| Clone Name | rbasd2a01 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY074784.1| Triticum aestivum dehydroascorbate reductase (DHAR) mRNA, complete cds Length = 956 Score = 224 bits (113), Expect = 2e-55 Identities = 128/133 (96%) Strand = Plus / Minus Query: 256 ggcgggggagcttacgggttcaccttcggcgcccacccggcgatcaggttctccttggtc 315 |||||| | |||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct: 724 ggcgggagggcttacgggttcactttcggcgcccacccggcgatcaggttctccttggtc 665 Query: 316 ggcttggtcttgacgaacgactcgcggctgaagagagcctcggtgtaggcatggacgctg 375 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 664 gccttggtcttgacgaacgactcgcggctgaagagagcctcggtgtaggcatggacgctg 605 Query: 376 gtcagtgtttcag 388 ||||| ||||||| Sbjct: 604 gtcagggtttcag 592 Score = 44.1 bits (22), Expect = 0.33 Identities = 22/22 (100%) Strand = Plus / Minus Query: 146 aggctcgctcgcattattccaa 167 |||||||||||||||||||||| Sbjct: 806 aggctcgctcgcattattccaa 785
>gb|DQ090998.1| Puccinellia tenuiflora dehydroascorbate reductase protein mRNA, partial cds Length = 202 Score = 163 bits (82), Expect = 5e-37 Identities = 112/122 (91%) Strand = Plus / Minus Query: 265 gcttacgggttcaccttcggcgcccacccggcgatcaggttctccttggtcggcttggtc 324 |||||||||||||| || |||||||| ||||||||||||||||||||||| ||||||||| Sbjct: 200 gcttacgggttcactttgggcgcccatccggcgatcaggttctccttggtgggcttggtc 141 Query: 325 ttgacgaacgactcgcggctgaagagagcctcggtgtaggcatggacgctggtcagtgtt 384 |||||||| || || |||||||| ||||||| |||||||||||||||||||||||| ||| Sbjct: 140 ttgacgaaggattcccggctgaacagagccttggtgtaggcatggacgctggtcagggtt 81 Query: 385 tc 386 || Sbjct: 80 tc 79
>gb|DQ093638.1| Eustoma grandiflorum dehydroascorbate reductase protein mRNA, partial cds Length = 195 Score = 157 bits (79), Expect = 3e-35 Identities = 109/119 (91%) Strand = Plus / Minus Query: 270 cgggttcaccttcggcgcccacccggcgatcaggttctccttggtcggcttggtcttgac 329 ||||||||| || |||||||| ||||||||||||||||||||||| |||||||||||||| Sbjct: 195 cgggttcactttgggcgcccatccggcgatcaggttctccttggtgggcttggtcttgac 136 Query: 330 gaacgactcgcggctgaagagagcctcggtgtaggcatggacgctggtcagtgtttcag 388 ||| || || |||||||| ||||||| |||||||||||||||||||||||| ||||||| Sbjct: 135 gaaggattcccggctgaacagagccttggtgtaggcatggacgctggtcagggtttcag 77
>gb|AE017283.1| Propionibacterium acnes KPA171202, complete genome Length = 2560265 Score = 44.1 bits (22), Expect = 0.33 Identities = 25/26 (96%) Strand = Plus / Minus Query: 312 ggtcggcttggtcttgacgaacgact 337 ||||||| |||||||||||||||||| Sbjct: 1119794 ggtcggcctggtcttgacgaacgact 1119769
>gb|AC109221.32| Mus musculus chromosome 7, clone RP23-207N2, complete sequence Length = 195657 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 80 agccaggcagggggcagacag 100 ||||||||||||||||||||| Sbjct: 71257 agccaggcagggggcagacag 71277
>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome Length = 3566135 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 269 acgggttcaccttcggcgccc 289 ||||||||||||||||||||| Sbjct: 209716 acgggttcaccttcggcgccc 209736
>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome Length = 4109442 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 308 ccttggtcggcttggtcttg 327 |||||||||||||||||||| Sbjct: 505341 ccttggtcggcttggtcttg 505322
>ref|XM_366481.1| Magnaporthe grisea 70-15 chromosome VII predicted protein (MG02557.4) partial mRNA Length = 966 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 315 cggcttggtcttgacgaacg 334 |||||||||||||||||||| Sbjct: 216 cggcttggtcttgacgaacg 197
>ref|XM_714685.1| Candida albicans SC5314 hypothetical protein (CaO19_14092), mRNA Length = 1569 Score = 40.1 bits (20), Expect = 5.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 207 tactactgccatcactactggcac 230 ||||||||||| |||||||||||| Sbjct: 1363 tactactgccagcactactggcac 1340
>ref|XM_714802.1| Candida albicans SC5314 hypothetical protein (CaO19_6800), mRNA Length = 1569 Score = 40.1 bits (20), Expect = 5.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 207 tactactgccatcactactggcac 230 ||||||||||| |||||||||||| Sbjct: 1363 tactactgccagcactactggcac 1340
>gb|AC144402.2| Atelerix albiventris clone LBNL4-89B6, complete sequence Length = 161430 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 127 caggcagagcacacagcaga 146 |||||||||||||||||||| Sbjct: 111810 caggcagagcacacagcaga 111829
>gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, complete sequence Length = 4895836 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 293 cggcgatcaggttctccttg 312 |||||||||||||||||||| Sbjct: 3304928 cggcgatcaggttctccttg 3304947
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome Length = 9105828 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 297 gatcaggttctccttggtcg 316 |||||||||||||||||||| Sbjct: 3814314 gatcaggttctccttggtcg 3814295
>emb|BX088727.14| Zebrafish DNA sequence from clone DKEY-218A22 in linkage group 2, complete sequence Length = 185178 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 153 ctcgcattattccaaaccca 172 |||||||||||||||||||| Sbjct: 28852 ctcgcattattccaaaccca 28833
>emb|Z84494.1|HSLUCA7 Human DNA sequence from clone XXcos-7 on chromosome 3, complete sequence Length = 16950 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 80 agccaggcagggggcagaca 99 |||||||||||||||||||| Sbjct: 12882 agccaggcagggggcagaca 12863 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,781,886 Number of Sequences: 3902068 Number of extensions: 1781886 Number of successful extensions: 33872 Number of sequences better than 10.0: 15 Number of HSP's better than 10.0 without gapping: 15 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 33734 Number of HSP's gapped (non-prelim): 138 length of query: 388 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 366 effective length of database: 17,147,199,772 effective search space: 6275875116552 effective search space used: 6275875116552 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)