ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal41h14
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X66428.1|HVPSANMR H.vulgare mRNA PsaN for photosystem I subu... 305 2e-80
2gb|AF052429.1|AF052429 Zea mays photosystem I complex PsaN subun... 121 7e-25
3gb|AY103702.1| Zea mays PCO139408 mRNA sequence 121 7e-25
4dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 109 3e-21
5dbj|AK059037.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 3e-21
6gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 109 3e-21
7emb|AL928749.4|CNS08CBM Oryza sativa chromosome 12, . BAC OSJNBa... 109 3e-21
8dbj|AK058774.1| Oryza sativa (japonica cultivar-group) cDNA clon... 72 6e-10
9gb|AY233207.1| Vitis vinifera putative photosystem I reaction ce... 52 5e-04
10ref|NM_125800.3| Arabidopsis thaliana PSI-N; calmodulin binding ... 50 0.002
11ref|NM_001037056.1| Arabidopsis thaliana PSI-N; calmodulin bindi... 50 0.002
12gb|AY081594.1| Arabidopsis thaliana photosystem I reaction cente... 50 0.002
13gb|AY062835.1| Arabidopsis thaliana photosystem I reaction centr... 50 0.002
14emb|BX834109.1|CNS0A0GR Arabidopsis thaliana Full-length cDNA Co... 50 0.002
15emb|BX833455.1|CNS0A0LJ Arabidopsis thaliana Full-length cDNA Co... 50 0.002
16emb|BX830459.1|CNS09YUQ Arabidopsis thaliana Full-length cDNA Co... 50 0.002
17emb|BX841638.1|CNS09YLQ Arabidopsis thaliana Full-length cDNA Co... 50 0.002
18dbj|AB008266.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 50 0.002
19gb|U32176.1|ATU32176 Arabidopsis thaliana photosystem I PSI-N mR... 50 0.002
20gb|DQ124073.1| Coffea arabica clone MN-SSH2-D11 mRNA sequence 46 0.032
21gb|AC008136.4|AC008136 Drosophila melanogaster, chromosome 3R, r... 42 0.49
22gb|AC005721.3|AC005721 Drosophila melanogaster, chromosome 3R, r... 42 0.49
23gb|AE003706.5| Drosophila melanogaster chromosome 3R, section 44... 42 0.49
24emb|AL928840.8| Mouse DNA sequence from clone RP24-233J2 on chro... 40 2.0
25emb|AL591712.18| Mouse DNA sequence from clone RP23-138C10 on ch... 40 2.0
26gb|BT013274.1| Lycopersicon esculentum clone 134851R, mRNA sequence 38 7.7
27gb|AC146509.2| Pan troglodytes BAC clone RP43-93E9 from X, compl... 38 7.7
28emb|Z75746.1|HSU221F2 Human DNA sequence from clone LL0XNC01-221... 38 7.7
29emb|AL592105.14| Zebrafish DNA sequence from clone BUSM1-150L22 ... 38 7.7
30emb|AL591476.7| Zebrafish DNA sequence from clone BUSM1-263J20 i... 38 7.7
31emb|AL591382.3| Zebrafish DNA sequence from clone BUSM1-105L16 i... 38 7.7
32emb|AL161591.2|ATCHRIV87 Arabidopsis thaliana DNA chromosome 4, ... 38 7.7
33emb|AL035601.1|ATF6G17 Arabidopsis thaliana DNA chromosome 4, BA... 38 7.7
34gb|AC024153.22| Homo sapiens 12 BAC RP13-359K18 (Roswell Park Ca... 38 7.7
35dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 38 7.7
36emb|AL591372.3| Zebrafish DNA sequence from clone BUSM1-178A3 in... 38 7.7
37emb|AL591405.3| Zebrafish DNA sequence from clone BUSM1-125J23 i... 38 7.7
38emb|AL591427.2| Zebrafish DNA sequence from clone BUSM1-219H16 i... 38 7.7

>emb|X66428.1|HVPSANMR H.vulgare mRNA PsaN for photosystem I subunit N
          Length = 665

 Score =  305 bits (154), Expect = 2e-80
 Identities = 158/160 (98%)
 Strand = Plus / Minus

                                                                       
Query: 1   cgaaacacttgtgcagtttggacatctaggtacagcctgactgacatacatcagcactcg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 563 cgaaacacttgtgcagtttggacatctaggtacagcctgactgacatacatcagcactcg 504

                                                                       
Query: 61  ccatatngaccagcttcaccatttccagaagacgttggacccgcacttgaacttntcctt 120
           |||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 503 ccatatcgaccagcttcaccatttccagaagacgttggacccgcacttgaacttctcctt 444

                                                   
Query: 121 cccctcgcactcgatctcgaggtcgtcggtgatgaacggg 160
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 443 cccctcgcactcgatctcgaggtcgtcggtgatgaacggg 404



to top

>gb|AF052429.1|AF052429 Zea mays photosystem I complex PsaN subunit precursor (psaN) mRNA,
           nuclear gene encoding chloroplast protein, partial cds
          Length = 518

 Score =  121 bits (61), Expect = 7e-25
 Identities = 78/84 (92%)
 Strand = Plus / Minus

                                                                       
Query: 73  gcttcaccatttccagaagacgttggacccgcacttgaacttntccttcccctcgcactc 132
           ||||||||| |||||||| |||||||| |||||||||||||| |||||||||||||||||
Sbjct: 343 gcttcaccacttccagaaaacgttggagccgcacttgaacttctccttcccctcgcactc 284

                                   
Query: 133 gatctcgaggtcgtcggtgatgaa 156
            ||||||||||||||| |||||||
Sbjct: 283 aatctcgaggtcgtcgctgatgaa 260



to top

>gb|AY103702.1| Zea mays PCO139408 mRNA sequence
          Length = 756

 Score =  121 bits (61), Expect = 7e-25
 Identities = 78/84 (92%)
 Strand = Plus / Minus

                                                                       
Query: 73  gcttcaccatttccagaagacgttggacccgcacttgaacttntccttcccctcgcactc 132
           ||||||||| |||||||| |||||||| |||||||||||||| |||||||||||||||||
Sbjct: 558 gcttcaccacttccagaaaacgttggagccgcacttgaacttctccttcccctcgcactc 499

                                   
Query: 133 gatctcgaggtcgtcggtgatgaa 156
            ||||||||||||||| |||||||
Sbjct: 498 aatctcgaggtcgtcgctgatgaa 475



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score =  109 bits (55), Expect = 3e-21
 Identities = 63/66 (95%)
 Strand = Plus / Minus

                                                                           
Query: 76      tcaccatttccagaagacgttggacccgcacttgaacttntccttcccctcgcactcgat 135
               |||||||||||||||||||||||| ||||||||| |||| ||||||||||||||||||||
Sbjct: 4506571 tcaccatttccagaagacgttggatccgcacttgtacttctccttcccctcgcactcgat 4506512

                     
Query: 136     ctcgag 141
               ||||||
Sbjct: 4506511 ctcgag 4506506



to top

>dbj|AK059037.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-021-C11, full
           insert sequence
          Length = 657

 Score =  109 bits (55), Expect = 3e-21
 Identities = 63/66 (95%)
 Strand = Plus / Minus

                                                                       
Query: 76  tcaccatttccagaagacgttggacccgcacttgaacttntccttcccctcgcactcgat 135
           |||||||||||||||||||||||| ||||||||| |||| ||||||||||||||||||||
Sbjct: 499 tcaccatttccagaagacgttggatccgcacttgtacttctccttcccctcgcactcgat 440

                 
Query: 136 ctcgag 141
           ||||||
Sbjct: 439 ctcgag 434



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  109 bits (55), Expect = 3e-21
 Identities = 63/66 (95%)
 Strand = Plus / Minus

                                                                           
Query: 76      tcaccatttccagaagacgttggacccgcacttgaacttntccttcccctcgcactcgat 135
               |||||||||||||||||||||||| ||||||||| |||| ||||||||||||||||||||
Sbjct: 4506552 tcaccatttccagaagacgttggatccgcacttgtacttctccttcccctcgcactcgat 4506493

                     
Query: 136     ctcgag 141
               ||||||
Sbjct: 4506492 ctcgag 4506487



to top

>emb|AL928749.4|CNS08CBM Oryza sativa chromosome 12, . BAC OSJNBa0002O20 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 129155

 Score =  109 bits (55), Expect = 3e-21
 Identities = 63/66 (95%)
 Strand = Plus / Plus

                                                                         
Query: 76    tcaccatttccagaagacgttggacccgcacttgaacttntccttcccctcgcactcgat 135
             |||||||||||||||||||||||| ||||||||| |||| ||||||||||||||||||||
Sbjct: 98207 tcaccatttccagaagacgttggatccgcacttgtacttctccttcccctcgcactcgat 98266

                   
Query: 136   ctcgag 141
             ||||||
Sbjct: 98267 ctcgag 98272



to top

>dbj|AK058774.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-002-A07, full
           insert sequence
          Length = 591

 Score = 71.9 bits (36), Expect = 6e-10
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                          
Query: 76  tcaccatttccagaagacgttggacccgcacttgaacttntccttcc 122
           |||||||||||||||||||||||| ||||||||| |||| |||||||
Sbjct: 384 tcaccatttccagaagacgttggatccgcacttgtacttctccttcc 338



to top

>gb|AY233207.1| Vitis vinifera putative photosystem I reaction center subunit N
           precursor (PsaN) mRNA, partial cds; nuclear gene for
           chloroplast product
          Length = 359

 Score = 52.0 bits (26), Expect = 5e-04
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 74  cttcaccatttccagaagacgttggacccgcacttgaacttntcc 118
           ||||||||||||||||| || ||||| ||||||||| |||| |||
Sbjct: 261 cttcaccatttccagaaaacattggaaccgcacttgtacttgtcc 217



to top

>ref|NM_125800.3| Arabidopsis thaliana PSI-N; calmodulin binding AT5G64040 (PSI-N)
           transcript variant AT5G64040.1 mRNA, complete cds
          Length = 747

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 74  cttcaccatttccagaagacgttggacccgcacttgaacttntccttcccctcgca 129
           ||||||||||||||||| || ||||| || |||||| |||| ||||| || |||||
Sbjct: 613 cttcaccatttccagaaaacattggaaccacacttgtacttgtccttgccttcgca 558



to top

>ref|NM_001037056.1| Arabidopsis thaliana PSI-N; calmodulin binding AT5G64040 (PSI-N)
           transcript variant AT5G64040.2 mRNA, complete cds
          Length = 950

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 74  cttcaccatttccagaagacgttggacccgcacttgaacttntccttcccctcgca 129
           ||||||||||||||||| || ||||| || |||||| |||| ||||| || |||||
Sbjct: 816 cttcaccatttccagaaaacattggaaccacacttgtacttgtccttgccttcgca 761



to top

>gb|AY081594.1| Arabidopsis thaliana photosystem I reaction center subunit psaN
           precursor (At5g64040) mRNA, complete cds
          Length = 605

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 74  cttcaccatttccagaagacgttggacccgcacttgaacttntccttcccctcgca 129
           ||||||||||||||||| || ||||| || |||||| |||| ||||| || |||||
Sbjct: 518 cttcaccatttccagaaaacattggaaccacacttgtacttgtccttgccttcgca 463



to top

>gb|AY062835.1| Arabidopsis thaliana photosystem I reaction centre subunit psaN
           precursor (At5g64040; MHJ24.2) mRNA, complete cds
          Length = 685

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 74  cttcaccatttccagaagacgttggacccgcacttgaacttntccttcccctcgca 129
           ||||||||||||||||| || ||||| || |||||| |||| ||||| || |||||
Sbjct: 574 cttcaccatttccagaaaacattggaaccacacttgtacttgtccttgccttcgca 519



to top

>emb|BX834109.1|CNS0A0GR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL9ZF02 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 650

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 74  cttcaccatttccagaagacgttggacccgcacttgaacttntccttcccctcgca 129
           ||||||||||||||||| || ||||| || |||||| |||| ||||| || |||||
Sbjct: 525 cttcaccatttccagaaaacattggaaccacacttgtacttgtccttgccttcgca 470



to top

>emb|BX833455.1|CNS0A0LJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL56ZH04 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 647

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 74  cttcaccatttccagaagacgttggacccgcacttgaacttntccttcccctcgca 129
           ||||||||||||||||| || ||||| || |||||| |||| ||||| || |||||
Sbjct: 566 cttcaccatttccagaaaacattggaaccacacttgtacttgtccttgccttcgca 511



to top

>emb|BX830459.1|CNS09YUQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB83ZA11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 639

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 74  cttcaccatttccagaagacgttggacccgcacttgaacttntccttcccctcgca 129
           ||||||||||||||||| || ||||| || |||||| |||| ||||| || |||||
Sbjct: 552 cttcaccatttccagaaaacattggaaccacacttgtacttgtccttgccttcgca 497



to top

>emb|BX841638.1|CNS09YLQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB87ZC06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 637

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 74  cttcaccatttccagaagacgttggacccgcacttgaacttntccttcccctcgca 129
           ||||||||||||||||| || ||||| || |||||| |||| ||||| || |||||
Sbjct: 553 cttcaccatttccagaaaacattggaaccacacttgtacttgtccttgccttcgca 498



to top

>dbj|AB008266.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MHJ24
          Length = 48622

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                    
Query: 74   cttcaccatttccagaagacgttggacccgcacttgaacttntccttcccctcgca 129
            ||||||||||||||||| || ||||| || |||||| |||| ||||| || |||||
Sbjct: 2128 cttcaccatttccagaaaacattggaaccacacttgtacttgtccttgccttcgca 2183



to top

>gb|U32176.1|ATU32176 Arabidopsis thaliana photosystem I PSI-N mRNA, nuclear gene
           encoding chloroplast protein, complete cds
          Length = 637

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 74  cttcaccatttccagaagacgttggacccgcacttgaacttntccttcccctcgca 129
           ||||||||||||||||| || ||||| || |||||| |||| ||||| || |||||
Sbjct: 548 cttcaccatttccagaaaacattggaaccacacttgtacttgtccttgccttcgca 493



to top

>gb|DQ124073.1| Coffea arabica clone MN-SSH2-D11 mRNA sequence
          Length = 643

 Score = 46.1 bits (23), Expect = 0.032
 Identities = 49/58 (84%)
 Strand = Plus / Plus

                                                                     
Query: 75  ttcaccatttccagaagacgttggacccgcacttgaacttntccttcccctcgcactc 132
           |||||||||||||||| || || || || ||||||||||| ||| | || ||||||||
Sbjct: 9   ttcaccatttccagaacacatttgaaccacacttgaacttgtccctgccttcgcactc 66



to top

>gb|AC008136.4|AC008136 Drosophila melanogaster, chromosome 3R, region 88D-88E, BAC clone
              BACR08H11, complete sequence
          Length = 154890

 Score = 42.1 bits (21), Expect = 0.49
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 68     gaccagcttcaccatttccag 88
              |||||||||||||||||||||
Sbjct: 139223 gaccagcttcaccatttccag 139243



to top

>gb|AC005721.3|AC005721 Drosophila melanogaster, chromosome 3R, region 88D8-88E1, BAC clone
              BACR48E23, complete sequence
          Length = 203183

 Score = 42.1 bits (21), Expect = 0.49
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 68     gaccagcttcaccatttccag 88
              |||||||||||||||||||||
Sbjct: 116842 gaccagcttcaccatttccag 116862



to top

>gb|AE003706.5| Drosophila melanogaster chromosome 3R, section 44 of 118 of the complete
              sequence
          Length = 270961

 Score = 42.1 bits (21), Expect = 0.49
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 68     gaccagcttcaccatttccag 88
              |||||||||||||||||||||
Sbjct: 253369 gaccagcttcaccatttccag 253389



to top

>emb|AL928840.8| Mouse DNA sequence from clone RP24-233J2 on chromosome 2, complete
            sequence
          Length = 35917

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 35   gcctgactgacatacatcag 54
            ||||||||||||||||||||
Sbjct: 1361 gcctgactgacatacatcag 1380



to top

>emb|AL591712.18| Mouse DNA sequence from clone RP23-138C10 on chromosome 2, complete
              sequence
          Length = 168958

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 35     gcctgactgacatacatcag 54
              ||||||||||||||||||||
Sbjct: 168319 gcctgactgacatacatcag 168338



to top

>gb|BT013274.1| Lycopersicon esculentum clone 134851R, mRNA sequence
          Length = 665

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 72  agcttcaccatttccagaa 90
           |||||||||||||||||||
Sbjct: 568 agcttcaccatttccagaa 550



to top

>gb|AC146509.2| Pan troglodytes BAC clone RP43-93E9 from X, complete sequence
          Length = 135272

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 69    accagcttcaccatttcca 87
             |||||||||||||||||||
Sbjct: 53827 accagcttcaccatttcca 53845



to top

>emb|Z75746.1|HSU221F2 Human DNA sequence from clone LL0XNC01-221F2 on chromosome X Contains
            the NXF3 gene for nuclear RNA export factor 3 and a novel
            pseudogene, complete sequence
          Length = 37764

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 69   accagcttcaccatttcca 87
            |||||||||||||||||||
Sbjct: 1946 accagcttcaccatttcca 1928



to top

>emb|AL592105.14| Zebrafish DNA sequence from clone BUSM1-150L22 in linkage group 7
             Contains the 3' part of the men1 gene (multiple endocrine
             neoplasia type 1 (menin 1)), a gene for a novel protein
             kinase, three genes for novel immune-type receptor, a
             novel immune-type receptor pseudogene, the nitr4.2,
             nitr5.3 and nitr1.23 genes (novel immune-type receptor
             4.2, 5.3 and 1.23), a novel gene and a CpG island,
             complete sequence
          Length = 106023

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 72    agcttcaccatttccagaa 90
             |||||||||||||||||||
Sbjct: 93080 agcttcaccatttccagaa 93098



to top

>emb|AL591476.7| Zebrafish DNA sequence from clone BUSM1-263J20 in linkage group 7
             Contains a gene for a novel kinase with a CNH domain, nine
             genes for novel immune-type receptors (nitr) and a nitr
             pseudogene, complete sequence
          Length = 93413

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 72    agcttcaccatttccagaa 90
             |||||||||||||||||||
Sbjct: 59858 agcttcaccatttccagaa 59876



to top

>emb|AL591382.3| Zebrafish DNA sequence from clone BUSM1-105L16 in linkage group 7
             Contains the nitr2d_1 gene for novel immune-type receptor
             2d, allele 1, the nitr1o_3 gene for novel immune-type
             receptor 1o, allele 3, the nitr1m_2 gene for novel
             immune-type receptor 1m, allele 2, the nitr1l_2 gene for
             novel immune-type receptor 1l, allele 2, a novel
             immune-type receptor 1 pseudogene, the nitr5_4 gene for
             novel immune-type receptor 5, allele 4, the nitr4a_2 gene
             for novel immune-type receptor 4a, allele 2, the nitr1i_2
             gene for novel immune-type receptor 1i, allele 2, the
             nitr1j_1 gene for novel immune-type receptor 1j, allele 1,
             the nitr1g_1 gene for novel immune-type receptor 1g,
             allele 1, a novel immune-type receptor 4b pseudogene, a
             novel gene, the nitr1k_3 gene for novel immune-type
             receptor 1k, allele 3 and a CpG island, complete sequence
          Length = 98934

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 72    agcttcaccatttccagaa 90
             |||||||||||||||||||
Sbjct: 20223 agcttcaccatttccagaa 20241



to top

>emb|AL161591.2|ATCHRIV87 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 87
          Length = 196339

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 81    atttccagaagacgttgga 99
             |||||||||||||||||||
Sbjct: 93326 atttccagaagacgttgga 93308



to top

>emb|AL035601.1|ATF6G17 Arabidopsis thaliana DNA chromosome 4, BAC clone  F6G17 (ESSA project)
          Length = 101009

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 81    atttccagaagacgttgga 99
             |||||||||||||||||||
Sbjct: 50717 atttccagaagacgttgga 50699



to top

>gb|AC024153.22| Homo sapiens 12 BAC RP13-359K18 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 178905

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 72    agcttcaccatttccagaa 90
             |||||||||||||||||||
Sbjct: 40632 agcttcaccatttccagaa 40650



to top

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 132     cgatctcgaggtcgtcggt 150
               |||||||||||||||||||
Sbjct: 3501886 cgatctcgaggtcgtcggt 3501868



to top

>emb|AL591372.3| Zebrafish DNA sequence from clone BUSM1-178A3 in linkage group 7,
             complete sequence
          Length = 32933

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 72    agcttcaccatttccagaa 90
             |||||||||||||||||||
Sbjct: 15772 agcttcaccatttccagaa 15754



to top

>emb|AL591405.3| Zebrafish DNA sequence from clone BUSM1-125J23 in linkage group 7,
             complete sequence
          Length = 79994

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 72    agcttcaccatttccagaa 90
             |||||||||||||||||||
Sbjct: 24671 agcttcaccatttccagaa 24689



to top

>emb|AL591427.2| Zebrafish DNA sequence from clone BUSM1-219H16 in linkage group 7,
             complete sequence
          Length = 126202

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 72    agcttcaccatttccagaa 90
             |||||||||||||||||||
Sbjct: 96937 agcttcaccatttccagaa 96919


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 845,383
Number of Sequences: 3902068
Number of extensions: 845383
Number of successful extensions: 58554
Number of sequences better than 10.0: 38
Number of HSP's better than 10.0 without gapping: 38
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 58377
Number of HSP's gapped (non-prelim): 177
length of query: 160
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 138
effective length of database: 17,147,199,772
effective search space: 2366313568536
effective search space used: 2366313568536
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top