>gb|AF525086.1| Triticum aestivum GSK-like kinase mRNA, complete cds
          Length = 1573

 Score =  549 bits (277), Expect = e-153
 Identities = 389/422 (92%), Gaps = 11/422 (2%)
 Strand = Plus / Minus

                                                                        
Query: 1    gaacaaatactggaccaa-tattggcggtacatagtgtgcatccttccttgcatagcaca 59
            |||||||||||||||||| |||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1527 gaacaaatactggaccaaatattggcggtacatagggtgcatccttcattgcatagcaca 1468

                                                                        
Query: 60   tgagctcaggggagaacagtcgaaacacttctcatctacttacagaatcatgggtgattt 119
            ||||||||||||| ||| ||||||||||||||||||||||||||| |||||||||| |||
Sbjct: 1467 tgagctcaggggaaaacggtcgaaacacttctcatctacttacagtatcatgggtggttt 1408

                                                                        
Query: 120  gttacatcggcagtagggggaaagaaagaatacatgacaccgaggtctcggacaagaaaa 179
            |||||||||||||||||||    ||||||||||||| || ||||||||||||| ||||||
Sbjct: 1407 gttacatcggcagtagggg----gaaagaatacatggcatcgaggtctcggacgagaaaa 1352

                                                                        
Query: 180  agaataataatcacatgtg-catcgcctatatcccatgtagctgcaggcaatctcaaact 238
             |||||||||||||||||| ||||||||||||||| ||| ||||||| ||||||||||||
Sbjct: 1351 ggaataataatcacatgtgtcatcgcctatatcccgtgtggctgcagacaatctcaaact 1292

                                                                        
Query: 239  cctggggtttctagtagacgacaataggatttgttctgaactaagcttcaa-cagccgt- 296
            ||||||||||||||||||| ||||  |||||||||||||||||| |||||| ||||||| 
Sbjct: 1291 cctggggtttctagtagacaacaactggatttgttctgaactaaacttcaagcagccgtc 1232

                                                                        
Query: 297  ---cggatcaccaccctacaaaggcgcagttcttncgagcatgttcagggatgagcttca 353
               |||||||||| ||||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 1231 tggcggatcaccatcctacaaaggcacagttcttccgagcatgttcagggatgagcttca 1172

                                                                        
Query: 354  ccaggatgtccatcggcacgcccttcaactcatggggcttgaagttaaagaggggaggaa 413
            ||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||
Sbjct: 1171 ccaggatgtccatcggcacacccttcaactcatggggcttaaagttaaagaggggaggaa 1112

              
Query: 414  ga 415
            ||
Sbjct: 1111 ga 1110

>dbj|AK121623.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033045G07, full
            insert sequence
          Length = 1884

 Score =  103 bits (52), Expect = 4e-19
 Identities = 99/115 (86%)
 Strand = Plus / Minus

                                                                        
Query: 300  atcaccaccctacaaaggcgcagttcttncgagcatgttcagggatgagcttcaccagga 359
            ||||||| |||||||| ||||| | ||| ||||||||||| ||||| |||||||||||||
Sbjct: 1454 atcaccatcctacaaacgcgcattgctttcgagcatgttcggggataagcttcaccagga 1395

                                                                   
Query: 360  tgtccatcggcacgcccttcaactcatggggcttgaagttaaagaggggaggaag 414
              ||||| ||||  |||||||  ||||||||||||||||| ||||| ||||||||
Sbjct: 1394 attccattggcatacccttcagttcatggggcttgaagttgaagagaggaggaag 1340

>dbj|AK064884.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000K07, full
            insert sequence
          Length = 2017

 Score =  103 bits (52), Expect = 4e-19
 Identities = 99/115 (86%)
 Strand = Plus / Minus

                                                                        
Query: 300  atcaccaccctacaaaggcgcagttcttncgagcatgttcagggatgagcttcaccagga 359
            ||||||| |||||||| ||||| | ||| ||||||||||| ||||| |||||||||||||
Sbjct: 1626 atcaccatcctacaaacgcgcattgctttcgagcatgttcggggataagcttcaccagga 1567

                                                                   
Query: 360  tgtccatcggcacgcccttcaactcatggggcttgaagttaaagaggggaggaag 414
              ||||| ||||  |||||||  ||||||||||||||||| ||||| ||||||||
Sbjct: 1566 attccattggcatacccttcagttcatggggcttgaagttgaagagaggaggaag 1512

>dbj|AK058276.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-C05, full
            insert sequence
          Length = 1800

 Score =  103 bits (52), Expect = 4e-19
 Identities = 99/115 (86%)
 Strand = Plus / Minus

                                                                        
Query: 300  atcaccaccctacaaaggcgcagttcttncgagcatgttcagggatgagcttcaccagga 359
            ||||||| |||||||| ||||| | ||| ||||||||||| ||||| |||||||||||||
Sbjct: 1454 atcaccatcctacaaacgcgcattgctttcgagcatgttcggggataagcttcaccagga 1395

                                                                   
Query: 360  tgtccatcggcacgcccttcaactcatggggcttgaagttaaagaggggaggaag 414
              ||||| ||||  |||||||  ||||||||||||||||| ||||| ||||||||
Sbjct: 1394 attccattggcatacccttcagttcatggggcttgaagttgaagagaggaggaag 1340

>gb|AC087552.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0519E07,
            complete sequence
          Length = 151399

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 69/81 (85%)
 Strand = Plus / Plus

                                                                        
Query: 300  atcaccaccctacaaaggcgcagttcttncgagcatgttcagggatgagcttcaccagga 359
            ||||||| |||||||| ||||| | ||| ||||||||||| ||||| |||||||||||||
Sbjct: 6936 atcaccatcctacaaacgcgcattgctttcgagcatgttcggggataagcttcaccagga 6995

                                 
Query: 360  tgtccatcggcacgcccttca 380
              ||||| ||||  |||||||
Sbjct: 6996 attccattggcatacccttca 7016



 Score = 46.1 bits (23), Expect = 0.090
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                           
Query: 384  catggggcttgaagttaaagaggggaggaag 414
            |||||||||||||||| ||||| ||||||||
Sbjct: 7120 catggggcttgaagttgaagagaggaggaag 7150

>gb|AC118288.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0077L08, complete sequence
          Length = 115640

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 69/81 (85%)
 Strand = Plus / Plus

                                                                         
Query: 300   atcaccaccctacaaaggcgcagttcttncgagcatgttcagggatgagcttcaccagga 359
             ||||||| |||||||| ||||| | ||| ||||||||||| ||||| |||||||||||||
Sbjct: 92833 atcaccatcctacaaacgcgcattgctttcgagcatgttcggggataagcttcaccagga 92892

                                  
Query: 360   tgtccatcggcacgcccttca 380
               ||||| ||||  |||||||
Sbjct: 92893 attccattggcatacccttca 92913



 Score = 46.1 bits (23), Expect = 0.090
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 384   catggggcttgaagttaaagaggggaggaag 414
             |||||||||||||||| ||||| ||||||||
Sbjct: 93017 catggggcttgaagttgaagagaggaggaag 93047

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 69/81 (85%)
 Strand = Plus / Plus

                                                                           
Query: 300     atcaccaccctacaaaggcgcagttcttncgagcatgttcagggatgagcttcaccagga 359
               ||||||| |||||||| ||||| | ||| ||||||||||| ||||| |||||||||||||
Sbjct: 1914059 atcaccatcctacaaacgcgcattgctttcgagcatgttcggggataagcttcaccagga 1914118

                                    
Query: 360     tgtccatcggcacgcccttca 380
                 ||||| ||||  |||||||
Sbjct: 1914119 attccattggcatacccttca 1914139



 Score = 46.1 bits (23), Expect = 0.090
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                              
Query: 384     catggggcttgaagttaaagaggggaggaag 414
               |||||||||||||||| ||||| ||||||||
Sbjct: 1914243 catggggcttgaagttgaagagaggaggaag 1914273

>dbj|AK067302.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013102H14, full
            insert sequence
          Length = 3100

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 69/81 (85%)
 Strand = Plus / Plus

                                                                        
Query: 300  atcaccaccctacaaaggcgcagttcttncgagcatgttcagggatgagcttcaccagga 359
            ||||||| |||||||| ||||| | ||| ||||||||||| ||||| |||||||||||||
Sbjct: 2670 atcaccatcctacaaacgcgcattgctttcgagcatgttcggggataagcttcaccagga 2729

                                 
Query: 360  tgtccatcggcacgcccttca 380
              ||||| ||||  |||||||
Sbjct: 2730 attccattggcatacccttca 2750



 Score = 46.1 bits (23), Expect = 0.090
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                           
Query: 384  catggggcttgaagttaaagaggggaggaag 414
            |||||||||||||||| ||||| ||||||||
Sbjct: 2854 catggggcttgaagttgaagagaggaggaag 2884

>gb|DQ241848.1| Solanum tuberosum clone 187B01 NtK-1-like mRNA, complete cds
          Length = 1711

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 376  cttcaactcatggggcttgaagttaaagaggggaggaaga 415
            |||||||||||| | |||||||||||| | ||||||||||
Sbjct: 1297 cttcaactcatgagccttgaagttaaacaagggaggaaga 1258

>gb|DQ252508.1| Solanum tuberosum clone 086D08 Ser/Thr protein kinase-like mRNA,
            complete cds
          Length = 1593

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 376  cttcaactcatggggcttgaagttaaagaggggaggaaga 415
            |||||||||||| | |||||||||||| | ||||||||||
Sbjct: 1282 cttcaactcatgagccttgaagttaaacaagggaggaaga 1243

>gb|AC091713.4| Papio anubis clone RP41-217F22, complete sequence
          Length = 215961

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 304    ccaccctacaaaggcgcagttc 325
              ||||||||||||||||||||||
Sbjct: 101221 ccaccctacaaaggcgcagttc 101200

>gb|AY108486.1| Zea mays PCO107502 mRNA sequence
          Length = 1752

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 93/117 (79%)
 Strand = Plus / Minus

                                                                        
Query: 299  gatcaccaccctacaaaggcgcagttcttncgagcatgttcagggatgagcttcaccagg 358
            |||||||||||||| ||||| || | ||| || ||||| |||||||  |  ||||||| |
Sbjct: 1403 gatcaccaccctacgaaggcacattgcttccgtgcatgctcagggaccaatttcaccatg 1344

                                                                     
Query: 359  atgtccatcggcacgcccttcaactcatggggcttgaagttaaagaggggaggaaga 415
            |  |||  |||||||  ||||| |||||||||||| || || ||||| || ||||||
Sbjct: 1343 aaatccgccggcacgttcttcagctcatggggcttaaaattgaagagaggcggaaga 1287

>gb|AF061509.1|AF061509 Zea mays shaggy kinase homolog mRNA, partial cds
          Length = 798

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 93/117 (79%)
 Strand = Plus / Minus

                                                                       
Query: 299 gatcaccaccctacaaaggcgcagttcttncgagcatgttcagggatgagcttcaccagg 358
           |||||||||||||| ||||| || | ||| || ||||| |||||||  |  ||||||| |
Sbjct: 359 gatcaccaccctacgaaggcacattgcttccgtgcatgctcagggaccaatttcaccatg 300

                                                                    
Query: 359 atgtccatcggcacgcccttcaactcatggggcttgaagttaaagaggggaggaaga 415
           |  |||  |||||||  ||||| |||||||||||| || || ||||| || ||||||
Sbjct: 299 aaatccgccggcacgttcttcagctcatggggcttaaaattgaagagaggcggaaga 243

>gb|AC169520.2| Mus musculus BAC clone RP23-35C6 from chromosome 19, complete sequence
          Length = 209374

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 54     agcacatgagctcaggggagaacag 78
              ||||| |||||||||||||||||||
Sbjct: 123500 agcacttgagctcaggggagaacag 123476

>gb|AC166063.4| Mus musculus BAC clone RP23-21L22 from chromosome 19, complete sequence
          Length = 232698

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 54     agcacatgagctcaggggagaacag 78
              ||||| |||||||||||||||||||
Sbjct: 138755 agcacttgagctcaggggagaacag 138779

>emb|AL031297.4|HS97P20 Human DNA sequence from clone RP1-97P20 on chromosome 1q23.2-24.3
              Contains the 3' end of a novel gene (FLJ45155 FLJ10706
              FLJ39174) and the gene for ezrin-binding partner PACE-1
              (PACE-1), complete sequence
          Length = 103181

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 246    tttctagtagacgacaataggattt 270
              |||||||||||||| ||||||||||
Sbjct: 102549 tttctagtagacgaaaataggattt 102573

>gb|AC154639.2| Mus musculus BAC clone RP23-306D9 from chromosome 13, complete sequence
          Length = 187693

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 384   catggggcttgaagttaaaga 404
             |||||||||||||||||||||
Sbjct: 77646 catggggcttgaagttaaaga 77666

>gb|AE000666.1| Methanothermobacter thermautotrophicus str. Delta H, complete genome
          Length = 1751377

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 338     tcagggatgagcttcaccaggatgt 362
               ||||||| |||||||||||||||||
Sbjct: 1085275 tcagggaggagcttcaccaggatgt 1085299

>gb|AC155249.2| Mus musculus BAC clone RP24-254A5 from chromosome 9, complete sequence
          Length = 191932

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 96    tacttacagaatcatgggtgattt 119
             |||||||||||||||| |||||||
Sbjct: 84831 tacttacagaatcatgtgtgattt 84854

>emb|AL732583.5| Human DNA sequence from clone XX-111B on chromosome 1 Contains a
            novel gene (KIAA1720) and a CpG island, complete sequence
          Length = 24695

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 224  aggcaatctcaaactcctgg 243
            ||||||||||||||||||||
Sbjct: 6836 aggcaatctcaaactcctgg 6855

>emb|AL136311.7| Human DNA sequence from clone RP3-417I1 on chromosome 6 Contains the 5'
             end of the BAG2 gene for BCL2-associated athanogene 2, the
             3' end of gene KIAA0576, the 5' end of a novel gene and a
             CpG island, complete sequence
          Length = 58988

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 230   tctcaaactcctggggtttc 249
             ||||||||||||||||||||
Sbjct: 57278 tctcaaactcctggggtttc 57259

>gb|AC079969.5| Homo sapiens chromosome 15, clone RP11-636P14, complete sequence
          Length = 227506

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 223   caggcaatctcaaactcctg 242
             ||||||||||||||||||||
Sbjct: 24283 caggcaatctcaaactcctg 24302

>gb|AC058803.5| Homo sapiens chromosome 15, clone RP11-717I24, complete sequence
          Length = 203493

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 223    caggcaatctcaaactcctg 242
              ||||||||||||||||||||
Sbjct: 119161 caggcaatctcaaactcctg 119142

>gb|AC116407.18| Homo sapiens chromosome 17, clone CTD-2095E4, complete sequence
          Length = 104176

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 227   caatctcaaactcctggggt 246
             ||||||||||||||||||||
Sbjct: 56790 caatctcaaactcctggggt 56809

>gb|AC154004.7| Mus musculus 6 BAC RP24-169F24 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 168376

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 170   gacaagaaaaagaataataa 189
             ||||||||||||||||||||
Sbjct: 43558 gacaagaaaaagaataataa 43577

>gb|AC006141.2|AC006141 Homo sapiens chromosome 17, clone hRPK.421_E_14, complete sequence
          Length = 121132

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 227   caatctcaaactcctggggt 246
             ||||||||||||||||||||
Sbjct: 47818 caatctcaaactcctggggt 47837

>gb|AC154001.5| Mus musculus 6 BAC RP24-419M4 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 183830

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 170   gacaagaaaaagaataataa 189
             ||||||||||||||||||||
Sbjct: 94938 gacaagaaaaagaataataa 94919

>gb|AC145974.4| Gallus gallus BAC clone CH261-3L16 from chromosome unknown, complete
             sequence
          Length = 201188

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 136   ggggaaagaaagaatacatg 155
             ||||||||||||||||||||
Sbjct: 26552 ggggaaagaaagaatacatg 26571

>emb|AL844884.5| Mouse DNA sequence from clone RP23-266B14 on chromosome 2, complete
              sequence
          Length = 150285

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 132    gtagggggaaagaaagaata 151
              ||||||||||||||||||||
Sbjct: 124382 gtagggggaaagaaagaata 124401


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,204,986
Number of Sequences: 3902068
Number of extensions: 5204986
Number of successful extensions: 172938
Number of sequences better than 10.0: 29
Number of HSP's better than 10.0 without gapping: 27
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 172810
Number of HSP's gapped (non-prelim): 124
length of query: 415
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 393
effective length of database: 17,147,199,772
effective search space: 6738849510396
effective search space used: 6738849510396
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)