| Clone Name | rbaal41h21 |
|---|---|
| Clone Library Name | barley_pub |
>emb|AL358372.11| Human DNA sequence from clone RP11-350E19 on chromosome 1 Contains a rodent farnesoid X receptor beta (Fxrb) pseudogene and the 5' end of the SYCP1 gene for synaptonemal complex protein 1, complete sequence Length = 155819 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 11 atgacaaatgtatgataaat 30 |||||||||||||||||||| Sbjct: 74398 atgacaaatgtatgataaat 74417
>emb|BX957246.7| Zebrafish DNA sequence from clone CH211-89F7 in linkage group 5, complete sequence Length = 186135 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 68 acatggaaatacaatatggt 87 |||||||||||||||||||| Sbjct: 166707 acatggaaatacaatatggt 166688
>gb|AC022832.13| Homo sapiens chromosome 8, clone RP11-145O15, complete sequence Length = 166236 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 11 atgacaaatgtatgataaat 30 |||||||||||||||||||| Sbjct: 80068 atgacaaatgtatgataaat 80049
>gb|AC022121.6| Homo sapiens chromosome 5 clone CTD-2007H13, complete sequence Length = 219258 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 11 atgacaaatgtatgataaat 30 |||||||||||||||||||| Sbjct: 59144 atgacaaatgtatgataaat 59163
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 atgtatgataaatacagaat 37 |||||||||||||||||||| Sbjct: 22849581 atgtatgataaatacagaat 22849562
>gb|AC106741.3| Homo sapiens chromosome 16 clone RP11-105F24, complete sequence Length = 176424 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 11 atgacaaatgtatgataaat 30 |||||||||||||||||||| Sbjct: 21340 atgacaaatgtatgataaat 21359
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 atgtatgataaatacagaat 37 |||||||||||||||||||| Sbjct: 22777772 atgtatgataaatacagaat 22777753
>emb|AL935070.3|CNS08CCM Oryza sativa chromosome 12, . BAC OSJNBa0040P10 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 148705 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 atgtatgataaatacagaat 37 |||||||||||||||||||| Sbjct: 107263 atgtatgataaatacagaat 107282
>emb|AL138783.6| Human DNA sequence from clone RP5-1165D20 on chromosome 1p13.1-13.3, complete sequence Length = 118065 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 11 atgacaaatgtatgataaat 30 |||||||||||||||||||| Sbjct: 56762 atgacaaatgtatgataaat 56781 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,187,605 Number of Sequences: 3902068 Number of extensions: 1187605 Number of successful extensions: 75862 Number of sequences better than 10.0: 9 Number of HSP's better than 10.0 without gapping: 9 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 75801 Number of HSP's gapped (non-prelim): 61 length of query: 227 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 205 effective length of database: 17,147,199,772 effective search space: 3515175953260 effective search space used: 3515175953260 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)