ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd2a01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY074784.1| Triticum aestivum dehydroascorbate reductase (DHA... 224 2e-55
2gb|DQ090998.1| Puccinellia tenuiflora dehydroascorbate reductase... 163 5e-37
3gb|DQ093638.1| Eustoma grandiflorum dehydroascorbate reductase p... 157 3e-35
4gb|AE017283.1| Propionibacterium acnes KPA171202, complete genome 44 0.33
5gb|AC109221.32| Mus musculus chromosome 7, clone RP23-207N2, com... 42 1.3
6dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, comp... 42 1.3
7gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 40 5.2
8ref|XM_366481.1| Magnaporthe grisea 70-15 chromosome VII predict... 40 5.2
9ref|XM_714685.1| Candida albicans SC5314 hypothetical protein (C... 40 5.2
10ref|XM_714802.1| Candida albicans SC5314 hypothetical protein (C... 40 5.2
11gb|AC144402.2| Atelerix albiventris clone LBNL4-89B6, complete s... 40 5.2
12gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, compl... 40 5.2
13dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 40 5.2
14emb|BX088727.14| Zebrafish DNA sequence from clone DKEY-218A22 i... 40 5.2
15emb|Z84494.1|HSLUCA7 Human DNA sequence from clone XXcos-7 on ch... 40 5.2

>gb|AY074784.1| Triticum aestivum dehydroascorbate reductase (DHAR) mRNA, complete
           cds
          Length = 956

 Score =  224 bits (113), Expect = 2e-55
 Identities = 128/133 (96%)
 Strand = Plus / Minus

                                                                       
Query: 256 ggcgggggagcttacgggttcaccttcggcgcccacccggcgatcaggttctccttggtc 315
           |||||| | |||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 724 ggcgggagggcttacgggttcactttcggcgcccacccggcgatcaggttctccttggtc 665

                                                                       
Query: 316 ggcttggtcttgacgaacgactcgcggctgaagagagcctcggtgtaggcatggacgctg 375
           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 664 gccttggtcttgacgaacgactcgcggctgaagagagcctcggtgtaggcatggacgctg 605

                        
Query: 376 gtcagtgtttcag 388
           ||||| |||||||
Sbjct: 604 gtcagggtttcag 592



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 146 aggctcgctcgcattattccaa 167
           ||||||||||||||||||||||
Sbjct: 806 aggctcgctcgcattattccaa 785



to top

>gb|DQ090998.1| Puccinellia tenuiflora dehydroascorbate reductase protein mRNA,
           partial cds
          Length = 202

 Score =  163 bits (82), Expect = 5e-37
 Identities = 112/122 (91%)
 Strand = Plus / Minus

                                                                       
Query: 265 gcttacgggttcaccttcggcgcccacccggcgatcaggttctccttggtcggcttggtc 324
           |||||||||||||| || |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 200 gcttacgggttcactttgggcgcccatccggcgatcaggttctccttggtgggcttggtc 141

                                                                       
Query: 325 ttgacgaacgactcgcggctgaagagagcctcggtgtaggcatggacgctggtcagtgtt 384
           |||||||| || || |||||||| ||||||| |||||||||||||||||||||||| |||
Sbjct: 140 ttgacgaaggattcccggctgaacagagccttggtgtaggcatggacgctggtcagggtt 81

             
Query: 385 tc 386
           ||
Sbjct: 80  tc 79



to top

>gb|DQ093638.1| Eustoma grandiflorum dehydroascorbate reductase protein mRNA,
           partial cds
          Length = 195

 Score =  157 bits (79), Expect = 3e-35
 Identities = 109/119 (91%)
 Strand = Plus / Minus

                                                                       
Query: 270 cgggttcaccttcggcgcccacccggcgatcaggttctccttggtcggcttggtcttgac 329
           ||||||||| || |||||||| ||||||||||||||||||||||| ||||||||||||||
Sbjct: 195 cgggttcactttgggcgcccatccggcgatcaggttctccttggtgggcttggtcttgac 136

                                                                      
Query: 330 gaacgactcgcggctgaagagagcctcggtgtaggcatggacgctggtcagtgtttcag 388
           ||| || || |||||||| ||||||| |||||||||||||||||||||||| |||||||
Sbjct: 135 gaaggattcccggctgaacagagccttggtgtaggcatggacgctggtcagggtttcag 77



to top

>gb|AE017283.1| Propionibacterium acnes KPA171202, complete genome
          Length = 2560265

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 312     ggtcggcttggtcttgacgaacgact 337
               ||||||| ||||||||||||||||||
Sbjct: 1119794 ggtcggcctggtcttgacgaacgact 1119769



to top

>gb|AC109221.32| Mus musculus chromosome 7, clone RP23-207N2, complete sequence
          Length = 195657

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 80    agccaggcagggggcagacag 100
             |||||||||||||||||||||
Sbjct: 71257 agccaggcagggggcagacag 71277



to top

>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome
          Length = 3566135

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 269    acgggttcaccttcggcgccc 289
              |||||||||||||||||||||
Sbjct: 209716 acgggttcaccttcggcgccc 209736



to top

>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 308    ccttggtcggcttggtcttg 327
              ||||||||||||||||||||
Sbjct: 505341 ccttggtcggcttggtcttg 505322



to top

>ref|XM_366481.1| Magnaporthe grisea 70-15 chromosome VII predicted protein
           (MG02557.4) partial mRNA
          Length = 966

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 315 cggcttggtcttgacgaacg 334
           ||||||||||||||||||||
Sbjct: 216 cggcttggtcttgacgaacg 197



to top

>ref|XM_714685.1| Candida albicans SC5314 hypothetical protein (CaO19_14092), mRNA
          Length = 1569

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 207  tactactgccatcactactggcac 230
            ||||||||||| ||||||||||||
Sbjct: 1363 tactactgccagcactactggcac 1340



to top

>ref|XM_714802.1| Candida albicans SC5314 hypothetical protein (CaO19_6800), mRNA
          Length = 1569

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 207  tactactgccatcactactggcac 230
            ||||||||||| ||||||||||||
Sbjct: 1363 tactactgccagcactactggcac 1340



to top

>gb|AC144402.2| Atelerix albiventris clone LBNL4-89B6, complete sequence
          Length = 161430

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 127    caggcagagcacacagcaga 146
              ||||||||||||||||||||
Sbjct: 111810 caggcagagcacacagcaga 111829



to top

>gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, complete sequence
          Length = 4895836

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 293     cggcgatcaggttctccttg 312
               ||||||||||||||||||||
Sbjct: 3304928 cggcgatcaggttctccttg 3304947



to top

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 297     gatcaggttctccttggtcg 316
               ||||||||||||||||||||
Sbjct: 3814314 gatcaggttctccttggtcg 3814295



to top

>emb|BX088727.14| Zebrafish DNA sequence from clone DKEY-218A22 in linkage group 2,
             complete sequence
          Length = 185178

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 153   ctcgcattattccaaaccca 172
             ||||||||||||||||||||
Sbjct: 28852 ctcgcattattccaaaccca 28833



to top

>emb|Z84494.1|HSLUCA7 Human DNA sequence from clone XXcos-7 on chromosome 3, complete
             sequence
          Length = 16950

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 80    agccaggcagggggcagaca 99
             ||||||||||||||||||||
Sbjct: 12882 agccaggcagggggcagaca 12863


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,781,886
Number of Sequences: 3902068
Number of extensions: 1781886
Number of successful extensions: 33872
Number of sequences better than 10.0: 15
Number of HSP's better than 10.0 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 33734
Number of HSP's gapped (non-prelim): 138
length of query: 388
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 366
effective length of database: 17,147,199,772
effective search space: 6275875116552
effective search space used: 6275875116552
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top