| Clone Name | rbaal40l07 |
|---|---|
| Clone Library Name | barley_pub |
| No. | Definition | Score (bits) |
E Value |
1 | emb|AL445565.1|MPULM03 Mycoplasma pulmonis (strain UAB CTIP) com... | 44 | 0.18 | 2 | emb|CR956360.10| Pig DNA sequence from clone CH242-245E12 on chr... | 40 | 2.8 | 3 | gb|AC151822.29| Medicago truncatula clone mth2-32h21, complete s... | 40 | 2.8 | 4 | gb|AY090542.1| Deschampsia antarctica clone Dacor 1.7 alanine am... | 40 | 2.8 |
|---|
>emb|AL445565.1|MPULM03 Mycoplasma pulmonis (strain UAB CTIP) complete genome; segment 3/3 Length = 315079 Score = 44.1 bits (22), Expect = 0.18 Identities = 25/26 (96%) Strand = Plus / Minus Query: 106 aatcaacttcaattgctggtagaaaa 131 |||||||||||||| ||||||||||| Sbjct: 147420 aatcaacttcaattcctggtagaaaa 147395
>emb|CR956360.10| Pig DNA sequence from clone CH242-245E12 on chromosome 7, complete sequence Length = 185507 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 166 ttttattctctcttcacagc 185 |||||||||||||||||||| Sbjct: 100464 ttttattctctcttcacagc 100445
>gb|AC151822.29| Medicago truncatula clone mth2-32h21, complete sequence Length = 118094 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 69 cagttttcttcaccatagtt 88 |||||||||||||||||||| Sbjct: 51301 cagttttcttcaccatagtt 51320
>gb|AY090542.1| Deschampsia antarctica clone Dacor 1.7 alanine aminotransferase mRNA, 3' UTR and partial cds Length = 583 Score = 40.1 bits (20), Expect = 2.8 Identities = 32/36 (88%) Strand = Plus / Minus Query: 110 aacttcaattgctggtagaaaagagcagcattatat 145 ||||| |||||||| ||||||| | ||||||||||| Sbjct: 511 aactttaattgctgctagaaaataacagcattatat 476 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,216,145 Number of Sequences: 3902068 Number of extensions: 2216145 Number of successful extensions: 166184 Number of sequences better than 10.0: 4 Number of HSP's better than 10.0 without gapping: 4 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 166170 Number of HSP's gapped (non-prelim): 14 length of query: 217 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 195 effective length of database: 17,147,199,772 effective search space: 3343703955540 effective search space used: 3343703955540 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)