| Clone Name | rbaal8m07 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_476775.1| Oryza sativa (japonica cultivar-group), mRNA Length = 363 Score = 240 bits (121), Expect = 4e-60 Identities = 227/261 (86%), Gaps = 1/261 (0%) Strand = Plus / Minus Query: 284 tcttctcgtcctcaaaagcttgcttcaggttctcgagctccttgtctagatcattgattg 343 ||||||| ||||||||||||||||| || ||||| ||||||||||||| ||||||||||| Sbjct: 328 tcttctcatcctcaaaagcttgcttgagattctcaagctccttgtctaaatcattgattg 269 Query: 344 cttgggtatacgccctgcgttggggaggattggcttgcagtatggatcctaacaatgatc 403 | || || ||||| || || |||| ||| ||| |||||||||||| ||| |||| |||| Sbjct: 268 cctgtgtgtacgct-tgagtaggggtggactggtttgcagtatggaccctgacaaggatc 210 Query: 404 ttgtactgaagggggtgaggcagcttatagccagcaaagtgaacatttgggtccctgtgc 463 |||||||||||||| ||||| |||||||| ||||||||| | || |||||||||||||| Sbjct: 209 ttgtactgaaggggatgagggagcttataaccagcaaagaggacgtttgggtccctgtgg 150 Query: 464 aactgcatgcggaggatgttgccgatggtgtggtcttcacgttcaattgtgaaagatgca 523 | ||||||||||||||||||||| ||||||||||| ||||| ||||||||||| || || Sbjct: 149 agctgcatgcggaggatgttgccaatggtgtggtcctcacgctcaattgtgaatgaccca 90 Query: 524 gcattcatgatctttgtatcc 544 ||||||| |||||||||||| Sbjct: 89 gcattcacaatctttgtatcc 69
>dbj|AK099622.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013053F13, full insert sequence Length = 787 Score = 240 bits (121), Expect = 4e-60 Identities = 227/261 (86%), Gaps = 1/261 (0%) Strand = Plus / Minus Query: 284 tcttctcgtcctcaaaagcttgcttcaggttctcgagctccttgtctagatcattgattg 343 ||||||| ||||||||||||||||| || ||||| ||||||||||||| ||||||||||| Sbjct: 505 tcttctcatcctcaaaagcttgcttgagattctcaagctccttgtctaaatcattgattg 446 Query: 344 cttgggtatacgccctgcgttggggaggattggcttgcagtatggatcctaacaatgatc 403 | || || ||||| || || |||| ||| ||| |||||||||||| ||| |||| |||| Sbjct: 445 cctgtgtgtacgct-tgagtaggggtggactggtttgcagtatggaccctgacaaggatc 387 Query: 404 ttgtactgaagggggtgaggcagcttatagccagcaaagtgaacatttgggtccctgtgc 463 |||||||||||||| ||||| |||||||| ||||||||| | || |||||||||||||| Sbjct: 386 ttgtactgaaggggatgagggagcttataaccagcaaagaggacgtttgggtccctgtgg 327 Query: 464 aactgcatgcggaggatgttgccgatggtgtggtcttcacgttcaattgtgaaagatgca 523 | ||||||||||||||||||||| ||||||||||| ||||| ||||||||||| || || Sbjct: 326 agctgcatgcggaggatgttgccaatggtgtggtcctcacgctcaattgtgaatgaccca 267 Query: 524 gcattcatgatctttgtatcc 544 ||||||| |||||||||||| Sbjct: 266 gcattcacaatctttgtatcc 246
>dbj|AK068132.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013131J17, full insert sequence Length = 812 Score = 240 bits (121), Expect = 4e-60 Identities = 227/261 (86%), Gaps = 1/261 (0%) Strand = Plus / Minus Query: 284 tcttctcgtcctcaaaagcttgcttcaggttctcgagctccttgtctagatcattgattg 343 ||||||| ||||||||||||||||| || ||||| ||||||||||||| ||||||||||| Sbjct: 507 tcttctcatcctcaaaagcttgcttgagattctcaagctccttgtctaaatcattgattg 448 Query: 344 cttgggtatacgccctgcgttggggaggattggcttgcagtatggatcctaacaatgatc 403 | || || ||||| || || |||| ||| ||| |||||||||||| ||| |||| |||| Sbjct: 447 cctgtgtgtacgct-tgagtaggggtggactggtttgcagtatggaccctgacaaggatc 389 Query: 404 ttgtactgaagggggtgaggcagcttatagccagcaaagtgaacatttgggtccctgtgc 463 |||||||||||||| ||||| |||||||| ||||||||| | || |||||||||||||| Sbjct: 388 ttgtactgaaggggatgagggagcttataaccagcaaagaggacgtttgggtccctgtgg 329 Query: 464 aactgcatgcggaggatgttgccgatggtgtggtcttcacgttcaattgtgaaagatgca 523 | ||||||||||||||||||||| ||||||||||| ||||| ||||||||||| || || Sbjct: 328 agctgcatgcggaggatgttgccaatggtgtggtcctcacgctcaattgtgaatgaccca 269 Query: 524 gcattcatgatctttgtatcc 544 ||||||| |||||||||||| Sbjct: 268 gcattcacaatctttgtatcc 248
>gb|BT017828.1| Zea mays clone EL01N0508G02.c mRNA sequence Length = 731 Score = 226 bits (114), Expect = 6e-56 Identities = 229/266 (86%), Gaps = 1/266 (0%) Strand = Plus / Minus Query: 284 tcttctcgtcctcaaaagcttgcttcaggttctcgagctccttgtctagatcattgattg 343 ||||||| ||||||||||||||||| |||| ||| ||||| ||||||||||||||||| | Sbjct: 525 tcttctcatcctcaaaagcttgcttaaggtactcaagctctttgtctagatcattgatag 466 Query: 344 cttgggtatacgccctgcgttggggaggattggcttgcagtatggatcctaacaatgatc 403 | ||||| || ||| ||||| |||||||| ||||| | || |||||||||||||||||| Sbjct: 465 cctgggtgtaggcc-tgcgtcggggaggactggctcgttgtgtggatcctaacaatgatc 407 Query: 404 ttgtactgaagggggtgaggcagcttatagccagcaaagtgaacatttgggtccctgtgc 463 |||||||| || |||||||| |||||||| || |||||| ||||||||||||| |||||| Sbjct: 406 ttgtactggagtgggtgagggagcttatacccggcaaagagaacatttgggtctctgtgc 347 Query: 464 aactgcatgcggaggatgttgccgatggtgtggtcttcacgttcaattgtgaaagatgca 523 ||||||||||||||||| ||||| | ||||| || || ||||| | ||||| |||||| Sbjct: 346 aactgcatgcggaggatattgcctacagtgtgatcctcgcgttcgacagtgaatgatgca 287 Query: 524 gcattcatgatctttgtatccttctc 549 ||||||| |||||||||||| |||| Sbjct: 286 gcattcacaatctttgtatccctctc 261
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 87.7 bits (44), Expect = 4e-14 Identities = 68/76 (89%) Strand = Plus / Plus Query: 469 catgcggaggatgttgccgatggtgtggtcttcacgttcaattgtgaaagatgcagcatt 528 |||||||||||||||||| ||||||||||| ||||| ||||||||||| || ||||||| Sbjct: 3847143 catgcggaggatgttgccaatggtgtggtcctcacgctcaattgtgaatgacccagcatt 3847202 Query: 529 catgatctttgtatcc 544 || |||||||||||| Sbjct: 3847203 cacaatctttgtatcc 3847218 Score = 79.8 bits (40), Expect = 9e-12 Identities = 61/68 (89%) Strand = Plus / Plus Query: 395 acaatgatcttgtactgaagggggtgaggcagcttatagccagcaaagtgaacatttggg 454 |||| |||||||||||||||||| ||||| |||||||| ||||||||| | || |||||| Sbjct: 3846984 acaaggatcttgtactgaaggggatgagggagcttataaccagcaaagaggacgtttggg 3847043 Query: 455 tccctgtg 462 |||||||| Sbjct: 3847044 tccctgtg 3847051 Score = 73.8 bits (37), Expect = 5e-10 Identities = 83/97 (85%), Gaps = 1/97 (1%) Strand = Plus / Plus Query: 293 cctcaaaagcttgcttcaggttctcgagctccttgtctagatcattgattgcttgggtat 352 |||||||||||||||| || ||||| ||||||||||||| |||||||||||| || || | Sbjct: 3846803 cctcaaaagcttgcttgagattctcaagctccttgtctaaatcattgattgcctgtgtgt 3846862 Query: 353 acgccctgcgttggggaggattggcttgcagtatgga 389 ||| | || || |||| ||| ||| |||||||||||| Sbjct: 3846863 acg-cttgagtaggggtggactggtttgcagtatgga 3846898
>dbj|AP004670.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0496D04 Length = 197358 Score = 87.7 bits (44), Expect = 4e-14 Identities = 68/76 (89%) Strand = Plus / Plus Query: 469 catgcggaggatgttgccgatggtgtggtcttcacgttcaattgtgaaagatgcagcatt 528 |||||||||||||||||| ||||||||||| ||||| ||||||||||| || ||||||| Sbjct: 86255 catgcggaggatgttgccaatggtgtggtcctcacgctcaattgtgaatgacccagcatt 86314 Query: 529 catgatctttgtatcc 544 || |||||||||||| Sbjct: 86315 cacaatctttgtatcc 86330 Score = 79.8 bits (40), Expect = 9e-12 Identities = 61/68 (89%) Strand = Plus / Plus Query: 395 acaatgatcttgtactgaagggggtgaggcagcttatagccagcaaagtgaacatttggg 454 |||| |||||||||||||||||| ||||| |||||||| ||||||||| | || |||||| Sbjct: 86096 acaaggatcttgtactgaaggggatgagggagcttataaccagcaaagaggacgtttggg 86155 Query: 455 tccctgtg 462 |||||||| Sbjct: 86156 tccctgtg 86163 Score = 73.8 bits (37), Expect = 5e-10 Identities = 83/97 (85%), Gaps = 1/97 (1%) Strand = Plus / Plus Query: 293 cctcaaaagcttgcttcaggttctcgagctccttgtctagatcattgattgcttgggtat 352 |||||||||||||||| || ||||| ||||||||||||| |||||||||||| || || | Sbjct: 85915 cctcaaaagcttgcttgagattctcaagctccttgtctaaatcattgattgcctgtgtgt 85974 Query: 353 acgccctgcgttggggaggattggcttgcagtatgga 389 ||| | || || |||| ||| ||| |||||||||||| Sbjct: 85975 acg-cttgagtaggggtggactggtttgcagtatgga 86010
>dbj|AP006144.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT23P21, TM0261, complete sequence Length = 121882 Score = 52.0 bits (26), Expect = 0.002 Identities = 65/78 (83%) Strand = Plus / Minus Query: 473 cggaggatgttgccgatggtgtggtcttcacgttcaattgtgaaagatgcagcattcatg 532 ||||||||||| ||||||||||| || || || || || ||||| ||||| ||||| ||| Sbjct: 40428 cggaggatgtttccgatggtgtgatcctctcgctctatggtgaacgatgccgcattgatg 40369 Query: 533 atctttgtatccttctcg 550 ||||| || ||| ||||| Sbjct: 40368 atcttggtgtccctctcg 40351
>gb|AC160340.2| Mus musculus BAC clone RP23-436E24 from chromosome 12, complete sequence Length = 209911 Score = 44.1 bits (22), Expect = 0.48 Identities = 25/26 (96%) Strand = Plus / Plus Query: 186 aggagttcagagactcatcgactagc 211 |||||||||||||||||| ||||||| Sbjct: 57811 aggagttcagagactcatagactagc 57836
>emb|AL157409.16| Human DNA sequence from clone RP5-823D19 on chromosome 1q42.11-43 Contains the 5' end of the SIPA1L2 gene for signal-induced proliferation-associated 1 like 2, complete sequence Length = 143798 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 452 gggtccctgtgcaactgcatg 472 ||||||||||||||||||||| Sbjct: 22867 gggtccctgtgcaactgcatg 22887
>gb|AC132516.4| Homo sapiens 3 BAC RP11-264A3 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 66262 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 451 tgggtccctgtgcaactgcat 471 ||||||||||||||||||||| Sbjct: 57078 tgggtccctgtgcaactgcat 57058
>gb|AC116301.8| Homo sapiens 3 BAC RP11-625D20 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 62190 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 451 tgggtccctgtgcaactgcat 471 ||||||||||||||||||||| Sbjct: 53007 tgggtccctgtgcaactgcat 52987
>ref|XM_776377.1| PREDICTED: Strongylocentrotus purpuratus similar to anaphase-promoting complex subunit 7 (LOC576029), mRNA Length = 738 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 381 cagtatggatcctaacaatga 401 ||||||||||||||||||||| Sbjct: 483 cagtatggatcctaacaatga 503
>emb|AL627392.12| Mouse DNA sequence from clone RP23-185I12 on chromosome 4, complete sequence Length = 182520 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 514 gaaagatgcagcattcatgatcttt 538 |||| |||||||||||||||||||| Sbjct: 115113 gaaaaatgcagcattcatgatcttt 115137
>gb|AC092110.9| Homo sapiens 12 BAC RP11-287J11 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 181207 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 527 ttcatgatctttgtatcctt 546 |||||||||||||||||||| Sbjct: 23174 ttcatgatctttgtatcctt 23155 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,439,079 Number of Sequences: 3902068 Number of extensions: 3439079 Number of successful extensions: 57540 Number of sequences better than 10.0: 14 Number of HSP's better than 10.0 without gapping: 14 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 57495 Number of HSP's gapped (non-prelim): 41 length of query: 554 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 531 effective length of database: 17,143,297,704 effective search space: 9103091080824 effective search space used: 9103091080824 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)