |||||| ||||| || Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggacgggatgctggcggcgttgccggc 339 Query: 347 gtt 349 ||| Sbjct: 338 gtt 336
>gb|M57249.1|MZEPLTPA Maize phospholipid transfer protein mRNA, 3' end Length = 677 Score = 63.9 bits (32), Expect = 4e-07 Identities = 46/51 (90%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggc 337 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| Sbjct: 247 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 197
>gb|J04176.1|MZEPLTP Maize phospholipid transfer protein mRNA, complete cds. of clone 9C2 Length = 813 Score = 63.9 bits (32), Expect = 4e-07 Identities = 46/51 (90%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggc 337 |||||||| ||| |||| ||||||||||||| |||||||||||| |||||| Sbjct: 434 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 384
>emb|X68655.1|HVCW18 H.vulgare Cw-18 mRNA Length = 732 Score = 61.9 bits (31), Expect = 2e-06 Identities = 48/54 (88%) Strand = Plus / Minus Query: 285 gcgctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggcc 338 |||||||| | ||| ||||||||||| |||||| ||||||||||||| |||||| Sbjct: 393 gcgctgatcgtgtaggggacgctgaccccgcacctggaggggatgcctgcggcc 340
>gb|AF051369.1|AF051369 Oryza sativa lipid transfer protein mRNA, complete cds Length = 766 Score = 60.0 bits (30), Expect = 6e-06 Identities = 56/65 (86%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 |||||||| ||||| |||||| ||||| |||| | |||| |||||| |||||||||||| Sbjct: 383 agcagtcggtggaagggctgatagcgtaggggatgttgaccccgcacttggaggggatgc 324 Query: 331 cggcg 335 ||||| Sbjct: 323 cggcg 319
>gb|DQ147200.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer protein 1 (plt1) gene, partial cds Length = 709 Score = 56.0 bits (28), Expect = 1e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggc 337 |||||||| || |||| ||||||||||||| |||||||||||| |||||| Sbjct: 302 gctgatggtataggggatgctgacgccgcacttggaggggatgctggcggc 252
>gb|DQ147195.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer protein 1 (plt1) gene, partial cds Length = 686 Score = 56.0 bits (28), Expect = 1e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcggc 337 |||||||| ||| |||| ||||||||| ||| |||||||||||| |||||| Sbjct: 303 gctgatggtgtaggggatgctgacgccacacttggaggggatgctggcggc 253
>dbj|D10955.1|RIC323PTP Oryza sativa mRNA for phospholipid trasfer protein Length = 372 Score = 54.0 bits (27), Expect = 4e-04 Identities = 53/62 (85%) Strand = Plus / Minus Query: 271 agcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatgc 330 |||||||| ||||| ||||||| |||| |||| | ||||| ||||| |||||||||||| Sbjct: 140 agcagtcggtggaagggctgatgccgtaggggatgttgacgtcgcacttggaggggatgc 81 Query: 331 cg 332 || Sbjct: 80 cg 79
>gb|AC131676.2| Mus musculus BAC clone RP23-330L3 from chromosome 6, complete sequence Length = 200673 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 179 tattcatatatatgtatgtatgtgtg 204 |||||||||||||||||||||||||| Sbjct: 131928 tattcatatatatgtatgtatgtgtg 131903
>gb|AY662492.1| Hordeum vulgare subsp. vulgare non-specific lipid transfer protein 6 (Ltp6) gene, promoter and complete cds Length = 3257 Score = 52.0 bits (26), Expect = 0.002 Identities = 43/49 (87%) Strand = Plus / Minus Query: 287 gctgatggcgtangggacgctgacgccgcacatggaggggatgccggcg 335 |||||||||||| |||| | ||||||||||| || ||||||||||||| Sbjct: 2770 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 2722
>emb|CT025614.7| Mouse DNA sequence from clone RP23-418B18 on chromosome 13, complete sequence Length = 183907 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 177 tttattcatatatatgtatgtatgtg 202 |||||||||||||||||||||||||| Sbjct: 118142 tttattcatatatatgtatgtatgtg 118117 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 atatatatgtatgtatgtgtg 204 ||||||||||||||||||||| Sbjct: 84210 atatatatgtatgtatgtgtg 84230
>gb|AC131678.4| Mus musculus BAC clone RP23-333L1 from chromosome 3, complete sequence Length = 203750 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Minus Query: 176 atttattcatatatatgtatgtatgtgtg 204 |||||||||||| |||||||||||||||| Sbjct: 29729 atttattcatatgtatgtatgtatgtgtg 29701 Score = 44.1 bits (22), Expect = 0.38 Identities = 28/30 (93%) Strand = Plus / Plus Query: 175 catttattcatatatatgtatgtatgtgtg 204 |||| |||||||||||||||||| |||||| Sbjct: 123704 cattcattcatatatatgtatgtgtgtgtg 123733
>gb|AC102367.35| Mus musculus chromosome 3, clone RP23-211J6, complete sequence Length = 185452 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Plus Query: 176 atttattcatatatatgtatgtatgtgtg 204 |||||||||||| |||||||||||||||| Sbjct: 59063 atttattcatatgtatgtatgtatgtgtg 59091
>gb|AC099975.11| Mus musculus chromosome 5, clone RP23-23A2, complete sequence Length = 213359 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 177 tttattcatatatatgtatgtatg 200 |||||||||||||||||||||||| Sbjct: 201655 tttattcatatatatgtatgtatg 201632
>gb|AC122011.3| Mus musculus chromosome 10 clone RP24-352E6, complete sequence Length = 181468 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 181 ttcatatatatgtatgtatgtgtg 204 |||||||||||||||||||||||| Sbjct: 91974 ttcatatatatgtatgtatgtgtg 91951
>gb|AC166342.3| Mus musculus BAC clone RP24-340A12 from chromosome 9, complete sequence Length = 174085 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtgac 206 |||||||||||||||||||||||| Sbjct: 1083 catatatatgtatgtatgtgtgac 1106
>gb|AC129336.4| Mus musculus BAC clone RP23-113I7 from chromosome 10, complete sequence Length = 215437 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 181 ttcatatatatgtatgtatgtgtg 204 |||||||||||||||||||||||| Sbjct: 230 ttcatatatatgtatgtatgtgtg 207
>gb|AC116383.11| Mus musculus chromosome 5, clone RP23-15P21, complete sequence Length = 259299 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 177 tttattcatatatatgtatgtatg 200 |||||||||||||||||||||||| Sbjct: 103346 tttattcatatatatgtatgtatg 103323
>gb|AC100506.17| Mus musculus chromosome 9, clone RP23-144D3, complete sequence Length = 198388 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtgac 206 |||||||||||||||||||||||| Sbjct: 118371 catatatatgtatgtatgtgtgac 118394
>gb|AC161590.2| Mus musculus BAC clone RP24-300B21 from chromosome 9, complete sequence Length = 162840 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Plus Query: 176 atttattcatatatatgtatgtat 199 |||||||||||||||||||||||| Sbjct: 121866 atttattcatatatatgtatgtat 121889
>emb|AL451076.14| Mouse DNA sequence from clone RP23-43O20 on chromosome X, complete sequence Length = 203581 Score = 48.1 bits (24), Expect = 0.024 Identities = 27/28 (96%) Strand = Plus / Minus Query: 176 atttattcatatatatgtatgtatgtgt 203 |||||||||||| ||||||||||||||| Sbjct: 198854 atttattcatatgtatgtatgtatgtgt 198827
>gb|AC164875.14| Mus musculus chromosome 1, clone RP23-59P14, complete sequence Length = 250957 Score = 48.1 bits (24), Expect = 0.024 Identities = 27/28 (96%) Strand = Plus / Plus Query: 175 catttattcatatatatgtatgtatgtg 202 |||| ||||||||||||||||||||||| Sbjct: 140060 cattcattcatatatatgtatgtatgtg 140087
>emb|AL732451.8| Mouse DNA sequence from clone RP23-85G19 on chromosome X, complete sequence Length = 213822 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 180 attcatatatatgtatgtatgtgt 203 |||||||||||||||||||||||| Sbjct: 14549 attcatatatatgtatgtatgtgt 14526 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 atatatatgtatgtatgtgtg 204 ||||||||||||||||||||| Sbjct: 14408 atatatatgtatgtatgtgtg 14428
>gb|AC129931.19| Mus musculus chromosome 15, clone RP23-136I22, complete sequence Length = 186914 Score = 46.1 bits (23), Expect = 0.096 Identities = 23/23 (100%) Strand = Plus / Minus Query: 182 tcatatatatgtatgtatgtgtg 204 ||||||||||||||||||||||| Sbjct: 63583 tcatatatatgtatgtatgtgtg 63561
>gb|AC131596.10| Mus musculus chromosome 10, clone RP23-476G10, complete sequence Length = 178668 Score = 46.1 bits (23), Expect = 0.096 Identities = 23/23 (100%) Strand = Plus / Plus Query: 179 tattcatatatatgtatgtatgt 201 ||||||||||||||||||||||| Sbjct: 109912 tattcatatatatgtatgtatgt 109934
>gb|AC146296.3| Mus musculus BAC clone RP23-277D1 from chromosome 9, complete sequence Length = 177641 Score = 46.1 bits (23), Expect = 0.096 Identities = 23/23 (100%) Strand = Plus / Minus Query: 179 tattcatatatatgtatgtatgt 201 ||||||||||||||||||||||| Sbjct: 91375 tattcatatatatgtatgtatgt 91353
>gb|AC122928.4| Mus musculus BAC clone RP23-10G8 from 9, complete sequence Length = 205725 Score = 46.1 bits (23), Expect = 0.096 Identities = 23/23 (100%) Strand = Plus / Plus Query: 179 tattcatatatatgtatgtatgt 201 ||||||||||||||||||||||| Sbjct: 32985 tattcatatatatgtatgtatgt 33007
>gb|AC121605.3| Mus musculus BAC clone RP23-312E16 from 1, complete sequence Length = 196494 Score = 46.1 bits (23), Expect = 0.096 Identities = 23/23 (100%) Strand = Plus / Plus Query: 179 tattcatatatatgtatgtatgt 201 ||||||||||||||||||||||| Sbjct: 39306 tattcatatatatgtatgtatgt 39328
>emb|AL391870.16| Human DNA sequence from clone RP11-491C24 on chromosome 9 Contains part of the CDK5RAP2 gene for CDK5 regulatory subunit associated protein 2 (C48) and a CpG island, complete sequence Length = 46372 Score = 46.1 bits (23), Expect = 0.096 Identities = 23/23 (100%) Strand = Plus / Minus Query: 179 tattcatatatatgtatgtatgt 201 ||||||||||||||||||||||| Sbjct: 13639 tattcatatatatgtatgtatgt 13617
>emb|AL390785.15| Human DNA sequence from clone RP11-325N9 on chromosome 10, complete sequence Length = 203169 Score = 46.1 bits (23), Expect = 0.096 Identities = 23/23 (100%) Strand = Plus / Minus Query: 179 tattcatatatatgtatgtatgt 201 ||||||||||||||||||||||| Sbjct: 119047 tattcatatatatgtatgtatgt 119025
>gb|AC159096.2| Mus musculus chromosome 1, clone RP24-95N15, complete sequence Length = 189668 Score = 46.1 bits (23), Expect = 0.096 Identities = 23/23 (100%) Strand = Plus / Minus Query: 179 tattcatatatatgtatgtatgt 201 ||||||||||||||||||||||| Sbjct: 139373 tattcatatatatgtatgtatgt 139351
>emb|AL683843.9| Mouse DNA sequence from clone RP23-217E1 on chromosome 11 Contains part of the Ranbp17 gene for RAN binding protein 17, an acidic (leucine-rich) nuclear phosphoprotein 32 family, member E (Anp32e) pseudogene and a high mobility group box 1 (Hmgb1) pseudogene, complete sequence Length = 198926 Score = 46.1 bits (23), Expect = 0.096 Identities = 29/31 (93%) Strand = Plus / Plus Query: 174 gcatttattcatatatatgtatgtatgtgtg 204 |||||||| ||||||||||||||||||||| Sbjct: 125884 gcatttatgaatatatatgtatgtatgtgtg 125914
>gb|AC098971.2| Homo sapiens chromosome 3 clone RP11-118N13, complete sequence Length = 175409 Score = 46.1 bits (23), Expect = 0.096 Identities = 23/23 (100%) Strand = Plus / Plus Query: 181 ttcatatatatgtatgtatgtgt 203 ||||||||||||||||||||||| Sbjct: 155851 ttcatatatatgtatgtatgtgt 155873
>gb|AC113370.2| Homo sapiens chromosome 5 clone RP11-124O5, complete sequence Length = 189590 Score = 46.1 bits (23), Expect = 0.096 Identities = 26/27 (96%) Strand = Plus / Minus Query: 179 tattcatatatatgtatgtatgtgtga 205 ||||||||||||||||||| ||||||| Sbjct: 167821 tattcatatatatgtatgtgtgtgtga 167795
>gb|AC109469.2| Homo sapiens chromosome 5 clone RP11-349F8, complete sequence Length = 184776 Score = 46.1 bits (23), Expect = 0.096 Identities = 26/27 (96%) Strand = Plus / Minus Query: 179 tattcatatatatgtatgtatgtgtga 205 ||||||||||||||||||| ||||||| Sbjct: 76982 tattcatatatatgtatgtgtgtgtga 76956
>gb|AC010474.5| Homo sapiens chromosome 5 clone CTD-2306F13, complete sequence Length = 88069 Score = 46.1 bits (23), Expect = 0.096 Identities = 26/27 (96%) Strand = Plus / Plus Query: 179 tattcatatatatgtatgtatgtgtga 205 ||||||||||||||||||| ||||||| Sbjct: 80840 tattcatatatatgtatgtgtgtgtga 80866
>emb|BX855592.19| Zebrafish DNA sequence from clone CH211-232K3, complete sequence Length = 159646 Score = 46.1 bits (23), Expect = 0.096 Identities = 23/23 (100%) Strand = Plus / Plus Query: 177 tttattcatatatatgtatgtat 199 ||||||||||||||||||||||| Sbjct: 141945 tttattcatatatatgtatgtat 141967
>gb|AC107028.5| Homo sapiens 3 BAC RP11-547K2 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 126716 Score = 46.1 bits (23), Expect = 0.096 Identities = 26/27 (96%) Strand = Plus / Plus Query: 176 atttattcatatatatgtatgtatgtg 202 |||||||||||||||||||||| |||| Sbjct: 109602 atttattcatatatatgtatgtgtgtg 109628
>gb|AC104823.4| Homo sapiens BAC clone RP11-762E8 from 2, complete sequence Length = 46638 Score = 46.1 bits (23), Expect = 0.096 Identities = 23/23 (100%) Strand = Plus / Plus Query: 178 ttattcatatatatgtatgtatg 200 ||||||||||||||||||||||| Sbjct: 8434 ttattcatatatatgtatgtatg 8456
>gb|AC012450.9| Homo sapiens BAC clone RP11-351J7 from 2, complete sequence Length = 183695 Score = 46.1 bits (23), Expect = 0.096 Identities = 26/27 (96%) Strand = Plus / Minus Query: 177 tttattcatatatatgtatgtatgtgt 203 |||||||||||||||||||| |||||| Sbjct: 146967 tttattcatatatatgtatgaatgtgt 146941
>gb|AC093927.3| Homo sapiens chromosome 3 clone RP11-81I24, complete sequence Length = 183190 Score = 46.1 bits (23), Expect = 0.096 Identities = 23/23 (100%) Strand = Plus / Minus Query: 181 ttcatatatatgtatgtatgtgt 203 ||||||||||||||||||||||| Sbjct: 168554 ttcatatatatgtatgtatgtgt 168532
>gb|AC139299.3| Mus musculus BAC clone RP23-335D20 from 1, complete sequence Length = 204848 Score = 46.1 bits (23), Expect = 0.096 Identities = 26/27 (96%) Strand = Plus / Minus Query: 177 tttattcatatatatgtatgtatgtgt 203 |||||| |||||||||||||||||||| Sbjct: 167582 tttatttatatatatgtatgtatgtgt 167556
>gb|AC160762.4| Mus musculus BAC clone RP24-330E8 from chromosome 1, complete sequence Length = 149232 Score = 46.1 bits (23), Expect = 0.096 Identities = 26/27 (96%) Strand = Plus / Minus Query: 177 tttattcatatatatgtatgtatgtgt 203 |||||| |||||||||||||||||||| Sbjct: 17539 tttatttatatatatgtatgtatgtgt 17513
>emb|AL772393.11| Mouse DNA sequence from clone RP23-398D18 on chromosome 4, complete sequence Length = 207495 Score = 46.1 bits (23), Expect = 0.096 Identities = 23/23 (100%) Strand = Plus / Plus Query: 179 tattcatatatatgtatgtatgt 201 ||||||||||||||||||||||| Sbjct: 138493 tattcatatatatgtatgtatgt 138515
>gb|AC153526.13| Mus musculus 10 BAC RP23-383C2 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 200117 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 170990 catatatatgtatgtatgtgtg 171011
>gb|DP000014.1| Callithrix jacchus target 1 genomic scaffold Length = 1952403 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 182234 catatatatgtatgtatgtgtg 182255
>gb|AC145272.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0002L02, complete sequence Length = 165685 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 146182 catatatatgtatgtatgtgtg 146203
>gb|AC158148.5| Mus musculus chromosome 1, clone RP24-353B6, complete sequence Length = 158895 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 28104 catatatatgtatgtatgtgtg 28083
>gb|AE014849.1| Plasmodium falciparum 3D7 chromosome 12, section 6 of 9 of the complete sequence Length = 250421 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 184 atatatatgtatgtatgtgtga 205 |||||||||||||||||||||| Sbjct: 76637 atatatatgtatgtatgtgtga 76616
>gb|AY020626.1| Oryza sativa microsatellite MRG2951 containing (TA)X12, genomic sequence Length = 224 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 71 catatatatgtatgtatgtgtg 92
>gb|AC128597.3| Rattus norvegicus BAC CH230-62C6 (Children's Hospital Oakland Research Institute Rat (BN/SsNHsd/MCW) BAC library) complete sequence Length = 198520 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 184703 catatatatgtatgtatgtgtg 184682
>gb|AC115061.20| Mus musculus chromosome 1, clone RP24-399G3, complete sequence Length = 203058 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 141363 catatatatgtatgtatgtgtg 141342
>gb|AC137612.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0022B03, complete sequence Length = 151814 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 9018 catatatatgtatgtatgtgtg 9039
>gb|AC166816.2| Mus musculus chromosome 5, clone RP24-321O22, complete sequence Length = 156357 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 33285 catatatatgtatgtatgtgtg 33264
>gb|BT015295.1| Drosophila melanogaster GH02989 full insert cDNA Length = 4587 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Plus Query: 176 atttattcatatatatgtatgtatgt 201 |||||| ||||||||||||||||||| Sbjct: 4454 atttatgcatatatatgtatgtatgt 4479
>gb|AC130649.2| Drosophila melanogaster clone BACR06L03, complete sequence Length = 144234 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Minus Query: 176 atttattcatatatatgtatgtatgt 201 |||||| ||||||||||||||||||| Sbjct: 45244 atttatgcatatatatgtatgtatgt 45219
>gb|AC132440.3| Mus musculus BAC clone RP23-239I24 from chromosome 8, complete sequence Length = 183218 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Plus Query: 176 atttattcatatatatgtatgtatgt 201 |||||||||||| ||||||||||||| Sbjct: 57251 atttattcatatgtatgtatgtatgt 57276
>gb|AC142111.3| Mus musculus BAC clone RP24-63G9 from chromosome 9, complete sequence Length = 185361 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 180 attcatatatatgtatgtatgt 201 |||||||||||||||||||||| Sbjct: 114691 attcatatatatgtatgtatgt 114670
>gb|AC158789.4| Mus musculus chromosome 5, clone RP23-192C21, complete sequence Length = 218871 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 194564 catatatatgtatgtatgtgtg 194543
>gb|AY519500.1| Gallus gallus CNR/Pcdh-alpha gene cluster, complete sequence Length = 187517 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 151166 catatatatgtatgtatgtgtg 151187
>gb|AY190953.1| Drosophila virilis clone DVIF01_19_E15 (D1419) genomic sequence Length = 43320 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Plus Query: 179 tattcatatatatgtatgtatgtgtg 204 |||| ||||||||||||||||||||| Sbjct: 5312 tatttatatatatgtatgtatgtgtg 5337
>gb|AC147066.2| Pan troglodytes BAC clone RP43-164F2 from 7, complete sequence Length = 149431 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Plus Query: 174 gcatttattcatatatatgtatgtat 199 |||| ||||||||||||||||||||| Sbjct: 78715 gcatgtattcatatatatgtatgtat 78740
>gb|AC144808.2| Mus musculus BAC clone RP24-434O1 from chromosome 5, complete sequence Length = 152463 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Minus Query: 179 tattcatatatatgtatgtatgtgtg 204 ||||||||||||||||| |||||||| Sbjct: 100028 tattcatatatatgtatatatgtgtg 100003
>gb|AC134434.4| Mus musculus BAC clone RP24-420E8 from chromosome 7, complete sequence Length = 214856 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 127196 catatatatgtatgtatgtgtg 127175
>gb|AC146512.2| Pan troglodytes BAC clone RP43-16E21 from 7, complete sequence Length = 178648 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Minus Query: 174 gcatttattcatatatatgtatgtat 199 |||| ||||||||||||||||||||| Sbjct: 105785 gcatgtattcatatatatgtatgtat 105760
>gb|AC122386.3| Mus musculus BAC clone RP24-72H18 from chromosome 7, complete sequence Length = 161949 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Plus Query: 179 tattcatatatatgtatgtatgtgtg 204 ||||||||| |||||||||||||||| Sbjct: 71743 tattcatatgtatgtatgtatgtgtg 71768
>gb|AC133210.3| Mus musculus chromosome UNK clone RP23-27L12, complete sequence Length = 210702 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 182395 catatatatgtatgtatgtgtg 182374
>gb|AC125234.4| Mus musculus BAC clone RP23-14K16 from 13, complete sequence Length = 209715 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 35368 catatatatgtatgtatgtgtg 35347
>gb|AC122187.3| Mus musculus BAC clone RP23-21P2 from 1, complete sequence Length = 252095 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 35804 catatatatgtatgtatgtgtg 35783 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 185 tatatatgtatgtatgtgtg 204 |||||||||||||||||||| Sbjct: 233644 tatatatgtatgtatgtgtg 233663
>gb|AC122037.2| Mus musculus BAC clone RP24-426D9 from 3, complete sequence Length = 185938 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 34233 catatatatgtatgtatgtgtg 34212
>gb|AC112261.4| Mus musculus BAC clone RP23-204O17 from 3, complete sequence Length = 186290 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 164722 catatatatgtatgtatgtgtg 164701
>emb|CR695648.1|CNS0FZPO Tetraodon nigroviridis full-length cDNA Length = 1323 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 1134 catatatatgtatgtatgtgtg 1155
>emb|CR692447.2|CNS0FX8R Tetraodon nigroviridis full-length cDNA Length = 1173 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 1007 catatatatgtatgtatgtgtg 1028
>emb|CR691712.2|CNS0FWOC Tetraodon nigroviridis full-length cDNA Length = 1335 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 1146 catatatatgtatgtatgtgtg 1167
>gb|AC006332.3| Homo sapiens BAC clone RP11-376O14 from 7, complete sequence Length = 153477 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Minus Query: 174 gcatttattcatatatatgtatgtat 199 |||| ||||||||||||||||||||| Sbjct: 75745 gcatgtattcatatatatgtatgtat 75720 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 179 tattcatatatatgtatgtat 199 ||||||||||||||||||||| Sbjct: 75722 tattcatatatatgtatgtat 75702
>emb|CR683623.2|CNS0FQFN Tetraodon nigroviridis full-length cDNA Length = 1267 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 1117 catatatatgtatgtatgtgtg 1138
>gb|AC092108.4| Homo sapiens BAC clone RP11-1263I10 from 7, complete sequence Length = 26349 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 5825 catatatatgtatgtatgtgtg 5804
>emb|CR681376.2|CNS0FOP8 Tetraodon nigroviridis full-length cDNA Length = 581 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 405 catatatatgtatgtatgtgtg 426
>emb|CR678828.2|CNS0FMQG Tetraodon nigroviridis full-length cDNA Length = 1058 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 883 catatatatgtatgtatgtgtg 904
>emb|CR675215.2|CNS0FJYT Tetraodon nigroviridis full-length cDNA Length = 1244 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 1091 catatatatgtatgtatgtgtg 1112
>emb|CR675000.2|CNS0FJSU Tetraodon nigroviridis full-length cDNA Length = 1072 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 896 catatatatgtatgtatgtgtg 917
>emb|CR669102.2|CNS0FF90 Tetraodon nigroviridis full-length cDNA Length = 1070 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 894 catatatatgtatgtatgtgtg 915
>emb|CR662543.2|CNS0FA6T Tetraodon nigroviridis full-length cDNA Length = 1302 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 1126 catatatatgtatgtatgtgtg 1147
>emb|CR662776.2|CNS0FADA Tetraodon nigroviridis full-length cDNA Length = 1294 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 1117 catatatatgtatgtatgtgtg 1138
>emb|CR658057.2|CNS0F6Q7 Tetraodon nigroviridis full-length cDNA Length = 1072 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 896 catatatatgtatgtatgtgtg 917
>gb|AC107769.7| Mus musculus chromosome 16, clone RP23-130N20, complete sequence Length = 192682 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 101087 catatatatgtatgtatgtgtg 101108
>gb|AC119848.8| Mus musculus chromosome 7, clone RP23-73B20, complete sequence Length = 239297 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 61265 catatatatgtatgtatgtgtg 61286
>gb|AC165338.3| Mus musculus BAC clone RP24-456K15 from chromosome 10, complete sequence Length = 165515 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 79851 catatatatgtatgtatgtgtg 79830
>emb|AL390248.10| Human DNA sequence from clone RP11-492M23 on chromosome 10 Contains the gene for a novel protein and a ribosomal protein L21 (RPL21)(L21) pseudogene, complete sequence Length = 125798 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 9882 catatatatgtatgtatgtgtg 9903
>emb|AL807736.6| Human DNA sequence from clone RP1-248F5 on chromosome X Contains the gene for PRO0659 protein (FLJ33130 FLJ35046 FLJ34279 FLJ38843 DFKZp667C0711) and a CpG island, complete sequence Length = 84792 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 74561 catatatatgtatgtatgtgtg 74582 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 74523 catatatatgtatgtatgtgtg 74544
>emb|AL592067.4| Human DNA sequence from clone RP11-361H7 on chromosome 13, complete sequence Length = 83141 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 18628 catatatatgtatgtatgtgtg 18607
>emb|AL450427.11| Human DNA sequence from clone RP11-372H19 on chromosome 6, complete sequence Length = 68843 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 7770 catatatatgtatgtatgtgtg 7749
>emb|AL513189.13| Human DNA sequence from clone RP11-339I11 on chromosome 1 Contains part of a novel gene, complete sequence Length = 59522 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 12695 catatatatgtatgtatgtgtg 12674
>emb|AL583830.7| Human DNA sequence from clone RP11-172L10 on chromosome 1 Contains the 5' end of a variant of the KCNK2 gene for potassium channel subfamily K member 2 and a translocase of inner mitochondrial membrane 17 homolog A (yeast) (TIMM17A) pseudogene, complete sequence Length = 151469 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 120123 catatatatgtatgtatgtgtg 120102
>emb|AL442636.3| Human DNA sequence from clone RP11-322F18 on chromosome 13 Contains a CpG island, complete sequence Length = 165618 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Minus Query: 180 attcatatatatgtatgtatgtgtga 205 |||||||||||||||||||| ||||| Sbjct: 40008 attcatatatatgtatgtatttgtga 39983
>emb|AL360015.25| Human DNA sequence from clone RP11-344F20 on chromosome 6 Contains a CGI-35 pseudogene, complete sequence Length = 153072 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Minus Query: 179 tattcatatatatgtatgtatgtgtg 204 ||||||||||||||||| |||||||| Sbjct: 7155 tattcatatatatgtatatatgtgtg 7130
>emb|AL357129.11| Human DNA sequence from clone RP11-114A21 on chromosome Xq21.31-22.1, complete sequence Length = 145380 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 140947 catatatatgtatgtatgtgtg 140968
>gb|AC112406.5| Rattus norvegicus 11 BAC CH230-329D3 (Children's Hospital Oakland Research Institute) complete sequence Length = 182245 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 45065 catatatatgtatgtatgtgtg 45044
>emb|AL161724.10| Human DNA sequence from clone RP11-114E4 on chromosome 9, complete sequence Length = 130767 Score = 44.1 bits (22), Expect = 0.38 Identities = 28/30 (93%) Strand = Plus / Plus Query: 175 catttattcatatatatgtatgtatgtgtg 204 |||| |||||||||||||||||||| |||| Sbjct: 45460 cattcattcatatatatgtatgtatatgtg 45489
>gb|AC099563.3| Homo sapiens chromosome 1 clone RP11-323K10, complete sequence Length = 91282 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 33182 catatatatgtatgtatgtgtg 33203
>gb|AC163635.5| Mus musculus BAC clone RP23-183F13 from chromosome 17, complete sequence Length = 185844 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 28060 catatatatgtatgtatgtgtg 28081
>emb|CR382400.1| Plasmodium falciparum chromosome 6, complete sequence; segment 3/5 Length = 348034 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 200069 catatatatgtatgtatgtgtg 200090 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 184 atatatatgtatgtatgtgt 203 |||||||||||||||||||| Sbjct: 153551 atatatatgtatgtatgtgt 153532
>emb|AL596096.7| Mouse DNA sequence from clone RP23-42P20 on chromosome 11 Contains the 5' end of the Alox12e gene for epidermal arachidonate lipoxygenase, the gene for arachidonate 15-lipoxygenase, a novel pseudogene, two genes for novel proteins (4930563C04Rik, 1110030J09Rik), a Mitochondrial 28S ribosomal protein pseudogene, a NADH dehydrogenase (ubiquinone) 1 beta subcomplex 8 (Ndufb8) pseudogene, the gene for a novel protein similar to Beta-arrestin 2 (Arrestin, beta 2) (LOC216869), the Cxcl16 gene for chemokine (C-X-C motif) ligand 16, the gene for a novel protein similar to human zinc finger MYND domain containg 15 (ZMYND15), the 5' end of the gene for a novel protein (2010003F10Rik) and three CpG islands, complete sequence Length = 193277 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 180 attcatatatatgtatgtatgt 201 |||||||||||||||||||||| Sbjct: 72588 attcatatatatgtatgtatgt 72609
>gb|AC163678.3| Mus musculus BAC clone RP24-104D14 from chromosome 10, complete sequence Length = 196603 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 43198 catatatatgtatgtatgtgtg 43177 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 atatatatgtatgtatgtgtg 204 ||||||||||||||||||||| Sbjct: 153891 atatatatgtatgtatgtgtg 153871
>gb|AC182032.3| Spermophilus tridecemlineatus clone VMRC20-712F8, complete sequence Length = 172253 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 1421 catatatatgtatgtatgtgtg 1442
>gb|AC162392.9| Mus musculus 6 BAC RP23-197G11 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 195176 Score = 44.1 bits (22), Expect = 0.38 Identities = 28/30 (93%) Strand = Plus / Plus Query: 176 atttattcatatatatgtatgtatgtgtga 205 |||||||||||||| | ||||||||||||| Sbjct: 114449 atttattcatatatgtatatgtatgtgtga 114478
>emb|AL592080.26| Mouse DNA sequence from clone RP23-102H10 on chromosome 11 Contains a endothelial differentiation-related factor 1 (Edf1) pseudogene, the 3' end of the gene for a novel protein similar to human sperm antigen HCMOGT-1 (B230396K10Rik) and a CpG island, complete sequence Length = 216023 Score = 44.1 bits (22), Expect = 0.38 Identities = 28/30 (93%) Strand = Plus / Minus Query: 175 catttattcatatatatgtatgtatgtgtg 204 ||||||| ||||||||||||||||| |||| Sbjct: 176322 catttatgcatatatatgtatgtatatgtg 176293
>emb|AL928625.5| Mouse DNA sequence from clone RP24-528P17 on chromosome 4, complete sequence Length = 170639 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 184 atatatatgtatgtatgtgtga 205 |||||||||||||||||||||| Sbjct: 104414 atatatatgtatgtatgtgtga 104435
>emb|BX511201.3|RN177J12 Rattus norvegicus chromosome 1 BAC RP32-177J12, complete sequence Length = 138052 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 30348 catatatatgtatgtatgtgtg 30327
>gb|AC091973.4| Homo sapiens chromosome 5 clone RP11-51B6, complete sequence Length = 156257 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Minus Query: 179 tattcatatatatgtatgtatgtgtg 204 ||||||||||||||||| |||||||| Sbjct: 92027 tattcatatatatgtatatatgtgtg 92002
>gb|AF461688.1| Drosophila virilis even-skipped 5' cis-regulatory region sequence Length = 13238 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Plus Query: 179 tattcatatatatgtatgtatgtgtg 204 |||| ||||||||||||||||||||| Sbjct: 8307 tatttatatatatgtatgtatgtgtg 8332
>gb|AC084768.4| Homo sapiens chromosome 8, clone RP11-281H11, complete sequence Length = 173677 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 38634 catatatatgtatgtatgtgtg 38655
>ref|NM_176778.1| Drosophila melanogaster lethal (1) G0196 CG14616-RD, transcript variant D (l(1)G0196), mRNA Length = 4724 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Plus Query: 176 atttattcatatatatgtatgtatgt 201 |||||| ||||||||||||||||||| Sbjct: 4616 atttatgcatatatatgtatgtatgt 4641
>gb|AC107022.4| Homo sapiens 3 BAC RP11-417H23 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 116557 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 30378 catatatatgtatgtatgtgtg 30357
>gb|AC100768.2| Homo sapiens chromosome 11, clone RP11-945A11, complete sequence Length = 190183 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 114690 catatatatgtatgtatgtgtg 114711
>gb|AF449447.1| Mus musculus C3H chromosome 3 hyplip1 region Length = 176641 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 90088 catatatatgtatgtatgtgtg 90109
>gb|AC063944.25| Homo sapiens 3 BAC RP11-446H18 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 180389 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 30492 catatatatgtatgtatgtgtg 30471
>gb|AC023886.7| Homo sapiens BAC clone RP11-402J6 from 4, complete sequence Length = 179697 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 157923 catatatatgtatgtatgtgtg 157902
>gb|AC007425.16| Homo sapiens 12q24.1-120.5-B PAC RPCI5-1048I22 (Roswell Park Cancer Institute Human PAC Library) complete sequence Length = 139971 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 124555 catatatatgtatgtatgtgtg 124534
>gb|AC092694.6| Homo sapiens 3q BAC RP11-172A10 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 151549 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 132135 catatatatgtatgtatgtgtg 132156
>gb|AC073878.7| Homo sapiens BAC clone RP11-744I24 from 7, complete sequence Length = 111375 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 1306 catatatatgtatgtatgtgtg 1327
>gb|AC097379.2| Homo sapiens BAC clone RP11-277G18 from 4, complete sequence Length = 96080 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 36129 catatatatgtatgtatgtgtg 36150
>gb|AC099542.2| Homo sapiens chromosome 3 clone RP11-520D19, complete sequence Length = 178351 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 70304 catatatatgtatgtatgtgtg 70283
>gb|AC109466.2| Homo sapiens chromosome 5 clone RP11-308N24, complete sequence Length = 153815 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Plus Query: 179 tattcatatatatgtatgtatgtgtg 204 ||||||||||||||||| |||||||| Sbjct: 130419 tattcatatatatgtatatatgtgtg 130444 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 atatatatgtatgtatgtgtg 204 ||||||||||||||||||||| Sbjct: 40738 atatatatgtatgtatgtgtg 40718
>dbj|AK141195.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length enriched library, clone:C230098G24 product:hypothetical protein, full insert sequence Length = 2397 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 127 catatatatgtatgtatgtgtg 148
>gb|AC104515.1| Drosophila melanogaster, chromosome X, region 20B-20C, BAC clone BACR27K09, complete sequence Length = 179386 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Minus Query: 176 atttattcatatatatgtatgtatgt 201 |||||| ||||||||||||||||||| Sbjct: 109854 atttatgcatatatatgtatgtatgt 109829
>gb|AC010471.4| Homo sapiens chromosome 5 clone CTD-2300P22, complete sequence Length = 112587 Score = 44.1 bits (22), Expect = 0.38 Identities = 28/30 (93%) Strand = Plus / Minus Query: 175 catttattcatatatatgtatgtatgtgtg 204 |||| |||||||||||||||||||| |||| Sbjct: 81088 cattcattcatatatatgtatgtatatgtg 81059
>gb|AC022313.5| Homo sapiens BAC clone RP11-437G1 from 4, complete sequence Length = 183516 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 114741 catatatatgtatgtatgtgtg 114762
>gb|AC153134.5| Mus musculus BAC clone RP24-202N2 from chromosome 13, complete sequence Length = 177669 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 172678 catatatatgtatgtatgtgtg 172657
>gb|AC162182.2| Mus musculus BAC clone RP23-73B23 from chromosome 17, complete sequence Length = 205221 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 112268 catatatatgtatgtatgtgtg 112247
>gb|AC146740.3| Callithrix jacchus clone CH259-204H2, complete sequence Length = 224361 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 182234 catatatatgtatgtatgtgtg 182255
>gb|AC007145.10| Drosophila melanogaster, chromosome 2L, region 37D, BAC clone BACR10I09, complete sequence Length = 169289 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Minus Query: 179 tattcatatatatgtatgtatgtgtg 204 ||||||||||||||||||||| |||| Sbjct: 5892 tattcatatatatgtatgtatatgtg 5867
>gb|AC020937.6| Homo sapiens chromosome 5 clone CTD-2299I21, complete sequence Length = 94161 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 180 attcatatatatgtatgtatgt 201 |||||||||||||||||||||| Sbjct: 91309 attcatatatatgtatgtatgt 91288
>emb|CR405841.1| Gallus gallus finished cDNA, clone ChEST885e19 Length = 1184 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 740 catatatatgtatgtatgtgtg 761
>dbj|AK032932.1| Mus musculus 12 days embryo male wolffian duct includes surrounding region cDNA, RIKEN full-length enriched library, clone:6720474J12 product:unclassifiable, full insert sequence Length = 2814 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 180 attcatatatatgtatgtatgt 201 |||||||||||||||||||||| Sbjct: 2630 attcatatatatgtatgtatgt 2609
>gb|AC159809.2| Mus musculus BAC clone RP24-216P6 from chromosome 9, complete sequence Length = 160712 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 83021 catatatatgtatgtatgtgtg 83042
>gb|AC008502.8| Homo sapiens chromosome 5 clone CTC-442G11, complete sequence Length = 123495 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 180 attcatatatatgtatgtatgt 201 |||||||||||||||||||||| Sbjct: 21611 attcatatatatgtatgtatgt 21590
>gb|AC008680.5|AC008680 Homo sapiens chromosome 5 clone CTB-53I9, complete sequence Length = 229045 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 63056 catatatatgtatgtatgtgtg 63035
>dbj|AK048247.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched library, clone:C130043D08 product:unclassifiable, full insert sequence Length = 2077 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 184 atatatatgtatgtatgtgtga 205 |||||||||||||||||||||| Sbjct: 491 atatatatgtatgtatgtgtga 470
>ref|NG_004818.1| Gallus gallus cadherin-related neuronal receptor 10 pseudogene (CNRV10) Length = 98944 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 72707 catatatatgtatgtatgtgtg 72728
>dbj|AK085615.1| Mus musculus 0 day neonate kidney cDNA, RIKEN full-length enriched library, clone:D630047J16 product:unclassifiable, full insert sequence Length = 2297 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 683 catatatatgtatgtatgtgtg 662
>gb|AC018694.4|AC018694 Homo sapiens BAC clone RP11-563P16 from 11, complete sequence Length = 196832 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 16979 catatatatgtatgtatgtgtg 17000
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 180 attcatatatatgtatgtatgt 201 |||||||||||||||||||||| Sbjct: 11599914 attcatatatatgtatgtatgt 11599893 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 184 atatatatgtatgtatgtgt 203 |||||||||||||||||||| Sbjct: 17161797 atatatatgtatgtatgtgt 17161816 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 176 atttattcatatatatgtat 195 |||||||||||||||||||| Sbjct: 11135084 atttattcatatatatgtat 11135103 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 184 atatatatgtatgtatgtgt 203 |||||||||||||||||||| Sbjct: 9547342 atatatatgtatgtatgtgt 9547361
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 10023416 catatatatgtatgtatgtgtg 10023437 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 184 atatatatgtatgtatgtgt 203 |||||||||||||||||||| Sbjct: 15014823 atatatatgtatgtatgtgt 15014842 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 184 atatatatgtatgtatgtgt 203 |||||||||||||||||||| Sbjct: 11795059 atatatatgtatgtatgtgt 11795040
>emb|BX817431.1|CNS0ACFH Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL22ZB05 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 687 Score = 44.1 bits (22), Expect = 0.38 Identities = 25/26 (96%) Strand = Plus / Plus Query: 5 catggtacaaaatacaataaactctt 30 ||||||||||||| |||||||||||| Sbjct: 166 catggtacaaaattcaataaactctt 191
>gb|AC106895.5| Homo sapiens BAC clone RP11-161D15 from 4, complete sequence Length = 135450 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 29358 catatatatgtatgtatgtgtg 29379 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 atatatatgtatgtatgtgtg 204 ||||||||||||||||||||| Sbjct: 75932 atatatatgtatgtatgtgtg 75912
>gb|AC007709.4|AC007709 Drosophila melanogaster, chromosome 3R, region 86E-86E, BAC clone BACR13P08, complete sequence Length = 169707 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 90871 catatatatgtatgtatgtgtg 90850
>gb|AC010744.7| Homo sapiens BAC clone RP11-548D17 from 2, complete sequence Length = 186687 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 85893 catatatatgtatgtatgtgtg 85872 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 atatatatgtatgtatgtgtg 204 ||||||||||||||||||||| Sbjct: 134261 atatatatgtatgtatgtgtg 134281
>gb|AC153948.5| Mus musculus 10 BAC RP24-507K2 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 130550 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 catatatatgtatgtatgtgtg 204 |||||||||||||||||||||| Sbjct: 7379 catatatatgtatgtatgtgtg 7400 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,103,775 Number of Sequences: 3902068 Number of extensions: 4103775 Number of successful extensions: 242189 Number of sequences better than 10.0: 1987 Number of HSP's better than 10.0 without gapping: 2004 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 227622 Number of HSP's gapped (non-prelim): 14328 length of query: 442 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 420 effective length of database: 17,147,199,772 effective search space: 7201823904240 effective search space used: 7201823904240 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)