>dbj|AB042069.1| Triticum aestivum rbcS gene for ribulose-1,5-bisphosphate
carboxylase/oxygenase small subunit, complete cds,
clone:6, subclone:16
Length = 5980
Score = 60.0 bits (30), Expect = 1e-06
Identities = 95/115 (82%), Gaps = 6/115 (5%)
Strand = Plus / Minus
Query: 3 acacaggtgtngnatgtgtgtaggcggtgctagaattgacatatgcatatatgctncaca 62
|||| ||||| | || ||||||| ||||||||||||| |||||||| ||||| ||||
Sbjct: 1445 acactggtgttgtatatgtgtagccggtgctagaatttacatatgc----atgctccaca 1390
Query: 63 acactatgctcgtgcatacacagatcatagagaa-gaaaatnatgctctggtcgg 116
|| ||||| |||| || |||||||||||| ||| ||||| |||||||||||||
Sbjct: 1389 ac-ctatgttcgtacaaacacagatcataccgaaggaaaaatatgctctggtcgg 1336
>emb|AL845173.4| Mouse DNA sequence from clone RP23-322G1 on chromosome 2, complete
sequence
Length = 194770
Score = 38.2 bits (19), Expect = 5.3
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 36 aattgacatatgcatatat 54
|||||||||||||||||||
Sbjct: 57522 aattgacatatgcatatat 57540
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 746,208
Number of Sequences: 3902068
Number of extensions: 746208
Number of successful extensions: 56777
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 56742
Number of HSP's gapped (non-prelim): 33
length of query: 116
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 95
effective length of database: 17,151,101,840
effective search space: 1629354674800
effective search space used: 1629354674800
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)