Clone Information

BLAST Search Result

Clone Name	rbaal41l10
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	emb\|AL021394.10\|HS237J2 Human DNA sequence from clone RP1-237J2 ...	46	0.13
2	dbj\|AB020752.1\| Arabidopsis thaliana genomic DNA, chromosome 5, ...	46	0.13
3	dbj\|AP000919.6\| Homo sapiens genomic DNA, chromosome 18 clone:RP...	46	0.13
4	emb\|AL353994.1\|ATF17I14 Arabidopsis thaliana DNA chromosome 5, B...	46	0.13
5	dbj\|AP005431.3\| Homo sapiens genomic DNA, chromosome 18 clone:RP...	46	0.13
6	dbj\|AP004959.1\| Lotus japonicus genomic DNA, chromosome 3, clone...	46	0.13
7	gb\|AC155712.8\| Mus musculus 10 BAC RP24-183O8 (Roswell Park Canc...	42	2.1
8	gb\|AC162466.6\| Mus musculus 6 BAC RP23-196O2 (Roswell Park Cance...	42	2.1
9	gb\|AC125025.7\| Mus musculus chromosome 5, clone RP24-340K5, comp...	42	2.1
10	gb\|AC165316.4\| Mus musculus chromosome 5, clone RP23-168G13, com...	42	2.1
11	gb\|AC122405.4\| Mus musculus BAC clone RP24-119O6 from chromosome...	42	2.1
12	gb\|AC146651.10\| Medicago truncatula clone mth2-113d3, complete s...	42	2.1
13	emb\|BX004968.20\| Zebrafish DNA sequence from clone DKEY-35I13 in...	42	2.1
14	gb\|AC093233.1\| Homo sapiens chromosome 19 clone LLNLR-257D11, co...	42	2.1
15	gb\|AC153596.5\| Mus musculus 6 BAC RP23-305C1 (Roswell Park Cance...	42	2.1
16	gb\|AC092310.2\| Homo sapiens chromosome 19 clone LLNLR-253H10, co...	42	2.1
17	gb\|AC013439.11\| Homo sapiens BAC clone RP11-270G18 from 2, compl...	42	2.1
18	gb\|AC010323.8\| Homo sapiens chromosome 19 clone CTD-2550O8, comp...	42	2.1
19	gb\|AC073575.30\| Homo sapiens 12 PAC RP1-267L14 (Roswell Park Can...	42	2.1
20	gb\|AF218055.1\|AF218055 Staphylococcus chromogenes metalloproteas...	42	2.1
21	emb\|AL158059.3\|CNS01RGK Human chromosome 14 DNA sequence BAC C-2...	42	2.1
22	ref\|NM_022666.1\| Rattus norvegicus glutamate receptor, metabotro...	40	8.2
23	gb\|AC008337.8\| Drosophila melanogaster clone BACR02B03, complete...	40	8.2
24	gb\|AC142167.4\| Mus musculus BAC clone RP24-117F4 from chromosome...	40	8.2
25	emb\|Z50177.1\|CEF46G10 Caenorhabditis elegans Cosmid F46G10, comp...	40	8.2
26	gb\|AC125176.4\| Mus musculus BAC clone RP24-574O24 from chromosom...	40	8.2
27	gb\|AC123935.4\| Mus musculus BAC clone RP23-354J3 from chromosome...	40	8.2
28	gb\|U47331.1\|RNU47331 Rattus norvegicus metabotropic glutamate re...	40	8.2
29	emb\|AL357083.19\| Human DNA sequence from clone RP11-562P17 on ch...	40	8.2
30	emb\|AL939113.1\|SCO939113 Streptomyces coelicolor A3(2) complete ...	40	8.2
31	emb\|AJ303141.2\|ECO303141 Escherichia coli pathogenicity island I	40	8.2
32	emb\|AJ277443.1\|ECO277443 Escherichia coli DNA for locus of enter...	40	8.2
33	emb\|BX005124.7\| Zebrafish DNA sequence from clone CH211-284A16 i...	40	8.2
34	emb\|AJ633130.1\| Escherichia coli locus of enterocyte effacement,...	40	8.2
35	emb\|AJ633129.1\| Escherichia coli locus of enterocyte effacement,...	40	8.2
36	emb\|BX537141.17\| Zebrafish DNA sequence from clone DKEY-9E8 in l...	40	8.2
37	gb\|AC024367.7\| Homo sapiens chromosome 8, clone RP11-75G10, comp...	40	8.2
38	gb\|AF311901.1\|AF311901 Citrobacter rodentium strain DBS100 patho...	40	8.2
39	dbj\|AP008213.1\| Oryza sativa (japonica cultivar-group) genomic D...	40	8.2
40	gb\|AF200363.1\|AF200363 Escherichia coli Ler (ler), EscR (escR), ...	40	8.2
41	gb\|AF453441.1\| Escherichia coli CadC (cadC) gene, partial cds; t...	40	8.2
42	dbj\|AP005248.4\| Oryza sativa (japonica cultivar-group) genomic D...	40	8.2
43	gb\|AC015853.8\|AC015853 Homo sapiens chromosome 17, clone RP5-102...	40	8.2
44	gb\|AC024810.1\| Caenorhabditis elegans cosmid Y54E10A, complete s...	40	8.2
45	gb\|AE001437.1\| Clostridium acetobutylicum ATCC 824, complete genome	40	8.2
46	emb\|BX511203.3\| Rattus norvegicus chromosome 1 clone RN-79C10, c...	40	8.2
47	emb\|CR925754.15\| Zebrafish DNA sequence from clone CH211-148J16 ...	40	8.2
48	gb\|AE003511.4\| Drosophila melanogaster chromosome X, section 63 ...	40	8.2
49	dbj\|AP002427.4\| Homo sapiens genomic DNA, chromosome 11 clone:RP...	40	8.2
50	gb\|AC113058.6\| Mus musculus chromosome 6, clone RP23-253C24, com...	40	8.2
51	gb\|AF022236.1\|AF022236 Escherichia coli strain E2348/69 pathogen...	40	8.2
52	gb\|AF071034.1\|AF071034 Escherichia coli L0001 (yicJ) gene, parti...	40	8.2
53	gb\|AE005174.2\| Escherichia coli O157:H7 EDL933, complete genome	40	8.2
54	dbj\|BA000007.2\| Escherichia coli O157:H7 DNA, complete genome	40	8.2
55	gb\|M90518.1\|RATMGLUR4A Rat metabotropic glutamate receptor (GLUR...	40	8.2
56	emb\|AJ312780.1\|AME312780 Anthemis melampodina internal transcrib...	40	8.2
57	emb\|AL683897.5\| Mouse DNA sequence from clone RP23-208E23 on chr...	40	8.2
58	emb\|AL645791.14\| Mouse DNA sequence from clone RP23-465A12 on ch...	40	8.2

>emb|AL021394.10|HS237J2 Human DNA sequence from clone RP1-237J2 on chromosome 20q12-13.13
             Contains part of the NCOA3 gene for nuclear receptor
             coactivator 3 and a CpG island, complete sequence
          Length = 68589

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 117   acccaagtccaaacataaaattc 139
             |||||||||||||||||||||||
Sbjct: 65673 acccaagtccaaacataaaattc 65651

to top

>dbj|AB020752.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MTH16
          Length = 68098

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 119   ccaagtccaaacataaaattctg 141
             |||||||||||||||||||||||
Sbjct: 63777 ccaagtccaaacataaaattctg 63799

to top

>dbj|AP000919.6| Homo sapiens genomic DNA, chromosome 18 clone:RP11-737O24, complete
              sequence
          Length = 184440

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 117    acccaagtccaaacataaaattc 139
              |||||||||||||||||||||||
Sbjct: 155014 acccaagtccaaacataaaattc 155036

to top

>emb|AL353994.1|ATF17I14 Arabidopsis thaliana DNA chromosome 5, BAC clone F17I14 (ESSA
            project)
          Length = 92491

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 119  ccaagtccaaacataaaattctg 141
            |||||||||||||||||||||||
Sbjct: 5807 ccaagtccaaacataaaattctg 5785

to top

>dbj|AP005431.3| Homo sapiens genomic DNA, chromosome 18 clone:RP11-193E15, complete
             sequence
          Length = 177785

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 117   acccaagtccaaacataaaattc 139
             |||||||||||||||||||||||
Sbjct: 31093 acccaagtccaaacataaaattc 31115

to top

>dbj|AP004959.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT21I12, TM0136,
             complete sequence
          Length = 81332

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 75    ttaactatgacaaaatctgaaag 97
             |||||||||||||||||||||||
Sbjct: 50264 ttaactatgacaaaatctgaaag 50286

to top

>gb|AC155712.8| Mus musculus 10 BAC RP24-183O8 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 151709

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 110   tacattcacccaagtccaaacataaaatt 138
             |||||||||||| ||||| ||||||||||
Sbjct: 52965 tacattcacccatgtccacacataaaatt 52937

to top

>gb|AC162466.6| Mus musculus 6 BAC RP23-196O2 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 186817

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 386   caaataaatactctaaagaaa 406
             |||||||||||||||||||||
Sbjct: 17475 caaataaatactctaaagaaa 17455

to top

>gb|AC125025.7| Mus musculus chromosome 5, clone RP24-340K5, complete sequence
          Length = 175313

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 433    taaaggggccaactcaaaatt 453
              |||||||||||||||||||||
Sbjct: 110133 taaaggggccaactcaaaatt 110153

to top

>gb|AC165316.4| Mus musculus chromosome 5, clone RP23-168G13, complete sequence
          Length = 205237

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 433    taaaggggccaactcaaaatt 453
              |||||||||||||||||||||
Sbjct: 191925 taaaggggccaactcaaaatt 191945

to top

>gb|AC122405.4| Mus musculus BAC clone RP24-119O6 from chromosome 12, complete sequence
          Length = 196285

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 465    taactcatttttcagatataa 485
              |||||||||||||||||||||
Sbjct: 114546 taactcatttttcagatataa 114526

to top

>gb|AC146651.10| Medicago truncatula clone mth2-113d3, complete sequence
          Length = 157296

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 42   atatactttatcacattataa 62
            |||||||||||||||||||||
Sbjct: 5563 atatactttatcacattataa 5583

to top

>emb|BX004968.20| Zebrafish DNA sequence from clone DKEY-35I13 in linkage group 15,
              complete sequence
          Length = 208706

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 123    gtccaaacataaaattctgtc 143
              |||||||||||||||||||||
Sbjct: 100333 gtccaaacataaaattctgtc 100353

to top

>gb|AC093233.1| Homo sapiens chromosome 19 clone LLNLR-257D11, complete sequence
          Length = 47090

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 398   ctaaagaaaccttgaaacttt 418
             |||||||||||||||||||||
Sbjct: 39112 ctaaagaaaccttgaaacttt 39132

to top

>gb|AC153596.5| Mus musculus 6 BAC RP23-305C1 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 148062

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 386   caaataaatactctaaagaaa 406
             |||||||||||||||||||||
Sbjct: 62104 caaataaatactctaaagaaa 62124

to top

>gb|AC092310.2| Homo sapiens chromosome 19 clone LLNLR-253H10, complete sequence
          Length = 47090

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 398  ctaaagaaaccttgaaacttt 418
            |||||||||||||||||||||
Sbjct: 7979 ctaaagaaaccttgaaacttt 7959

to top

>gb|AC013439.11| Homo sapiens BAC clone RP11-270G18 from 2, complete sequence
          Length = 167891

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 133   aaaattctgtccaacatagta 153
             |||||||||||||||||||||
Sbjct: 47165 aaaattctgtccaacatagta 47145

to top

>gb|AC010323.8| Homo sapiens chromosome 19 clone CTD-2550O8, complete sequence
          Length = 166618

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 398   ctaaagaaaccttgaaacttt 418
             |||||||||||||||||||||
Sbjct: 88153 ctaaagaaaccttgaaacttt 88173

to top

>gb|AC073575.30| Homo sapiens 12 PAC RP1-267L14 (Roswell Park Cancer Institute Human PAC
             Library) complete sequence
          Length = 173718

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 379   aacgacacaaataaatactct 399
             |||||||||||||||||||||
Sbjct: 31768 aacgacacaaataaatactct 31748

to top

>gb|AF218055.1|AF218055 Staphylococcus chromogenes metalloprotease (scp) gene, complete cds
          Length = 1506

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 109  ttacattcacccaagtccaaa 129
            |||||||||||||||||||||
Sbjct: 1170 ttacattcacccaagtccaaa 1190

to top

>emb|AL158059.3|CNS01RGK Human chromosome 14 DNA sequence BAC C-2007A10 of library CalTech-D from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 148515

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 465    taactcatttttcagatataa 485
              |||||||||||||||||||||
Sbjct: 100544 taactcatttttcagatataa 100524

to top

>ref|NM_022666.1| Rattus norvegicus glutamate receptor, metabotropic 4 (Grm4), mRNA
          Length = 4488

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 534 gtgcccgtgctgctgatgct 553
           ||||||||||||||||||||
Sbjct: 227 gtgcccgtgctgctgatgct 208

to top

>gb|AC008337.8| Drosophila melanogaster clone BACR02B03, complete sequence
          Length = 169680

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 383   acacaaataaatactctaaagaaa 406
             ||||||| ||||||||||||||||
Sbjct: 28637 acacaaaaaaatactctaaagaaa 28614

to top

>gb|AC142167.4| Mus musculus BAC clone RP24-117F4 from chromosome 3, complete sequence
          Length = 190937

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 238   cctctaaaattttcatgttg 257
             ||||||||||||||||||||
Sbjct: 36173 cctctaaaattttcatgttg 36192

to top

>emb|Z50177.1|CEF46G10 Caenorhabditis elegans Cosmid F46G10, complete sequence
          Length = 42223

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 409  ttgaaactttatctaaaacttatg 432
            |||||||||||||||||| |||||
Sbjct: 6602 ttgaaactttatctaaaaattatg 6625

to top

>gb|AC125176.4| Mus musculus BAC clone RP24-574O24 from chromosome 3, complete sequence
          Length = 162693

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 238   cctctaaaattttcatgttg 257
             ||||||||||||||||||||
Sbjct: 13824 cctctaaaattttcatgttg 13843

to top

>gb|AC123935.4| Mus musculus BAC clone RP23-354J3 from chromosome 13, complete sequence
          Length = 219370

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 155   aacccactttgataatttca 174
             ||||||||||||||||||||
Sbjct: 54628 aacccactttgataatttca 54609

to top

>gb|U47331.1|RNU47331 Rattus norvegicus metabotropic glutamate receptor 4b mRNA, complete
           cds
          Length = 3868

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 534 gtgcccgtgctgctgatgct 553
           ||||||||||||||||||||
Sbjct: 227 gtgcccgtgctgctgatgct 208

to top

>emb|AL357083.19| Human DNA sequence from clone RP11-562P17 on chromosome 13 Contains part
              of the NEAB gene for neurobeachin (BCL8B FLJ10197 KIAA1544)
              and a prohibitin (PHB) pseudogene, complete sequence
          Length = 134156

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 415    ctttatctaaaacttatgta 434
              ||||||||||||||||||||
Sbjct: 103723 ctttatctaaaacttatgta 103742

to top

>emb|AL939113.1|SCO939113 Streptomyces coelicolor A3(2) complete genome; segment 10/29
          Length = 310550

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 532    gtgtgcccgtgctgctgatg 551
              ||||||||||||||||||||
Sbjct: 201588 gtgtgcccgtgctgctgatg 201569

to top

>emb|AJ303141.2|ECO303141 Escherichia coli pathogenicity island I
          Length = 112929

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 131   ataaaattctgtccaacata 150
             ||||||||||||||||||||
Sbjct: 83758 ataaaattctgtccaacata 83777

to top

>emb|AJ277443.1|ECO277443 Escherichia coli DNA for locus of enterocyte effacement II (LEE II)
          Length = 60073

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 131   ataaaattctgtccaacata 150
             ||||||||||||||||||||
Sbjct: 20123 ataaaattctgtccaacata 20104

to top

>emb|BX005124.7| Zebrafish DNA sequence from clone CH211-284A16 in linkage group 20
              Contains the 5' end of the xrn2 gene for 5'-3'
              exoribonuclease 2, a novel gene and a CpG island, complete
              sequence
          Length = 148325

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 68     cacaccattaactatgacaa 87
              ||||||||||||||||||||
Sbjct: 110264 cacaccattaactatgacaa 110245

to top

>emb|AJ633130.1| Escherichia coli locus of enterocyte effacement, strain 3431-4/86
          Length = 38091

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 131   ataaaattctgtccaacata 150
             ||||||||||||||||||||
Sbjct: 19872 ataaaattctgtccaacata 19853

to top

>emb|AJ633129.1| Escherichia coli locus of enterocyte effacement, strain 0181-6/86
          Length = 35786

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 131   ataaaattctgtccaacata 150
             ||||||||||||||||||||
Sbjct: 18560 ataaaattctgtccaacata 18541

to top

>emb|BX537141.17| Zebrafish DNA sequence from clone DKEY-9E8 in linkage group 2, complete
              sequence
          Length = 264534

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 233    aacagcctctaaaattttca 252
              ||||||||||||||||||||
Sbjct: 129230 aacagcctctaaaattttca 129211

to top

>gb|AC024367.7| Homo sapiens chromosome 8, clone RP11-75G10, complete sequence
          Length = 170022

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 245    aattttcatgttgtaactttattt 268
              |||||||| |||||||||||||||
Sbjct: 103445 aattttcaagttgtaactttattt 103468

to top

>gb|AF311901.1|AF311901 Citrobacter rodentium strain DBS100 pathogenicity island LEE, complete
             sequence
          Length = 42001

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 131   ataaaattctgtccaacata 150
             ||||||||||||||||||||
Sbjct: 18702 ataaaattctgtccaacata 18683

to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 360      ctctcaaaccgtacatccaa 379
                ||||||||||||||||||||
Sbjct: 13605354 ctctcaaaccgtacatccaa 13605335

to top

>gb|AF200363.1|AF200363 Escherichia coli Ler (ler), EscR (escR), EscS (escS), EscT (escT), EscU
             (escU), CesD (cesD), EscC (escC), EscJ (escJ), SepZ
             (sepZ), EscV (escV), EscN (escN), SepQ (sepQ), Tir (tir),
             CesT (cesT), intimin (eae), EscD (escD), SepL (sepL), EspA
             (espA), EspD (espD), EspB (espB), EscF (escF), EspF
             (espF), and putative transposase genes, complete cds; LifA
             (lifA) gene, partial cds; and unknown genes
          Length = 37889

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 131   ataaaattctgtccaacata 150
             ||||||||||||||||||||
Sbjct: 19019 ataaaattctgtccaacata 19000

to top

>gb|AF453441.1| Escherichia coli CadC (cadC) gene, partial cds; transposase 2,
             transposase 1, IS2 transposase, EspG (espG), Ler (ler),
             EscR (escR), EscS (escS), EscT (escT), EscU (escU), CesD
             (cesD), EscC (escC), SepD (sepD), EscJ (escJ), SepZ
             (sepZ), EscV (escV), EscN (escN), SepQ (sepQ), Tir (tir),
             CesT (cesT), Eae (eae), EscD (escD), SepL (sepL), EspA
             (espA), EspD (espD), EspB (espB), EscF (escF), EspF
             (espF), putative transposase, Efa1 (efa1), putative
             transposase, putative enterotoxin, putative transposase,
             putative transposase, and CP4-like integrase (int-phe)
             genes, complete cds; tRNA-Phe gene, complete sequence; and
             unknown genes
          Length = 60354

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 131   ataaaattctgtccaacata 150
             ||||||||||||||||||||
Sbjct: 21086 ataaaattctgtccaacata 21067

to top

>dbj|AP005248.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OSJNBa0084P08
          Length = 158656

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 360   ctctcaaaccgtacatccaa 379
             ||||||||||||||||||||
Sbjct: 72973 ctctcaaaccgtacatccaa 72954

to top

>gb|AC015853.8|AC015853 Homo sapiens chromosome 17, clone RP5-1029F21, complete sequence
          Length = 97351

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 402   agaaaccttgaaactttatc 421
             ||||||||||||||||||||
Sbjct: 76624 agaaaccttgaaactttatc 76605

to top

>gb|AC024810.1| Caenorhabditis elegans cosmid Y54E10A, complete sequence
          Length = 101640

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 231   agaacagcctctaaaatttt 250
             ||||||||||||||||||||
Sbjct: 41027 agaacagcctctaaaatttt 41046

to top

>gb|AE001437.1| Clostridium acetobutylicum ATCC 824, complete genome
          Length = 3940880

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 408     cttgaaactttatctaaaac 427
               ||||||||||||||||||||
Sbjct: 2821676 cttgaaactttatctaaaac 2821695

to top

>emb|BX511203.3| Rattus norvegicus chromosome 1 clone RN-79C10, complete sequence
          Length = 157310

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 492   ttattttccattgcacctga 511
             ||||||||||||||||||||
Sbjct: 89242 ttattttccattgcacctga 89223

to top

>emb|CR925754.15| Zebrafish DNA sequence from clone CH211-148J16 in linkage group 6,
             complete sequence
          Length = 150312

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 199   cctgacaagtgatatgtgtt 218
             ||||||||||||||||||||
Sbjct: 85386 cctgacaagtgatatgtgtt 85405

to top

>gb|AE003511.4| Drosophila melanogaster chromosome X, section 63 of 74 of the complete
              sequence
          Length = 297969

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 383    acacaaataaatactctaaagaaa 406
              ||||||| ||||||||||||||||
Sbjct: 183959 acacaaaaaaatactctaaagaaa 183936

to top

>dbj|AP002427.4| Homo sapiens genomic DNA, chromosome 11 clone:RP11-90I16, complete
             sequence
          Length = 154159

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 79    ctatgacaaaatctgaaagt 98
             ||||||||||||||||||||
Sbjct: 45788 ctatgacaaaatctgaaagt 45807

to top

>gb|AC113058.6| Mus musculus chromosome 6, clone RP23-253C24, complete sequence
          Length = 248761

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 141   gtccaacatagtacaaccca 160
             ||||||||||||||||||||
Sbjct: 74547 gtccaacatagtacaaccca 74528

to top

>gb|AF022236.1|AF022236 Escherichia coli strain E2348/69 pathogenicity island, rOrf1 (rorf1),
             rOrf2 (rorf2), EscR (escR), EscS (escS), EscT (escT), EscU
             (escU), CesD (cesD), EscC (escC), EscJ (escJ), SepZ
             (sepZ), EscV (escV), EscN (escN), SepQ (sepQ), Tir (tir),
             OrfU (orfU), intimin (eae), EscD (escD), SepL (sepL), EspA
             (espA), EspD (espD), EspB (espB), EscF (escF), EspF (espF)
             genes, complete cds
          Length = 35624

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 131   ataaaattctgtccaacata 150
             ||||||||||||||||||||
Sbjct: 18567 ataaaattctgtccaacata 18548

to top

>gb|AF071034.1|AF071034 Escherichia coli L0001 (yicJ) gene, partial cds; tRNA-Sec gene,
             complete sequence; CP4-like integrase (int), L0004, L0005,
             L0006, L0007, L0008, L0009, L0010, L0011, L0012, L0013,
             L0014, L0015, L0016, L0017, L0018 (escF), L0019, L0020
             (espB), L0021 (espD), L0022 (espA), L0023 (sepL), L0024
             (escD), L0025 (eaeA), L0026 (orfU), L0027 (tir), L0028,
             L0029, L0030, L0031 (sepQ), L0032, L0033, L0034 (escN),
             L0035 (escV), L0036, L0037 (sepZ), L0038, L0039 (escJ),
             L0040, L0041 (escC), L0042 (cesD), L0043, L0044, L0045,
             L0046 (escU), L0047 (escT), L0048 (escS), L0049 (escR),
             L0050, L0051, L0052, L0053, L0054, L0055, and L0056 genes,
             complete cds; and L0057 (yicL) gene, partial cds
          Length = 45325

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 131   ataaaattctgtccaacata 150
             ||||||||||||||||||||
Sbjct: 25697 ataaaattctgtccaacata 25716

to top

>gb|AE005174.2| Escherichia coli O157:H7 EDL933, complete genome
          Length = 5528445

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 131     ataaaattctgtccaacata 150
               ||||||||||||||||||||
Sbjct: 4674656 ataaaattctgtccaacata 4674675

to top

>dbj|BA000007.2| Escherichia coli O157:H7 DNA, complete genome
          Length = 5498450

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 131     ataaaattctgtccaacata 150
               ||||||||||||||||||||
Sbjct: 4605673 ataaaattctgtccaacata 4605692

to top

>gb|M90518.1|RATMGLUR4A Rat metabotropic glutamate receptor (GLUR4) mRNA, complete cds
          Length = 4488

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 534 gtgcccgtgctgctgatgct 553
           ||||||||||||||||||||
Sbjct: 227 gtgcccgtgctgctgatgct 208

to top

>emb|AJ312780.1|AME312780 Anthemis melampodina internal transcribed spacer 1 (ITS1), country
           Egypt: Sinai
          Length = 253

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 110 tacattcacccaagtccaaa 129
           ||||||||||||||||||||
Sbjct: 134 tacattcacccaagtccaaa 115

to top

>emb|AL683897.5| Mouse DNA sequence from clone RP23-208E23 on chromosome 2, complete
             sequence
          Length = 187308

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 161   ctttgataatttcataggat 180
             ||||||||||||||||||||
Sbjct: 53091 ctttgataatttcataggat 53072

to top

>emb|AL645791.14| Mouse DNA sequence from clone RP23-465A12 on chromosome 11, complete
             sequence
          Length = 200883

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 383   acacaaataaatactctaaa 402
             ||||||||||||||||||||
Sbjct: 30409 acacaaataaatactctaaa 30428


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,849,079
Number of Sequences: 3902068
Number of extensions: 6849079
Number of successful extensions: 124451
Number of sequences better than 10.0: 58
Number of HSP's better than 10.0 without gapping: 58
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 124191
Number of HSP's gapped (non-prelim): 260
length of query: 603
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 580
effective length of database: 17,143,297,704
effective search space: 9943112668320
effective search space used: 9943112668320
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result