>gb|AC164418.10| Mus musculus chromosome 1, clone RP23-431J24, complete sequence
          Length = 189965

 Score = 46.1 bits (23), Expect = 0.019
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 26    gaacactttacaaatggaatcta 48
             |||||||||||||||||||||||
Sbjct: 97730 gaacactttacaaatggaatcta 97752

>gb|AC119842.9| Mus musculus chromosome 1, clone RP23-277F23, complete sequence
          Length = 175179

 Score = 46.1 bits (23), Expect = 0.019
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 26     gaacactttacaaatggaatcta 48
              |||||||||||||||||||||||
Sbjct: 137866 gaacactttacaaatggaatcta 137888

>gb|AE010300.1| Leptospira interrogans serovar lai str. 56601 chromosome I, complete
               sequence
          Length = 4332241

 Score = 42.1 bits (21), Expect = 0.29
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 73      aaaattgaactgtaaagttca 93
               |||||||||||||||||||||
Sbjct: 1298219 aaaattgaactgtaaagttca 1298239

>gb|AE016823.1| Leptospira interrogans serovar Copenhageni str. Fiocruz L1-130, chromosome
               I, complete sequence
          Length = 4277185

 Score = 42.1 bits (21), Expect = 0.29
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 73      aaaattgaactgtaaagttca 93
               |||||||||||||||||||||
Sbjct: 2927913 aaaattgaactgtaaagttca 2927893

>emb|BX247888.10| Zebrafish DNA sequence from clone DKEY-10D15 in linkage group 9,
             complete sequence
          Length = 223425

 Score = 38.2 bits (19), Expect = 4.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 76    attgaactgtaaagttcat 94
             |||||||||||||||||||
Sbjct: 80558 attgaactgtaaagttcat 80576

>gb|AC026353.12| Homo sapiens 3 RP11-298O21 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 138312

 Score = 38.2 bits (19), Expect = 4.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 29     cactttacaaatggaatct 47
              |||||||||||||||||||
Sbjct: 131559 cactttacaaatggaatct 131541

>gb|AC008094.5|AC008094 Drosophila melanogaster, chromosome 3R, region 84F-84F, BAC clone
             BACR45A07, complete sequence
          Length = 170498

 Score = 38.2 bits (19), Expect = 4.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    cccctacaaaattgaactg 84
             |||||||||||||||||||
Sbjct: 83943 cccctacaaaattgaactg 83961

>gb|CP000033.1| Lactobacillus acidophilus NCFM, complete genome
          Length = 1993564

 Score = 38.2 bits (19), Expect = 4.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 76      attgaactgtaaagttcat 94
               |||||||||||||||||||
Sbjct: 1837130 attgaactgtaaagttcat 1837148

>gb|AE003678.3| Drosophila melanogaster chromosome 3R, section 16 of 118 of the
            complete sequence
          Length = 244757

 Score = 38.2 bits (19), Expect = 4.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 66   cccctacaaaattgaactg 84
            |||||||||||||||||||
Sbjct: 5947 cccctacaaaattgaactg 5965

>gb|U14180.1|LVU14180 Lytechinus variegatus moesin gene, complete cds
          Length = 2014

 Score = 38.2 bits (19), Expect = 4.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 83   tgtaaagttcatggttgcc 101
            |||||||||||||||||||
Sbjct: 1006 tgtaaagttcatggttgcc 988


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 765,355
Number of Sequences: 3902068
Number of extensions: 765355
Number of successful extensions: 56091
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 55984
Number of HSP's gapped (non-prelim): 107
length of query: 102
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 81
effective length of database: 17,151,101,840
effective search space: 1389239249040
effective search space used: 1389239249040
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)