Clone Name	rbaal41c09
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	ref|NM_069676.2| Caenorhabditis elegans Ribosomal Protein, Small...	375	e-101
2	emb|Z68751.1|CET05E11 Caenorhabditis elegans Cosmid T05E11, comp...	359	2e-96
3	gb|AC084495.1|CBRG10C24 Caenorhabditis briggsae cosmid G10C24, c...	254	9e-65
4	ref|NM_078658.2| Drosophila melanogaster Ribosomal protein S5a C...	196	2e-47
5	gb|AY075368.1| Drosophila melanogaster GM13047 full length cDNA	196	2e-47
6	gb|U48394.1|DMU48394 Drosophila melanogaster ribosomal protein S...	196	2e-47
7	ref|XM_792179.1| PREDICTED: Strongylocentrotus purpuratus simila...	180	1e-42
8	gb|AY826153.1| Aedes albopictus clone AL_39 ribosomal protein S5...	170	1e-39
9	emb|CR938304.1| Single read from an extremity of a full-length c...	165	7e-38
10	emb|CR938303.1| Single read from an extremity of a full-length c...	165	7e-38
11	emb|CR938121.1| Single read from an extremity of a full-length c...	165	7e-38
12	gb|DQ440005.1| Aedes aegypti clone AE-198A ribosomal protein S5 ...	163	3e-37
13	emb|CR938247.1| Single read from an extremity of a full-length c...	157	2e-35
14	emb|CR938133.1| Single read from an extremity of a full-length c...	157	2e-35
15	gb|AF263471.1|AF263471 Aedes albopictus ribosomal S5 protein mRN...	143	2e-31
16	gb|AY241965.1| Dermacentor variabilis 40S ribosomal protein S5 m...	135	6e-29
17	gb|AY785292.1| Callinectes sapidus receptor guanylyl cyclase (GC...	133	2e-28
18	gb|AF402813.1| Ictalurus punctatus 40S ribosomal protein S5 mRNA...	131	9e-28
19	gb|AY674223.1| Ixodes pacificus clone IP_7_60_92_100_CLU 40S rib...	129	4e-27
20	gb|AY130369.1| Branchiostoma lanceolatum ribosomal protein S5 mR...	129	4e-27
21	ref|XM_512950.1| PREDICTED: Pan troglodytes similar to ribosomal...	127	1e-26
22	gb|BC015405.1| Homo sapiens ribosomal protein S5, mRNA (cDNA clo...	127	1e-26
23	gb|BC004392.1| Homo sapiens cDNA clone IMAGE:3635299, **** WARNI...	127	1e-26
24	gb|BC015589.2| Homo sapiens cDNA clone IMAGE:4643450, partial cds	127	1e-26
25	gb|BC011718.1| Homo sapiens cDNA clone IMAGE:4099312, **** WARNI...	127	1e-26
26	ref|NM_001009.3| Homo sapiens ribosomal protein S5 (RPS5), mRNA	127	1e-26
27	emb|CR625375.1| full-length cDNA clone CS0DI026YC20 of Placenta ...	127	1e-26
28	emb|CR619033.1| full-length cDNA clone CS0DK007YN14 of HeLa cell...	127	1e-26
29	emb|CR614318.1| full-length cDNA clone CS0DI033YI16 of Placenta ...	127	1e-26
30	emb|CR605125.1| full-length cDNA clone CS0DM009YE02 of Fetal liv...	127	1e-26
31	emb|CR606098.1| full-length cDNA clone CS0DK012YE07 of HeLa cell...	127	1e-26
32	emb|CR593754.1| full-length cDNA clone CS0DI002YN03 of Placenta ...	127	1e-26
33	ref|NM_142150.2| Drosophila melanogaster Ribosomal protein S5b C...	127	1e-26
34	gb|AY071138.1| Drosophila melanogaster RE17836 full length cDNA	127	1e-26
35	gb|AY891473.1| Synthetic construct Homo sapiens clone FLH027247....	127	1e-26
36	gb|AY888836.1| Synthetic construct Homo sapiens clone FLH027250....	127	1e-26
37	gb|BC018151.1| Homo sapiens ribosomal protein S5, mRNA (cDNA clo...	127	1e-26
38	gb|BC035830.1| Homo sapiens ribosomal protein S5, mRNA (cDNA clo...	127	1e-26
39	gb|BC018828.2| Homo sapiens ribosomal protein S5, mRNA (cDNA clo...	127	1e-26
40	gb|U14970.1|HSU14970 Human ribosomal protein S5 mRNA, complete cds	127	1e-26
41	ref|XM_958137.1| Neurospora crassa OR74A 40S RIBOSOMAL PROTEIN S...	125	6e-26
42	ref|XM_329833.1| Neurospora crassa OR74A 40S RIBOSOMAL PROTEIN S...	125	6e-26
43	emb|BX060985.1|CNS09J7X Single read from an extremity of a full-...	125	6e-26
44	emb|BX069149.1|CNS09PIP Single read from an extremity of a full-...	125	6e-26
45	emb|BX068414.1|CNS09OYA Single read from an extremity of a full-...	125	6e-26
46	emb|BX067806.1|CNS09OHE Single read from an extremity of a full-...	125	6e-26
47	emb|BX067805.1|CNS09OHD Single read from an extremity of a full-...	125	6e-26
48	emb|BX066614.1|CNS09NKA Single read from an extremity of a full-...	125	6e-26
49	emb|BX066613.1|CNS09NK9 Single read from an extremity of a full-...	125	6e-26
50	emb|BX066319.1|CNS09NC3 Single read from an extremity of a full-...	125	6e-26
51	emb|BX065223.1|CNS09MHN Single read from an extremity of a full-...	125	6e-26
52	emb|BX060576.1|CNS09IWK Single read from an extremity of a full-...	125	6e-26
53	emb|BX060097.1|CNS09IJ9 Single read from an extremity of a full-...	125	6e-26
54	emb|BX059487.1|CNS09I2B Single read from an extremity of a full-...	125	6e-26
55	emb|BX051928.1|CNS09C8C Single read from an extremity of a full-...	125	6e-26
56	emb|BX050054.1|CNS09ASA Single read from an extremity of a full-...	125	6e-26
57	emb|BX047653.1|CNS098XL Single read from an extremity of a full-...	125	6e-26
58	emb|BX046292.1|CNS097VS Single read from an extremity of a full-...	125	6e-26
59	emb|BX043117.1|CNS095FL Single read from an extremity of a full-...	125	6e-26
60	emb|BX042340.1|CNS094U0 Single read from an extremity of a full-...	125	6e-26
61	emb|BX041676.1|CNS094BK Single read from an extremity of a full-...	125	6e-26
62	emb|BX041675.1|CNS094BJ Single read from an extremity of a full-...	125	6e-26
63	emb|BX041951.1|CNS094J7 Single read from an extremity of a full-...	125	6e-26
64	emb|BX041207.1|CNS093YJ Single read from an extremity of a full-...	125	6e-26
65	emb|BX040008.1|CNS09318 Single read from an extremity of a full-...	125	6e-26
66	emb|BX040007.1|CNS09317 Single read from an extremity of a full-...	125	6e-26
67	emb|BX037483.1|CNS09133 Single read from an extremity of a full-...	125	6e-26
68	emb|BX037168.1|CNS090UC Single read from an extremity of a full-...	125	6e-26
69	emb|BX037167.1|CNS090UB Single read from an extremity of a full-...	125	6e-26
70	emb|BX036321.1|CNS0906T Single read from an extremity of a full-...	125	6e-26
71	emb|BX036320.1|CNS0906S Single read from an extremity of a full-...	125	6e-26
72	emb|BX035877.1|CNS08ZUH Single read from an extremity of a full-...	125	6e-26
73	emb|BX035876.1|CNS08ZUG Single read from an extremity of a full-...	125	6e-26
74	emb|BX035843.1|CNS08ZTJ Single read from an extremity of a full-...	125	6e-26
75	emb|BX034367.1|CNS08YOJ Single read from an extremity of a full-...	125	6e-26
76	emb|BX034366.1|CNS08YOI Single read from an extremity of a full-...	125	6e-26
77	emb|BX032460.1|CNS08X7K Single read from an extremity of a full-...	125	6e-26
78	emb|BX031739.1|CNS08WNJ Single read from an extremity of a full-...	125	6e-26
79	emb|BX031421.1|CNS08WEP Single read from an extremity of a full-...	125	6e-26
80	emb|BX031420.1|CNS08WEO Single read from an extremity of a full-...	125	6e-26
81	emb|BX031299.1|CNS08WBB Single read from an extremity of a full-...	125	6e-26
82	emb|BX030434.1|CNS08VNA Single read from an extremity of a full-...	125	6e-26
83	emb|BX030022.1|CNS08VBU Single read from an extremity of a full-...	125	6e-26
84	emb|BX030005.1|CNS08VBD Single read from an extremity of a full-...	125	6e-26
85	emb|BX028667.1|CNS08UA7 Single read from an extremity of a full-...	125	6e-26
86	emb|BX028362.1|CNS08U1Q Single read from an extremity of a full-...	125	6e-26
87	emb|BX027498.1|CNS08TDQ Single read from an extremity of a full-...	125	6e-26
88	emb|BX027481.1|CNS08TD9 Single read from an extremity of a full-...	125	6e-26
89	emb|BX027414.1|CNS08TBE Single read from an extremity of a full-...	125	6e-26
90	emb|BX027413.1|CNS08TBD Single read from an extremity of a full-...	125	6e-26
91	emb|BX025592.1|CNS08RWS Single read from an extremity of a full-...	125	6e-26
92	emb|BX024680.1|CNS08R7G Single read from an extremity of a full-...	125	6e-26
93	emb|BX024182.1|CNS08QTM Single read from an extremity of a full-...	125	6e-26
94	emb|BX022047.1|CNS08P6B Single read from an extremity of a full-...	125	6e-26
95	emb|BX021562.1|CNS08OSU Single read from an extremity of a full-...	125	6e-26
96	emb|BX016310.1|CNS08KQY Single read from an extremity of a full-...	125	6e-26
97	emb|BX015921.1|CNS08KG5 Single read from an extremity of a full-...	125	6e-26
98	emb|BX015406.1|CNS08K1U Single read from an extremity of a full-...	125	6e-26
99	emb|BX014758.1|CNS08JJU Single read from an extremity of a full-...	125	6e-26
100	emb|BX012966.1|CNS08I62 Single read from an extremity of a full-...	125	6e-26
101	emb|BX012868.1|CNS08I3C Single read from an extremity of a full-...	125	6e-26
102	emb|BX012118.1|CNS08HII Single read from an extremity of a full-...	125	6e-26
103	emb|BX010779.1|CNS08GHB Single read from an extremity of a full-...	125	6e-26
104	emb|BX010285.1|CNS08G3L Single read from an extremity of a full-...	125	6e-26
105	emb|BX010284.1|CNS08G3K Single read from an extremity of a full-...	125	6e-26
106	emb|BX009579.1|CNS08FJZ Single read from an extremity of a full-...	125	6e-26
107	emb|BX008809.1|CNS08EYL Single read from an extremity of a full-...	125	6e-26
108	emb|BX006288.1|CNS08D0K Single read from an extremity of a full-...	125	6e-26
109	emb|BX006287.1|CNS08D0J Single read from an extremity of a full-...	125	6e-26
110	emb|BX006100.1|CNS08CVC Single read from an extremity of a full-...	125	6e-26
111	emb|BX842597.1| Neurospora crassa DNA linkage group II BAC clone...	125	6e-26
112	emb|BX842596.1| Neurospora crassa DNA linkage group II BAC clone...	125	6e-26
113	emb|CT032678.1| Platynereis dumerilii EST IB0AAA33CA06EM1	123	2e-25
114	emb|CT032568.1| Platynereis dumerilii EST IB0AAA36BC12EM1	123	2e-25
115	emb|CT032567.1| Platynereis dumerilii EST IB0AAA36BC12FM1	123	2e-25
116	emb|AJ439528.1|PSP439528 Polytomella sp. 'Pringsheim 198.80' mRN...	121	9e-25
117	gb|DQ066208.1| Ixodes scapularis isolate ISUFL41 40S ribosomal p...	121	9e-25
118	emb|BX006874.1|CNS08DGU Single read from an extremity of a full-...	119	3e-24
119	dbj|AK223106.1| Homo sapiens mRNA for ribosomal protein S5 varia...	119	3e-24
120	emb|BX060986.1|CNS09J7Y Single read from an extremity of a full-...	117	1e-23
121	emb|BX069150.1|CNS09PIQ Single read from an extremity of a full-...	117	1e-23
122	emb|BX067167.1|CNS09NZN Single read from an extremity of a full-...	117	1e-23
123	emb|BX064990.1|CNS09MB6 Single read from an extremity of a full-...	117	1e-23
124	emb|BX064166.1|CNS09LOA Single read from an extremity of a full-...	117	1e-23
125	emb|BX062350.1|CNS09K9U Single read from an extremity of a full-...	117	1e-23
126	emb|BX061779.1|CNS09JTZ Single read from an extremity of a full-...	117	1e-23
127	emb|BX060577.1|CNS09IWL Single read from an extremity of a full-...	117	1e-23
128	emb|BX059488.1|CNS09I2C Single read from an extremity of a full-...	117	1e-23
129	emb|BX054593.1|CNS09EAD Single read from an extremity of a full-...	117	1e-23
130	emb|BX054182.1|CNS09DYY Single read from an extremity of a full-...	117	1e-23
131	emb|BX054146.1|CNS09DXY Single read from an extremity of a full-...	117	1e-23
132	emb|BX050132.1|CNS09AUG Single read from an extremity of a full-...	117	1e-23
133	emb|BX049760.1|CNS09AK4 Single read from an extremity of a full-...	117	1e-23
134	emb|BX030899.1|CNS08W07 Single read from an extremity of a full-...	117	1e-23
135	emb|BX047889.1|CNS09945 Single read from an extremity of a full-...	117	1e-23
136	emb|BX047406.1|CNS098QQ Single read from an extremity of a full-...	117	1e-23
137	emb|BX047180.1|CNS098KG Single read from an extremity of a full-...	117	1e-23
138	emb|BX045879.1|CNS097KB Single read from an extremity of a full-...	117	1e-23
139	emb|BX042956.1|CNS095B4 Single read from an extremity of a full-...	117	1e-23
140	emb|BX043656.1|CNS095UK Single read from an extremity of a full-...	117	1e-23
141	emb|BX043116.1|CNS095FK Single read from an extremity of a full-...	117	1e-23
142	emb|BX039701.1|CNS092SP Single read from an extremity of a full-...	117	1e-23
143	emb|BX037484.1|CNS09134 Single read from an extremity of a full-...	117	1e-23
144	emb|BX034032.1|CNS08YF8 Single read from an extremity of a full-...	117	1e-23
145	emb|BX034031.1|CNS08YF7 Single read from an extremity of a full-...	117	1e-23
146	emb|BX033399.1|CNS08XXN Single read from an extremity of a full-...	117	1e-23
147	emb|BX032461.1|CNS08X7L Single read from an extremity of a full-...	117	1e-23
148	emb|BX032232.1|CNS08X18 Single read from an extremity of a full-...	117	1e-23
149	emb|BX031884.1|CNS08WRK Single read from an extremity of a full-...	117	1e-23
150	emb|BX031803.1|CNS08WPB Single read from an extremity of a full-...	117	1e-23
151	emb|BX031740.1|CNS08WNK Single read from an extremity of a full-...	117	1e-23
152	emb|BX031300.1|CNS08WBC Single read from an extremity of a full-...	117	1e-23
153	emb|BX031110.1|CNS08W62 Single read from an extremity of a full-...	117	1e-23
154	emb|BX030006.1|CNS08VBE Single read from an extremity of a full-...	117	1e-23
155	emb|BX029671.1|CNS08V23 Single read from an extremity of a full-...	117	1e-23
156	emb|BX028773.1|CNS08UD5 Single read from an extremity of a full-...	117	1e-23
157	emb|BX028668.1|CNS08UA8 Single read from an extremity of a full-...	117	1e-23
158	emb|BX028421.1|CNS08U3D Single read from an extremity of a full-...	117	1e-23
159	emb|BX028363.1|CNS08U1R Single read from an extremity of a full-...	117	1e-23
160	emb|BX026183.1|CNS08SD7 Single read from an extremity of a full-...	117	1e-23
161	emb|BX025369.1|CNS08RQL Single read from an extremity of a full-...	117	1e-23
162	emb|BX022855.1|CNS08PSR Single read from an extremity of a full-...	117	1e-23
163	emb|BX024183.1|CNS08QTN Single read from an extremity of a full-...	117	1e-23
164	emb|BX023607.1|CNS08QDN Single read from an extremity of a full-...	117	1e-23
165	emb|BX023606.1|CNS08QDM Single read from an extremity of a full-...	117	1e-23
166	emb|BX023496.1|CNS08QAK Single read from an extremity of a full-...	117	1e-23
167	emb|BX023083.1|CNS08PZ3 Single read from an extremity of a full-...	117	1e-23
168	emb|BX022243.1|CNS08PBR Single read from an extremity of a full-...	117	1e-23
169	emb|BX022242.1|CNS08PBQ Single read from an extremity of a full-...	117	1e-23
170	emb|BX018907.1|CNS08MR3 Single read from an extremity of a full-...	117	1e-23
171	emb|BX015407.1|CNS08K1V Single read from an extremity of a full-...	117	1e-23
172	emb|BX013915.1|CNS08IWF Single read from an extremity of a full-...	117	1e-23
173	emb|BX013914.1|CNS08IWE Single read from an extremity of a full-...	117	1e-23
174	emb|BX008810.1|CNS08EYM Single read from an extremity of a full-...	117	1e-23
175	emb|BX008262.1|CNS08EJE Single read from an extremity of a full-...	117	1e-23
176	emb|BX007419.1|CNS08DVZ Single read from an extremity of a full-...	117	1e-23
177	emb|BX007418.1|CNS08DVY Single read from an extremity of a full-...	117	1e-23
178	emb|BX006492.1|CNS08D68 Single read from an extremity of a full-...	117	1e-23
179	gb|AC008136.4|AC008136 Drosophila melanogaster, chromosome 3R, r...	117	1e-23
180	gb|AC005721.3|AC005721 Drosophila melanogaster, chromosome 3R, r...	117	1e-23
181	ref|XM_555129.2| Anopheles gambiae str. PEST ENSANGP00000028274 ...	117	1e-23
182	ref|XM_317132.2| Anopheles gambiae str. PEST ENSANGP00000025326 ...	117	1e-23
183	gb|AE003706.5| Drosophila melanogaster chromosome 3R, section 44...	117	1e-23
184	gb|AC010921.12| Drosophila melanogaster clone BACR15L12, complet...	111	8e-22
185	gb|AC012160.7| Drosophila melanogaster clone BACR06G02, complete...	111	8e-22
186	emb|BX041256.1|CNS093ZW Single read from an extremity of a full-...	111	8e-22
187	emb|BX036089.1|CNS0900D Single read from an extremity of a full-...	111	8e-22
188	gb|U35631.2|DMU35631 Drosophila melanogaster MEI-217 (mei-217) a...	111	8e-22
189	gb|AE003504.4| Drosophila melanogaster chromosome X, section 56 ...	111	8e-22
190	emb|CT033676.1| Platynereis dumerilii EST IB0AAA16AH02EM1	111	8e-22
191	emb|CT033675.1| Platynereis dumerilii EST IB0AAA16AH02FM1	111	8e-22
192	emb|CT033316.1| Platynereis dumerilii EST IB0AAA22CF06FM1	111	8e-22
193	emb|BX070858.1|CNS09QU6 Single read from an extremity of a full-...	109	3e-21
194	emb|BX069638.1|CNS09PWA Single read from an extremity of a full-...	109	3e-21
195	emb|BX066320.1|CNS09NC4 Single read from an extremity of a full-...	109	3e-21
196	emb|BX064714.1|CNS09M3I Single read from an extremity of a full-...	109	3e-21
197	emb|BX059728.1|CNS09I90 Single read from an extremity of a full-...	109	3e-21
198	emb|BX059727.1|CNS09I8Z Single read from an extremity of a full-...	109	3e-21
199	emb|BX059264.1|CNS09HW4 Single read from an extremity of a full-...	109	3e-21
200	emb|BX054183.1|CNS09DYZ Single read from an extremity of a full-...	109	3e-21
201	emb|BX047407.1|CNS098QR Single read from an extremity of a full-...	109	3e-21
202	emb|BX045880.1|CNS097KC Single read from an extremity of a full-...	109	3e-21
203	emb|BX042957.1|CNS095B5 Single read from an extremity of a full-...	109	3e-21
204	emb|BX042339.1|CNS094TZ Single read from an extremity of a full-...	109	3e-21
205	emb|BX031111.1|CNS08W63 Single read from an extremity of a full-...	109	3e-21
206	emb|BX028774.1|CNS08UD6 Single read from an extremity of a full-...	109	3e-21
207	emb|BX028422.1|CNS08U3E Single read from an extremity of a full-...	109	3e-21
208	emb|BX024681.1|CNS08R7H Single read from an extremity of a full-...	109	3e-21
209	emb|BX024121.1|CNS08QRX Single read from an extremity of a full-...	109	3e-21
210	emb|BX020767.1|CNS08O6R Single read from an extremity of a full-...	109	3e-21
211	emb|BX018908.1|CNS08MR4 Single read from an extremity of a full-...	109	3e-21
212	emb|BX015043.1|CNS08JRR Single read from an extremity of a full-...	109	3e-21
213	emb|BX014759.1|CNS08JJV Single read from an extremity of a full-...	109	3e-21
214	emb|BX012967.1|CNS08I63 Single read from an extremity of a full-...	109	3e-21
215	emb|BX008888.1|CNS08F0S Single read from an extremity of a full-...	109	3e-21
216	emb|BX066873.1|CNS09NRH Single read from an extremity of a full-...	107	1e-20
217	emb|BX058348.1|CNS09H6O Single read from an extremity of a full-...	107	1e-20
218	emb|BX056006.1|CNS09FDM Single read from an extremity of a full-...	107	1e-20
219	emb|BX037292.1|CNS090XS Single read from an extremity of a full-...	107	1e-20
220	emb|BX034797.1|CNS08Z0H Single read from an extremity of a full-...	107	1e-20
221	emb|BX006274.1|CNS08D06 Single read from an extremity of a full-...	107	1e-20
222	emb|CT032677.1| Platynereis dumerilii EST IB0AAA33CA06FM1	107	1e-20
223	ref|NM_183433.2| Oryza sativa (japonica cultivar-group), mRNA	105	5e-20
224	ref|XM_341788.2| PREDICTED: Rattus norvegicus ribosomal protein ...	105	5e-20
225	dbj|AK121523.1| Oryza sativa (japonica cultivar-group) cDNA clon...	105	5e-20
226	dbj|AK059844.1| Oryza sativa (japonica cultivar-group) cDNA clon...	105	5e-20
227	gb|BC059443.1| Danio rerio ribosomal protein S5, mRNA (cDNA clon...	101	8e-19
228	emb|BX070857.1|CNS09QU5 Single read from an extremity of a full-...	101	8e-19
229	emb|BX067168.1|CNS09NZO Single read from an extremity of a full-...	101	8e-19
230	emb|BX065224.1|CNS09MHO Single read from an extremity of a full-...	101	8e-19
231	emb|BX055290.1|CNS09ETQ Single read from an extremity of a full-...	101	8e-19
232	emb|BX036088.1|CNS0900C Single read from an extremity of a full-...	101	8e-19
233	emb|BX035842.1|CNS08ZTI Single read from an extremity of a full-...	101	8e-19
234	emb|BX030023.1|CNS08VBV Single read from an extremity of a full-...	101	8e-19
235	emb|BX025593.1|CNS08RWT Single read from an extremity of a full-...	101	8e-19
236	emb|BX023497.1|CNS08QAL Single read from an extremity of a full-...	101	8e-19
237	emb|BX022048.1|CNS08P6C Single read from an extremity of a full-...	101	8e-19
238	emb|BX012119.1|CNS08HIJ Single read from an extremity of a full-...	101	8e-19
239	emb|BX035703.1|CNS08ZPN Single read from an extremity of a full-...	100	3e-18
240	emb|BX055955.1|CNS09FC7 Single read from an extremity of a full-...	100	3e-18
241	emb|BX032904.1|CNS08XJW Single read from an extremity of a full-...	100	3e-18
242	emb|BX010780.1|CNS08GHC Single read from an extremity of a full-...	100	3e-18
243	emb|BX006934.1|CNS08DII Single read from an extremity of a full-...	100	3e-18
244	emb|AM167929.1| Chlamydomonas sp. ICE-L mRNA for 40S ribosomal p...	100	3e-18
245	gb|BC058690.1| Mus musculus ribosomal protein S5, mRNA (cDNA clo...	98	1e-17
246	ref|XM_747778.1| Aspergillus fumigatus Af293 40S ribosomal prote...	98	1e-17
247	emb|Y12431.1|MMRPS5 M.musculus mRNA for ribosomal protein S5	98	1e-17
248	dbj|AK152449.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	98	1e-17
249	dbj|AK167533.1| Mus musculus 14 days embryo liver cDNA, RIKEN fu...	98	1e-17
250	dbj|AK164079.1| Mus musculus 12 days embryo spinal cord cDNA, RI...	98	1e-17
251	dbj|AK160552.1| Mus musculus ES cells cDNA, RIKEN full-length en...	98	1e-17
252	dbj|AK168106.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length...	98	1e-17
253	dbj|AK168044.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-...	98	1e-17
254	dbj|AK169016.1| Mus musculus 17 days embryo kidney cDNA, RIKEN f...	98	1e-17
255	dbj|AK172446.1| Mus musculus activated spleen cDNA, RIKEN full-l...	98	1e-17
256	dbj|AK020477.1| Mus musculus 12 days embryo embryonic body betwe...	98	1e-17
257	dbj|AK010681.1| Mus musculus ES cells cDNA, RIKEN full-length en...	98	1e-17
258	dbj|AK009663.1| Mus musculus adult male tongue cDNA, RIKEN full-...	98	1e-17
259	dbj|AK050622.1| Mus musculus 2 days neonate thymus thymic cells ...	98	1e-17
260	dbj|AK050611.1| Mus musculus 2 days neonate thymus thymic cells ...	98	1e-17
261	dbj|AK012481.1| Mus musculus 11 days embryo whole body cDNA, RIK...	98	1e-17
262	dbj|AK012424.1| Mus musculus 11 days embryo whole body cDNA, RIK...	98	1e-17
263	dbj|AK002235.1| Mus musculus adult male kidney cDNA, RIKEN full-...	98	1e-17
264	dbj|AK020754.1| Mus musculus 0 day neonate thymus cDNA, RIKEN fu...	98	1e-17
265	dbj|AK103918.1| Oryza sativa (japonica cultivar-group) cDNA clon...	98	1e-17
266	dbj|AK059823.1| Oryza sativa (japonica cultivar-group) cDNA clon...	98	1e-17
267	dbj|AK059558.1| Oryza sativa (japonica cultivar-group) cDNA clon...	98	1e-17
268	gb|BC020401.1| Mus musculus ribosomal protein S5, mRNA (cDNA clo...	98	1e-17
269	emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1...	98	1e-17
270	gb|AY650305.1| Macaca fascicularis ribosomal protein S5 mRNA, pa...	96	5e-17
271	ref|XM_505167.1| Yarrowia lipolytica CLIB122, YALI0F08569g predi...	96	5e-17
272	emb|BX029068.1|CNS08ULC Single read from an extremity of a full-...	96	5e-17
273	ref|XM_528175.1| PREDICTED: Pan troglodytes similar to ribosomal...	94	2e-16
274	ref|NM_173232.1| Danio rerio ribosomal protein S5 (rps5), mRNA	94	2e-16
275	emb|BX061780.1|CNS09JU0 Single read from an extremity of a full-...	94	2e-16
276	emb|BX041950.1|CNS094J6 Single read from an extremity of a full-...	94	2e-16
277	emb|BX033400.1|CNS08XXO Single read from an extremity of a full-...	94	2e-16
278	emb|BX032903.1|CNS08XJV Single read from an extremity of a full-...	94	2e-16
279	emb|BX012234.1|CNS08HLQ Single read from an extremity of a full-...	94	2e-16
280	gb|AF506223.1| Danio rerio 40S ribosomal protein S5 (rps5) mRNA,...	94	2e-16
281	gb|BT016445.1| Zea mays clone Contig278 mRNA sequence	92	8e-16
282	emb|BX068415.1|CNS09OYB Single read from an extremity of a full-...	92	8e-16
283	emb|BX060098.1|CNS09IJA Single read from an extremity of a full-...	92	8e-16
284	emb|BX027499.1|CNS08TDR Single read from an extremity of a full-...	92	8e-16
285	emb|BX023855.1|CNS08QKJ Single read from an extremity of a full-...	92	8e-16
286	emb|BX009580.1|CNS08FK0 Single read from an extremity of a full-...	92	8e-16
287	emb|Y08860.1|NP40SRS5 N.plumbaginifolia mRNA for 40S ribosomal p...	92	8e-16
288	gb|AY103625.1| Zea mays PCO091587 mRNA sequence	92	8e-16
289	gb|BT016516.1| Zea mays clone Contig349 mRNA sequence	90	3e-15
290	gb|AF517858.1| Griffithsia japonica isolate Gj431 40S ribosome p...	90	3e-15
291	dbj|AK062556.1| Oryza sativa (japonica cultivar-group) cDNA clon...	90	3e-15
292	ref|NM_009095.1| Mus musculus ribosomal protein S5 (Rps5), mRNA	90	3e-15
293	emb|X58465.1|RNRPS5 Rat mRNA for ribosomal protein S5	90	3e-15
294	gb|U78085.1|MMU78085 Mus musculus ribosomal protein S5 mRNA, com...	90	3e-15
295	emb|BX062351.1|CNS09K9V Single read from an extremity of a full-...	88	1e-14
296	emb|BX043657.1|CNS095UL Single read from an extremity of a full-...	88	1e-14
297	ref|XM_518704.1| PREDICTED: Pan troglodytes similar to KIAA0721 ...	86	5e-14
298	gb|AE017351.1| Cryptococcus neoformans var. neoformans JEC21 chr...	86	5e-14
299	ref|XM_567915.1| Cryptococcus neoformans var. neoformans JEC21 4...	86	5e-14
300	emb|AL050331.11|HSDJ486I3 Human DNA sequence from clone RP3-486I...	86	5e-14
301	emb|BX059265.1|CNS09HW5 Single read from an extremity of a full-...	86	5e-14
302	emb|BX055957.1|CNS09FC9 Single read from an extremity of a full-...	86	5e-14
303	emb|BX015922.1|CNS08KG6 Single read from an extremity of a full-...	86	5e-14
304	gb|AC104212.3| Homo sapiens chromosome 8, clone RP11-941H19, com...	86	5e-14
305	ref|NG_000896.1| Homo sapiens ribosomal protein S5 pseudogene 1 ...	86	5e-14
306	gb|AY130451.1| Petromyzon marinus ribosomal protein S5 mRNA, par...	86	5e-14
307	dbj|D29726.1|RICYK40 Oryza sativa mRNA, partial homologous to ri...	86	5e-14
308	emb|AJ563480.1|CGI563480 Crassostrea gigas partial mRNA for ribo...	86	5e-14
309	ref|XM_653355.1| Aspergillus nidulans FGSC A4 40S ribosomal prot...	84	2e-13
310	emb|CR523515.1| Gallus gallus finished cDNA, clone ChEST17m15	84	2e-13
311	ref|NM_001015531.1| Bos taurus ribosomal protein S5 (RPS5), mRNA	82	8e-13
312	ref|XM_386195.1| Gibberella zeae PH-1 chromosome 3 RS5_CICAR 40S...	82	8e-13
313	ref|XM_856770.1| PREDICTED: Canis familiaris similar to ribosoma...	82	8e-13
314	ref|XM_856740.1| PREDICTED: Canis familiaris similar to ribosoma...	82	8e-13
315	ref|XM_856714.1| PREDICTED: Canis familiaris similar to ribosoma...	82	8e-13
316	ref|XM_856685.1| PREDICTED: Canis familiaris similar to ribosoma...	82	8e-13
317	ref|XM_533568.2| PREDICTED: Canis familiaris similar to ribosoma...	82	8e-13
318	gb|BC102374.1| Bos taurus ribosomal protein S5, mRNA (cDNA clone...	82	8e-13
319	gb|BT021032.1| Bos taurus ribosomal protein S5 (RPS5), mRNA, com...	82	8e-13
320	gb|AE016815.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10...	82	8e-13
321	gb|AY547734.1| Ornithodoros moubata 40S ribosomal protein S5 mRN...	80	3e-12
322	gb|AY194365.1| Vitis vinifera putative 40S ribosomal protein S5 ...	80	3e-12
323	emb|BX064991.1|CNS09MB7 Single read from an extremity of a full-...	80	3e-12
324	emb|BX062734.1|CNS09KKI Single read from an extremity of a full-...	80	3e-12
325	emb|BX056032.1|CNS09FEC Single read from an extremity of a full-...	80	3e-12
326	emb|BX030900.1|CNS08W08 Single read from an extremity of a full-...	80	3e-12
327	emb|BX047654.1|CNS098XM Single read from an extremity of a full-...	80	3e-12
328	emb|BX029672.1|CNS08V24 Single read from an extremity of a full-...	80	3e-12
329	emb|BX016311.1|CNS08KQZ Single read from an extremity of a full-...	80	3e-12
330	emb|BX006935.1|CNS08DIJ Single read from an extremity of a full-...	80	3e-12
331	gb|AY837869.1| Trichoplusia ni ribosomal protein S5 mRNA, comple...	80	3e-12
332	ref|NM_208472.1| Eremothecium gossypii ABR171Wp (ABR171W), mRNA	80	3e-12
333	ref|NM_112027.2| Arabidopsis thaliana ATRPS5A (RIBOSOMAL PROTEIN...	78	1e-11
334	ref|NM_180233.1| Arabidopsis thaliana ATRPS5A (RIBOSOMAL PROTEIN...	78	1e-11
335	emb|BX051929.1|CNS09C8D Single read from an extremity of a full-...	78	1e-11
336	gb|AY091376.1| Arabidopsis thaliana putative 40S ribosomal prote...	78	1e-11
337	gb|AY045846.1| Arabidopsis thaliana putative 40S ribosomal prote...	78	1e-11
338	dbj|AB199894.1| Crassostrea gigas mRNA for ribosomal protein S5,...	78	1e-11
339	emb|BX822925.1|CNS0A746 Arabidopsis thaliana Full-length cDNA Co...	78	1e-11
340	emb|BX822599.1|CNS0A75J Arabidopsis thaliana Full-length cDNA Co...	78	1e-11
341	emb|BX824143.1|CNS0A6QW Arabidopsis thaliana Full-length cDNA Co...	78	1e-11
342	emb|BX822969.1|CNS0A70I Arabidopsis thaliana Full-length cDNA Co...	78	1e-11
343	gb|AY086938.1| Arabidopsis thaliana clone 29782 mRNA, complete s...	78	1e-11
344	ref|NM_129283.2| Arabidopsis thaliana ATRPS5B (RIBOSOMAL PROTEIN...	76	5e-11
345	ref|NM_001036425.1| Arabidopsis thaliana ATRPS5B (RIBOSOMAL PROT...	76	5e-11
346	emb|Z99168.1|SPAC8C9 S.pombe chromosome I cosmid c8C9	76	5e-11
347	emb|BX048651.1|CNS099PB Single read from an extremity of a full-...	76	5e-11
348	emb|BX037293.1|CNS090XT Single read from an extremity of a full-...	76	5e-11
349	emb|AL360054.1|SPAC328 S.pombe chromosome I cosmid c328	76	5e-11
350	gb|AY081669.1| Arabidopsis thaliana 40S ribosomal protein S5 (At...	76	5e-11
351	gb|AY059849.1| Arabidopsis thaliana 40S ribosomal protein S5 (At...	76	5e-11
352	ref|NM_001019702.1| Schizosaccharomyces pombe 972h- hypothetical...	76	5e-11
353	ref|NM_001019635.1| Schizosaccharomyces pombe 972h- hypothetical...	76	5e-11
354	gb|AC158328.1| Homo sapiens chromosome 21 clone WI2-2902K17, com...	76	5e-11
355	ref|NG_000903.1| Homo sapiens ribosomal protein S5-like (RPS5L) ...	76	5e-11
356	emb|BX820728.1|CNS0A81J Arabidopsis thaliana Full-length cDNA Co...	76	5e-11
357	emb|BX824064.1|CNS0A6PV Arabidopsis thaliana Full-length cDNA Co...	76	5e-11
358	dbj|AP000046.1| Homo sapiens genomic DNA, chromosome 21q22.1, se...	76	5e-11
359	gb|AF039906.1|AF039906 Homo sapiens cosmid D16B8, chromosome 21 ...	76	5e-11
360	emb|AL954218.1| Pan troglodytes chromosome 22 clone PTB-451A22 m...	76	5e-11
361	dbj|AP001717.1| Homo sapiens genomic DNA, chromosome 21q, sectio...	76	5e-11
362	dbj|AP000190.1| Homo sapiens genomic DNA, chromosome 21q22.1, D2...	76	5e-11
363	dbj|AP000302.1| Homo sapiens genomic DNA, chromosome 21q22.1, D2...	76	5e-11
364	dbj|AP000114.1| Homo sapiens genomic DNA of 21q22.1, GART and AM...	76	5e-11
365	gb|AY088613.1| Arabidopsis thaliana clone 8397 mRNA, complete se...	74	2e-10
366	ref|XM_531542.1| PREDICTED: Pan troglodytes similar to ribosomal...	72	7e-10
367	emb|BX034798.1|CNS08Z0I Single read from an extremity of a full-...	72	7e-10
368	emb|BX017025.1|CNS08LAT Single read from an extremity of a full-...	72	7e-10
369	gb|AC012313.7| Homo sapiens chromosome 19 clone CTD-2619J13, com...	72	7e-10
370	dbj|AB061853.2| Homo sapiens RPS5 gene for ribosomal protein S5,...	72	7e-10
371	dbj|BS000181.1| Pan troglodytes chromosome 22 clone:PTB-128M13, ...	72	7e-10
372	dbj|BS000154.1| Pan troglodytes chromosome 22 clone:RP43-091K15,...	72	7e-10
373	dbj|AB209803.1| Homo sapiens mRNA for ribosomal protein S5 varia...	72	7e-10
374	ref|XM_525506.1| PREDICTED: Pan troglodytes similar to ribosomal...	70	3e-09
375	gb|AC156838.3| Pan troglodytes BAC clone CH251-75L15 from chromo...	70	3e-09
376	gb|AC159107.2| Pan troglodytes BAC clone CH251-567D12 from chrom...	70	3e-09
377	dbj|BS000186.1| Pan troglodytes chromosome 22 clone:RP43-074L01,...	70	3e-09
378	dbj|AP001719.1| Homo sapiens genomic DNA, chromosome 21q, sectio...	70	3e-09
379	dbj|AP000165.1| Homo sapiens genomic DNA, chromosome 21q22.1, D2...	70	3e-09
380	dbj|AP000315.1| Homo sapiens genomic DNA, chromosome 21q22.1, D2...	70	3e-09
381	dbj|AB007149.1| Homo sapiens gene for ribosomal protein S5, part...	70	3e-09
382	gb|AY190724.1| Pagrus major 40S ribosomal protein S5 mRNA, parti...	68	1e-08
383	gb|AC114011.5| Oryza sativa (japonica cultivar-group) chromosome...	68	1e-08
384	emb|AL117162.1|CNS01DQQ Botrytis cinerea strain T4 cDNA library	68	1e-08
385	emb|AL116007.1|CNS01CUN Botrytis cinerea strain T4 cDNA library	68	1e-08
386	emb|AL113461.1|CNS01AVX Botrytis cinerea strain T4 cDNA library	68	1e-08
387	emb|AL111465.1|CNS019CH Botrytis cinerea strain T4 cDNA library	68	1e-08
388	dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D...	68	1e-08
389	gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome...	68	1e-08
390	emb|BX064620.1|CNS09M0W Single read from an extremity of a full-...	66	4e-08
391	emb|BX025370.1|CNS08RQM Single read from an extremity of a full-...	66	4e-08
392	gb|AF426408.1|AF426408 Drosophila virilis MEI-217 (mei-217) and ...	66	4e-08
393	emb|BX064715.1|CNS09M3J Single read from an extremity of a full-...	64	2e-07
394	emb|BX030435.1|CNS08VNB Single read from an extremity of a full-...	64	2e-07
395	dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005	64	2e-07
396	emb|BX054147.1|CNS09DXZ Single read from an extremity of a full-...	62	7e-07
397	emb|CR380954.1| Candida glabrata strain CBS138 chromosome H comp...	62	7e-07
398	emb|AL116405.1|CNS01D5P Botrytis cinerea strain T4 cDNA library	62	7e-07
399	emb|AL114940.1|CNS01C10 Botrytis cinerea strain T4 cDNA library	62	7e-07
400	ref|XM_446818.1| Candida glabrata CBS138, CAGL0H00462g partial mRNA	60	3e-06
401	emb|BX069208.1|CNS09PKC Single read from an extremity of a full-...	60	3e-06
402	emb|BX022854.1|CNS08PSQ Single read from an extremity of a full-...	60	3e-06
403	emb|AL114695.1|CNS01BU7 Botrytis cinerea strain T4 cDNA library	60	3e-06
404	emb|AL111606.1|CNS019GE Botrytis cinerea strain T4 cDNA library	60	3e-06
405	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	60	3e-06
406	dbj|AP003727.3| Oryza sativa (japonica cultivar-group) genomic D...	60	3e-06
407	dbj|AP008219.1| Oryza sativa (japonica cultivar-group) genomic D...	60	3e-06
408	dbj|AP003610.2| Oryza sativa (japonica cultivar-group) genomic D...	60	3e-06
409	emb|AM048932.1| Micromalthus debilis partial mRNA for ribosomal ...	58	1e-05
410	emb|BX047181.1|CNS098KH Single read from an extremity of a full-...	58	1e-05
411	gb|AC107704.8| Mus musculus chromosome 7, clone RP24-121L4, comp...	56	4e-05
412	ref|XM_370161.1| Magnaporthe grisea 70-15 chromosome II hypothet...	56	4e-05
413	gb|AC121301.8| Mus musculus chromosome 7, clone RP23-432H1, comp...	56	4e-05
414	ref|XM_751645.1| Ustilago maydis 521 hypothetical protein (UM005...	56	4e-05
415	emb|BX027480.1|CNS08TD8 Single read from an extremity of a full-...	56	4e-05
416	gb|AF429979.1| Spodoptera frugiperda ribosomal protein S5 mRNA, ...	56	4e-05
417	emb|AL116092.1|CNS01CX0 Botrytis cinerea strain T4 cDNA library	54	2e-04
418	emb|X89368.1|SCDNARPS5 S.cerevisiae DNA for ribosomal protein S5...	54	2e-04
419	emb|Z49623.1|SCYJR123W S.cerevisiae chromosome X reading frame O...	54	2e-04
420	gb|AY692868.1| Saccharomyces cerevisiae clone FLH111166.01X YJR1...	52	7e-04
421	gb|AY498744.1| Capsicum annuum 40S ribosomal protein S5 (RpS5) m...	52	7e-04
422	emb|AL353151.26| Human DNA sequence from clone RP11-307I14 on ch...	52	7e-04
423	emb|BX029809.1|CNS08V5X Single read from an extremity of a full-...	52	7e-04
424	dbj|AK108544.1| Oryza sativa (japonica cultivar-group) cDNA clon...	52	7e-04
425	ref|XM_816135.1| Trypanosoma cruzi strain CL Brener 40S ribosoma...	50	0.003
426	ref|XM_816136.1| Trypanosoma cruzi strain CL Brener 40S ribosoma...	50	0.003
427	ref|XM_815106.1| Trypanosoma cruzi strain CL Brener 40S ribosoma...	50	0.003
428	ref|XM_815107.1| Trypanosoma cruzi strain CL Brener 40S ribosoma...	50	0.003
429	emb|CR759918.11| Zebrafish DNA sequence from clone CH211-278M11 ...	50	0.003
430	emb|BX055289.1|CNS09ETP Single read from an extremity of a full-...	50	0.003
431	gb|AC078991.21| Homo sapiens Xp BAC RP11-459A10 (Roswell Park Ca...	50	0.003
432	ref|NM_001016992.2| Xenopus tropicalis hypothetical protein LOC5...	48	0.011
433	gb|BC082738.1| Xenopus tropicalis cDNA clone IMAGE:7030532, cont...	48	0.011
434	ref|XM_823611.1| Trypanosoma brucei TREU927 40S ribosomal protei...	48	0.011
435	emb|BX066872.1|CNS09NRG Single read from an extremity of a full-...	48	0.011
436	emb|AL115882.1|CNS01CR6 Botrytis cinerea strain T4 cDNA library	48	0.011
437	emb|AL113881.1|CNS01B7L Botrytis cinerea strain T4 cDNA library	48	0.011
438	gb|AY196150.1| Leishmania major ribosomal protein S5 gene cluste...	48	0.011
439	emb|BX842610.3| Mouse DNA sequence from clone RP24-16C11 on chro...	48	0.011
440	dbj|AK110655.1| Oryza sativa (japonica cultivar-group) cDNA clon...	48	0.011
441	emb|CR848217.2| Xenopus tropicalis finished cDNA, clone TTpA005f24	48	0.011
442	ref|XM_459740.1| Debaryomyces hansenii CBS767 hypothetical prote...	46	0.042
443	ref|XM_715676.1| Candida albicans SC5314 putative cytosolic ribo...	46	0.042
444	ref|XM_715548.1| Candida albicans SC5314 putative cytosolic ribo...	46	0.042
445	ref|XM_453536.1| Kluyveromyces lactis NRRL Y-1140, KLLA0D10659g ...	46	0.042
446	emb|X71383.1|PCRPS5 P.carnea mRNA for 40S ribosomal protein S5	46	0.042
447	emb|CR382137.1| Debaryomyces hansenii chromosome E of strain CBS...	46	0.042
448	emb|CR382124.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso...	46	0.042
449	emb|AJ783869.1| Timarcha balearica mRNA for S5e ribosomal protei...	46	0.042
450	gb|BC054263.1| Xenopus laevis hypothetical protein MGC64490, mRN...	44	0.16
451	emb|BX053463.1|CNS09DEZ Single read from an extremity of a full-...	44	0.16
452	emb|BX021278.1|CNS08OKY Single read from an extremity of a full-...	44	0.16
453	emb|BX538352.1| Cryptosporidium parvum chromosome 6, complete se...	44	0.16
454	gb|AY857462.1| Suberites domuncula S5 mRNA, complete cds	44	0.16
455	ref|XM_627764.1| Cryptosporidium parvum Iowa II 40S ribosomal pr...	44	0.16
456	gb|BC041523.1| Xenopus laevis hypothetical protein MGC64490, mRN...	44	0.16
457	ref|XM_380885.1| Gibberella zeae PH-1 chromosome 1 hypothetical ...	42	0.65
458	emb|BX050940.1|CNS09BGW Single read from an extremity of a full-...	42	0.65
459	emb|BX049761.1|CNS09AK5 Single read from an extremity of a full-...	42	0.65
460	emb|BX039702.1|CNS092SQ Single read from an extremity of a full-...	42	0.65
461	emb|BX026184.1|CNS08SD8 Single read from an extremity of a full-...	42	0.65
462	emb|BX012218.1|CNS08HLA Single read from an extremity of a full-...	42	0.65
463	dbj|BA000035.2| Corynebacterium efficiens YS-314 DNA, complete g...	42	0.65
464	dbj|AB083299.1| Corynebacterium efficiens pyc gene for pyruvate ...	42	0.65
465	ref|XM_520471.1| PREDICTED: Pan troglodytes similar to RNA cycla...	40	2.6
466	ref|XM_360835.1| Magnaporthe grisea 70-15 hypothetical protein (...	40	2.6
467	gb|AC016795.6|ATAC016795 Arabidopsis thaliana chromosome III BAC...	40	2.6
468	ref|XM_757892.1| Theileria parva strain Muguga chromosome 3 40S ...	40	2.6
469	emb|BX050491.1|CNS09B4F Single read from an extremity of a full-...	40	2.6
470	gb|L47230.1|THE150KDA Theileria parva polymorphic 150 kDa antige...	40	2.6
471	dbj|AK174081.1| Ciona intestinalis cDNA, clone:ciad070j12, full ...	40	2.6
472	dbj|AK173988.1| Ciona intestinalis cDNA, clone:ciad008g18, full ...	40	2.6
473	dbj|AP002040.1| Arabidopsis thaliana genomic DNA, chromosome 3, ...	40	2.6
474	dbj|AK112816.1| Ciona intestinalis cDNA, clone:cilv029d14, full ...	40	2.6

---

>ref|NM_069676.2| Caenorhabditis elegans Ribosomal Protein, Small subunit family
           member (rps-5) (rps-5) mRNA, complete cds
          Length = 755

 Score =  375 bits (189), Expect = e-101
 Identities = 197/201 (98%)
 Strand = Plus / Minus

                                                                       
Query: 1   aaagaaaaacaacangttgcttatcggttggacttggcgacacgctcgagctcatccttc 60
           |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 661 aaagaaaaacaacaagttgcttatcggttggacttggcgacacgctcgagctcatccttc 602

                                                                       
Query: 61  ttcttgatagcgtagctgttggaggatcccttggcggcgttgatgagctcatcagccaag 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 601 ttcttgatagcgtagctgttggaggatcccttggcggcgttgatgagctcatcagccaag 542

                                                                       
Query: 121 cattcggcgatggtcttaacgtttntgaaggcagnctcacgagctccagtgcagagaagc 180
           |||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||
Sbjct: 541 cattcggcgatggtcttaacgtttctgaaggcagcctcacgagctccagtgcagagaagc 482

                                
Query: 181 cagatagcctggttgantctt 201
           |||||||||||||||| ||||
Sbjct: 481 cagatagcctggttgactctt 461

---

>emb|Z68751.1|CET05E11 Caenorhabditis elegans Cosmid T05E11, complete sequence
          Length = 24554

 Score =  359 bits (181), Expect = 2e-96
 Identities = 187/190 (98%)
 Strand = Plus / Plus

                                                                        
Query: 1    aaagaaaaacaacangttgcttatcggttggacttggcgacacgctcgagctcatccttc 60
            |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6844 aaagaaaaacaacaagttgcttatcggttggacttggcgacacgctcgagctcatccttc 6903

                                                                        
Query: 61   ttcttgatagcgtagctgttggaggatcccttggcggcgttgatgagctcatcagccaag 120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6904 ttcttgatagcgtagctgttggaggatcccttggcggcgttgatgagctcatcagccaag 6963

                                                                        
Query: 121  cattcggcgatggtcttaacgtttntgaaggcagnctcacgagctccagtgcagagaagc 180
            |||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||
Sbjct: 6964 cattcggcgatggtcttaacgtttctgaaggcagcctcacgagctccagtgcagagaagc 7023

                      
Query: 181  cagatagcct 190
            ||||||||||
Sbjct: 7024 cagatagcct 7033

---

>gb|AC084495.1|CBRG10C24 Caenorhabditis briggsae cosmid G10C24, complete sequence
          Length = 21608

 Score =  254 bits (128), Expect = 9e-65
 Identities = 167/181 (92%)
 Strand = Plus / Minus

                                                                        
Query: 11   aacangttgcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatag 70
            |||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
Sbjct: 8250 aacaagttgcttatcggttggacttggcgacacgctcgagctcgtccttcttcttgatgg 8191

                                                                        
Query: 71   cgtagctgttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcga 130
            |||||||||||||||||||||| |||||||||||||| || |||||||||||||| ||||
Sbjct: 8190 cgtagctgttggaggatcccttagcggcgttgatgagttcgtcagccaagcattcagcga 8131

                                                                        
Query: 131  tggtcttaacgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcct 190
            ||||||| |||||| |||| ||||  || |||||||| ||||||||||||||||||||||
Sbjct: 8130 tggtcttgacgtttctgaaagcagcttcgcgagctccggtgcagagaagccagatagcct 8071

             
Query: 191  g 191
            |
Sbjct: 8070 g 8070

---

>ref|NM_078658.2| Drosophila melanogaster Ribosomal protein S5a CG8922-RA (RpS5a),
           mRNA
          Length = 855

 Score =  196 bits (99), Expect = 2e-47
 Identities = 157/177 (88%)
 Strand = Plus / Minus

                                                                       
Query: 20  cttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgt 79
           |||| ||||||||||||||||||||||| | |||||||||||||||||| |||||   ||
Sbjct: 740 cttaacggttggacttggcgacacgctccaactcatccttcttcttgatggcgtacgagt 681

                                                                       
Query: 80  tggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaa 139
           |||| |||||||| || |||||||| ||||||||||||| ||| |||||||||||||| |
Sbjct: 680 tggaagatcccttagcagcgttgatcagctcatcagccaggcactcggcgatggtcttga 621

                                                                    
Query: 140 cgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggttga 196
            |||  ||||||||| |||||||||||||||||| || |||||||||||||||||||
Sbjct: 620 tgttcctgaaggcagcctcacgagctccagtgcacagcagccagatagcctggttga 564

---

>gb|AY075368.1| Drosophila melanogaster GM13047 full length cDNA
          Length = 873

 Score =  196 bits (99), Expect = 2e-47
 Identities = 157/177 (88%)
 Strand = Plus / Minus

                                                                       
Query: 20  cttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgt 79
           |||| ||||||||||||||||||||||| | |||||||||||||||||| |||||   ||
Sbjct: 740 cttaacggttggacttggcgacacgctccaactcatccttcttcttgatggcgtacgagt 681

                                                                       
Query: 80  tggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaa 139
           |||| |||||||| || |||||||| ||||||||||||| ||| |||||||||||||| |
Sbjct: 680 tggaagatcccttagcagcgttgatcagctcatcagccaggcactcggcgatggtcttga 621

                                                                    
Query: 140 cgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggttga 196
            |||  ||||||||| |||||||||||||||||| || |||||||||||||||||||
Sbjct: 620 tgttcctgaaggcagcctcacgagctccagtgcacagcagccagatagcctggttga 564

---

>gb|U48394.1|DMU48394 Drosophila melanogaster ribosomal protein S5 homolog (M(1)15D)
           mRNA, complete cds
          Length = 860

 Score =  196 bits (99), Expect = 2e-47
 Identities = 157/177 (88%)
 Strand = Plus / Minus

                                                                       
Query: 20  cttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgt 79
           |||| ||||||||||||||||||||||| | |||||||||||||||||| |||||   ||
Sbjct: 744 cttaacggttggacttggcgacacgctccaactcatccttcttcttgatggcgtacgagt 685

                                                                       
Query: 80  tggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaa 139
           |||| |||||||| || |||||||| ||||||||||||| ||| |||||||||||||| |
Sbjct: 684 tggaagatcccttagcagcgttgatcagctcatcagccaggcactcggcgatggtcttga 625

                                                                    
Query: 140 cgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggttga 196
            |||  ||||||||| |||||||||||||||||| || |||||||||||||||||||
Sbjct: 624 tgttcctgaaggcagcctcacgagctccagtgcacagcagccagatagcctggttga 568

---

>ref|XM_792179.1| PREDICTED: Strongylocentrotus purpuratus similar to ribosomal
           protein S5 (LOC592668), mRNA
          Length = 663

 Score =  180 bits (91), Expect = 1e-42
 Identities = 154/176 (87%)
 Strand = Plus / Minus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           |||||||| || || |||||||||||||| |||||||||||||| |||||   |||||||
Sbjct: 659 cggttggattttgcaacacgctcgagctcgtccttcttcttgattgcgtacgagttggag 600

                                                                       
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
           |||||||||||||| |||||||| |||||||||||||| || ||||||||||| | ||| 
Sbjct: 599 gatcccttggcggcattgatgagttcatcagccaagcactcagcgatggtcttgatgttc 540

                                                                   
Query: 145 ntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggttgantct 200
            |||| |||| |||||||||||||||||| || |||||||||||||| |||| |||
Sbjct: 539 ctgaatgcagcctcacgagctccagtgcacagcagccagatagcctgattgactct 484

---

>gb|AY826153.1| Aedes albopictus clone AL_39 ribosomal protein S5 mRNA, complete
           cds
          Length = 660

 Score =  170 bits (86), Expect = 1e-39
 Identities = 153/176 (86%)
 Strand = Plus / Minus

                                                                       
Query: 21  ttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgtt 80
           |||||||||||||||||| ||||| || || || |||||||||||||| |||||   |||
Sbjct: 660 ttatcggttggacttggccacacgttccagttcgtccttcttcttgatggcgtacgagtt 601

                                                                       
Query: 81  ggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaac 140
           |||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| 
Sbjct: 600 ggaggatcccttagcggcgttgatcagctcatcagccaagcattcggcgatggtcttaat 541

                                                                   
Query: 141 gtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggttga 196
           |||   ||| ||||  || || ||||||||||| |  |||||||||||||||||||
Sbjct: 540 gttacggaatgcagcttcgcgggctccagtgcacaacagccagatagcctggttga 485

---

>emb|CR938304.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YD20AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 888

 Score =  165 bits (83), Expect = 7e-38
 Identities = 153/177 (86%)
 Strand = Plus / Minus

                                                                       
Query: 20  cttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgt 79
           ||||||||||||||||||| ||||| || |  || |||||||||||||| |||||   ||
Sbjct: 714 cttatcggttggacttggccacacgttccaattcgtccttcttcttgatggcgtacgagt 655

                                                                       
Query: 80  tggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaa 139
           ||||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 654 tggaggatcccttagcagcgttgatcagctcatcagccaagcattcggcgatggtcttaa 595

                                                                    
Query: 140 cgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggttga 196
            |||   ||| ||||  || || ||||||||||| || |||||||||||||||||||
Sbjct: 594 tgttacggaatgcagcttcgcgggctccagtgcacagcagccagatagcctggttga 538

---

>emb|CR938303.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 3-prime end of clone
           KW0AAA2YD20BBM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 796

 Score =  165 bits (83), Expect = 7e-38
 Identities = 153/177 (86%)
 Strand = Plus / Plus

                                                                       
Query: 20  cttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgt 79
           ||||||||||||||||||| ||||| || |  || |||||||||||||| |||||   ||
Sbjct: 155 cttatcggttggacttggccacacgttccaattcgtccttcttcttgatggcgtacgagt 214

                                                                       
Query: 80  tggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaa 139
           ||||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 215 tggaggatcccttagcagcgttgatcagctcatcagccaagcattcggcgatggtcttaa 274

                                                                    
Query: 140 cgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggttga 196
            |||   ||| ||||  || || ||||||||||| || |||||||||||||||||||
Sbjct: 275 tgttacggaatgcagcttcgcgggctccagtgcacagcagccagatagcctggttga 331

---

>emb|CR938121.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YJ20AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 717

 Score =  165 bits (83), Expect = 7e-38
 Identities = 153/177 (86%)
 Strand = Plus / Minus

                                                                       
Query: 20  cttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgt 79
           ||||||||||||||||||| ||||| || |  || |||||||||||||| |||||   ||
Sbjct: 714 cttatcggttggacttggccacacgttccaattcgtccttcttcttgatggcgtacgagt 655

                                                                       
Query: 80  tggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaa 139
           ||||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 654 tggaggatcccttagcagcgttgatcagctcatcagccaagcattcggcgatggtcttaa 595

                                                                    
Query: 140 cgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggttga 196
            |||   ||| ||||  || || ||||||||||| || |||||||||||||||||||
Sbjct: 594 tgttacggaatgcagcttcgcgggctccagtgcacagcagccagatagcctggttga 538

---

>gb|DQ440005.1| Aedes aegypti clone AE-198A ribosomal protein S5 mRNA, complete cds
          Length = 660

 Score =  163 bits (82), Expect = 3e-37
 Identities = 152/176 (86%)
 Strand = Plus / Minus

                                                                       
Query: 21  ttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgtt 80
           |||||||||||||||||| ||||| || |  || |||||||||||||| |||||   |||
Sbjct: 660 ttatcggttggacttggccacacgttccaattcgtccttcttcttgatggcgtacgagtt 601

                                                                       
Query: 81  ggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaac 140
           |||||||||||| || |||||||| |||||||||||||||||||||||||||||||||| 
Sbjct: 600 ggaggatcccttagcagcgttgatcagctcatcagccaagcattcggcgatggtcttaat 541

                                                                   
Query: 141 gtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggttga 196
           |||   ||| ||||  || || ||||||||||| || |||||||||||||||||||
Sbjct: 540 gttacggaatgcagcttcgcgggctccagtgcacagcagccagatagcctggttga 485

---

>emb|CR938247.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YF17AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 905

 Score =  157 bits (79), Expect = 2e-35
 Identities = 152/177 (85%)
 Strand = Plus / Minus

                                                                       
Query: 20  cttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgt 79
           ||||||||||||||||||| ||||| || |  || |||||||||||||| ||| |   ||
Sbjct: 714 cttatcggttggacttggccacacgttccaattcgtccttcttcttgatggcgcacgagt 655

                                                                       
Query: 80  tggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaa 139
           ||||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 654 tggaggatcccttagcagcgttgatcagctcatcagccaagcattcggcgatggtcttaa 595

                                                                    
Query: 140 cgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggttga 196
            |||   ||| ||||  || || ||||||||||| || |||||||||||||||||||
Sbjct: 594 tgttacggaatgcagcttcgcgggctccagtgcacagcagccagatagcctggttga 538

---

>emb|CR938133.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YJ09AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 864

 Score =  157 bits (79), Expect = 2e-35
 Identities = 152/177 (85%)
 Strand = Plus / Minus

                                                                       
Query: 20  cttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgt 79
           ||||||||||||||||||| ||||| || |  || ||||||| |||||| |||||   ||
Sbjct: 714 cttatcggttggacttggccacacgttccaattcgtccttctccttgatggcgtacgagt 655

                                                                       
Query: 80  tggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaa 139
           ||||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 654 tggaggatcccttagcagcgttgatcagctcatcagccaagcattcggcgatggtcttaa 595

                                                                    
Query: 140 cgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggttga 196
            |||   ||| ||||  || || ||||||||||| || |||||||||||||||||||
Sbjct: 594 tgttacggaatgcagcttcgcgggctccagtgcacagcagccagatagcctggttga 538

---

>gb|AF263471.1|AF263471 Aedes albopictus ribosomal S5 protein mRNA, partial cds
          Length = 313

 Score =  143 bits (72), Expect = 2e-31
 Identities = 108/120 (90%)
 Strand = Plus / Minus

                                                                       
Query: 20  cttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgt 79
           ||||||||||||||||||| ||||| || || || |||||||||||||| |||||   ||
Sbjct: 132 cttatcggttggacttggccacacgttccagttcgtccttcttcttgatggcgtacgagt 73

                                                                       
Query: 80  tggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaa 139
           ||||||||||||| |||||||||||  |||||||||||||||||||||||||||||||||
Sbjct: 72  tggaggatcccttagcggcgttgatctgctcatcagccaagcattcggcgatggtcttaa 13

---

>gb|AY241965.1| Dermacentor variabilis 40S ribosomal protein S5 mRNA, complete cds
          Length = 756

 Score =  135 bits (68), Expect = 6e-29
 Identities = 144/170 (84%)
 Strand = Plus / Minus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           |||||||||||||| |||||||||||||| |||||||||||||| || |||||||| || 
Sbjct: 675 cggttggacttggccacacgctcgagctcgtccttcttcttgatcgcatagctgttcgat 616

                                                                       
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
           || |||||||| || ||||||||||||||||||||||| ||||| ||||| || | ||| 
Sbjct: 615 gaacccttggctgcattgatgagctcatcagccaagcactcggcaatggttttgatgttg 556

                                                             
Query: 145 ntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggtt 194
             |||||||   ||||| || || ||||| || |||||||| ||||||||
Sbjct: 555 cggaaggcactttcacgggcgcctgtgcacagcagccagatggcctggtt 506

---

>gb|AY785292.1| Callinectes sapidus receptor guanylyl cyclase (GC-YO1) mRNA, complete
            cds
          Length = 4010

 Score =  133 bits (67), Expect = 2e-28
 Identities = 149/177 (84%)
 Strand = Plus / Minus

                                                                        
Query: 20   cttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgt 79
            |||| ||||||||||| || || ||||| ||||| |||||||||||||| ||||||||||
Sbjct: 3942 cttaacggttggactttgccacgcgctccagctcgtccttcttcttgatggcgtagctgt 3883

                                                                        
Query: 80   tggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaa 139
            ||||||| ||| |||  ||||||||||||||||||||||| || || ||||||||||| |
Sbjct: 3882 tggaggagcccctggatgcgttgatgagctcatcagccaaacactcagcgatggtcttga 3823

                                                                     
Query: 140  cgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggttga 196
             |||   |||||||| ||| ||||| || |||   || |||||||| ||||||||||
Sbjct: 3822 tgttacggaaggcagcctcgcgagcaccggtggtcagcagccagatggcctggttga 3766

---

>gb|AF402813.1| Ictalurus punctatus 40S ribosomal protein S5 mRNA, complete cds
          Length = 704

 Score =  131 bits (66), Expect = 9e-28
 Identities = 145/172 (84%)
 Strand = Plus / Minus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           |||||||| ||||| || | ||| ||||| |||||||||||||| |||||   ||| || 
Sbjct: 639 cggttggatttggccactctctccagctcgtccttcttcttgatggcgtacgagtttgac 580

                                                                       
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
           || ||||| ||||||||||||||||| |||||||| || |||||||||||||||| ||||
Sbjct: 579 gaacccttagcggcgttgatgagctcgtcagccaaacactcggcgatggtcttaatgttt 520

                                                               
Query: 145 ntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggttga 196
            ||||||| | ||| |  || |||||||| || |||||||||||||||||||
Sbjct: 519 ctgaaggcggcctctctcgccccagtgcacagcagccagatagcctggttga 468

---

>gb|AY674223.1| Ixodes pacificus clone IP_7_60_92_100_CLU 40S ribosomal protein S5
           mRNA, complete cds
          Length = 630

 Score =  129 bits (65), Expect = 4e-27
 Identities = 101/113 (89%)
 Strand = Plus / Minus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           ||||||||||||||||||||||| ||||| |||||||||||||| |||||||||||||| 
Sbjct: 626 cggttggacttggcgacacgctccagctcgtccttcttcttgatggcgtagctgttggaa 567

                                                                
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctt 137
           || ||||||||||| ||||||||||| || |||| ||| || || ||||||||
Sbjct: 566 gagcccttggcggcattgatgagctcgtccgccaggcactctgcaatggtctt 514

---

>gb|AY130369.1| Branchiostoma lanceolatum ribosomal protein S5 mRNA, partial cds
          Length = 533

 Score =  129 bits (65), Expect = 4e-27
 Identities = 128/150 (85%)
 Strand = Plus / Minus

                                                                       
Query: 51  ctcatccttcttcttgatagcgtagctgttggaggatcccttggcggcgttgatgagctc 110
           |||||||||||||||||||||||||  |||||||||||||||||| || |||||||| ||
Sbjct: 532 ctcatccttcttcttgatagcgtaggagttggaggatcccttggcagcattgatgagttc 473

                                                                       
Query: 111 atcagccaagcattcggcgatggtcttaacgtttntgaaggcagnctcacgagctccagt 170
           |||||||||||| || || || ||||| |||||  ||||||| | ||||||||| || ||
Sbjct: 472 atcagccaagcactcagcaatcgtcttcacgttcctgaaggccgcctcacgagcaccggt 413

                                         
Query: 171 gcagagaagccagatagcctggttgantct 200
           ||| |  | |||||| |||||||||| |||
Sbjct: 412 gcacaacaaccagatggcctggttgactct 383

---

>ref|XM_512950.1| PREDICTED: Pan troglodytes similar to ribosomal protein S5; 40S
           ribosomal protein S5 (LOC456347), mRNA
          Length = 678

 Score =  127 bits (64), Expect = 1e-26
 Identities = 143/170 (84%)
 Strand = Plus / Minus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           |||||||||||||| |||||||| ||||| ||||||||||| || || |||  ||| |||
Sbjct: 622 cggttggacttggccacacgctccagctcgtccttcttcttaatggcataggagttcgag 563

                                                                       
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
           || |||||||| || |||||||||||||| |||| ||| || || |||||||||| ||| 
Sbjct: 562 gagcccttggcagcattgatgagctcatctgccaggcactcagcaatggtcttaatgttc 503

                                                             
Query: 145 ntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggtt 194
             |||||||| ||||||||| || ||||| || |||||||| ||||||||
Sbjct: 502 cggaaggcagcctcacgagcgcctgtgcacagcagccagatggcctggtt 453

---

>gb|BC015405.1| Homo sapiens ribosomal protein S5, mRNA (cDNA clone MGC:21949
           IMAGE:4390892), complete cds
          Length = 743

 Score =  127 bits (64), Expect = 1e-26
 Identities = 143/170 (84%)
 Strand = Plus / Minus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           |||||||||||||| |||||||| ||||| ||||||||||| || || |||  ||| |||
Sbjct: 671 cggttggacttggccacacgctccagctcgtccttcttcttaatggcataggagttcgag 612

                                                                       
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
           || |||||||| || |||||||||||||| |||| ||| || || |||||||||| ||| 
Sbjct: 611 gagcccttggcagcattgatgagctcatctgccaggcactcagcaatggtcttaatgttc 552

                                                             
Query: 145 ntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggtt 194
             |||||||| ||||||||| || ||||| || |||||||| ||||||||
Sbjct: 551 cggaaggcagcctcacgagcgcctgtgcacagcagccagatggcctggtt 502

---

>gb|BC004392.1| Homo sapiens cDNA clone IMAGE:3635299, **** WARNING: chimeric clone
            ****
          Length = 4791

 Score =  127 bits (64), Expect = 1e-26
 Identities = 143/170 (84%)
 Strand = Plus / Plus

                                                                        
Query: 25   cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
            |||||||||||||| |||||||| ||||| ||||||||||| || || |||  ||| |||
Sbjct: 1803 cggttggacttggccacacgctccagctcgtccttcttcttaatggcataggagttcgag 1862

                                                                        
Query: 85   gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
            || |||||||| || |||||||||||||| |||| ||| || || |||||||||| ||| 
Sbjct: 1863 gagcccttggcagcattgatgagctcatctgccaggcactcagcaatggtcttaatgttc 1922

                                                              
Query: 145  ntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggtt 194
              |||||||| ||||||||| || ||||| || |||||||| ||||||||
Sbjct: 1923 cggaaggcagcctcacgagcgcctgtgcacagcagccagatggcctggtt 1972

---

>gb|BC015589.2| Homo sapiens cDNA clone IMAGE:4643450, partial cds
          Length = 1512

 Score =  127 bits (64), Expect = 1e-26
 Identities = 143/170 (84%)
 Strand = Plus / Plus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           |||||||||||||| |||||||| ||||| ||||||||||| || || |||  ||| |||
Sbjct: 100 cggttggacttggccacacgctccagctcgtccttcttcttaatggcataggagttcgag 159

                                                                       
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
           || |||||||| || |||||||||||||| |||| ||| || || |||||||||| ||| 
Sbjct: 160 gagcccttggcagcattgatgagctcatctgccaggcactcagcaatggtcttaatgttc 219

                                                             
Query: 145 ntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggtt 194
             |||||||| ||||||||| || ||||| || |||||||| ||||||||
Sbjct: 220 cggaaggcagcctcacgagcgcctgtgcacagcagccagatggcctggtt 269

---

>gb|BC011718.1| Homo sapiens cDNA clone IMAGE:4099312, **** WARNING: chimeric clone
            ****
          Length = 3787

 Score =  127 bits (64), Expect = 1e-26
 Identities = 143/170 (84%)
 Strand = Plus / Plus

                                                                        
Query: 25   cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
            |||||||||||||| |||||||| ||||| ||||||||||| || || |||  ||| |||
Sbjct: 1680 cggttggacttggccacacgctccagctcgtccttcttcttaatggcataggagttcgag 1739

                                                                        
Query: 85   gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
            || |||||||| || |||||||||||||| |||| ||| || || |||||||||| ||| 
Sbjct: 1740 gagcccttggcagcattgatgagctcatctgccaggcactcagcaatggtcttaatgttc 1799

                                                              
Query: 145  ntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggtt 194
              |||||||| ||||||||| || ||||| || |||||||| ||||||||
Sbjct: 1800 cggaaggcagcctcacgagcgcctgtgcacagcagccagatggcctggtt 1849

---

>ref|NM_001009.3| Homo sapiens ribosomal protein S5 (RPS5), mRNA
          Length = 755

 Score =  127 bits (64), Expect = 1e-26
 Identities = 143/170 (84%)
 Strand = Plus / Minus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           |||||||||||||| |||||||| ||||| ||||||||||| || || |||  ||| |||
Sbjct: 683 cggttggacttggccacacgctccagctcgtccttcttcttaatggcataggagttcgag 624

                                                                       
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
           || |||||||| || |||||||||||||| |||| ||| || || |||||||||| ||| 
Sbjct: 623 gagcccttggcagcattgatgagctcatctgccaggcactcagcaatggtcttaatgttc 564

                                                             
Query: 145 ntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggtt 194
             |||||||| ||||||||| || ||||| || |||||||| ||||||||
Sbjct: 563 cggaaggcagcctcacgagcgcctgtgcacagcagccagatggcctggtt 514

---

>emb|CR625375.1| full-length cDNA clone CS0DI026YC20 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 714

 Score =  127 bits (64), Expect = 1e-26
 Identities = 143/170 (84%)
 Strand = Plus / Minus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           |||||||||||||| |||||||| ||||| ||||||||||| || || |||  ||| |||
Sbjct: 658 cggttggacttggccacacgctccagctcgtccttcttcttaatggcataggagttcgag 599

                                                                       
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
           || |||||||| || |||||||||||||| |||| ||| || || |||||||||| ||| 
Sbjct: 598 gagcccttggcagcattgatgagctcatctgccaggcactcagcaatggtcttaatgttc 539

                                                             
Query: 145 ntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggtt 194
             |||||||| ||||||||| || ||||| || |||||||| ||||||||
Sbjct: 538 cggaaggcagcctcacgagcgcctgtgcacagcagccagatggcctggtt 489

---

>emb|CR619033.1| full-length cDNA clone CS0DK007YN14 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 537

 Score =  127 bits (64), Expect = 1e-26
 Identities = 143/170 (84%)
 Strand = Plus / Minus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           |||||||||||||| |||||||| ||||| ||||||||||| || || |||  ||| |||
Sbjct: 479 cggttggacttggccacacgctccagctcgtccttcttcttaatggcataggagttcgag 420

                                                                       
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
           || |||||||| || |||||||||||||| |||| ||| || || |||||||||| ||| 
Sbjct: 419 gagcccttggcagcattgatgagctcatctgccaggcactcagcaatggtcttaatgttc 360

                                                             
Query: 145 ntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggtt 194
             |||||||| ||||||||| || ||||| || |||||||| ||||||||
Sbjct: 359 cggaaggcagcctcacgagcgcctgtgcacagcagccagatggcctggtt 310

---

>emb|CR614318.1| full-length cDNA clone CS0DI033YI16 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1520

 Score =  127 bits (64), Expect = 1e-26
 Identities = 143/170 (84%)
 Strand = Plus / Minus

                                                                        
Query: 25   cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
            |||||||||||||| |||||||| ||||| ||||||||||| || || |||  ||| |||
Sbjct: 1460 cggttggacttggccacacgctccagctcgtccttcttcttaatggcataggagttcgag 1401

                                                                        
Query: 85   gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
            || |||||||| || |||||||||||||| |||| ||| || || |||||||||| ||| 
Sbjct: 1400 gagcccttggcagcattgatgagctcatctgccaggcactcagcaatggtcttaatgttc 1341

                                                              
Query: 145  ntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggtt 194
              |||||||| ||||||||| || ||||| || |||||||| ||||||||
Sbjct: 1340 cggaaggcagcctcacgagcgcctgtgcacagcagccagatggcctggtt 1291

---

>emb|CR605125.1| full-length cDNA clone CS0DM009YE02 of Fetal liver of Homo sapiens
           (human)
          Length = 720

 Score =  127 bits (64), Expect = 1e-26
 Identities = 143/170 (84%)
 Strand = Plus / Minus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           |||||||||||||| |||||||| ||||| ||||||||||| || || |||  ||| |||
Sbjct: 664 cggttggacttggccacacgctccagctcgtccttcttcttaatggcataggagttcgag 605

                                                                       
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
           || |||||||| || |||||||||||||| |||| ||| || || |||||||||| ||| 
Sbjct: 604 gagcccttggcagcattgatgagctcatctgccaggcactcagcaatggtcttaatgttc 545

                                                             
Query: 145 ntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggtt 194
             |||||||| ||||||||| || ||||| || |||||||| ||||||||
Sbjct: 544 cggaaggcagcctcacgagcgcctgtgcacagcagccagatggcctggtt 495

---

>emb|CR606098.1| full-length cDNA clone CS0DK012YE07 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 716

 Score =  127 bits (64), Expect = 1e-26
 Identities = 143/170 (84%)
 Strand = Plus / Minus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           |||||||||||||| |||||||| ||||| ||||||||||| || || |||  ||| |||
Sbjct: 662 cggttggacttggccacacgctccagctcgtccttcttcttaatggcataggagttcgag 603

                                                                       
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
           || |||||||| || |||||||||||||| |||| ||| || || |||||||||| ||| 
Sbjct: 602 gagcccttggcagcattgatgagctcatctgccaggcactcagcaatggtcttaatgttc 543

                                                             
Query: 145 ntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggtt 194
             |||||||| ||||||||| || ||||| || |||||||| ||||||||
Sbjct: 542 cggaaggcagcctcacgagcgcctgtgcacagcagccagatggcctggtt 493

---

>emb|CR593754.1| full-length cDNA clone CS0DI002YN03 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 354

 Score =  127 bits (64), Expect = 1e-26
 Identities = 143/170 (84%)
 Strand = Plus / Minus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           |||||||||||||| |||||||| ||||| ||||||||||| || || |||  ||| |||
Sbjct: 298 cggttggacttggccacacgctccagctcgtccttcttcttaatggcataggagttcgag 239

                                                                       
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
           || |||||||| || |||||||||||||| |||| ||| || || |||||||||| ||| 
Sbjct: 238 gagcccttggcagcattgatgagctcatctgccaggcactcagcaatggtcttaatgttc 179

                                                             
Query: 145 ntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggtt 194
             |||||||| ||||||||| || ||||| || |||||||| ||||||||
Sbjct: 178 cggaaggcagcctcacgagcgcctgtgcacagcagccagatggcctggtt 129

---

>ref|NM_142150.2| Drosophila melanogaster Ribosomal protein S5b CG7014-RA (RpS5b),
           mRNA
          Length = 899

 Score =  127 bits (64), Expect = 1e-26
 Identities = 140/166 (84%)
 Strand = Plus / Minus

                                                                       
Query: 31  gacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggaggatccc 90
           |||||||| || ||||| | ||| |||||||||||||| ||||||  |||||||||||||
Sbjct: 794 gacttggccacgcgctccaactcgtccttcttcttgatggcgtaggagttggaggatccc 735

                                                                       
Query: 91  ttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgtttntgaag 150
           |||||||||||||| |||||||||||||  || ||||| |  ||||| | |||   ||||
Sbjct: 734 ttggcggcgttgatcagctcatcagccagacactcggccaccgtcttgatgttgcggaag 675

                                                         
Query: 151 gcagnctcacgagctccagtgcagagaagccagatagcctggttga 196
           |||| |||||| |||||||||||||  ||||| || ||||||||||
Sbjct: 674 gcagcctcacgtgctccagtgcagattagccaaattgcctggttga 629

---

>gb|AY071138.1| Drosophila melanogaster RE17836 full length cDNA
          Length = 888

 Score =  127 bits (64), Expect = 1e-26
 Identities = 140/166 (84%)
 Strand = Plus / Minus

                                                                       
Query: 31  gacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggaggatccc 90
           |||||||| || ||||| | ||| |||||||||||||| ||||||  |||||||||||||
Sbjct: 767 gacttggccacgcgctccaactcgtccttcttcttgatggcgtaggagttggaggatccc 708

                                                                       
Query: 91  ttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgtttntgaag 150
           |||||||||||||| |||||||||||||  || ||||| |  ||||| | |||   ||||
Sbjct: 707 ttggcggcgttgatcagctcatcagccagacactcggccaccgtcttgatgttgcggaag 648

                                                         
Query: 151 gcagnctcacgagctccagtgcagagaagccagatagcctggttga 196
           |||| |||||| |||||||||||||  ||||| || ||||||||||
Sbjct: 647 gcagcctcacgtgctccagtgcagattagccaaattgcctggttga 602

---

>gb|AY891473.1| Synthetic construct Homo sapiens clone FLH027247.01L ribosomal
           protein S5 (RPS5) mRNA, partial cds
          Length = 615

 Score =  127 bits (64), Expect = 1e-26
 Identities = 143/170 (84%)
 Strand = Plus / Minus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           |||||||||||||| |||||||| ||||| ||||||||||| || || |||  ||| |||
Sbjct: 611 cggttggacttggccacacgctccagctcgtccttcttcttaatggcataggagttcgag 552

                                                                       
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
           || |||||||| || |||||||||||||| |||| ||| || || |||||||||| ||| 
Sbjct: 551 gagcccttggcagcattgatgagctcatctgccaggcactcagcaatggtcttaatgttc 492

                                                             
Query: 145 ntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggtt 194
             |||||||| ||||||||| || ||||| || |||||||| ||||||||
Sbjct: 491 cggaaggcagcctcacgagcgcctgtgcacagcagccagatggcctggtt 442

---

>gb|AY888836.1| Synthetic construct Homo sapiens clone FLH027250.01X ribosomal
           protein S5 (RPS5) mRNA, complete cds
          Length = 615

 Score =  127 bits (64), Expect = 1e-26
 Identities = 143/170 (84%)
 Strand = Plus / Minus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           |||||||||||||| |||||||| ||||| ||||||||||| || || |||  ||| |||
Sbjct: 611 cggttggacttggccacacgctccagctcgtccttcttcttaatggcataggagttcgag 552

                                                                       
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
           || |||||||| || |||||||||||||| |||| ||| || || |||||||||| ||| 
Sbjct: 551 gagcccttggcagcattgatgagctcatctgccaggcactcagcaatggtcttaatgttc 492

                                                             
Query: 145 ntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggtt 194
             |||||||| ||||||||| || ||||| || |||||||| ||||||||
Sbjct: 491 cggaaggcagcctcacgagcgcctgtgcacagcagccagatggcctggtt 442

---

>gb|BC018151.1| Homo sapiens ribosomal protein S5, mRNA (cDNA clone MGC:9774
           IMAGE:3856663), complete cds
          Length = 797

 Score =  127 bits (64), Expect = 1e-26
 Identities = 143/170 (84%)
 Strand = Plus / Minus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           |||||||||||||| |||||||| ||||| ||||||||||| || || |||  ||| |||
Sbjct: 658 cggttggacttggccacacgctccagctcgtccttcttcttaatggcataggagttcgag 599

                                                                       
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
           || |||||||| || |||||||||||||| |||| ||| || || |||||||||| ||| 
Sbjct: 598 gagcccttggcagcattgatgagctcatctgccaggcactcagcaatggtcttaatgttc 539

                                                             
Query: 145 ntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggtt 194
             |||||||| ||||||||| || ||||| || |||||||| ||||||||
Sbjct: 538 cggaaggcagcctcacgagcgcctgtgcacagcagccagatggcctggtt 489

---

>gb|BC035830.1| Homo sapiens ribosomal protein S5, mRNA (cDNA clone IMAGE:5581961)
          Length = 740

 Score =  127 bits (64), Expect = 1e-26
 Identities = 143/170 (84%)
 Strand = Plus / Minus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           |||||||||||||| |||||||| ||||| ||||||||||| || || |||  ||| |||
Sbjct: 671 cggttggacttggccacacgctccagctcgtccttcttcttaatggcataggagttcgag 612

                                                                       
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
           || |||||||| || |||||||||||||| |||| ||| || || |||||||||| ||| 
Sbjct: 611 gagcccttggcagcattgatgagctcatctgccaggcactcagcaatggtcttaatgttc 552

                                                             
Query: 145 ntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggtt 194
             |||||||| ||||||||| || ||||| || |||||||| ||||||||
Sbjct: 551 cggaaggcagcctcacgagcgcctgtgcacagcagccagatggcctggtt 502

---

>gb|BC018828.2| Homo sapiens ribosomal protein S5, mRNA (cDNA clone IMAGE:3343539)
          Length = 764

 Score =  127 bits (64), Expect = 1e-26
 Identities = 143/170 (84%)
 Strand = Plus / Minus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           |||||||||||||| |||||||| ||||| ||||||||||| || || |||  ||| |||
Sbjct: 669 cggttggacttggccacacgctccagctcgtccttcttcttaatggcataggagttcgag 610

                                                                       
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
           || |||||||| || |||||||||||||| |||| ||| || || |||||||||| ||| 
Sbjct: 609 gagcccttggcagcattgatgagctcatctgccaggcactcagcaatggtcttaatgttc 550

                                                             
Query: 145 ntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggtt 194
             |||||||| ||||||||| || ||||| || |||||||| ||||||||
Sbjct: 549 cggaaggcagcctcacgagcgcctgtgcacagcagccagatggcctggtt 500

---

>gb|U14970.1|HSU14970 Human ribosomal protein S5 mRNA, complete cds
          Length = 705

 Score =  127 bits (64), Expect = 1e-26
 Identities = 143/170 (84%)
 Strand = Plus / Minus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           |||||||||||||| |||||||| ||||| ||||||||||| || || |||  ||| |||
Sbjct: 648 cggttggacttggccacacgctccagctcgtccttcttcttaatggcataggagttcgag 589

                                                                       
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
           || |||||||| || |||||||||||||| |||| ||| || || |||||||||| ||| 
Sbjct: 588 gagcccttggcagcattgatgagctcatctgccaggcactcagcaatggtcttaatgttc 529

                                                             
Query: 145 ntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggtt 194
             |||||||| ||||||||| || ||||| || |||||||| ||||||||
Sbjct: 528 cggaaggcagcctcacgagcgcctgtgcacagcagccagatggcctggtt 479

---

>ref|XM_958137.1| Neurospora crassa OR74A 40S RIBOSOMAL PROTEIN S5 (NCU09475.1)
           partial mRNA
          Length = 582

 Score =  125 bits (63), Expect = 6e-26
 Identities = 105/119 (88%)
 Strand = Plus / Minus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           |||||||||||||| ||||||||||||||||||||||||||||| |||||   |||||||
Sbjct: 578 cggttggacttggcaacacgctcgagctcatccttcttcttgatggcgtacgagttggag 519

                                                                      
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgtt 143
           || ||||||||||||||||| ||||| ||||| | ||| ||||| |||| ||| |||||
Sbjct: 518 gagcccttggcggcgttgatcagctcctcagcaaggcactcggcaatggacttgacgtt 460

---

>ref|XM_329833.1| Neurospora crassa OR74A 40S RIBOSOMAL PROTEIN S5 (NCU09475.1)
           partial mRNA
          Length = 582

 Score =  125 bits (63), Expect = 6e-26
 Identities = 105/119 (88%)
 Strand = Plus / Minus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           |||||||||||||| ||||||||||||||||||||||||||||| |||||   |||||||
Sbjct: 578 cggttggacttggcaacacgctcgagctcatccttcttcttgatggcgtacgagttggag 519

                                                                      
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgtt 143
           || ||||||||||||||||| ||||| ||||| | ||| ||||| |||| ||| |||||
Sbjct: 518 gagcccttggcggcgttgatcagctcctcagcaaggcactcggcaatggacttgacgtt 460

---

>emb|BX060985.1|CNS09J7X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 861

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 693 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 634

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 633 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 574

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 573 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 521

---

>emb|BX069149.1|CNS09PIP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1036

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 738 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 679

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 678 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 619

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 618 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 566

---

>emb|BX068414.1|CNS09OYA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52CE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1006

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 755 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 696

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 695 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 636

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 635 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 583

---

>emb|BX067806.1|CNS09OHE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51CF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1003

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 366 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 425

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 426 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 485

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 486 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 538

---

>emb|BX067805.1|CNS09OHD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1032

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 738 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 679

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 678 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 619

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 618 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 566

---

>emb|BX066614.1|CNS09NKA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 380 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 439

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 440 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 499

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 500 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 552

---

>emb|BX066613.1|CNS09NK9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 915

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 742 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 683

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 682 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 623

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 622 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 570

---

>emb|BX066319.1|CNS09NC3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 739 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 680

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 679 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 620

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 619 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 567

---

>emb|BX065223.1|CNS09MHN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 879

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 720 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 661

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 660 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 601

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 600 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 548

---

>emb|BX060576.1|CNS09IWK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41AA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1001

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 728 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 669

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 668 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 609

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 608 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 556

---

>emb|BX060097.1|CNS09IJ9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 737 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 678

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 677 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 618

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 617 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 565

---

>emb|BX059487.1|CNS09I2B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 848

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 751 gcttatcggttagacttggcaacacgctccagctcatccttcttcttgatggcgtacgag 692

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 691 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 632

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 631 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 579

---

>emb|BX051928.1|CNS09C8C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 907

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 737 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 678

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 677 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 618

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 617 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 565

---

>emb|BX050054.1|CNS09ASA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26BB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 794

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 605 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 546

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 545 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 486

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 485 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 433

---

>emb|BX047653.1|CNS098XL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC22BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 751

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 740 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 681

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 680 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 621

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 620 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 568

---

>emb|BX046292.1|CNS097VS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2DE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 738 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 679

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 678 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 619

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 618 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 566

---

>emb|BX043117.1|CNS095FL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC15CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 636

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 364 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 423

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 424 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 483

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 484 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 536

---

>emb|BX042340.1|CNS094U0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC14BD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 558

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 368 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 427

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 428 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 487

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 488 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 540

---

>emb|BX041676.1|CNS094BK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC13BA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 832

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 378 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 437

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 438 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 497

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 498 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 550

---

>emb|BX041675.1|CNS094BJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13BA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 827

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 729 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 670

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 669 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 610

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 609 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 557

---

>emb|BX041951.1|CNS094J7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC13CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 778

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 390 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 449

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 450 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 509

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 510 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 562

---

>emb|BX041207.1|CNS093YJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC12BG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 692

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 356 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 415

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 416 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 475

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 476 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 528

---

>emb|BX040008.1|CNS09318 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC10CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 877

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 373 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 432

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 433 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 492

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 493 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 545

---

>emb|BX040007.1|CNS09317 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 744 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 685

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 684 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 625

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 624 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 572

---

>emb|BX037483.1|CNS09133 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9DH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 945

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 728 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 669

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 668 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 609

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 608 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 556

---

>emb|BX037168.1|CNS090UC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9CA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 993

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 369 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 428

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 429 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 488

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 489 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 541

---

>emb|BX037167.1|CNS090UB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9CA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 978

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 777 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 718

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 717 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 658

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 657 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 605

---

>emb|BX036321.1|CNS0906T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA8AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 377 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 436

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 437 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 496

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 497 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 549

---

>emb|BX036320.1|CNS0906S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 783 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 724

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 723 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 664

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 663 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 611

---

>emb|BX035877.1|CNS08ZUH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7BF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 394 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 453

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 454 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 513

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 514 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 566

---

>emb|BX035876.1|CNS08ZUG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7BF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 952

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 749 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 690

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 689 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 630

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 629 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 577

---

>emb|BX035843.1|CNS08ZTJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7BE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 763

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 378 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 437

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 438 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 497

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 498 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 550

---

>emb|BX034367.1|CNS08YOJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA50BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1022

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 352 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 411

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 412 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 471

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 472 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 524

---

>emb|BX034366.1|CNS08YOI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1068

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 749 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 690

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 689 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 630

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 629 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 577

---

>emb|BX032460.1|CNS08X7K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48BD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 843

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 820 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 761

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 760 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 701

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 700 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 648

---

>emb|BX031739.1|CNS08WNJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 737 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 678

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 677 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 618

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 617 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 565

---

>emb|BX031421.1|CNS08WEP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA46DD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 795

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 385 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 444

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 445 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 504

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 505 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 557

---

>emb|BX031420.1|CNS08WEO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46DD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 745 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 686

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 685 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 626

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 625 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 573

---

>emb|BX031299.1|CNS08WBB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46CG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 877

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 705 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 646

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 645 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 586

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 585 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 533

---

>emb|BX030434.1|CNS08VNA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA45BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 737 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 678

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 677 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 618

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 617 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 565

---

>emb|BX030022.1|CNS08VBU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1013

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 753 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 694

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 693 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 634

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 633 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 581

---

>emb|BX030005.1|CNS08VBD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44DC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1021

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 748 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 689

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 688 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 629

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 628 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 576

---

>emb|BX028667.1|CNS08UA7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42DC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 894

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 748 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 689

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 688 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 629

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 628 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 576

---

>emb|BX028362.1|CNS08U1Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42BE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 740 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 681

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 680 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 621

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 620 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 568

---

>emb|BX027498.1|CNS08TDQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41AF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 758 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 699

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 698 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 639

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 638 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 586

---

>emb|BX027481.1|CNS08TD9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 589

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 368 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 427

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 428 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 487

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 488 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 540

---

>emb|BX027414.1|CNS08TBE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41AC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 860

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 379 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 438

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 439 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 498

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 499 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 551

---

>emb|BX027413.1|CNS08TBD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41AC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 908

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 741 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 682

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 681 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 622

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 621 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 569

---

>emb|BX025592.1|CNS08RWS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA39AH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 748 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 689

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 688 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 629

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 628 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 576

---

>emb|BX024680.1|CNS08R7G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37DA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 809

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 740 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 681

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 680 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 621

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 620 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 568

---

>emb|BX024182.1|CNS08QTM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA36DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 924

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 732 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 673

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 672 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 613

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 612 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 560

---

>emb|BX022047.1|CNS08P6B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 779 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 720

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 719 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 660

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 659 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 607

---

>emb|BX021562.1|CNS08OSU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 899

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 735 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 676

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 675 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 616

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 615 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 563

---

>emb|BX016310.1|CNS08KQY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24BH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 888

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 702 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 643

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 642 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 583

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 582 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 530

---

>emb|BX015921.1|CNS08KG5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA23DF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 915

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 746 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 687

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 686 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 627

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 626 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 574

---

>emb|BX015406.1|CNS08K1U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA23AF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 736 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 677

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 676 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 617

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 616 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 564

---

>emb|BX014758.1|CNS08JJU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 970

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 733 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 674

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 673 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 614

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 613 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 561

---

>emb|BX012966.1|CNS08I62 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA2CB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 746 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 687

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 686 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 627

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 626 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 574

---

>emb|BX012868.1|CNS08I3C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA2BE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 366 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 425

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 426 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 485

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 486 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 538

---

>emb|BX012118.1|CNS08HII Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19BC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 935

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 725 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 666

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 665 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 606

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 605 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 553

---

>emb|BX010779.1|CNS08GHB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA17BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 780 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 721

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 720 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 661

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 660 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 608

---

>emb|BX010285.1|CNS08G3L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 952

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 375 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 434

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 435 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 494

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 495 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 547

---

>emb|BX010284.1|CNS08G3K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 874

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 691 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 632

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 631 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 572

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 571 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 519

---

>emb|BX009579.1|CNS08FJZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 839

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 711 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 652

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 651 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 592

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 591 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 539

---

>emb|BX008809.1|CNS08EYL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA14BF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 851

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 694 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 635

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 634 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 575

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 574 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 522

---

>emb|BX006288.1|CNS08D0K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA10CG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 778

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 378 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 437

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 438 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 497

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 498 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 550

---

>emb|BX006287.1|CNS08D0J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10CG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 813

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 730 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 671

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 670 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 611

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 610 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 558

---

>emb|BX006100.1|CNS08CVC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10BF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 735

 Score =  125 bits (63), Expect = 6e-26
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 720 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 661

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 660 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 601

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 600 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 548

---

>emb|BX842597.1| Neurospora crassa DNA linkage group II BAC clone B22K18
          Length = 75214

 Score =  125 bits (63), Expect = 6e-26
 Identities = 105/119 (88%)
 Strand = Plus / Minus

                                                                         
Query: 25    cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
             |||||||||||||| ||||||||||||||||||||||||||||| |||||   |||||||
Sbjct: 73207 cggttggacttggcaacacgctcgagctcatccttcttcttgatggcgtacgagttggag 73148

                                                                        
Query: 85    gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgtt 143
             || ||||||||||||||||| ||||| ||||| | ||| ||||| |||| ||| |||||
Sbjct: 73147 gagcccttggcggcgttgatcagctcctcagcaaggcactcggcaatggacttgacgtt 73089

---

>emb|BX842596.1| Neurospora crassa DNA linkage group II BAC clone B10K17
          Length = 77292

 Score =  125 bits (63), Expect = 6e-26
 Identities = 105/119 (88%)
 Strand = Plus / Plus

                                                                         
Query: 25    cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
             |||||||||||||| ||||||||||||||||||||||||||||| |||||   |||||||
Sbjct: 44638 cggttggacttggcaacacgctcgagctcatccttcttcttgatggcgtacgagttggag 44697

                                                                        
Query: 85    gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgtt 143
             || ||||||||||||||||| ||||| ||||| | ||| ||||| |||| ||| |||||
Sbjct: 44698 gagcccttggcggcgttgatcagctcctcagcaaggcactcggcaatggacttgacgtt 44756

---

>emb|CT032678.1| Platynereis dumerilii EST IB0AAA33CA06EM1
          Length = 720

 Score =  123 bits (62), Expect = 2e-25
 Identities = 144/172 (83%)
 Strand = Plus / Minus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           ||||||||||||||||||||||| | ||| ||||| ||||||||||||||    ||||| 
Sbjct: 642 cggttggacttggcgacacgctccaactcgtcctttttcttgatagcgtatgaattggat 583

                                                                       
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
           |||||||||||||||||||| ||||| || ||||  || |||||||| ||||| | ||||
Sbjct: 582 gatcccttggcggcgttgatcagctcgtcggccagacactcggcgatcgtcttgatgttt 523

                                                               
Query: 145 ntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggttga 196
            ||||||||| ||| || ||||| ||||| || | |||||| || |||||||
Sbjct: 522 ctgaaggcagactctcgggctcctgtgcacagtaaccagatggcttggttga 471

---

>emb|CT032568.1| Platynereis dumerilii EST IB0AAA36BC12EM1
          Length = 704

 Score =  123 bits (62), Expect = 2e-25
 Identities = 144/172 (83%)
 Strand = Plus / Minus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           ||||||||||||||||||||||| | ||| ||||| ||||||||||||||    ||||| 
Sbjct: 628 cggttggacttggcgacacgctccaactcgtcctttttcttgatagcgtatgaattggat 569

                                                                       
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
           |||||||||||||||||||| ||||| || ||||  || |||||||| ||||| | ||||
Sbjct: 568 gatcccttggcggcgttgatcagctcgtcggccagacactcggcgatcgtcttgatgttt 509

                                                               
Query: 145 ntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggttga 196
            ||||||||| ||| || ||||| ||||| || | |||||| || |||||||
Sbjct: 508 ctgaaggcagactctcgggctcctgtgcacagtaaccagatggcttggttga 457

---

>emb|CT032567.1| Platynereis dumerilii EST IB0AAA36BC12FM1
          Length = 704

 Score =  123 bits (62), Expect = 2e-25
 Identities = 144/172 (83%)
 Strand = Plus / Plus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           ||||||||||||||||||||||| | ||| ||||| ||||||||||||||    ||||| 
Sbjct: 77  cggttggacttggcgacacgctccaactcgtcctttttcttgatagcgtatgaattggat 136

                                                                       
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
           |||||||||||||||||||| ||||| || ||||  || |||||||| ||||| | ||||
Sbjct: 137 gatcccttggcggcgttgatcagctcgtcggccagacactcggcgatcgtcttgatgttt 196

                                                               
Query: 145 ntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggttga 196
            ||||||||| ||| || ||||| ||||| || | |||||| || |||||||
Sbjct: 197 ctgaaggcagactctcgggctcctgtgcacagtaaccagatggcttggttga 248

---

>emb|AJ439528.1|PSP439528 Polytomella sp. 'Pringsheim 198.80' mRNA for 40S ribosomal protein
           s5 (rs5 gene)
          Length = 885

 Score =  121 bits (61), Expect = 9e-25
 Identities = 119/139 (85%)
 Strand = Plus / Minus

                                                                       
Query: 33  cttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggaggatccctt 92
           |||||| || ||||||| ||||||||||||||| || || |||||||||||||| |||||
Sbjct: 582 cttggcaacgcgctcgatctcatccttcttcttaatggcatagctgttggaggaaccctt 523

                                                                       
Query: 93  ggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgtttntgaaggc 152
           |||||| || |||||||||||||||||||| || || |||||||| | |||   ||| ||
Sbjct: 522 ggcggcattcatgagctcatcagccaagcactcagcaatggtcttgatgttacggaaagc 463

                              
Query: 153 agnctcacgagctccagtg 171
           || ||||||||| ||||||
Sbjct: 462 agcctcacgagcaccagtg 444

---

>gb|DQ066208.1| Ixodes scapularis isolate ISUFL41 40S ribosomal protein S5 mRNA,
           complete cds
          Length = 630

 Score =  121 bits (61), Expect = 9e-25
 Identities = 100/113 (88%)
 Strand = Plus / Minus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           ||||||||||||||||||||||| ||||| |||||||||||||| || ||||||||||| 
Sbjct: 626 cggttggacttggcgacacgctccagctcgtccttcttcttgatggcatagctgttggaa 567

                                                                
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctt 137
           || ||||||||||| ||||||||||| || |||| ||| || || ||||||||
Sbjct: 566 gagcccttggcggcattgatgagctcgtccgccaggcactcagcaatggtctt 514

---

>emb|BX006874.1|CNS08DGU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA11CC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 760

 Score =  119 bits (60), Expect = 3e-24
 Identities = 146/174 (83%), Gaps = 1/174 (0%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 384 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 443

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcga-tggtctt 137
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||||
Sbjct: 444 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccggtctt 503

                                                                 
Query: 138 aacgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
            | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 504 gatgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 557

---

>dbj|AK223106.1| Homo sapiens mRNA for ribosomal protein S5 variant, clone: KAT05451
          Length = 820

 Score =  119 bits (60), Expect = 3e-24
 Identities = 142/170 (83%)
 Strand = Plus / Minus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           |||||||||||||| |||||||| ||||| ||| ||||||| || || |||  ||| |||
Sbjct: 683 cggttggacttggccacacgctccagctcgtccctcttcttaatggcatagaagttcgag 624

                                                                       
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
           || |||||||| || |||||||||||||| |||| ||| || || |||||||||| ||| 
Sbjct: 623 gagcccttggcagcattgatgagctcatctgccaggcactcagcaatggtcttaatgttc 564

                                                             
Query: 145 ntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggtt 194
             |||||||| ||||||||| || ||||| || |||||||| ||||||||
Sbjct: 563 cggaaggcagcctcacgagcgcctgtgcacagcagccagatggcctggtt 514

---

>emb|BX060986.1|CNS09J7Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41CD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 357 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 416

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 417 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 476

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||| ||||||
Sbjct: 477 atgttacggaatgcagcctcacgagccccggtgcacagcagccagaaagcctg 529

---

>emb|BX069150.1|CNS09PIQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53CG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 736

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 380 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 439

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 440 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 499

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||| ||||||
Sbjct: 500 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagaaagcctg 552

---

>emb|BX067167.1|CNS09NZN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 757 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 698

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 697 ttcgacgaacccttcgcggcgttgatcagctcatcggccagacattcggcaaccgtcttg 638

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 637 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 585

---

>emb|BX064990.1|CNS09MB6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 812

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 570 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 511

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 510 ttcgacgaacccttcgcggcgttgatcagctcatcggccagacattcggcaaccgtcttg 451

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 450 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 398

---

>emb|BX064166.1|CNS09LOA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1044

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 739 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 680

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 679 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 620

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| |  ||||||||||||||
Sbjct: 619 atgttacggaatgcagcctcacgagcaccggtgcacaacagccagatagcctg 567

---

>emb|BX062350.1|CNS09K9U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43CD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1011

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 735 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 676

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 675 ttcgacgaacccttcgcggcgttgatcagctcatcggccagacattcggcaaccgtcttg 616

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 615 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 563

---

>emb|BX061779.1|CNS09JTZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 734 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 675

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 674 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 615

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| |  ||||||||||||||
Sbjct: 614 atgttacggaatgcagcctcacgagcaccggtgcacaacagccagatagcctg 562

---

>emb|BX060577.1|CNS09IWL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41AA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 973

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 378 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 437

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| |||| |||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 438 ttcgacgaacccttcgcggggttgatcagctcatcggccaaacattcggcaaccgtcttg 497

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 498 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 550

---

>emb|BX059488.1|CNS09I2C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 656

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 382 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 441

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 442 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 501

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||| ||||||
Sbjct: 502 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagaaagcctg 554

---

>emb|BX054593.1|CNS09EAD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 848

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 526 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 467

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 466 ttcgacgaacccttcgcggcgttgatcagctcatcggccagacattcggcaaccgtcttg 407

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 406 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 354

---

>emb|BX054182.1|CNS09DYY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32BA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 503

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 402 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 343

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 342 ttcgacgaacccttcgcggcgttgatcagctcatcggccagacattcggcaaccgtcttg 283

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 282 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 230

---

>emb|BX054146.1|CNS09DXY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32AG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 703 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 644

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 643 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 584

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| |  ||||||||||||||
Sbjct: 583 atgttacggaatgcagcctcacgagcaccggtgcacaacagccagatagcctg 531

---

>emb|BX050132.1|CNS09AUG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26BF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 914

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 727 gcttatcggttagacttggcaacacgctccagctcatccttcttcttgatggcgtacgag 668

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 667 ttcgacgaacccttcgcggcgttgatcagctcatcggccagacattcggcaaccgtcttg 608

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 607 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 555

---

>emb|BX049760.1|CNS09AK4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25DD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 786

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 729 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 670

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 669 ttcgacgaacccttcgcggcgttgatcagctcatcggccagacattcggcaaccgtcttg 610

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 609 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 557

---

>emb|BX030899.1|CNS08W07 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46AE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 741 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 682

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 681 ttcgacgaacccttcgcggcgttgatcagctcatcggccagacattcggcaaccgtcttg 622

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 621 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 569

---

>emb|BX047889.1|CNS09945 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC22CG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 917

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 370 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 429

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           |  || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 430 tgcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 489

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 490 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 542

---

>emb|BX047406.1|CNS098QQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21CE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 915

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 702 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 643

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 642 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 583

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| |  ||||||||||||||
Sbjct: 582 atgttacggaatgcagcctcacgagcaccggtgcacaacagccagatagcctg 530

---

>emb|BX047180.1|CNS098KG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 703

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 569 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 510

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 509 ttcgacgaacccttcgcggcgttgatcagctcatcggccagacattcggcaaccgtcttg 450

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 449 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 397

---

>emb|BX045879.1|CNS097KB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2AH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 663 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 604

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 603 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 544

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| |  ||||||||||||||
Sbjct: 543 atgttacggaatgcagcctcacgagcaccggtgcacaacagccagatagcctg 491

---

>emb|BX042956.1|CNS095B4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 761 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 702

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 701 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 642

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| ||||  |||||||| || ||||| || ||||||||||||||
Sbjct: 641 atgttacggaatgcagcttcacgagcaccggtgcacagcagccagatagcctg 589

---

>emb|BX043656.1|CNS095UK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC16BF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 742 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 683

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 682 ttcgacgaacccttcgcggcgttgatcagctcatcggccagacattcggcaaccgtcttg 623

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 622 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 570

---

>emb|BX043116.1|CNS095FK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||| ||||||||||||| |||||   |
Sbjct: 698 gcttatcggttagacttggccacacgctccagctcacccttcttcttgatggcgtacgag 639

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 638 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 579

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 578 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 526

---

>emb|BX039701.1|CNS092SP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10AE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 742 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 683

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 682 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 623

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| |  ||||||||||||||
Sbjct: 622 atgttacggaatgcagcctcacgagcaccggtgcacaacagccagatagcctg 570

---

>emb|BX037484.1|CNS09134 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9DH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 356 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 415

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 416 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 475

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||| ||||||
Sbjct: 476 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagaaagcctg 528

---

>emb|BX034032.1|CNS08YF8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA5DB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 862

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 269 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 328

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 329 ttcgacgaacccttcgcggcgttgatcagctcatcggccagacattcggcaaccgtcttg 388

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 389 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 441

---

>emb|BX034031.1|CNS08YF7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA5DB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 816

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 594 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 535

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 534 ttcgacgaacccttcgcggcgttgatcagctcatcggccagacattcggcaaccgtcttg 475

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 474 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 422

---

>emb|BX033399.1|CNS08XXN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 736 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 677

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 676 ttcgacgaacccttcgcggcgttgatcagctcatcggccagacattcggcaaccgtcttg 617

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 616 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 564

---

>emb|BX032461.1|CNS08X7L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA48BD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 757

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 386 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 445

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 446 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 505

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||| ||||||
Sbjct: 506 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagaaagcctg 558

---

>emb|BX032232.1|CNS08X18 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA48AB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 384

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 73  gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 132

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 133 ttcgacgaacccttcgcggcgttgatcagctcatcggccagacattcggcaaccgtcttg 192

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 193 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 245

---

>emb|BX031884.1|CNS08WRK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47CA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 737 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 678

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 677 ttcgacgaacccttcgcggcgttgatcagctcatcggccagacattcggcaaccgtcttg 618

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 617 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 565

---

>emb|BX031803.1|CNS08WPB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47BE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 737

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 374 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 433

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 434 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 493

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||| ||||||
Sbjct: 494 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagaaagcctg 546

---

>emb|BX031740.1|CNS08WNK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 835

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 381 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 440

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 441 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 500

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||| ||||||
Sbjct: 501 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagaaagcctg 553

---

>emb|BX031300.1|CNS08WBC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA46CG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 713

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 392 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 451

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 452 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 511

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||| ||||||
Sbjct: 512 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagaaagcctg 564

---

>emb|BX031110.1|CNS08W62 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 740 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 681

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 680 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 621

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| |  ||||||||||||||
Sbjct: 620 atgttacggaatgcagcctcacgagcaccggtgcacaacagccagatagcctg 568

---

>emb|BX030006.1|CNS08VBE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44DC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 379 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 438

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 439 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 498

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||| ||||||
Sbjct: 499 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagaaagcctg 551

---

>emb|BX029671.1|CNS08V23 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 739 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 680

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 679 ttcgacgaacccttcgcggcgttgatcagctcatcggccagacattcggcaaccgtcttg 620

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 619 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 567

---

>emb|BX028773.1|CNS08UD5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42DH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1044

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 752 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 693

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 692 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 633

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| |  ||||||||||||||
Sbjct: 632 atgttacggaatgcagcctcacgagcaccggtgcacaacagccagatagcctg 580

---

>emb|BX028668.1|CNS08UA8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA42DC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 614

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 385 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 444

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 445 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 504

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||| ||||||
Sbjct: 505 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagaaagcctg 557

---

>emb|BX028421.1|CNS08U3D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42BH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 728

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 569 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 510

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 509 ttcgacgaacccttcgcggcgttgatcagctcatcggccagacattcggcaaccgtcttg 450

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 449 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 397

---

>emb|BX028363.1|CNS08U1R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA42BE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 374 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 433

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 434 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 493

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||| ||||||
Sbjct: 494 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagaaagcctg 546

---

>emb|BX026183.1|CNS08SD7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4BE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 897

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 740 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 681

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 680 ttcgacgaacccttcgcggcgttgatcagctcatcggccagacattcggcaaccgtcttg 621

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 620 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 568

---

>emb|BX025369.1|CNS08RQL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA38DF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 511

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 434 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 375

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 374 ttcgacgaacccttcgcggcgttgatcagctcatcggccagacattcggcaaccgtcttg 315

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 314 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 262

---

>emb|BX022855.1|CNS08PSR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA34DG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 771

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 383 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 442

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 443 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 502

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| |  ||||||||||||||
Sbjct: 503 atgttacggaatgcagcctcacgagcaccggtgcacaacagccagatagcctg 555

---

>emb|BX024183.1|CNS08QTN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA36DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 849

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 365 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 424

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 425 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 484

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||| ||||||
Sbjct: 485 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagaaagcctg 537

---

>emb|BX023607.1|CNS08QDN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA36AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 379 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 438

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 439 ttcgacgaacccttcgcggcgttgatcagctcatcggccagacattcggcaaccgtcttg 498

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 499 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 551

---

>emb|BX023606.1|CNS08QDM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA36AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 973

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 761 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 702

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 701 ttcgacgaacccttcgcggcgttgatcagctcatcggccagacattcggcaaccgtcttg 642

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 641 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 589

---

>emb|BX023496.1|CNS08QAK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA35DF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 747 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 688

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 687 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 628

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| |  ||||||||||||||
Sbjct: 627 atgttacggaatgcagcctcacgagcaccggtgcacaacagccagatagcctg 575

---

>emb|BX023083.1|CNS08PZ3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA35BB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 729 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 670

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 669 ttcgacgaacccttcgcggcgttgatcagctcatcggccagacattcggcaaccgtcttg 610

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 609 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 557

---

>emb|BX022243.1|CNS08PBR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA34AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 393 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 452

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 453 ttcgacgaacccttcgcggcgttgatcagctcatcggccagacattcggcaaccgtcttg 512

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| |||||||||||| ||||| || ||||||| ||||||
Sbjct: 513 atgttacggaatgcagcctcacgagctccggtgcacagcagccagaaagcctg 565

---

>emb|BX022242.1|CNS08PBQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 695 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 636

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 635 ttcgacgaacccttcgcggcgttgatcagctcatcggccagacattcggcaaccgtcttg 576

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 575 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 523

---

>emb|BX018907.1|CNS08MR3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28CH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 693 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 634

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 633 ttcgacgaacccttcgcggcgttgatcagctcatcggccagacattcggcaaccgtcttg 574

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 573 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 521

---

>emb|BX015407.1|CNS08K1V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA23AF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 367 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 426

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 427 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 486

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||| ||||||
Sbjct: 487 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagaaagcctg 539

---

>emb|BX013915.1|CNS08IWF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA20DF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 377 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 436

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 437 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 496

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| |||||| || || ||||| || ||||||||||||||
Sbjct: 497 atgttacggaatgcagcctcacgggcaccggtgcacagcagccagatagcctg 549

---

>emb|BX013914.1|CNS08IWE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA20DF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 928

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 709 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 650

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 649 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 590

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| |||||| || || ||||| || ||||||||||||||
Sbjct: 589 atgttacggaatgcagcctcacgggcaccggtgcacagcagccagatagcctg 537

---

>emb|BX008810.1|CNS08EYM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA14BF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 602

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 372 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 431

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 432 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 491

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||| ||||||
Sbjct: 492 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagaaagcctg 544

---

>emb|BX008262.1|CNS08EJE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 756 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 697

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 696 ttcgacgaacccttcgcggcgttgatcagctcatcggccagacattcggcaaccgtcttg 637

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 636 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 584

---

>emb|BX007419.1|CNS08DVZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA12BE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 683

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 131 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 190

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 191 ttcgacgaacccttcgcggcgttgatcagctcatcggccagacattcggcaaccgtcttg 250

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 251 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 303

---

>emb|BX007418.1|CNS08DVY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12BE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 668

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 467 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 408

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 407 ttcgacgaacccttcgcggcgttgatcagctcatcggccagacattcggcaaccgtcttg 348

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 347 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 295

---

>emb|BX006492.1|CNS08D68 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10DH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 744 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 685

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 684 ttcgacgaacccttcgcggcgttgatcagctcatcggccagacattcggcaaccgtcttg 625

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 624 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 572

---

>gb|AC008136.4|AC008136 Drosophila melanogaster, chromosome 3R, region 88D-88E, BAC clone
             BACR08H11, complete sequence
          Length = 154890

 Score =  117 bits (59), Expect = 1e-23
 Identities = 123/145 (84%)
 Strand = Plus / Plus

                                                                         
Query: 31    gacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggaggatccc 90
             |||||||| || ||||| | ||| |||||||||||||| ||||||  |||||||||||||
Sbjct: 88998 gacttggccacgcgctccaactcgtccttcttcttgatggcgtaggagttggaggatccc 89057

                                                                         
Query: 91    ttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgtttntgaag 150
             |||||||||||||| |||||||||||||  || ||||| |  ||||| | |||   ||||
Sbjct: 89058 ttggcggcgttgatcagctcatcagccagacactcggccaccgtcttgatgttgcggaag 89117

                                      
Query: 151   gcagnctcacgagctccagtgcaga 175
             |||| |||||| |||||||||||||
Sbjct: 89118 gcagcctcacgtgctccagtgcaga 89142

---

>gb|AC005721.3|AC005721 Drosophila melanogaster, chromosome 3R, region 88D8-88E1, BAC clone
             BACR48E23, complete sequence
          Length = 203183

 Score =  117 bits (59), Expect = 1e-23
 Identities = 123/145 (84%)
 Strand = Plus / Plus

                                                                         
Query: 31    gacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggaggatccc 90
             |||||||| || ||||| | ||| |||||||||||||| ||||||  |||||||||||||
Sbjct: 66617 gacttggccacgcgctccaactcgtccttcttcttgatggcgtaggagttggaggatccc 66676

                                                                         
Query: 91    ttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgtttntgaag 150
             |||||||||||||| |||||||||||||  || ||||| |  ||||| | |||   ||||
Sbjct: 66677 ttggcggcgttgatcagctcatcagccagacactcggccaccgtcttgatgttgcggaag 66736

                                      
Query: 151   gcagnctcacgagctccagtgcaga 175
             |||| |||||| |||||||||||||
Sbjct: 66737 gcagcctcacgtgctccagtgcaga 66761

---

>ref|XM_555129.2| Anopheles gambiae str. PEST ENSANGP00000028274
           (ENSANGG00000020660), mRNA
          Length = 1061

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 749 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 690

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 689 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 630

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| |  ||||||||||||||
Sbjct: 629 atgttacggaatgcagcctcacgagcaccggtgcacaacagccagatagcctg 577

---

>ref|XM_317132.2| Anopheles gambiae str. PEST ENSANGP00000025326
           (ENSANGG00000020660), mRNA
          Length = 1170

 Score =  117 bits (59), Expect = 1e-23
 Identities = 144/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 784 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 725

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 724 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 665

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| |  ||||||||||||||
Sbjct: 664 atgttacggaatgcagcctcacgagcaccggtgcacaacagccagatagcctg 612

---

>gb|AE003706.5| Drosophila melanogaster chromosome 3R, section 44 of 118 of the complete
              sequence
          Length = 270961

 Score =  117 bits (59), Expect = 1e-23
 Identities = 123/145 (84%)
 Strand = Plus / Plus

                                                                          
Query: 31     gacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggaggatccc 90
              |||||||| || ||||| | ||| |||||||||||||| ||||||  |||||||||||||
Sbjct: 203144 gacttggccacgcgctccaactcgtccttcttcttgatggcgtaggagttggaggatccc 203203

                                                                          
Query: 91     ttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgtttntgaag 150
              |||||||||||||| |||||||||||||  || ||||| |  ||||| | |||   ||||
Sbjct: 203204 ttggcggcgttgatcagctcatcagccagacactcggccaccgtcttgatgttgcggaag 203263

                                       
Query: 151    gcagnctcacgagctccagtgcaga 175
              |||| |||||| |||||||||||||
Sbjct: 203264 gcagcctcacgtgctccagtgcaga 203288

---

>gb|AC010921.12| Drosophila melanogaster clone BACR15L12, complete sequence
          Length = 163466

 Score =  111 bits (56), Expect = 8e-22
 Identities = 84/94 (89%)
 Strand = Plus / Minus

                                                                         
Query: 97    gcgttgatgagctcatcagccaagcattcggcgatggtcttaacgtttntgaaggcagnc 156
             |||||||| ||||||||||||| ||| |||||||||||||| | |||  ||||||||| |
Sbjct: 27144 gcgttgatcagctcatcagccaggcactcggcgatggtcttgatgttcctgaaggcagcc 27085

                                               
Query: 157   tcacgagctccagtgcagagaagccagatagcct 190
             ||||||||||||||||| || |||||||||||||
Sbjct: 27084 tcacgagctccagtgcacagcagccagatagcct 27051



 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 64/72 (88%)
 Strand = Plus / Minus

                                                                         
Query: 20    cttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgt 79
             |||| ||||||||||||||||||||||| | |||||||||||||||||| |||||   ||
Sbjct: 28067 cttaacggttggacttggcgacacgctccaactcatccttcttcttgatggcgtacgagt 28008

                         
Query: 80    tggaggatccct 91
             |||| |||||||
Sbjct: 28007 tggaagatccct 27996

---

>gb|AC012160.7| Drosophila melanogaster clone BACR06G02, complete sequence
          Length = 172069

 Score =  111 bits (56), Expect = 8e-22
 Identities = 84/94 (89%)
 Strand = Plus / Plus

                                                                         
Query: 97    gcgttgatgagctcatcagccaagcattcggcgatggtcttaacgtttntgaaggcagnc 156
             |||||||| ||||||||||||| ||| |||||||||||||| | |||  ||||||||| |
Sbjct: 76562 gcgttgatcagctcatcagccaggcactcggcgatggtcttgatgttcctgaaggcagcc 76621

                                               
Query: 157   tcacgagctccagtgcagagaagccagatagcct 190
             ||||||||||||||||| || |||||||||||||
Sbjct: 76622 tcacgagctccagtgcacagcagccagatagcct 76655



 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 64/72 (88%)
 Strand = Plus / Plus

                                                                         
Query: 20    cttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgt 79
             |||| ||||||||||||||||||||||| | |||||||||||||||||| |||||   ||
Sbjct: 75639 cttaacggttggacttggcgacacgctccaactcatccttcttcttgatggcgtacgagt 75698

                         
Query: 80    tggaggatccct 91
             |||| |||||||
Sbjct: 75699 tggaagatccct 75710

---

>emb|BX041256.1|CNS093ZW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12CB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 863

 Score =  111 bits (56), Expect = 8e-22
 Identities = 145/174 (83%), Gaps = 1/174 (0%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 570 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 511

                                                                       
Query: 79  ttggaggatcccttggcggcgt-tgatgagctcatcagccaagcattcggcgatggtctt 137
           || || || ||||| ||||||| |||| |||||||| ||||| |||||||| |  |||||
Sbjct: 510 ttcgacgaacccttcgcggcgtgtgatcagctcatcggccaaacattcggcaaccgtctt 451

                                                                 
Query: 138 aacgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
            | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 450 gatgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 397

---

>emb|BX036089.1|CNS0900D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7DA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 511

 Score =  111 bits (56), Expect = 8e-22
 Identities = 141/170 (82%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 342 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 401

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 402 ttcgacgaacccttcgcggcgttgatcagctcatcggccagacattcggcaaccgtcttg 461

                                                             
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagc 188
           | |||   ||| |||| ||||||||| || ||||| || |||||||||||
Sbjct: 462 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagc 511

---

>gb|U35631.2|DMU35631 Drosophila melanogaster MEI-217 (mei-217) and MEI-218 (mei-218)
           genes, complete cds
          Length = 8598

 Score =  111 bits (56), Expect = 8e-22
 Identities = 84/94 (89%)
 Strand = Plus / Minus

                                                                       
Query: 97  gcgttgatgagctcatcagccaagcattcggcgatggtcttaacgtttntgaaggcagnc 156
           |||||||| ||||||||||||| ||| |||||||||||||| | |||  ||||||||| |
Sbjct: 537 gcgttgatcagctcatcagccaggcactcggcgatggtcttgatgttcctgaaggcagcc 478

                                             
Query: 157 tcacgagctccagtgcagagaagccagatagcct 190
           ||||||||||||||||| || |||||||||||||
Sbjct: 477 tcacgagctccagtgcacagcagccagatagcct 444



 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 51/55 (92%)
 Strand = Plus / Minus

                                                                   
Query: 20   cttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgta 74
            |||| ||||||||||||||||||||||| | |||||||||||||||||| |||||
Sbjct: 1460 cttaacggttggacttggcgacacgctccaactcatccttcttcttgatggcgta 1406

---

>gb|AE003504.4| Drosophila melanogaster chromosome X, section 56 of 74 of the complete
              sequence
          Length = 298703

 Score =  111 bits (56), Expect = 8e-22
 Identities = 84/94 (89%)
 Strand = Plus / Plus

                                                                          
Query: 97     gcgttgatgagctcatcagccaagcattcggcgatggtcttaacgtttntgaaggcagnc 156
              |||||||| ||||||||||||| ||| |||||||||||||| | |||  ||||||||| |
Sbjct: 206779 gcgttgatcagctcatcagccaggcactcggcgatggtcttgatgttcctgaaggcagcc 206838

                                                
Query: 157    tcacgagctccagtgcagagaagccagatagcct 190
              ||||||||||||||||| || |||||||||||||
Sbjct: 206839 tcacgagctccagtgcacagcagccagatagcct 206872



 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 64/72 (88%)
 Strand = Plus / Plus

                                                                          
Query: 20     cttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgt 79
              |||| ||||||||||||||||||||||| | |||||||||||||||||| |||||   ||
Sbjct: 205856 cttaacggttggacttggcgacacgctccaactcatccttcttcttgatggcgtacgagt 205915

                          
Query: 80     tggaggatccct 91
              |||| |||||||
Sbjct: 205916 tggaagatccct 205927

---

>emb|CT033676.1| Platynereis dumerilii EST IB0AAA16AH02EM1
          Length = 687

 Score =  111 bits (56), Expect = 8e-22
 Identities = 114/134 (85%)
 Strand = Plus / Minus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           ||||||||||||||||||||||| | ||| |||||||| |||||||||||    ||||| 
Sbjct: 628 cggttggacttggcgacacgctccaactcgtccttctttttgatagcgtatgaattggat 569

                                                                       
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
           |||||||||||||||||||| ||||| || ||||  || |||||||| ||||| | ||||
Sbjct: 568 gatcccttggcggcgttgatcagctcgtcggccagacactcggcgatcgtcttgatgttt 509

                         
Query: 145 ntgaaggcagnctc 158
            ||||||||| |||
Sbjct: 508 ctgaaggcagactc 495

---

>emb|CT033675.1| Platynereis dumerilii EST IB0AAA16AH02FM1
          Length = 687

 Score =  111 bits (56), Expect = 8e-22
 Identities = 114/134 (85%)
 Strand = Plus / Plus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           ||||||||||||||||||||||| | ||| |||||||| |||||||||||    ||||| 
Sbjct: 60  cggttggacttggcgacacgctccaactcgtccttctttttgatagcgtatgaattggat 119

                                                                       
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
           |||||||||||||||||||| ||||| || ||||  || |||||||| ||||| | ||||
Sbjct: 120 gatcccttggcggcgttgatcagctcgtcggccagacactcggcgatcgtcttgatgttt 179

                         
Query: 145 ntgaaggcagnctc 158
            ||||||||| |||
Sbjct: 180 ctgaaggcagactc 193

---

>emb|CT033316.1| Platynereis dumerilii EST IB0AAA22CF06FM1
          Length = 812

 Score =  111 bits (56), Expect = 8e-22
 Identities = 114/134 (85%)
 Strand = Plus / Plus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           ||||||||||||||||||||||| | ||| ||||| ||||||||||||||    ||||| 
Sbjct: 77  cggttggacttggcgacacgctccaactcgtcctttttcttgatagcgtatgaattggat 136

                                                                       
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
           |||||||||||||||||||| ||||| || ||||  || |||||||| ||||| | ||||
Sbjct: 137 gatcccttggcggcgttgatcagctcgtcggccagacactcggcgatcgtcttgatgttt 196

                         
Query: 145 ntgaaggcagnctc 158
            ||||||||| |||
Sbjct: 197 ctgaaggcagactc 210

---

>emb|BX070858.1|CNS09QU6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8AF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score =  109 bits (55), Expect = 3e-21
 Identities = 143/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 336 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 395

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 396 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 455

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| |  ||||||| ||||||
Sbjct: 456 atgttacggaatgcagcctcacgagcaccggtgcacaacagccagaaagcctg 508

---

>emb|BX069638.1|CNS09PWA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6BE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 763

 Score =  109 bits (55), Expect = 3e-21
 Identities = 143/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 322 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 381

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 382 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 441

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| |  ||||||| ||||||
Sbjct: 442 atgttacggaatgcagcctcacgagcaccggtgcacaacagccagaaagcctg 494

---

>emb|BX066320.1|CNS09NC4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score =  109 bits (55), Expect = 3e-21
 Identities = 143/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| ||| |||||||||||||||| |||||   |
Sbjct: 376 gcttatcggttagacttggccacacgctccagcccatccttcttcttgatggcgtacgag 435

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 436 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 495

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||| ||||||
Sbjct: 496 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagaaagcctg 548

---

>emb|BX064714.1|CNS09M3I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 859

 Score =  109 bits (55), Expect = 3e-21
 Identities = 143/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| ||| |||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 698 gcttatcggttagacctggccacacgctccagctcatccttcttcttgatggcgtacgag 639

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 638 ttcgacgaacccttcgcggcgttgatcagctcatcggccagacattcggcaaccgtcttg 579

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 578 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 526

---

>emb|BX059728.1|CNS09I90 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4DA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 755

 Score =  109 bits (55), Expect = 3e-21
 Identities = 143/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 350 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 409

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 410 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 469

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| |  ||||||| ||||||
Sbjct: 470 atgttacggaatgcagcctcacgagcaccggtgcacaacagccagaaagcctg 522

---

>emb|BX059727.1|CNS09I8Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4DA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 775

 Score =  109 bits (55), Expect = 3e-21
 Identities = 143/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 569 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 510

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 509 ttcgacgaacccttcgcggcgttgatcagctcatcggccatacattcggcaaccgtcttg 450

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| |  ||||||||||||||
Sbjct: 449 atgttacggaatgcagcctcacgagcaccggtgcacaacagccagatagcctg 397

---

>emb|BX059264.1|CNS09HW4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 973

 Score =  109 bits (55), Expect = 3e-21
 Identities = 143/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 733 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 674

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||| ||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 673 ttcgacgaacccttcgcgacgttgatcagctcatcggccagacattcggcaaccgtcttg 614

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 613 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 561

---

>emb|BX054183.1|CNS09DYZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32BA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 819

 Score =  109 bits (55), Expect = 3e-21
 Identities = 143/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 380 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 439

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 440 ttcgacgaacccttcgcggcgttgatcagctcatcggccagacattcggcaaccgtcttg 499

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||| ||||||
Sbjct: 500 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagaaagcctg 552

---

>emb|BX047407.1|CNS098QR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC21CE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 885

 Score =  109 bits (55), Expect = 3e-21
 Identities = 143/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 318 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 377

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 378 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 437

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| |  ||||||| ||||||
Sbjct: 438 atgttacggaatgcagcctcacgagcaccggtgcacaacagccagaaagcctg 490

---

>emb|BX045880.1|CNS097KC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC2AH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 634

 Score =  109 bits (55), Expect = 3e-21
 Identities = 143/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 325 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 384

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 385 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 444

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| |  ||||||| ||||||
Sbjct: 445 atgttacggaatgcagcctcacgagcaccggtgcacaacagccagaaagcctg 497

---

>emb|BX042957.1|CNS095B5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC15AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score =  109 bits (55), Expect = 3e-21
 Identities = 143/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 398 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 457

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 458 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 517

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| ||||  |||||||| || ||||| || ||||||| ||||||
Sbjct: 518 atgttacggaatgcagcttcacgagcaccggtgcacagcagccagaaagcctg 570

---

>emb|BX042339.1|CNS094TZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC14BD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 732

 Score =  109 bits (55), Expect = 3e-21
 Identities = 140/169 (82%)
 Strand = Plus / Minus

                                                                       
Query: 23  atcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttgg 82
           ||||||| |||||| | |||||||| |||||||||||||||||||| |||||   ||| |
Sbjct: 732 atcggttagacttgaccacacgctccagctcatccttcttcttgatggcgtacgagttcg 673

                                                                       
Query: 83  aggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgt 142
           | || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| | ||
Sbjct: 672 acgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttgatgt 613

                                                            
Query: 143 ttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           |   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 612 tacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 564

---

>emb|BX031111.1|CNS08W63 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA46BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score =  109 bits (55), Expect = 3e-21
 Identities = 143/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 378 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 437

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 438 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 497

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| |  ||||||| ||||||
Sbjct: 498 atgttacggaatgcagcctcacgagcaccggtgcacaacagccagaaagcctg 550

---

>emb|BX028774.1|CNS08UD6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA42DH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 991

 Score =  109 bits (55), Expect = 3e-21
 Identities = 143/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 378 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 437

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 438 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 497

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| |  ||||||| ||||||
Sbjct: 498 atgttacggaatgcagcctcacgagcaccggtgcacaacagccagaaagcctg 550

---

>emb|BX028422.1|CNS08U3E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA42BH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 839

 Score =  109 bits (55), Expect = 3e-21
 Identities = 144/173 (83%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 370 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 429

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 430 ttcgacgaacccttcgcggcgttgatcagctcatcggccagacattcggcaaccgtcttg 489

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | | ||  ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 490 atg-ttacgaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 541

---

>emb|BX024681.1|CNS08R7H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA37DA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 753

 Score =  109 bits (55), Expect = 3e-21
 Identities = 143/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 373 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 432

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 433 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 492

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | ||     || |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 493 atgtaaaaaaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 545

---

>emb|BX024121.1|CNS08QRX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA36DC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score =  109 bits (55), Expect = 3e-21
 Identities = 143/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||  | |||||||| |||||||||||||||||||| |||||   |
Sbjct: 358 gcttatcggttagacttttccacacgctccagctcatccttcttcttgatggcgtacgag 417

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 418 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 477

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 478 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 530

---

>emb|BX020767.1|CNS08O6R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30CD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 710

 Score =  109 bits (55), Expect = 3e-21
 Identities = 143/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 653 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 594

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| | ||||||||| |||||||| ||||  |||||||| |  ||||| 
Sbjct: 593 ttcgacgaacccttcgtggcgttgatcagctcatcggccagacattcggcaaccgtcttg 534

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 533 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 481

---

>emb|BX018908.1|CNS08MR4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA28CH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 846

 Score =  109 bits (55), Expect = 3e-21
 Identities = 143/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 352 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 411

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||   ||||||| |  ||||| 
Sbjct: 412 ttcgacgaacccttcgcggcgttgatcagctcatcggccagaaattcggcaaccgtcttg 471

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 472 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 524

---

>emb|BX015043.1|CNS08JRR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22CD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 881

 Score =  109 bits (55), Expect = 3e-21
 Identities = 143/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 743 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 684

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 683 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 624

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| |  | ||| || ||||||||||||||
Sbjct: 623 atgttacggaatgcagcctcacgagcactggggcacagcagccagatagcctg 571

---

>emb|BX014759.1|CNS08JJV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA22AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 623

 Score =  109 bits (55), Expect = 3e-21
 Identities = 143/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 376 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 435

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 436 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 495

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||| ||| ||||||
Sbjct: 496 atgttacggaatgcagcctcacgagcaccggtgcacagcagcaagaaagcctg 548

---

>emb|BX012967.1|CNS08I63 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA2CB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 835

 Score =  109 bits (55), Expect = 3e-21
 Identities = 143/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 381 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 440

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           |  || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 441 tccgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 500

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||| ||||||
Sbjct: 501 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagaaagcctg 553

---

>emb|BX008888.1|CNS08F0S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA14CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 643

 Score =  109 bits (55), Expect = 3e-21
 Identities = 143/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||    
Sbjct: 197 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgaa 256

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 257 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 316

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||| ||||||
Sbjct: 317 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagaaagcctg 369

---

>emb|BX066873.1|CNS09NRH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50BD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 546

 Score =  107 bits (54), Expect = 1e-20
 Identities = 142/172 (82%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 368 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 427

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| |||| |||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 428 ttcgacgaacccttcgcggggttgatcagctcatcggccaaacattcggcaaccgtcttg 487

                                                               
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcct 190
           | |||   ||| |||| ||||||||| || ||||| || ||||||| |||||
Sbjct: 488 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagaaagcct 539

---

>emb|BX058348.1|CNS09H6O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 525

 Score =  107 bits (54), Expect = 1e-20
 Identities = 96/110 (87%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 374 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 433

                                                             
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggc 128
           || || || ||||| ||||||||||| |||||||| ||||| ||||||||
Sbjct: 434 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggc 483

---

>emb|BX056006.1|CNS09FDM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC34DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 544

 Score =  107 bits (54), Expect = 1e-20
 Identities = 96/110 (87%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 345 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 404

                                                             
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggc 128
           || || || ||||| ||||||||||| |||||||| ||||| ||||||||
Sbjct: 405 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggc 454

---

>emb|BX037292.1|CNS090XS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score =  107 bits (54), Expect = 1e-20
 Identities = 96/110 (87%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 692 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 633

                                                             
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggc 128
           || || || ||||| ||||||||||| |||||||| ||||| ||||||||
Sbjct: 632 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggc 583

---

>emb|BX034797.1|CNS08Z0H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score =  107 bits (54), Expect = 1e-20
 Identities = 96/110 (87%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 737 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 678

                                                             
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggc 128
           || || || ||||| ||||||||||| |||||||| ||||| ||||||||
Sbjct: 677 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggc 628

---

>emb|BX006274.1|CNS08D06 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10CF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 179

 Score =  107 bits (54), Expect = 1e-20
 Identities = 96/110 (87%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 143 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 84

                                                             
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggc 128
           || || || ||||| ||||||||||| |||||||| ||||| ||||||||
Sbjct: 83  ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggc 34

---

>emb|CT032677.1| Platynereis dumerilii EST IB0AAA33CA06FM1
          Length = 699

 Score =  107 bits (54), Expect = 1e-20
 Identities = 142/172 (82%)
 Strand = Plus / Plus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           ||||||||||||||||| | ||| | ||| ||||| ||||||||||||||    ||||| 
Sbjct: 79  cggttggacttggcgaccccctccaactcgtcctttttcttgatagcgtatgaattggat 138

                                                                       
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
           |||||||||||||||||||| ||||| || ||||  || |||||||| ||||| | ||||
Sbjct: 139 gatcccttggcggcgttgatcagctcgtcggccagacactcggcgatcgtcttgatgttt 198

                                                               
Query: 145 ntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggttga 196
            ||||||||| ||| || ||||| ||||| || | |||||| || |||||||
Sbjct: 199 ctgaaggcagactctcgggctcctgtgcacagtaaccagatggcttggttga 250

---

>ref|NM_183433.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 864

 Score =  105 bits (53), Expect = 5e-20
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 33  cttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggaggatccctt 92
           |||||| |||||||| | |||||||||||||||||| || ||||||||||| || |||||
Sbjct: 669 cttggcaacacgctcaatctcatccttcttcttgatggcatagctgttggatgagccctt 610

                                                        
Query: 93  ggcggcgttgatgagctcatcagccaagcattcggcgatggtctt 137
           |||||| ||||||||||||||||| | ||| || || ||||||||
Sbjct: 609 ggcggcattgatgagctcatcagcaaggcactcagcaatggtctt 565

---

>ref|XM_341788.2| PREDICTED: Rattus norvegicus ribosomal protein S5 (Rps5), mRNA
          Length = 722

 Score =  105 bits (53), Expect = 5e-20
 Identities = 138/167 (82%)
 Strand = Plus / Minus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           ||||| |||||||| |||||||| || ||||| |||||||||||||| |||  |||||||
Sbjct: 672 cggttagacttggccacacgctccagttcatctttcttcttgatagcataggagttggag 613

                                                                       
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
           || |||||||| || || ||||||||||| || | ||| || ||||||||||| | ||| 
Sbjct: 612 gagcccttggcagcattaatgagctcatctgcaaggcactcagcgatggtcttgatgttc 553

                                                          
Query: 145 ntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
             ||| |||| ||||||||| || ||||| || |||||||| |||||
Sbjct: 552 cggaaagcagcctcacgagcccccgtgcacagcagccagatggcctg 506

---

>dbj|AK121523.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033028P14, full
           insert sequence
          Length = 916

 Score =  105 bits (53), Expect = 5e-20
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 33  cttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggaggatccctt 92
           |||||| |||||||| | |||||||||||||||||| || ||||||||||| || |||||
Sbjct: 679 cttggcaacacgctcaatctcatccttcttcttgatggcatagctgttggatgagccctt 620

                                                        
Query: 93  ggcggcgttgatgagctcatcagccaagcattcggcgatggtctt 137
           |||||| ||||||||||||||||| | ||| || || ||||||||
Sbjct: 619 ggcggcattgatgagctcatcagcaaggcactcagcaatggtctt 575

---

>dbj|AK059844.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-206-E02, full
           insert sequence
          Length = 864

 Score =  105 bits (53), Expect = 5e-20
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 33  cttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggaggatccctt 92
           |||||| |||||||| | |||||||||||||||||| || ||||||||||| || |||||
Sbjct: 669 cttggcaacacgctcaatctcatccttcttcttgatggcatagctgttggatgagccctt 610

                                                        
Query: 93  ggcggcgttgatgagctcatcagccaagcattcggcgatggtctt 137
           |||||| ||||||||||||||||| | ||| || || ||||||||
Sbjct: 609 ggcggcattgatgagctcatcagcaaggcactcagcaatggtctt 565

---

>gb|BC059443.1| Danio rerio ribosomal protein S5, mRNA (cDNA clone MGC:73068
           IMAGE:4145464), complete cds
          Length = 742

 Score =  101 bits (51), Expect = 8e-19
 Identities = 144/176 (81%)
 Strand = Plus / Minus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           ||||| |||||||| || | ||| |||||||| ||||||||||| |||||   |||||||
Sbjct: 637 cggttagacttggccactctctccagctcatctttcttcttgatggcgtaagagttggag 578

                                                                       
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
           || |||||||| |||||||||||||| ||||| |  || || ||||||||||| | ||| 
Sbjct: 577 gaacccttggcagcgttgatgagctcgtcagcaagacactctgcgatggtcttgatgttc 518

                                                                   
Query: 145 ntgaaggcagnctcacgagctccagtgcagagaagccagatagcctggttgantct 200
            |||| ||||  || |  || ||||||||||| |||||||| |||||||||| |||
Sbjct: 517 ctgaaagcagcttctcttgcaccagtgcagagcagccagatggcctggttgactct 462

---

>emb|BX070857.1|CNS09QU5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 987

 Score =  101 bits (51), Expect = 8e-19
 Identities = 143/173 (82%), Gaps = 1/173 (0%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 726 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 667

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||| | ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 666 ttcgacgaaccc-tcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 608

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| |  ||||||||||||||
Sbjct: 607 atgttacggaatgcagcctcacgagcaccggtgcacaacagccagatagcctg 555

---

>emb|BX067168.1|CNS09NZO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50CH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 613

 Score =  101 bits (51), Expect = 8e-19
 Identities = 142/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 400 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 459

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||   ||||||| |  ||||| 
Sbjct: 460 ttcgacgaacccttcgcggcgttgatcagctcatcggccagaaattcggcaaccgtcttg 519

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||| ||||||
Sbjct: 520 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagaaagcctg 572

---

>emb|BX065224.1|CNS09MHO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 605

 Score =  101 bits (51), Expect = 8e-19
 Identities = 142/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| ||| |||||||||||||||| |||||   |
Sbjct: 344 gcttatcggttagacttggccacacgctccagcccatccttcttcttgatggcgtacgag 403

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 404 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 463

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | ||    ||| |||| ||||||||| || ||||| || ||||||| ||||||
Sbjct: 464 atgtaacggaatgcagcctcacgagcaccggtgcacagcagccagaaagcctg 516

---

>emb|BX055290.1|CNS09ETQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33DD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 663

 Score =  101 bits (51), Expect = 8e-19
 Identities = 142/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 329 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 388

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||   ||||||| |  ||||| 
Sbjct: 389 ttcgacgaacccttcgcggcgttgatcagctcatcggccagaaattcggcaaccgtcttg 448

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||| ||||||
Sbjct: 449 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagaaagcctg 501

---

>emb|BX036088.1|CNS0900C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7DA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 832

 Score =  101 bits (51), Expect = 8e-19
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 570 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 511

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||    |||||| |  ||||| 
Sbjct: 510 ttcgacgaacccttcgcggcgttgatcagctcatcggccattttttcggcaaccgtcttg 451

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 450 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 398

---

>emb|BX035842.1|CNS08ZTI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7BE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 767

 Score =  101 bits (51), Expect = 8e-19
 Identities = 142/173 (82%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 739 gcttatcggttagacttggcaacacgctccagctcatccttcttcttgatggcgtacgag 680

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           ||     | ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 679 tttttttaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 620

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||||||||||
Sbjct: 619 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcctg 567

---

>emb|BX030023.1|CNS08VBV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score =  101 bits (51), Expect = 8e-19
 Identities = 142/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| ||| |||||||||||||||| |||||   |
Sbjct: 399 gcttatcggttagacttggccacacgctccagcccatccttcttcttgatggcgtacgag 458

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           |  || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 459 tccgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 518

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||| ||||||
Sbjct: 519 atgttacggaatgcagcctcacgagccccggtgcacagcagccagaaagcctg 571

---

>emb|BX025593.1|CNS08RWT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA39AH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 839

 Score =  101 bits (51), Expect = 8e-19
 Identities = 142/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           |||||||||||  ||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 386 gcttatcggttaaacttggccacacgctccagctcatccttcttcttgatggcgtacgag 445

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 446 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 505

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||| ||| ||||||
Sbjct: 506 atgttacggaatgcagcctcacgagcaccggtgcacagcagcaagaaagcctg 558

---

>emb|BX023497.1|CNS08QAL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA35DF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score =  101 bits (51), Expect = 8e-19
 Identities = 142/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| ||| |||||||||||||||| |||||   |
Sbjct: 376 gcttatcggttagacttggccacacgctccagcccatccttcttcttgatggcgtacgag 435

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 436 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 495

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| |  ||||||| ||||||
Sbjct: 496 atgttacggaatgcagcctcacgagcaccggtgcacaacagccagaaagcctg 548

---

>emb|BX022048.1|CNS08P6C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA32DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score =  101 bits (51), Expect = 8e-19
 Identities = 142/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| ||||||||||||||||||   |||||   |
Sbjct: 389 gcttatcggttagacttggccacacgctccagctcatccttcttcttgggggcgtacgag 448

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  ||||| 
Sbjct: 449 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgtcttg 508

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||| ||||||
Sbjct: 509 atgttacggaatgcagcctcacgagcaccggtgcacagcagccagaaagcctg 561

---

>emb|BX012119.1|CNS08HIJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA19BC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 721

 Score =  101 bits (51), Expect = 8e-19
 Identities = 142/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| ||| |||||||||||||||| |||||   |
Sbjct: 371 gcttatcggttagacttggccacacgctccagcccatccttcttcttgatggcgtacgag 430

                                                                       
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtctta 138
           || || || ||||| ||||||||||| |||||||| ||||| |||||||| |  || || 
Sbjct: 431 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggcaaccgttttg 490

                                                                
Query: 139 acgtttntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
           | |||   ||| |||| ||||||||| || ||||| || ||||||| ||||||
Sbjct: 491 atgttacggaatgcagcctcacgagccccggtgcacagcagccagaaagcctg 543

---

>emb|BX035703.1|CNS08ZPN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7AF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 747

 Score = 99.6 bits (50), Expect = 3e-18
 Identities = 138/168 (82%)
 Strand = Plus / Minus

                                                                       
Query: 22  tatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttg 81
           |||||||| |||||||| |||||||| || ||||||||||||||||| |||||   ||| 
Sbjct: 747 tatcggttagacttggccacacgctccaggtcatccttcttcttgatggcgtacgagttc 688

                                                                       
Query: 82  gaggatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacg 141
           || || ||||| ||||||||||| |||||||| ||||  |||||||| |  ||||| | |
Sbjct: 687 gacgaacccttcgcggcgttgatcagctcatcggccagacattcggcaaccgtcttgatg 628

                                                           
Query: 142 tttntgaaggcagnctcacgagctccagtgcagagaagccagatagcc 189
           ||   ||| |||| ||||||||| || ||||| || ||||||||||||
Sbjct: 627 ttacggaatgcagcctcacgagcaccggtgcacagcagccagatagcc 580

---

>emb|BX055955.1|CNS09FC7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC34DB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 476

 Score = 99.6 bits (50), Expect = 3e-18
 Identities = 95/110 (86%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 340 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 399

                                                             
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggc 128
           || || || ||||| ||||||||||| |||||||| | ||| ||||||||
Sbjct: 400 ttcgacgaacccttcgcggcgttgatcagctcatcgggcaaacattcggc 449

---

>emb|BX032904.1|CNS08XJW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49AD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 502

 Score = 99.6 bits (50), Expect = 3e-18
 Identities = 95/110 (86%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 380 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 439

                                                             
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggc 128
           || || || ||||| |||| |||||| |||||||| ||||| ||||||||
Sbjct: 440 ttcgacgaacccttcgcggggttgatcagctcatcggccaaacattcggc 489

---

>emb|BX010780.1|CNS08GHC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA17BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 589

 Score = 99.6 bits (50), Expect = 3e-18
 Identities = 95/110 (86%)
 Strand = Plus / Plus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| ||| |||||||||||||||| |||||   |
Sbjct: 373 gcttatcggttagacttggccacacgctccagcccatccttcttcttgatggcgtacgag 432

                                                             
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggc 128
           || || || ||||| ||||||||||| |||||||| ||||| ||||||||
Sbjct: 433 ttcgacgaacccttcgcggcgttgatcagctcatcggccaaacattcggc 482

---

>emb|BX006934.1|CNS08DII Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 858

 Score = 99.6 bits (50), Expect = 3e-18
 Identities = 95/110 (86%)
 Strand = Plus / Minus

                                                                       
Query: 19  gcttatcggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctg 78
           ||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||   |
Sbjct: 709 gcttatcggttagacttggccacacgctccagctcatccttcttcttgatggcgtacgag 650

                                                             
Query: 79  ttggaggatcccttggcggcgttgatgagctcatcagccaagcattcggc 128
           || || || ||||| ||||||||||| |||||||| ||||  ||||||||
Sbjct: 649 ttcgacgaacccttcgcggcgttgatcagctcatcggccagacattcggc 600

---

>emb|AM167929.1| Chlamydomonas sp. ICE-L mRNA for 40S ribosomal protein S5 (RPS5
           gene)
          Length = 747

 Score = 99.6 bits (50), Expect = 3e-18
 Identities = 86/98 (87%)
 Strand = Plus / Minus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           ||||||| |||||| |||||||| ||||| ||||||||||| |||||||| |||||||| 
Sbjct: 612 cggttggccttggcaacacgctccagctcgtccttcttcttaatagcgtaactgttggaa 553

                                                 
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagca 122
           |||||||| ||||||||||  | ||| |||||||||||
Sbjct: 552 gatcccttagcggcgttgaccaactcgtcagccaagca 515

---

>gb|BC058690.1| Mus musculus ribosomal protein S5, mRNA (cDNA clone MGC:63220
           IMAGE:6814814), complete cds
          Length = 749

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 137/167 (82%)
 Strand = Plus / Minus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           ||||| |||||||| |||||||| || ||||| ||||||||||| || |||   ||||||
Sbjct: 671 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 612

                                                                       
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
           || |||||||| || || ||||||||||| || | ||| |||||||||||||| | ||| 
Sbjct: 611 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 552

                                                          
Query: 145 ntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
             ||| |||| ||||||||| || ||||| || |||||||| |||||
Sbjct: 551 cggaaagcagcctcacgagcccctgtgcacagcagccagatggcctg 505

---

>ref|XM_747778.1| Aspergillus fumigatus Af293 40S ribosomal protein S5 (Afu1g15020)
           partial mRNA
          Length = 696

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 33  cttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggaggatccctt 92
           |||||| |||||||||||||| |||||||||||||| |||||   |||||||  ||||||
Sbjct: 684 cttggcaacacgctcgagctcgtccttcttcttgatggcgtaagagttggagcttccctt 625

                                                        
Query: 93  ggcggcgttgatgagctcatcagccaagcattcggcgatggtctt 137
           ||| |||||||||||||| ||||||| ||| ||||| ||| ||||
Sbjct: 624 ggcagcgttgatgagctcttcagccaggcactcggcaatgctctt 580

---

>emb|Y12431.1|MMRPS5 M.musculus mRNA for ribosomal protein S5
          Length = 715

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 137/167 (82%)
 Strand = Plus / Minus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           ||||| |||||||| |||||||| || ||||| ||||||||||| || |||   ||||||
Sbjct: 666 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 607

                                                                       
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
           || |||||||| || || ||||||||||| || | ||| |||||||||||||| | ||| 
Sbjct: 606 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 547

                                                          
Query: 145 ntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
             ||| |||| ||||||||| || ||||| || |||||||| |||||
Sbjct: 546 cggaaagcagcctcacgagcccctgtgcacagcagccagatggcctg 500

---

>dbj|AK152449.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830072L04 product:ribosomal
           protein S5, full insert sequence
          Length = 731

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 137/167 (82%)
 Strand = Plus / Minus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           ||||| |||||||| |||||||| || ||||| ||||||||||| || |||   ||||||
Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625

                                                                       
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
           || |||||||| || || ||||||||||| || | ||| |||||||||||||| | ||| 
Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565

                                                          
Query: 145 ntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
             ||| |||| ||||||||| || ||||| || |||||||| |||||
Sbjct: 564 cggaaagcagcctcacgagcccctgtgcacagcagccagatggcctg 518

---

>dbj|AK167533.1| Mus musculus 14 days embryo liver cDNA, RIKEN full-length enriched
           library, clone:I530018P15 product:ribosomal protein S5,
           full insert sequence
          Length = 731

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 137/167 (82%)
 Strand = Plus / Minus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           ||||| |||||||| |||||||| || ||||| ||||||||||| || |||   ||||||
Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625

                                                                       
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
           || |||||||| || || ||||||||||| || | ||| |||||||||||||| | ||| 
Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565

                                                          
Query: 145 ntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
             ||| |||| ||||||||| || ||||| || |||||||| |||||
Sbjct: 564 cggaaagcagcctcacgagcccctgtgcacagcagccagatggcctg 518

---

>dbj|AK164079.1| Mus musculus 12 days embryo spinal cord cDNA, RIKEN full-length
           enriched library, clone:C530002K11 product:ribosomal
           protein S5, full insert sequence
          Length = 731

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 137/167 (82%)
 Strand = Plus / Minus

                                                                       
Query: 25  cggttggacttggcgacacgctcgagctcatccttcttcttgatagcgtagctgttggag 84
           ||||| |||||||| |||||||| || ||||| ||||||||||| || |||   ||||||
Sbjct: 684 cggttagacttggccacacgctccagttcatctttcttcttgatggcataggaattggag 625

                                                                       
Query: 85  gatcccttggcggcgttgatgagctcatcagccaagcattcggcgatggtcttaacgttt 144
           || |||||||| || || ||||||||||| || | ||| |||||||||||||| | ||| 
Sbjct: 624 gagcccttggcagcattaatgagctcatctgcaaggcactcggcgatggtcttgatgttc 565

                                                          
Query: 145 ntgaaggcagnctcacgagctccagtgcagagaagccagatagcctg 191
             ||| |||| ||||||||| || ||||| || |||||||| |||||
Sbjct: 564 cggaaagcagcctcacgagcccctgtgcacagcagccagatggcctg 518


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,440,184
Number of Sequences: 3902068
Number of extensions: 1440184
Number of successful extensions: 117707
Number of sequences better than 10.0: 474
Number of HSP's better than 10.0 without gapping: 472
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 116613
Number of HSP's gapped (non-prelim): 924
length of query: 204
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 182
effective length of database: 17,147,199,772
effective search space: 3120790358504
effective search space used: 3120790358504
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---