ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal40c16
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds 900 0.0
2ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predic... 779 0.0
3gb|AY100470.1| Oryza sativa (indica cultivar-group) putative sol... 779 0.0
4dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 779 0.0
5dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic D... 779 0.0
6dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clon... 779 0.0
7dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clon... 779 0.0
8dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clon... 779 0.0
9dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clon... 771 0.0
10emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding... 741 0.0
11ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predic... 716 0.0
12dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic D... 716 0.0
13dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clon... 716 0.0
14dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clon... 716 0.0
15gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protei... 714 0.0
16emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chl... 712 0.0
17dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 712 0.0
18dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic D... 712 0.0
19dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic D... 712 0.0
20emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll ... 712 0.0
21dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clon... 712 0.0
22dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clon... 712 0.0
23dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clon... 712 0.0
24dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clon... 712 0.0
25dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clon... 704 0.0
26dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRN... 688 0.0
27emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chloro... 684 0.0
28emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlo... 672 0.0
29emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chloro... 652 0.0
30dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue... 630 e-177
31gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding p... 599 e-168
32emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putat... 593 e-166
33gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b ... 587 e-164
34gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast c... 575 e-161
35emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b bin... 567 e-158
36gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein g... 557 e-155
37emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein 541 e-150
38gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene... 525 e-146
39gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 521 e-145
40emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting... 498 e-137
41gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b... 494 e-136
42dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clon... 468 e-128
43gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 456 e-125
44gb|AY109324.1| Zea mays CL187_1 mRNA sequence 442 e-121
45gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/... 432 e-118
46gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genom... 426 e-116
47gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 426 e-116
48dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 426 e-116
49dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clon... 418 e-113
50emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chl... 402 e-109
51gb|AY389553.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 398 e-108
52dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRN... 394 e-106
53gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll... 385 e-103
54gb|AY389573.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 371 2e-99
55emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for lig... 357 3e-95
56emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for ligh... 357 3e-95
57emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll... 355 1e-94
58emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll... 347 3e-92
59gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (L... 347 3e-92
60emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b bind... 347 3e-92
61gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlor... 343 5e-91
62gb|AY617096.1| Picea sitchensis chloroplast light harvesting chl... 341 2e-90
63emb|AJ843976.1| Plantago major partial mRNA for light harvesting... 339 8e-90
64emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chloro... 339 8e-90
65gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding p... 335 1e-88
66dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clon... 331 2e-87
67gb|U21113.1|STU21113 Solanum tuberosum chlorophyll a/b binding p... 331 2e-87
68emb|X52743.1|NTCAB21 Tabacco Cab21 mRNA for major chlorophyll a/... 327 3e-86
69emb|AJ234428.1|HVU234428 Hordeum vulgare partial mRNA; clone cMW... 325 1e-85
70emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chloro... 317 3e-83
71gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlor... 315 1e-82
72gb|AY617092.1| Pinus monophylla chloroplast light harvesting chl... 315 1e-82
73gb|AY617084.1| Pinus contorta chloroplast light harvesting chlor... 313 4e-82
74gb|AY617083.1| Pinus radiata chloroplast light harvesting chloro... 313 4e-82
75gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlo... 313 4e-82
76gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll... 313 4e-82
77gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlor... 311 2e-81
78gb|U21114.1|STU21114 Solanum tuberosum chlorophyll a/b binding p... 311 2e-81
79gb|AY617091.1| Pinus strobus chloroplast light harvesting chloro... 307 3e-80
80gb|AY617090.1| Pinus monticola chloroplast light harvesting chlo... 307 3e-80
81dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 g... 307 3e-80
82gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlor... 305 1e-79
83dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light... 303 4e-79
84gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll... 301 2e-78
85gb|BT014208.1| Lycopersicon esculentum clone 133385R, mRNA sequence 299 7e-78
86gb|DQ018375.1| Pinus gerardiana chloroplast putative light harve... 299 7e-78
87gb|AY617093.1| Pinus remota chloroplast light harvesting chlorop... 299 7e-78
88gb|AY617089.1| Pinus lambertiana chloroplast light harvesting ch... 299 7e-78
89gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chl... 297 3e-77
90gb|DQ418483.1| Zingiber officinale chloroplast chlorophyll a/b-b... 295 1e-76
91dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for ... 295 1e-76
92gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chl... 291 2e-75
93gb|AY617081.1| Pinus echinata chloroplast light harvesting chlor... 291 2e-75
94gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b bi... 289 6e-75
95emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding pr... 287 2e-74
96gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding p... 287 2e-74
97dbj|AB012636.1| Nicotiana sylvestris Lhcb1*1 gene for light harv... 285 1e-73
98gb|M14443.1|TOMCBPA Tomato chlorophyll a/b-binding protein gene ... 283 4e-73
99emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-h... 278 2e-71
100gb|DQ018376.1| Pinus krempfii chloroplast putative light harvest... 274 4e-70
101gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting comple... 270 6e-69
102dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvest... 270 6e-69
103emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding p... 268 2e-68
104dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harv... 268 2e-68
105emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/... 264 4e-67
106gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II ch... 264 4e-67
107dbj|AB013728.1| Cryptomeria japonica mRNA for light-harvesting c... 262 1e-66
108dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clon... 258 2e-65
109gb|U21112.1|STU21112 Solanum tuberosum chlorophyll a/b binding p... 256 9e-65
110gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvestin... 254 3e-64
111emb|X52744.1|NTCAB40 Tabacco Cab40 mRNA for major chlorophyll a/... 250 5e-63
112emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/... 250 5e-63
113dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene... 248 2e-62
114gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding prot... 246 8e-62
115gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab... 240 5e-60
116gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting ... 238 2e-59
117emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding pr... 236 8e-59
118gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene ... 230 5e-57
119dbj|AB051208.1| Chlamydomonas reinhardtii mRNA for light-harvest... 230 5e-57
120gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding prot... 222 1e-54
121dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harv... 222 1e-54
122gb|M21397.1|TOBCABA Tobacco chlorophyll a/b-binding protein (Cab... 220 5e-54
123ref|XM_478729.1| Oryza sativa (japonica cultivar-group), mRNA 216 8e-53
124ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group... 216 8e-53
125ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group... 216 8e-53
126ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group... 216 8e-53
127ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group... 216 8e-53
128ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group... 216 8e-53
129ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group... 216 8e-53
130ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group... 216 8e-53
131dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 216 8e-53
132dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic D... 216 8e-53
133dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clon... 216 8e-53
134dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clon... 216 8e-53
135dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clon... 216 8e-53
136dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clon... 216 8e-53
137dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clon... 216 8e-53
138dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clon... 216 8e-53
139dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clon... 216 8e-53
140dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clon... 216 8e-53
141emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b bindin... 214 3e-52
142gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding p... 212 1e-51
143gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein... 212 1e-51
144gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosyste... 210 5e-51
145gb|AF495472.1| Chlamydomonas reinhardtii major light-harvesting ... 208 2e-50
146dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clon... 208 2e-50
147dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clon... 208 2e-50
148gb|AY112240.1| Zea mays CL187_6 mRNA sequence 206 7e-50
149emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putativ... 202 1e-48
150gb|M16058.1|CUSLHCPB Cucumber LHCP mRNA encoding chlorophyll a/b... 202 1e-48
151emb|X02359.1|PECAB22L Petunia gene for chlorophyll a/b binding p... 198 2e-47
152gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvestin... 198 2e-47
153gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein... 198 2e-47
154gb|K00974.1|PETCAB4 Petunia major chlorophyll a/b binding protei... 196 7e-47
155gb|M16057.1|CUSLHCPA Cucumber LHCP mRNA encoding chlorophyll a/b... 196 7e-47
156gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chl... 194 3e-46
157gb|M14449.1|TOMCBPG Tomato chlorophyll a/b-binding protein gene ... 194 3e-46
158dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-b... 194 3e-46
159emb|X02360.1|PECAB22R Petunia gene for chlorophyll a/b binding p... 192 1e-45
160gb|M30616.1|TOMCBPC2 Tomato chlorophyll a/b-binding protein Cab-... 188 2e-44
161dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene... 186 7e-44
162gb|AF017998.1|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b bin... 182 1e-42
163gb|M30620.1|TOMCBPE2 Tomato chlorophyll a/b-binding protein Cab-... 182 1e-42
164gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-bindi... 180 4e-42
165gb|AF133340.1|AF133340 Phalaenopsis sp. 'KCbutterfly' putative c... 180 4e-42
166gb|AY198376.1| Citrus limon chlorophyll a/b-binding protein prec... 176 6e-41
167gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chl... 174 3e-40
168gb|M30622.1|TOMCBPF2 Tomato chlorophyll a/b-binding protein Cab-... 174 3e-40
169dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone... 172 1e-39
170emb|Z75663.1|AGCHLABBP A.graveolens mRNA for chlorophyll a/b bin... 170 4e-39
171gb|M23532.1|PCPCBP P.patens major chlorophyll binding protein ge... 170 4e-39
172emb|X16536.1|GMCAB5 G.max DNA for Cab5 165 2e-37
173gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding pro... 165 2e-37
174gb|K00976.1|PETCAB102 Petunia major chlorophyll a/b binding prot... 163 1e-36
175gb|AF479778.1| Chlamydomonas reinhardtii major light-harvesting ... 161 4e-36
176gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/... 161 4e-36
177gb|M30618.1|TOMCBPD2 Tomato chlorophyll a/b-binding protein Cab-... 161 4e-36
178ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2... 159 2e-35
179ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2... 159 2e-35
180ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll bindin... 159 2e-35
181ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) ... 159 2e-35
182gb|AY142513.1| Arabidopsis thaliana putative photosystem II type... 159 2e-35
183gb|AY045806.1| Arabidopsis thaliana putative photosystem II type... 159 2e-35
184gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 ma... 159 2e-35
185gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 ma... 159 2e-35
186gb|AY081587.1| Arabidopsis thaliana photosystem II type I chloro... 159 2e-35
187gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 159 2e-35
188gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 159 2e-35
189gb|AY065125.1| Arabidopsis thaliana photosystem II type I chloro... 159 2e-35
190gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 ... 159 2e-35
191gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 ... 159 2e-35
192gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 ... 159 2e-35
193gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 159 2e-35
194gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 ... 159 2e-35
195emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Co... 159 2e-35
196emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Co... 159 2e-35
197emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Co... 159 2e-35
198emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II c... 159 2e-35
199dbj|AB051209.1| Chlamydomonas reinhardtii mRNA for light-harvest... 159 2e-35
200dbj|AB051205.1| Chlamydomonas reinhardtii gene for light-harvest... 159 2e-35
201gb|AF479779.1| Chlamydomonas reinhardtii major light-harvesting ... 157 6e-35
202emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b bindi... 157 6e-35
203emb|AJ318069.1|STU318069 Solanum tuberosum mRNA for ferredoxin-t... 157 6e-35
204dbj|AB051204.1| Chlamydomonas reinhardtii gene for light-harvest... 157 6e-35
205gb|K00975.1|PETCAB10 Petunia major chlorophyll a/b binding prote... 155 2e-34
206emb|AJ538931.1|NTA538931 Nicotiana tabacum cDNA-AFLP-fragment BT... 153 9e-34
207emb|AJ538840.1|NTA538840 Nicotiana tabacum cDNA-AFLP-fragment BT... 153 9e-34
208gb|M16887.1|SIPCAB White campion chlorophyll a/b-binding protein... 153 9e-34
209gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein... 151 4e-33
210gb|AF330793.1|AF330793 Chlamydomonas reinhardtii light-harvestin... 151 4e-33
211gb|K00972.1|PETCAB146 Petunia major chlorophyll a/b binding prot... 151 4e-33
212gb|AF104631.3| Chlamydomonas reinhardtii light harvesting comple... 149 1e-32
213emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Co... 149 1e-32
214emb|X16535.1|GMCAB4 G.max DNA for Cab4 149 1e-32
215gb|AF495473.1| Chlamydomonas reinhardtii major light-harvesting ... 147 6e-32
216emb|X63197.1|HVLHBC H.vulgare lhbC mRNA for type III LHCII CAB p... 147 6e-32
217dbj|AB051206.1| Chlamydomonas reinhardtii gene for light-harvest... 147 6e-32
218ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll bindin... 143 9e-31
219gb|AF339687.1| Arabidopsis thaliana putative photosystem II type... 143 9e-31
220gb|AF326864.1| Arabidopsis thaliana putative photosystem II type... 143 9e-31
221gb|AY120776.1| Arabidopsis thaliana putative photosystem II type... 143 9e-31
222gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430... 143 9e-31
223emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Co... 143 9e-31
224emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Co... 143 9e-31
225gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete s... 143 9e-31
226emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II ... 143 9e-31
227gb|BT002103.1| Arabidopsis thaliana putative photosystem II type... 143 9e-31
228gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence 141 4e-30
229gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding... 141 4e-30
230emb|X68333.1|HHLHC H.helix mRNA for light harvesting chlorophyll... 141 4e-30
231gb|U01964.1|GMU01964 Glycine max cv. Dare photosystem II type I ... 141 4e-30
232dbj|AB012639.1| Nicotiana sylvestris Lhcb1*7 gene for light harv... 141 4e-30
233emb|Z49749.1|PMLHCABBP P.menziesii mRNA for light-harvesting chl... 139 1e-29
234dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chloro... 137 6e-29
235gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence 135 2e-28
236gb|M21396.1|SOYCBPA Soybean light-harvesting chlorophyll a/b-bin... 135 2e-28
237gb|M24072.1|CRECABA C.reinhardtii encoding chlorophyll a/b-bindi... 135 2e-28
238ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BIND... 133 9e-28
239gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-bin... 133 9e-28
240gb|AY050935.1| Arabidopsis thaliana putative photosystem II type... 133 9e-28
241gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 133 9e-28
242gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 m... 133 9e-28
243gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 133 9e-28
244emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Co... 133 9e-28
245emb|BX819530.1|CNS0A9V8 Arabidopsis thaliana Full-length cDNA Co... 133 9e-28
246gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P... 133 9e-28
247gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N... 133 9e-28
248emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding ... 131 3e-27
249emb|X61915.1|PTCABP P.thunbergii cab gene 131 3e-27
250emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b... 131 3e-27
251gb|AF162200.1|AF162200 Lactuca sativa light-harvesting chlorophy... 131 3e-27
252ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding ... 129 1e-26
253gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472)... 129 1e-26
254gb|AY128345.1| Arabidopsis thaliana photosystem II type I chloro... 129 1e-26
255dbj|AB236867.1| Panax ginseng cab mRNA for chlorophyll a/b bindi... 129 1e-26
256gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 129 1e-26
257gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 129 1e-26
258gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 129 1e-26
259gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 129 1e-26
260gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 129 1e-26
261emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Co... 129 1e-26
262emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophy... 129 1e-26
263ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BIND... 127 5e-26
264gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 127 5e-26
265gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 127 5e-26
266emb|BX814757.1|CNS0AEAM Arabidopsis thaliana Full-length cDNA Co... 127 5e-26
267emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Co... 127 5e-26
268emb|AJ538464.1|NTA538464 Nicotiana tabacum cDNA-AFLP-fragment BC... 127 5e-26
269gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence 125 2e-25
270gb|M97171.1|SOYCAB6A Glycine max chlorophyll a/b binding protein... 125 2e-25
271emb|BX817619.1|CNS0AAVV Arabidopsis thaliana Full-length cDNA Co... 125 2e-25
272emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophy... 125 2e-25
273emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophy... 125 2e-25
274gb|AF279250.1|AF279250 Vigna radiata LHCII type I chlorophyll a/... 123 8e-25
275dbj|D14002.1|LAUCAB Lettuce mRNA for light-harvesting chlorophyl... 123 8e-25
276gb|AF295639.1| Beta vulgaris chlorophyll a/b binding protein (ca... 121 3e-24
277gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding p... 121 3e-24
278gb|L36064.1|PRULHP Prunus persica (clone pAB19) light harvesting... 121 3e-24
279gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete s... 119 1e-23
280emb|AJ538874.1|NTA538874 Nicotiana tabacum cDNA-AFLP-fragment BT... 119 1e-23
281gb|K00973.1|PETCAB3 Petunia major chlorophyll a/b binding protei... 119 1e-23
282gb|AF220527.1|AF220527 Euphorbia esula chlorophyll a/b binding p... 117 5e-23
283emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding pr... 115 2e-22
284gb|DQ124219.1| Fagus sylvatica putative chlorophyll a/b-binding ... 111 3e-21
285gb|DQ355993.1| Brassica napus chlorophyll a/b binding protein (L... 109 1e-20
286emb|AJ538493.1|NTA538493 Nicotiana tabacum cDNA-AFLP-fragment BC... 109 1e-20
287emb|X12980.1|GMCAB2 Soybean Cab2 gene for minor PSII LHCII chlor... 109 1e-20
288gb|AF022738.1|AF022738 Oryza sativa chlorophyll a-b binding prot... 109 1e-20
289emb|X13407.1|PTCAB Pinus thunbergii cab mRNA for light-harvestin... 107 5e-20
290emb|X69434.1|CSCAB1 C.stellata cab1 mRNA for chlorophyll a/b bin... 105 2e-19
291dbj|AB006081.1| Fagus crenata mRNA for chlorophyll a/b-binding p... 105 2e-19
292gb|AY646197.1| Chlorella pyrenoidosa chloroplast light-harvestin... 103 8e-19
293emb|X54090.1|GHCAB G.hirsutum cab gene for chlorophyll ab bindin... 103 8e-19
294emb|Z13987.1|STCABPSII S.tuberosum gene for chlorophyll a/b-bind... 101 3e-18
295emb|X56538.1|PSCABIIC P.sativum Cab-8 gene for photosystemm II c... 101 3e-18
296gb|M86906.1|PEACHLROPH Pea (subclone AB9) Cab9 gene, 3' end 101 3e-18
297gb|J01253.1|PEACAB15 Pea major chlorophyll a/b-binding thylakoid... 101 3e-18
298gb|AY845253.1| Pisum sativum light-harvesting chlorophyll-a/b bi... 100 1e-17
299emb|X61361.1|EGLHCAB E.gracilis gene for light harvesting chloro... 100 1e-17
300gb|M37489.1|PINCABII2 Pinus sylvestris chlorophyll a/b-binding p... 100 1e-17
301emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-bi... 100 1e-17
302gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protei... 96 2e-16
303gb|AC139600.16| Medicago truncatula clone mth2-20m4, complete se... 96 2e-16
304gb|AF312227.1|AF312227 Citrus reticulata light-harvesting chloro... 96 2e-16
305gb|AF039598.1| Prunus persica light harvesting chlorophyll A/B b... 96 2e-16
306gb|AF139465.2|AF139465 Vigna radiata LHCII type III chlorophyll ... 96 2e-16
307emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/... 94 7e-16
308dbj|AP006706.1| Lotus japonicus genomic DNA, chromosome 3, clone... 94 7e-16
309emb|AJ000765.1|CRAJ765 Chlamydomonas reinhardtii mRNA for calret... 92 3e-15
310gb|AF195221.1|AF195221 Pyrus pyrifolia strain Whangkeumbae chlor... 92 3e-15
311emb|Z35160.1|STCHLABP S.tuberosum gene for chlorophyll a/b bindi... 92 3e-15
312gb|AY786530.1| Haematococcus pluvialis chloroplast major light-h... 90 1e-14
313gb|U21115.1|STU21115 Solanum tuberosum chlorophyll a/b binding p... 90 1e-14
314emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll ... 90 1e-14
315gb|M34396.1|PMJCABF3 Polystichum munitum chlorophyll a/b-binding... 90 1e-14
316emb|AJ538488.1|NTA538488 Nicotiana tabacum cDNA-AFLP-fragment BC... 88 5e-14
317emb|X74731.1|AHLHCB A.hypochondriacus Lhcb1*Ah1 mRNA 88 5e-14
318gb|M15214.1|TOMCBPH Tomato chlorophyll a/b-binding protein gene ... 88 5e-14
319gb|M17558.1|TOMCAB4A Tomato Cab-4 gene encoding chlorophyll a/b-... 88 5e-14
320gb|M60049.1|DUNCAB D.tertiolecta 28.5-kDa LHCII apoprotein mRNA,... 86 2e-13
321dbj|AB050125.1| Amaranthus tricolor cab1b mRNA for type I chloro... 86 2e-13
322emb|X63052.1|HVCP29 Hordeum vulgare gene for CP29 precursor for ... 84 7e-13
323emb|X17697.1|MDCHBP Apple light-harvesting chlorophyll a/b bindi... 84 7e-13
324emb|X04966.1|PHCAB37 Petunia Cab gene for chlorophyll a/b bindin... 84 7e-13
325gb|M64619.1|PEACAB66 Pea cab gene, complete cds 84 7e-13
326gb|K02067.1|PEACAB80 Pea (P.sativum) gene AB80 encoding major li... 84 7e-13
327gb|AY818400.1| Manihot esculenta chloroplast chlorophyll A/B bin... 82 3e-12
328gb|AY105650.1| Zea mays PCO135935 mRNA sequence 82 3e-12
329gb|U23189.1|ZMU23189 Zea mays chlorophyll a/b-binding apoprotein... 82 3e-12
330gb|U23188.1|ZMU23188 Zea mays chlorophyll a/b-binding apoprotein... 82 3e-12
331gb|DQ460158.1| Nicotiana tabacum cDNA-AFLP fragment H-N_BC4M24-1... 80 1e-11
332gb|AY433957.1| Pyrus communis chlorophyll a/b-binding protein mR... 80 1e-11
333gb|DQ226725.1| Boechera divaricarpa isolate SLW-A-F06 mRNA sequence 78 4e-11
334gb|AF417304.1| Castanea sativa putative chlorophyll-A-B-binding ... 78 4e-11
335emb|BX814964.1|CNS0AE8Q Arabidopsis thaliana Full-length cDNA Co... 78 4e-11
336gb|AY554168.1| Nicotiana tabacum chloroplast chlorophyll a-b bin... 78 4e-11
337gb|DQ471302.1| Carya cathayensis putative chloroplast chlorophyl... 76 2e-10
338gb|DQ185425.1| Rosa roxburghii clone C40 defense-related mRNA, p... 76 2e-10
339emb|X74732.1|AHLHAH A.hypochondriacus Lhcb2*Ah1 mRNA 76 2e-10
340dbj|AP008949.1| Lotus japonicus genomic DNA, chromosome 2, clone... 76 2e-10
341gb|M23531.1|DUNCBP D.salina major chlorophyll binding protein mR... 76 2e-10
342gb|AY855171.1| Eleusine coracana subsp. coracana clone 1 light h... 74 7e-10
343gb|M17559.1|TOMCAB5A Tomato Cab-5 gene encoding chlorophyll a/b-... 74 7e-10
344emb|AJ539048.1|NTA539048 Nicotiana tabacum cDNA-AFLP-fragment BT... 72 3e-09
345gb|U51634.1|PPU51634 Pinus palustris type 2 light-harvesting chl... 72 3e-09
346gb|L29644.1|EGRLHCPII Euglena gracilis chlorophyll a/b binding p... 72 3e-09
347gb|M95068.1|MZEORFI Zea mays putative light-harvesting chlorophy... 72 3e-09
348ref|NM_126537.2| Arabidopsis thaliana LHCB2.2; chlorophyll bindi... 70 1e-08
349ref|NM_001036246.1| Arabidopsis thaliana ATP binding / kinase/ p... 70 1e-08
350gb|AY093372.1| Arabidopsis thaliana putative chlorophyll a/b bin... 70 1e-08
351gb|AC007211.6| Arabidopsis thaliana chromosome 2 BAC F1O13 genom... 70 1e-08
352gb|AY066036.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, com... 70 1e-08
353gb|AY062563.1| Arabidopsis thaliana putative chlorophyll a/b bin... 70 1e-08
354gb|AY054218.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, com... 70 1e-08
355emb|BX819347.1|CNS0A9RX Arabidopsis thaliana Full-length cDNA Co... 70 1e-08
356emb|BX820206.1|CNS0A9D7 Arabidopsis thaliana Full-length cDNA Co... 70 1e-08
357emb|BX820202.1|CNS0A9FS Arabidopsis thaliana Full-length cDNA Co... 70 1e-08
358emb|BX819668.1|CNS0A9CZ Arabidopsis thaliana Full-length cDNA Co... 70 1e-08
359emb|BX819509.1|CNS0A82Q Arabidopsis thaliana Full-length cDNA Co... 70 1e-08
360gb|AF134123.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.2) mRNA... 70 1e-08
361gb|AF134122.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.1) mRNA... 70 1e-08
362gb|U03392.1|EGU03392 Euglena gracilis var. bacillaris PSII chlor... 70 1e-08
363gb|AF279248.1|AF279248 Vigna radiata LHCII type II chlorophyll a... 68 4e-08
364dbj|AB050007.2| Chlamydomonas reinhardtii lhcb5 mRNA for CP26, c... 68 4e-08
365emb|X58230.1|NTCAB36 Tobacco CAB36 gene for chlorophyll a/b bind... 68 4e-08
366dbj|AB050123.1| Amaranthus tricolor cab1a mRNA for type I chloro... 68 4e-08
367gb|AC135460.3| Oryza sativa (japonica cultivar-group) chromosome... 66 2e-07
368gb|AY267624.1| Bigelowiella natans chlorophyll a/b-binding prote... 66 2e-07
369dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 66 2e-07
370dbj|AK104824.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 2e-07
371dbj|AK098872.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 2e-07
372dbj|AK061295.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 2e-07
373gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 66 2e-07
374gb|AY219853.1| Nicotiana tabacum chlorophyll a/b binding protein... 64 7e-07
375emb|X06602.1|EGLHCPAB Euglena gracilis mRNA for light harvesting... 64 7e-07
376dbj|AU066541.1| Chlamydomonas sp. HS-5 mRNA for hypothetical pro... 64 7e-07
377ref|NM_126540.2| Arabidopsis thaliana LHCB2.1; chlorophyll bindi... 62 3e-06
378gb|BT012757.1| Lycopersicon esculentum clone 113701F, mRNA sequence 62 3e-06
379gb|AY045787.1| Arabidopsis thaliana At2g05100 mRNA sequence 62 3e-06
380gb|AC007443.5| Arabidopsis thaliana chromosome 2 clone F15L11 ma... 62 3e-06
381gb|AY052348.1| Arabidopsis thaliana At2g05100/F15L11.2 mRNA, com... 62 3e-06
382gb|AY052275.1| Arabidopsis thaliana At2g05100/F15L11.2 mRNA, com... 62 3e-06
383emb|BX819843.1|CNS0A9GW Arabidopsis thaliana Full-length cDNA Co... 62 3e-06
384emb|BX819702.1|CNS0A9H1 Arabidopsis thaliana Full-length cDNA Co... 62 3e-06
385emb|BX819270.1|CNS0A9RF Arabidopsis thaliana Full-length cDNA Co... 62 3e-06
386emb|BX821844.1|CNS0A936 Arabidopsis thaliana Full-length cDNA Co... 62 3e-06
387emb|BX821132.1|CNS0A9BI Arabidopsis thaliana Full-length cDNA Co... 62 3e-06
388emb|BX819861.1|CNS0A9DS Arabidopsis thaliana Full-length cDNA Co... 62 3e-06
389emb|BX819751.1|CNS0A9F6 Arabidopsis thaliana Full-length cDNA Co... 62 3e-06
390emb|BX819688.1|CNS0A9G4 Arabidopsis thaliana Full-length cDNA Co... 62 3e-06
391emb|BX819687.1|CNS0A9G3 Arabidopsis thaliana Full-length cDNA Co... 62 3e-06
392emb|BX819683.1|CNS0A80L Arabidopsis thaliana Full-length cDNA Co... 62 3e-06
393emb|BX842010.1|CNS09YA7 Arabidopsis thaliana Full-length cDNA Co... 62 3e-06
394gb|AF134124.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.3) mRNA... 62 3e-06
395gb|BT001933.1| Arabidopsis thaliana clone C105385 putative chlor... 62 3e-06
396dbj|AB122118.1| Chlamydomonas reinhardtii LhcI-5 gene for light-... 60 1e-05
397emb|CT571263.1| Medicago truncatula chromosome 5 clone mte1-7c20... 60 1e-05
398ref|NM_124807.2| Arabidopsis thaliana LHCB3 (LIGHT-HARVESTING CH... 58 4e-05
399ref|NM_124808.3| Arabidopsis thaliana ATM2 (ARABIDOPSIS THALIANA... 58 4e-05
400gb|DQ226800.1| Boechera divaricarpa isolate SLW-B-D01 mRNA sequence 58 4e-05
401gb|AF361858.1| Arabidopsis thaliana AT5g54270/MDK4_9 mRNA, compl... 58 4e-05
402gb|AY057735.1| Arabidopsis thaliana AT5g54270/MDK4_9 mRNA, compl... 58 4e-05
403gb|AF398746.1|AF398746 Carlquistia muirii ASCAB9 (ASCAB9) gene, ... 58 4e-05
404gb|AF398740.1|AF398740 Wilkesia gymnoxiphium ASCAB9-B (ASCAB9-B)... 58 4e-05
405gb|AF372917.1|AF372917 Arabidopsis thaliana AT5g54270/MDK4_9 mRN... 58 4e-05
406emb|BX831260.1|CNS09ZEV Arabidopsis thaliana Full-length cDNA Co... 58 4e-05
407emb|BX831139.1|CNS09ZGL Arabidopsis thaliana Full-length cDNA Co... 58 4e-05
408gb|AF134126.1| Arabidopsis thaliana chromosome V Lhcb3 protein (... 58 4e-05
409dbj|AB010695.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 58 4e-05
410gb|AF143691.1|AF143691 Arabidopsis thaliana type III chlorophyll... 58 4e-05
411dbj|D85512.1| Oryza sativa (japonica cultivar-group) CP26 mRNA, ... 58 4e-05
412gb|BT013404.1| Lycopersicon esculentum clone 135718R, mRNA sequence 56 2e-04
413emb|AJ538915.1|NTA538915 Nicotiana tabacum cDNA-AFLP-fragment BT... 56 2e-04
414emb|X60275.1|LELHBC1G L.esculentum lhbC1 gene for LHCII type III 56 2e-04
415emb|X73540.1|MSLHC13 M.squamata Lhc1*3 mRNA for chlorophyll a/b/... 56 2e-04
416emb|X73539.1|MSLHC14 M.squamata Lhc1*4 mRNA for chlorophyll a/b/... 56 2e-04
417gb|AY104614.1| Zea mays PCO084486 mRNA sequence 56 2e-04
418gb|M30397.1|PMJCABF8 Polystichum munitum chlorophyll a/b-binding... 56 2e-04
419gb|M30395.1|PMJCABF6 Polystichum munitum chlorophyll a/b-binding... 56 2e-04
420emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Co... 54 6e-04
421emb|Z22782.1|MSCHLABA M.squamata chlorophyll a/b binding protein... 54 6e-04
422emb|AJ308530.2|RSP308530 Rhodomonas sp. CS24 lhcc1 gene (partial... 54 6e-04
423gb|L15738.1|MNTCPCABBP Mantoniella squamata chloroplast photosyn... 54 6e-04
424dbj|AB050126.1| Amaranthus tricolor cab3 mRNA for type III chlor... 54 6e-04
425gb|AY845254.1| Pisum sativum light-harvesting chlorophyll-a/b bi... 52 0.003
426gb|AF104633.2| Chlamydomonas reinhardtii light harvesting comple... 52 0.003
427gb|AY267623.1| Bigelowiella natans chlorophyll a/b-binding prote... 52 0.003
428gb|AF268321.1|AF268321 Chlorarachnion CCMP621 light-harvesting c... 52 0.003
429gb|AF268320.1|AF268320 Chlorarachnion CCMP621 light-harvesting c... 52 0.003
430gb|AF268319.1|AF268319 Chlorarachnion CCMP621 light-harvesting c... 52 0.003
431gb|AF195794.1|AF195794 Chlamydomonas reinhardtii chlorophyll A-B... 52 0.003
432dbj|AB122119.1| Chlamydomonas reinhardtii LhcI-6 gene for light-... 52 0.003
433emb|Z29965.1|TRLHCABBP T.repens (Huia) mRNA for light-harvesting... 52 0.003
434emb|X65119.1|CRCABI1MR C.reinhardtii cabI-1 mRNA for light harve... 52 0.003
435emb|X57082.1|PSCABII P.sativum Cab II gene for chlorophyll a/b-b... 52 0.003
436gb|AY105356.1| Zea mays PCO075138 mRNA sequence 52 0.003
437emb|X61610.1|BNLHCB3C B.napus gene for LHCII Type III chlorophyl... 50 0.010
438gb|AF517869.1| Griffithsia japonica isolate Gj446 light-harvest ... 50 0.010
439gb|AF398742.1|AF398742 Centromadia pungens ASCAB9 (ASCAB9) gene,... 50 0.010
440gb|AF398738.1|AF398738 Dubautia plantaginea ASCAB9-B (ASCAB9-B) ... 50 0.010
441gb|AF398735.1|AF398735 Dubautia laevigata ASCAB9-B (ASCAB9-B) ge... 50 0.010
442gb|AF398733.1|AF398733 Argyroxiphium sandwicense ASCAB9-B (ASCAB... 50 0.010
443gb|AF398732.1|AF398732 Argyroxiphium caliginis ASCAB9-B (ASCAB9-... 50 0.010
444emb|BX830083.1|CNS0A1XR Arabidopsis thaliana Full-length cDNA Co... 50 0.010
445dbj|AP004756.2| Oryza sativa (japonica cultivar-group) genomic D... 50 0.010
446dbj|AK066997.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.010
447gb|AY845255.1| Pisum sativum light-harvesting chlorophyll-a/b bi... 48 0.040
448dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.040
449dbj|AP003511.3| Oryza sativa (japonica cultivar-group) genomic D... 48 0.040
450emb|X69525.1|MSCABC2 M.squamata cabc2 mRNA for chlorophyll a/b/c... 48 0.040
451emb|X69215.1|PSLHCB31G P.sativum Lhcb3 gene for chlorophyll a/b-... 48 0.040
452dbj|AK098864.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.040
453dbj|AK060904.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.040
454dbj|AK060800.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.040
455gb|AF094776.1|AF094776 Oryza sativa chlorophyll a/b-binding prot... 48 0.040
456emb|AL939126.1|SCO939126 Streptomyces coelicolor A3(2) complete ... 46 0.16
457emb|AJ821839.1| Guillardia theta partial mRNA for light harvesti... 46 0.16
458emb|AJ821820.1| Guillardia theta partial mRNA for light harvesti... 46 0.16
459emb|AJ821811.1| Guillardia theta partial mRNA for light harvesti... 46 0.16
460gb|AF398747.1|AF398747 Anisocarpus scabridus ASCAB9 (ASCAB9) gen... 46 0.16
461gb|AF398745.1|AF398745 Osmadenia tenella ASCAB9 (ASCAB9) gene, e... 46 0.16
462gb|AF398744.1|AF398744 Madia nutans ASCAB9 (ASCAB9) gene, exons ... 46 0.16
463gb|AF398743.1|AF398743 Deinandra lobbii ASCAB9 (ASCAB9) gene, ex... 46 0.16
464gb|AF398741.1|AF398741 Wilkesia gymnoxiphium ASCAB9-C (ASCAB9-C)... 46 0.16
465gb|AF398739.1|AF398739 Dubautia scabra ASCAB9-C (ASCAB9-C) gene,... 46 0.16
466gb|AF398737.1|AF398737 Dubautia laxa ASCAB9-C (ASCAB9-C) gene, e... 46 0.16
467gb|AF398736.1|AF398736 Dubautia latifolia ASCAB9-C (ASCAB9-C) ge... 46 0.16
468gb|AF398734.1|AF398734 Argyroxiphium sandwicense ASCAB9-C (ASCAB... 46 0.16
469gb|AF398731.1|AF398731 Wilkesia gymnoxiphium ASCAB9-A (ASCAB9-A)... 46 0.16
470gb|AF398730.1|AF398730 Dubautia sherffiana ASCAB9-A (ASCAB9-A) g... 46 0.16
471gb|AF398729.1|AF398729 Dubautia raillardioides ASCAB9-A (ASCAB9-... 46 0.16
472gb|AF398728.1|AF398728 Dubautia plantaginea ASCAB9-A (ASCAB9-A) ... 46 0.16
473gb|AF398727.1|AF398727 Dubautia laxa ASCAB9-A (ASCAB9-A) gene, e... 46 0.16
474gb|AF398726.1|AF398726 Dubautia latifolia ASCAB9-A (ASCAB9-A) ge... 46 0.16
475gb|AF398725.1|AF398725 Dubautia laevigata ASCAB9-A (ASCAB9-A) ge... 46 0.16
476gb|AF398724.1|AF398724 Argyroxiphium sandwicense ASCAB9-A (ASCAB... 46 0.16
477gb|AF398723.1|AF398723 Argyroxiphium caliginis ASCAB9-A (ASCAB9-... 46 0.16
478gb|AF207690.1|AF207690 Daucus carota cultivar Kurodagosun chloro... 46 0.16
479emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple... 46 0.16
480gb|AY954738.1| Ostreococcus tauri chloroplast chlorophyll a/b-bi... 44 0.62
481gb|AY954735.1| Ostreococcus tauri chloroplast light-harvesting c... 44 0.62
482gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome 44 0.62
483gb|DQ455591.1| Phaseolus vulgaris chloroplast chlorophyll a/b bi... 44 0.62
484gb|AC003084.1| Homo sapiens BAC clone CTB-84D4 from 7, complete ... 44 0.62
485emb|BX842574.1| Mycobacterium tuberculosis H37Rv complete genome... 44 0.62
486emb|BX248336.1| Mycobacterium bovis subsp. bovis AF2122/97 compl... 44 0.62
487gb|DQ356257.1| Homo sapiens isolate cftr10471_A cystic fibrosis ... 44 0.62
488gb|DP000025.1| Gorilla gorilla gorilla target 1 genomic scaffold 44 0.62
489gb|AF001452.1| Zea mays chlorophyll a/b binding protein-like seq... 44 0.62
490emb|X61609.1|BNLHCB3B B.napus gene for LHC II Type III chlorophy... 44 0.62
491dbj|AB122116.1| Chlamydomonas reinhardtii LhcI-3 gene for light-... 44 0.62
492emb|X84308.1|HVLHCA2 H.vulgare mRNA for photosysteme I antenna p... 44 0.62
493emb|X12979.1|GMCAB1P Soybean Cab1 pseudogene for chlorophyll a/b... 44 0.62
494gb|AY106149.1| Zea mays PCO102434 mRNA sequence 44 0.62
495gb|AF093617.1|AF093617 Acetabularia acetabulum clone JO-10 chlor... 44 0.62
496gb|U66108.1|MTU66108 Mycobacterium tuberculosis methoxy mycolic ... 44 0.62
497gb|U22329.1|VCU22329 Volvox carteri light harvesting complex a m... 44 0.62
498dbj|AU066540.1| Chlamydomonas sp. HS-5 mRNA for hypothetical pro... 44 0.62
499ref|NM_197038.1| Oryza sativa (japonica cultivar-group) putative... 42 2.5
500gb|AY954742.1| Ostreococcus tauri chloroplast prasinophyte chlor... 42 2.5 
>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds
          Length = 1044

 Score =  900 bits (454), Expect = 0.0
 Identities = 550/582 (94%)
 Strand = Plus / Minus

                                                                       
Query: 124 agcttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 183
           |||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||
Sbjct: 867 agcttacttgccgggcacgaagttggtggcgaaggcccaggcgttgttgttgacggggtc 808

                                                                       
Query: 184 ggcaaggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaa 243
           ||  |||||||||||||||||||| |  ||||||||||| ||||| ||||||||||||||
Sbjct: 807 ggagaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctgcacgaa 748

                                                                       
Query: 244 aaagccgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctc 303
            ||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 747 gaagccgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctc 688

                                                                       
Query: 304 ggcgaacgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagag 363
            ||||||||||| ||||||||||| ||||| |||||||||||||| || |||||||||||
Sbjct: 687 cgcgaacgcctcagggtcgtcggcaaggcccagggggtcgaagctgccgccggggtagag 628

                                                                       
Query: 364 ggggtcgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccat 423
            ||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||
Sbjct: 627 cgggtcgacgatctcgccgagcgggccgccggcgacgcggtacccctcgacggcgcccat 568

                                                                       
Query: 424 gagcacgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggtt 483
           ||||||||||||||| ||||||||||||||||||||||| |||||||| |||||||||||
Sbjct: 567 gagcacgacctggcaggcccagatggcgaggatgctctgcgcgtggaccaggctggggtt 508

                                                                       
Query: 484 gccgaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggc 543
           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 507 gccgaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccacacggc 448

                                                                       
Query: 544 ctcgccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgcc 603
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 447 ctcgccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgcc 388

                                                                       
Query: 604 gagcatggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggg 663
            ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 387 cagcatggcccaccggcagtggatcacctccagctcccggttcttggcgaaggtctcggg 328

                                                     
Query: 664 gtcggcagagagccccgcagtgtcccatccgtagtcaccggg 705
           |||||| || |||||||| |||||||| |||||||| |||||
Sbjct: 327 gtcggccgacagccccgcggtgtcccacccgtagtcgccggg 286



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 33/36 (91%), Gaps = 1/36 (2%)
 Strand = Plus / Minus

                                                
Query: 4    agtcttttgcattnaccct-cgtactttacatcatg 38
            ||||||||||||| | ||| ||||||||||||||||
Sbjct: 1005 agtcttttgcattcaaccttcgtactttacatcatg 970



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 42/49 (85%), Gaps = 4/49 (8%)
 Strand = Plus / Minus

                                                            
Query: 60  gcacacttcatcgcgtacgt----acgtgcactgtcggtttctagacac 104
           |||||||| |||||||||||    |||||||| ||||||||| ||||||
Sbjct: 926 gcacacttgatcgcgtacgtacgcacgtgcacggtcggtttccagacac 878
to top
>ref|NM_191799.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 798

 Score =  779 bits (393), Expect = 0.0
 Identities = 531/577 (92%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||| |
Sbjct: 796 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 737

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           |||||||||| |||||||||| ||| |||||||| ||||| |||||||| ||||| || |
Sbjct: 736 ggtggtcggccaggttctccagtggccccttgccggtgacgatggcctggacgaagaacc 677

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 676 cgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcggcga 617

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           |||||||||||||||||||||||||||| ||||||||||| || ||||||||||| ||||
Sbjct: 616 acgcctcggggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcgggt 557

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           |||||| |||||||||||||||||||||||| ||||| ||||||||||||||||||||||
Sbjct: 556 cgacgacctcgccgagcgggccgccggcgacgcggtacccctcgacggcgcccatgagca 497

                                                                       
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
           ||||||||||| ||||||| || ||||||||||| |||||||  ||||||||||||||||
Sbjct: 496 cgacctggcaaccccagatcgccaggatgctctgcgcgtggatcaggctggggttgccga 437

                                                                       
Query: 489 ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
           |||||||||| || |||||||||||||||||||| || ||||||||||| ||||||||||
Sbjct: 436 ggtagtcgagccccccctcgctgaagatctgggaccccgccttgaaccacacggcctcgc 377

                                                                       
Query: 549 cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
           ||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||| ||||
Sbjct: 376 cgaacttcacgccgttgcgggcgaggagctccgggaagacgcagccgagcgcgcccagca 317

                                                                       
Query: 609 tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
           ||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||||
Sbjct: 316 tggcccaccggcagtggatcacctccagctcccggttcttggcgaacgtctccgggtcgg 257

                                                
Query: 669 cagagagccccgcagtgtcccatccgtagtcaccggg 705
           | || ||||| || |||||||| |||||||| |||||
Sbjct: 256 ccgacagcccggcggtgtcccagccgtagtcgccggg 220
to top
>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase
             IV-1 gene, complete cds
          Length = 15000

 Score =  779 bits (393), Expect = 0.0
 Identities = 531/577 (92%)
 Strand = Plus / Plus

                                                                         
Query: 129   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
             |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||| |
Sbjct: 13878 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 13937

                                                                         
Query: 189   ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             |||||||||| |||||||||| ||| |||||||| ||||| |||||||| ||||| || |
Sbjct: 13938 ggtggtcggccaggttctccagtggccccttgccggtgacgatggcctggacgaagaacc 13997

                                                                         
Query: 249   cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
             ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 13998 cgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcggcga 14057

                                                                         
Query: 309   acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
             |||||||||||||||||||||||||||| ||||||||||| || ||||||||||| ||||
Sbjct: 14058 acgcctcggggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcgggt 14117

                                                                         
Query: 369   cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
             |||||| |||||||||||||||||||||||| ||||| ||||||||||||||||||||||
Sbjct: 14118 cgacgacctcgccgagcgggccgccggcgacgcggtacccctcgacggcgcccatgagca 14177

                                                                         
Query: 429   cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
             ||||||||||| ||||||| || ||||||||||| |||||||  ||||||||||||||||
Sbjct: 14178 cgacctggcaaccccagatcgccaggatgctctgcgcgtggatcaggctggggttgccga 14237

                                                                         
Query: 489   ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
             |||||||||| || |||||||||||||||||||| || ||||||||||| ||||||||||
Sbjct: 14238 ggtagtcgagccccccctcgctgaagatctgggaccccgccttgaaccacacggcctcgc 14297

                                                                         
Query: 549   cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
             ||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||| ||||
Sbjct: 14298 cgaacttcacgccgttgcgggcgaggagctccgggaagacgcagccgagcgcgcccagca 14357

                                                                         
Query: 609   tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
             ||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||||
Sbjct: 14358 tggcccaccggcagtggatcacctccagctcccggttcttggcgaacgtctccgggtcgg 14417

                                                  
Query: 669   cagagagccccgcagtgtcccatccgtagtcaccggg 705
             | || ||||| || |||||||| |||||||| |||||
Sbjct: 14418 ccgacagcccggcggtgtcccagccgtagtcgccggg 14454
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  779 bits (393), Expect = 0.0
 Identities = 531/577 (92%)
 Strand = Plus / Minus

                                                                            
Query: 129      acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
                |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||| |
Sbjct: 30025133 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 30025074

                                                                            
Query: 189      ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
                |||||||||| |||||||||| ||| |||||||| ||||| |||||||| ||||| || |
Sbjct: 30025073 ggtggtcggccaggttctccagtggccccttgccggtgacgatggcctggacgaagaacc 30025014

                                                                            
Query: 249      cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
                ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 30025013 cgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcggcga 30024954

                                                                            
Query: 309      acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
                |||||||||||||||||||||||||||| ||||||||||| || ||||||||||| ||||
Sbjct: 30024953 acgcctcggggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcgggt 30024894

                                                                            
Query: 369      cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
                |||||| |||||||||||||||||||||||| ||||| ||||||||||||||||||||||
Sbjct: 30024893 cgacgacctcgccgagcgggccgccggcgacgcggtacccctcgacggcgcccatgagca 30024834

                                                                            
Query: 429      cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
                ||||||||||| ||||||| || ||||||||||| |||||||  ||||||||||||||||
Sbjct: 30024833 cgacctggcaaccccagatcgccaggatgctctgcgcgtggatcaggctggggttgccga 30024774

                                                                            
Query: 489      ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
                |||||||||| || |||||||||||||||||||| || ||||||||||| ||||||||||
Sbjct: 30024773 ggtagtcgagccccccctcgctgaagatctgggaccccgccttgaaccacacggcctcgc 30024714

                                                                            
Query: 549      cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
                ||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||| ||||
Sbjct: 30024713 cgaacttcacgccgttgcgggcgaggagctccgggaagacgcagccgagcgcgcccagca 30024654

                                                                            
Query: 609      tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
                ||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||||
Sbjct: 30024653 tggcccaccggcagtggatcacctccagctcccggttcttggcgaacgtctccgggtcgg 30024594

                                                     
Query: 669      cagagagccccgcagtgtcccatccgtagtcaccggg 705
                | || ||||| || |||||||| |||||||| |||||
Sbjct: 30024593 ccgacagcccggcggtgtcccagccgtagtcgccggg 30024557



 Score =  716 bits (361), Expect = 0.0
 Identities = 523/577 (90%)
 Strand = Plus / Minus

                                                                            
Query: 129      acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
                |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||| |
Sbjct: 23604327 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 23604268

                                                                            
Query: 189      ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
                ||||||||||||||||||| |  ||||||||||| ||||| |||||||| ||||| ||||
Sbjct: 23604267 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagc 23604208

                                                                            
Query: 249      cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
                ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||
Sbjct: 23604207 cgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgcga 23604148

                                                                            
Query: 309      acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
                | ||||| |||||||||||||||||||| ||||||||||| || ||||||||||| ||||
Sbjct: 23604147 aggcctccgggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcgggt 23604088

                                                                            
Query: 369      cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
                |||||| |||||||||||| ||||||||||  ||||| ||||||||||||||||||||||
Sbjct: 23604087 cgacgacctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgagca 23604028

                                                                            
Query: 429      cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
                | ||||||   ||||||||||||||||||||||| |||||||  ||||| ||||||||||
Sbjct: 23604027 ccacctggaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccga 23603968

                                                                            
Query: 489      ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
                |||||||||| |||||||||||||||||||| || || ||||||||||| || |||||||
Sbjct: 23603967 ggtagtcgagcccgccctcgctgaagatctgcgaccccgccttgaaccacaccgcctcgc 23603908

                                                                            
Query: 549      cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
                ||||||||||||||||||||||||| ||||| ||||| |||||||| |||||||||||||
Sbjct: 23603907 cgaacttgacgccgttgcgggcgaggagctccgggaacacgcagcccagcgcgccgagca 23603848

                                                                            
Query: 609      tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
                | ||||||| | ||||||||||||||||||||||||||||||| || ||||| |||||||
Sbjct: 23603847 tcgcccacctggagtggatcacctccagctcccggttcttggcgaacgtctccgggtcgg 23603788

                                                     
Query: 669      cagagagccccgcagtgtcccatccgtagtcaccggg 705
                | ||||||||||| |||||||| |||||||| |||||
Sbjct: 23603787 cggagagccccgcggtgtcccacccgtagtcgccggg 23603751
to top
>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0690B02
          Length = 153116

 Score =  779 bits (393), Expect = 0.0
 Identities = 531/577 (92%)
 Strand = Plus / Minus

                                                                         
Query: 129   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
             |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||| |
Sbjct: 21123 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 21064

                                                                         
Query: 189   ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             |||||||||| |||||||||| ||| |||||||| ||||| |||||||| ||||| || |
Sbjct: 21063 ggtggtcggccaggttctccagtggccccttgccggtgacgatggcctggacgaagaacc 21004

                                                                         
Query: 249   cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
             ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 21003 cgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcggcga 20944

                                                                         
Query: 309   acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
             |||||||||||||||||||||||||||| ||||||||||| || ||||||||||| ||||
Sbjct: 20943 acgcctcggggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcgggt 20884

                                                                         
Query: 369   cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
             |||||| |||||||||||||||||||||||| ||||| ||||||||||||||||||||||
Sbjct: 20883 cgacgacctcgccgagcgggccgccggcgacgcggtacccctcgacggcgcccatgagca 20824

                                                                         
Query: 429   cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
             ||||||||||| ||||||| || ||||||||||| |||||||  ||||||||||||||||
Sbjct: 20823 cgacctggcaaccccagatcgccaggatgctctgcgcgtggatcaggctggggttgccga 20764

                                                                         
Query: 489   ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
             |||||||||| || |||||||||||||||||||| || ||||||||||| ||||||||||
Sbjct: 20763 ggtagtcgagccccccctcgctgaagatctgggaccccgccttgaaccacacggcctcgc 20704

                                                                         
Query: 549   cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
             ||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||| ||||
Sbjct: 20703 cgaacttcacgccgttgcgggcgaggagctccgggaagacgcagccgagcgcgcccagca 20644

                                                                         
Query: 609   tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
             ||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||||
Sbjct: 20643 tggcccaccggcagtggatcacctccagctcccggttcttggcgaacgtctccgggtcgg 20584

                                                  
Query: 669   cagagagccccgcagtgtcccatccgtagtcaccggg 705
             | || ||||| || |||||||| |||||||| |||||
Sbjct: 20583 ccgacagcccggcggtgtcccagccgtagtcgccggg 20547
to top
>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full
           insert sequence
          Length = 1055

 Score =  779 bits (393), Expect = 0.0
 Identities = 531/577 (92%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||| |
Sbjct: 877 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 818

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           |||||||||| |||||||||| ||| |||||||| ||||| |||||||| ||||| || |
Sbjct: 817 ggtggtcggccaggttctccagtggccccttgccggtgacgatggcctggacgaagaacc 758

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 757 cgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcggcga 698

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           |||||||||||||||||||||||||||| ||||||||||| || ||||||||||| ||||
Sbjct: 697 acgcctcggggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcgggt 638

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           |||||| |||||||||||||||||||||||| ||||| ||||||||||||||||||||||
Sbjct: 637 cgacgacctcgccgagcgggccgccggcgacgcggtacccctcgacggcgcccatgagca 578

                                                                       
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
           ||||||||||| ||||||| || ||||||||||| |||||||  ||||||||||||||||
Sbjct: 577 cgacctggcaaccccagatcgccaggatgctctgcgcgtggatcaggctggggttgccga 518

                                                                       
Query: 489 ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
           |||||||||| || |||||||||||||||||||| || ||||||||||| ||||||||||
Sbjct: 517 ggtagtcgagccccccctcgctgaagatctgggaccccgccttgaaccacacggcctcgc 458

                                                                       
Query: 549 cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
           ||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||| ||||
Sbjct: 457 cgaacttcacgccgttgcgggcgaggagctccgggaagacgcagccgagcgcgcccagca 398

                                                                       
Query: 609 tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
           ||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||||
Sbjct: 397 tggcccaccggcagtggatcacctccagctcccggttcttggcgaacgtctccgggtcgg 338

                                                
Query: 669 cagagagccccgcagtgtcccatccgtagtcaccggg 705
           | || ||||| || |||||||| |||||||| |||||
Sbjct: 337 ccgacagcccggcggtgtcccagccgtagtcgccggg 301
to top
>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full
           insert sequence
          Length = 1055

 Score =  779 bits (393), Expect = 0.0
 Identities = 531/577 (92%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||| |
Sbjct: 877 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 818

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           |||||||||| |||||||||| ||| |||||||| ||||| |||||||| ||||| || |
Sbjct: 817 ggtggtcggccaggttctccagtggccccttgccggtgacgatggcctggacgaagaacc 758

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 757 cgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcggcga 698

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           |||||||||||||||||||||||||||| ||||||||||| || ||||||||||| ||||
Sbjct: 697 acgcctcggggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcgggt 638

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           |||||| |||||||||||||||||||||||| ||||| ||||||||||||||||||||||
Sbjct: 637 cgacgacctcgccgagcgggccgccggcgacgcggtacccctcgacggcgcccatgagca 578

                                                                       
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
           ||||||||||| ||||||| || ||||||||||| |||||||  ||||||||||||||||
Sbjct: 577 cgacctggcaaccccagatcgccaggatgctctgcgcgtggatcaggctggggttgccga 518

                                                                       
Query: 489 ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
           |||||||||| || |||||||||||||||||||| || ||||||||||| ||||||||||
Sbjct: 517 ggtagtcgagccccccctcgctgaagatctgggaccccgccttgaaccacacggcctcgc 458

                                                                       
Query: 549 cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
           ||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||| ||||
Sbjct: 457 cgaacttcacgccgttgcgggcgaggagctccgggaagacgcagccgagcgcgcccagca 398

                                                                       
Query: 609 tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
           ||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||||
Sbjct: 397 tggcccaccggcagtggatcacctccagctcccggttcttggcgaacgtctccgggtcgg 338

                                                
Query: 669 cagagagccccgcagtgtcccatccgtagtcaccggg 705
           | || ||||| || |||||||| |||||||| |||||
Sbjct: 337 ccgacagcccggcggtgtcccagccgtagtcgccggg 301
to top
>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full
           insert sequence
          Length = 1057

 Score =  779 bits (393), Expect = 0.0
 Identities = 531/577 (92%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||| |
Sbjct: 879 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 820

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           |||||||||| |||||||||| ||| |||||||| ||||| |||||||| ||||| || |
Sbjct: 819 ggtggtcggccaggttctccagtggccccttgccggtgacgatggcctggacgaagaacc 760

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 759 cgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcggcga 700

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           |||||||||||||||||||||||||||| ||||||||||| || ||||||||||| ||||
Sbjct: 699 acgcctcggggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcgggt 640

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           |||||| |||||||||||||||||||||||| ||||| ||||||||||||||||||||||
Sbjct: 639 cgacgacctcgccgagcgggccgccggcgacgcggtacccctcgacggcgcccatgagca 580

                                                                       
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
           ||||||||||| ||||||| || ||||||||||| |||||||  ||||||||||||||||
Sbjct: 579 cgacctggcaaccccagatcgccaggatgctctgcgcgtggatcaggctggggttgccga 520

                                                                       
Query: 489 ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
           |||||||||| || |||||||||||||||||||| || ||||||||||| ||||||||||
Sbjct: 519 ggtagtcgagccccccctcgctgaagatctgggaccccgccttgaaccacacggcctcgc 460

                                                                       
Query: 549 cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
           ||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||| ||||
Sbjct: 459 cgaacttcacgccgttgcgggcgaggagctccgggaagacgcagccgagcgcgcccagca 400

                                                                       
Query: 609 tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
           ||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||||
Sbjct: 399 tggcccaccggcagtggatcacctccagctcccggttcttggcgaacgtctccgggtcgg 340

                                                
Query: 669 cagagagccccgcagtgtcccatccgtagtcaccggg 705
           | || ||||| || |||||||| |||||||| |||||
Sbjct: 339 ccgacagcccggcggtgtcccagccgtagtcgccggg 303
to top
>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full
           insert sequence
          Length = 1057

 Score =  771 bits (389), Expect = 0.0
 Identities = 530/577 (91%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||| |
Sbjct: 879 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 820

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           |||||||||| |||||||||| ||| |||||||| ||||| |||||||| ||||| || |
Sbjct: 819 ggtggtcggccaggttctccagtggccccttgccggtgacgatggcctggacgaagaacc 760

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 759 cgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcggcga 700

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           |||||||||||||||||||||||||||| | ||||||||| || ||||||||||| ||||
Sbjct: 699 acgcctcggggtcgtcggcgaggccgagcgagtcgaagctgccgccggggtagagcgggt 640

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           |||||| |||||||||||||||||||||||| ||||| ||||||||||||||||||||||
Sbjct: 639 cgacgacctcgccgagcgggccgccggcgacgcggtacccctcgacggcgcccatgagca 580

                                                                       
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
           ||||||||||| ||||||| || ||||||||||| |||||||  ||||||||||||||||
Sbjct: 579 cgacctggcaaccccagatcgccaggatgctctgcgcgtggatcaggctggggttgccga 520

                                                                       
Query: 489 ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
           |||||||||| || |||||||||||||||||||| || ||||||||||| ||||||||||
Sbjct: 519 ggtagtcgagccccccctcgctgaagatctgggaccccgccttgaaccacacggcctcgc 460

                                                                       
Query: 549 cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
           ||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||| ||||
Sbjct: 459 cgaacttcacgccgttgcgggcgaggagctccgggaagacgcagccgagcgcgcccagca 400

                                                                       
Query: 609 tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
           ||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||||
Sbjct: 399 tggcccaccggcagtggatcacctccagctcccggttcttggcgaacgtctccgggtcgg 340

                                                
Query: 669 cagagagccccgcagtgtcccatccgtagtcaccggg 705
           | || ||||| || |||||||| |||||||| |||||
Sbjct: 339 ccgacagcccggcggtgtcccagccgtagtcgccggg 303
to top
>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein
          Length = 2100

 Score =  741 bits (374), Expect = 0.0
 Identities = 530/582 (91%)
 Strand = Plus / Minus

                                                                        
Query: 124  agcttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 183
            |||||| |||||||| || |||||||||||| ||||||| |||||||||||||| |||||
Sbjct: 1683 agcttagttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgactgggtc 1624

                                                                        
Query: 184  ggcaaggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaa 243
             || | |||||| ||||||||||| |  ||||||||||| ||||| |||||||| |||||
Sbjct: 1623 agcgatgtggtcagcgaggttctcgagcgggcccttgccggtgacgatggcctggacgaa 1564

                                                                        
Query: 244  aaagccgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctc 303
             |||||||||||||| |||||||| ||||| |||||||||| ||||||||||||||||||
Sbjct: 1563 gaagccgaacatggaaaacatggcgaggcggccgttcttgagctccttcaccttgagctc 1504

                                                                        
Query: 304  ggcgaacgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagag 363
            |||||| ||||||||||||||||| |||||||||||||||||||| || || ||||| ||
Sbjct: 1503 ggcgaaggcctcggggtcgtcggccaggccgagggggtcgaagctgccgccagggtacag 1444

                                                                        
Query: 364  ggggtcgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccat 423
             |||||||||| |||||||||||| |||||||| |  ||||||||||||||||| |||||
Sbjct: 1443 cgggtcgacgacctcgccgagcggcccgccggcaatgcggtagccctcgacggcacccat 1384

                                                                        
Query: 424  gagcacgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggtt 483
            ||||||||||||||| ||||||||||||||||||||||| |||||||  |||||||||||
Sbjct: 1383 gagcacgacctggcaggcccagatggcgaggatgctctgcgcgtggatcaggctggggtt 1324

                                                                        
Query: 484  gccgaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggc 543
            |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1323 gccgaggtagtccagcccgccctcgctgaagatctgggagccggccttgaaccagacggc 1264

                                                                        
Query: 544  ctcgccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgcc 603
            |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 1263 ctcgccgaacttgacgccgttgcgggagagcagctcggggaagacgcagccgagcgcgcc 1204

                                                                        
Query: 604  gagcatggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggg 663
            |||||||||||| ||| ||||||||||||||||||| ||||||||||| || ||||||||
Sbjct: 1203 gagcatggcccagcgggagtggatcacctccagctcgcggttcttggcgaatgtctcggg 1144

                                                      
Query: 664  gtcggcagagagccccgcagtgtcccatccgtagtcaccggg 705
            |||||| || ||||| || |||||||| |||||||| |||||
Sbjct: 1143 gtcggcggacagcccggcggtgtcccagccgtagtcgccggg 1102
to top
>ref|NM_192636.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 789

 Score =  716 bits (361), Expect = 0.0
 Identities = 523/577 (90%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||| |
Sbjct: 784 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 725

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           ||||||||||||||||||| |  ||||||||||| ||||| |||||||| ||||| ||||
Sbjct: 724 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagc 665

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||
Sbjct: 664 cgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgcga 605

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           | ||||| |||||||||||||||||||| ||||||||||| || ||||||||||| ||||
Sbjct: 604 aggcctccgggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcgggt 545

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           |||||| |||||||||||| ||||||||||  ||||| ||||||||||||||||||||||
Sbjct: 544 cgacgacctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgagca 485

                                                                       
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
           | ||||||   ||||||||||||||||||||||| |||||||  ||||| ||||||||||
Sbjct: 484 ccacctggaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccga 425

                                                                       
Query: 489 ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
           |||||||||| |||||||||||||||||||| || || ||||||||||| || |||||||
Sbjct: 424 ggtagtcgagcccgccctcgctgaagatctgcgaccccgccttgaaccacaccgcctcgc 365

                                                                       
Query: 549 cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
           ||||||||||||||||||||||||| ||||| ||||| |||||||| |||||||||||||
Sbjct: 364 cgaacttgacgccgttgcgggcgaggagctccgggaacacgcagcccagcgcgccgagca 305

                                                                       
Query: 609 tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
           | ||||||| | ||||||||||||||||||||||||||||||| || ||||| |||||||
Sbjct: 304 tcgcccacctggagtggatcacctccagctcccggttcttggcgaacgtctccgggtcgg 245

                                                
Query: 669 cagagagccccgcagtgtcccatccgtagtcaccggg 705
           | ||||||||||| |||||||| |||||||| |||||
Sbjct: 244 cggagagccccgcggtgtcccacccgtagtcgccggg 208
to top
>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0518F01
          Length = 154541

 Score =  716 bits (361), Expect = 0.0
 Identities = 523/577 (90%)
 Strand = Plus / Minus

                                                                         
Query: 129   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
             |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||| |
Sbjct: 67026 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 66967

                                                                         
Query: 189   ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             ||||||||||||||||||| |  ||||||||||| ||||| |||||||| ||||| ||||
Sbjct: 66966 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagc 66907

                                                                         
Query: 249   cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
             ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||
Sbjct: 66906 cgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgcga 66847

                                                                         
Query: 309   acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
             | ||||| |||||||||||||||||||| ||||||||||| || ||||||||||| ||||
Sbjct: 66846 aggcctccgggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcgggt 66787

                                                                         
Query: 369   cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
             |||||| |||||||||||| ||||||||||  ||||| ||||||||||||||||||||||
Sbjct: 66786 cgacgacctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgagca 66727

                                                                         
Query: 429   cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
             | ||||||   ||||||||||||||||||||||| |||||||  ||||| ||||||||||
Sbjct: 66726 ccacctggaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccga 66667

                                                                         
Query: 489   ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
             |||||||||| |||||||||||||||||||| || || ||||||||||| || |||||||
Sbjct: 66666 ggtagtcgagcccgccctcgctgaagatctgcgaccccgccttgaaccacaccgcctcgc 66607

                                                                         
Query: 549   cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
             ||||||||||||||||||||||||| ||||| ||||| |||||||| |||||||||||||
Sbjct: 66606 cgaacttgacgccgttgcgggcgaggagctccgggaacacgcagcccagcgcgccgagca 66547

                                                                         
Query: 609   tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
             | ||||||| | ||||||||||||||||||||||||||||||| || ||||| |||||||
Sbjct: 66546 tcgcccacctggagtggatcacctccagctcccggttcttggcgaacgtctccgggtcgg 66487

                                                  
Query: 669   cagagagccccgcagtgtcccatccgtagtcaccggg 705
             | ||||||||||| |||||||| |||||||| |||||
Sbjct: 66486 cggagagccccgcggtgtcccacccgtagtcgccggg 66450
to top
>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full
           insert sequence
          Length = 1180

 Score =  716 bits (361), Expect = 0.0
 Identities = 523/577 (90%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||| |
Sbjct: 855 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 796

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           ||||||||||||||||||| |  ||||||||||| ||||| |||||||| ||||| ||||
Sbjct: 795 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagc 736

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||
Sbjct: 735 cgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgcga 676

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           | ||||| |||||||||||||||||||| ||||||||||| || ||||||||||| ||||
Sbjct: 675 aggcctccgggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcgggt 616

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           |||||| |||||||||||| ||||||||||  ||||| ||||||||||||||||||||||
Sbjct: 615 cgacgacctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgagca 556

                                                                       
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
           | ||||||   ||||||||||||||||||||||| |||||||  ||||| ||||||||||
Sbjct: 555 ccacctggaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccga 496

                                                                       
Query: 489 ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
           |||||||||| |||||||||||||||||||| || || ||||||||||| || |||||||
Sbjct: 495 ggtagtcgagcccgccctcgctgaagatctgcgaccccgccttgaaccacaccgcctcgc 436

                                                                       
Query: 549 cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
           ||||||||||||||||||||||||| ||||| ||||| |||||||| |||||||||||||
Sbjct: 435 cgaacttgacgccgttgcgggcgaggagctccgggaacacgcagcccagcgcgccgagca 376

                                                                       
Query: 609 tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
           | ||||||| | ||||||||||||||||||||||||||||||| || ||||| |||||||
Sbjct: 375 tcgcccacctggagtggatcacctccagctcccggttcttggcgaacgtctccgggtcgg 316

                                                
Query: 669 cagagagccccgcagtgtcccatccgtagtcaccggg 705
           | ||||||||||| |||||||| |||||||| |||||
Sbjct: 315 cggagagccccgcggtgtcccacccgtagtcgccggg 279
to top
>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full
           insert sequence
          Length = 1126

 Score =  716 bits (361), Expect = 0.0
 Identities = 523/577 (90%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||| |
Sbjct: 854 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 795

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           ||||||||||||||||||| |  ||||||||||| ||||| |||||||| ||||| ||||
Sbjct: 794 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagc 735

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||
Sbjct: 734 cgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgcga 675

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           | ||||| |||||||||||||||||||| ||||||||||| || ||||||||||| ||||
Sbjct: 674 aggcctccgggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcgggt 615

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           |||||| |||||||||||| ||||||||||  ||||| ||||||||||||||||||||||
Sbjct: 614 cgacgacctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgagca 555

                                                                       
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
           | ||||||   ||||||||||||||||||||||| |||||||  ||||| ||||||||||
Sbjct: 554 ccacctggaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccga 495

                                                                       
Query: 489 ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
           |||||||||| |||||||||||||||||||| || || ||||||||||| || |||||||
Sbjct: 494 ggtagtcgagcccgccctcgctgaagatctgcgaccccgccttgaaccacaccgcctcgc 435

                                                                       
Query: 549 cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
           ||||||||||||||||||||||||| ||||| ||||| |||||||| |||||||||||||
Sbjct: 434 cgaacttgacgccgttgcgggcgaggagctccgggaacacgcagcccagcgcgccgagca 375

                                                                       
Query: 609 tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
           | ||||||| | ||||||||||||||||||||||||||||||| || ||||| |||||||
Sbjct: 374 tcgcccacctggagtggatcacctccagctcccggttcttggcgaacgtctccgggtcgg 315

                                                
Query: 669 cagagagccccgcagtgtcccatccgtagtcaccggg 705
           | ||||||||||| |||||||| |||||||| |||||
Sbjct: 314 cggagagccccgcggtgtcccacccgtagtcgccggg 278
to top
>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA,
           complete cds
          Length = 1022

 Score =  714 bits (360), Expect = 0.0
 Identities = 522/576 (90%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||||||||| ||||||||||||||| ||||||| ||||||||||||||||||||||| |
Sbjct: 838 acttgccggggacaaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 779

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           ||||||| | || |||||||| ||| |||||||| ||||| |||||||| || ||||| |
Sbjct: 778 ggtggtctgtgatgttctccagtggccccttgccggtgacgatggcctggacaaaaaacc 719

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           |||||||||| |||||||| ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 718 cgaacatggataacatggcgaggcggccgttcttgatctccttcaccttgagctcggcga 659

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           |||||||||||||||||||||||||||| ||||| || || || ||||||||||| ||||
Sbjct: 658 acgcctcggggtcgtcggcgaggccgagcgggtctaaactgccgccggggtagagcgggt 599

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           |||| | ||| |||||||||||||||||||| ||||| ||||||||||||||||||| ||
Sbjct: 598 cgacaacctccccgagcgggccgccggcgacgcggtacccctcgacggcgcccatgaaca 539

                                                                       
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
           ||||||||||| |||| || || ||||||||||| |||||||  ||||||||||||||||
Sbjct: 538 cgacctggcaaccccaaatcgccaggatgctctgcgcgtggatcaggctggggttgccga 479

                                                                       
Query: 489 ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
           |||||||||| || |||||||||||||||||||| || ||||||||||| ||||||||||
Sbjct: 478 ggtagtcgagccccccctcgctgaagatctgggaccccgccttgaaccacacggcctcgc 419

                                                                       
Query: 549 cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
           ||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||| ||||
Sbjct: 418 cgaacttcacgccgttgcgggcgaggagctccgggaagacgcagccgagcgcgcccagca 359

                                                                       
Query: 609 tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
           ||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||||
Sbjct: 358 tggcccaccggcagtggatcacctccagctcccggttcttggcgaacgtctccgggtcgg 299

                                               
Query: 669 cagagagccccgcagtgtcccatccgtagtcaccgg 704
           | || ||||| || |||||||| |||||||| ||||
Sbjct: 298 ccgacagcccggcggtgtcccagccgtagtcgccgg 263
to top
>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding
            protein
          Length = 2261

 Score =  712 bits (359), Expect = 0.0
 Identities = 518/571 (90%)
 Strand = Plus / Minus

                                                                        
Query: 129  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
            |||||||||| || |||||||||||| ||||||| |||||||||||||||||||||||||
Sbjct: 1808 acttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggcaa 1749

                                                                        
Query: 189  ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             |||||| ||||||||||| |  |||||||| || ||||| |||||||| ||||| || |
Sbjct: 1748 tgtggtcagcgaggttctcgagcgggcccttcccggtgacgatggcctggacgaagaatc 1689

                                                                        
Query: 249  cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
            ||||||||||||||||||| ||||| || ||||||| |||||||||||||||||| ||||
Sbjct: 1688 cgaacatggagaacatggcgaggcggcccttcttgagctccttcaccttgagctcagcga 1629

                                                                        
Query: 309  acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
            | ||||||||||||||||||||||| || ||||||||||| || ||||| ||||| ||||
Sbjct: 1628 aggcctcggggtcgtcggcgaggcccagcgggtcgaagctgccgccgggatagagcgggt 1569

                                                                        
Query: 369  cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
            |||||| |||||||||||||||||||||||  ||||||||||||||||||||||||||||
Sbjct: 1568 cgacgacctcgccgagcgggccgccggcgatgcggtagccctcgacggcgcccatgagca 1509

                                                                        
Query: 429  cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
            |||||||||| ||||||||||||||||||||||| ||||||| |||||| ||||| ||||
Sbjct: 1508 cgacctggcaggcccagatggcgaggatgctctgcgcgtggatgaggctcgggttcccga 1449

                                                                        
Query: 489  ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
            ||||||| || || ||||||||||||||||||||||||||||||||||  ||||||||||
Sbjct: 1448 ggtagtccagtccaccctcgctgaagatctgggagccggccttgaacccaacggcctcgc 1389

                                                                        
Query: 549  cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
            ||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| ||||
Sbjct: 1388 cgaacttgacgccgttgcgggcgagcagctccgggaagacgcaaccgagcgcgcccagca 1329

                                                                        
Query: 609  tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
            ||||||| ||| ||||||||||||||||||||||||||||||| || ||||| ||||| |
Sbjct: 1328 tggcccagcgggagtggatcacctccagctcccggttcttggcgaacgtctccgggtccg 1269

                                           
Query: 669  cagagagccccgcagtgtcccatccgtagtc 699
            | || |||||||| |||||||| ||||||||
Sbjct: 1268 ccgacagccccgcggtgtcccagccgtagtc 1238
to top
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  712 bits (359), Expect = 0.0
 Identities = 518/571 (90%)
 Strand = Plus / Minus

                                                                            
Query: 129      acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
                |||||||||| || |||||||||||| | ||||| ||||||||||||||||||||||| |
Sbjct: 10793780 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 10793721

                                                                            
Query: 189      ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
                ||||||||||||||||||| |  ||||||||||| ||||| |||||||| ||||| ||||
Sbjct: 10793720 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagc 10793661

                                                                            
Query: 249      cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
                ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||
Sbjct: 10793660 cgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgcga 10793601

                                                                            
Query: 309      acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
                ||||||||||||| |||||||||||||| |||||||||   || ||||||||||| ||||
Sbjct: 10793600 acgcctcggggtcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagcgggt 10793541

                                                                            
Query: 369      cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
                |||||| |||||||||||| ||||||||||  ||||| ||||||||||||||||||||||
Sbjct: 10793540 cgacgacctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgagca 10793481

                                                                            
Query: 429      cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
                | |||||    ||||||||||||||||||||||| |||||||  ||||| ||||||||||
Sbjct: 10793480 ccacctgcaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccga 10793421

                                                                            
Query: 489      ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
                |||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||||||||
Sbjct: 10793420 ggtagtcgagcccgccctcgctgaagatctgcgagcccgccttgaaccacacggcctcgc 10793361

                                                                            
Query: 549      cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
                |||||||||||||||| |||||||| ||||| ||||||||||||||||||||||| ||||
Sbjct: 10793360 cgaacttgacgccgttccgggcgaggagctccgggaagacgcagccgagcgcgcccagca 10793301

                                                                            
Query: 609      tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
                | ||||||||| ||||||||||||||||||||||||||||||| || ||||| |||||||
Sbjct: 10793300 tcgcccaccgggagtggatcacctccagctcccggttcttggcgaacgtctccgggtcgg 10793241

                                               
Query: 669      cagagagccccgcagtgtcccatccgtagtc 699
                | ||||||||||| |||||||| ||||||||
Sbjct: 10793240 cggagagccccgcggtgtcccacccgtagtc 10793210



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                            
Query: 269     aggcgtccgttcttgatctccttcacctt 297
               ||||| |||||||||||||||||||||||
Sbjct: 7133593 aggcgaccgttcttgatctccttcacctt 7133565
to top
>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0512H04
          Length = 151049

 Score =  712 bits (359), Expect = 0.0
 Identities = 518/571 (90%)
 Strand = Plus / Minus

                                                                         
Query: 129   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
             |||||||||| || |||||||||||| | ||||| ||||||||||||||||||||||| |
Sbjct: 17503 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 17444

                                                                         
Query: 189   ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             ||||||||||||||||||| |  ||||||||||| ||||| |||||||| ||||| ||||
Sbjct: 17443 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagc 17384

                                                                         
Query: 249   cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
             ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||
Sbjct: 17383 cgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgcga 17324

                                                                         
Query: 309   acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
             ||||||||||||| |||||||||||||| |||||||||   || ||||||||||| ||||
Sbjct: 17323 acgcctcggggtcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagcgggt 17264

                                                                         
Query: 369   cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
             |||||| |||||||||||| ||||||||||  ||||| ||||||||||||||||||||||
Sbjct: 17263 cgacgacctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgagca 17204

                                                                         
Query: 429   cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
             | |||||    ||||||||||||||||||||||| |||||||  ||||| ||||||||||
Sbjct: 17203 ccacctgcaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccga 17144

                                                                         
Query: 489   ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
             |||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||||||||
Sbjct: 17143 ggtagtcgagcccgccctcgctgaagatctgcgagcccgccttgaaccacacggcctcgc 17084

                                                                         
Query: 549   cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
             |||||||||||||||| |||||||| ||||| ||||||||||||||||||||||| ||||
Sbjct: 17083 cgaacttgacgccgttccgggcgaggagctccgggaagacgcagccgagcgcgcccagca 17024

                                                                         
Query: 609   tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
             | ||||||||| ||||||||||||||||||||||||||||||| || ||||| |||||||
Sbjct: 17023 tcgcccaccgggagtggatcacctccagctcccggttcttggcgaacgtctccgggtcgg 16964

                                            
Query: 669   cagagagccccgcagtgtcccatccgtagtc 699
             | ||||||||||| |||||||| ||||||||
Sbjct: 16963 cggagagccccgcggtgtcccacccgtagtc 16933
to top
>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OSJNBb0085I16
          Length = 141701

 Score =  712 bits (359), Expect = 0.0
 Identities = 518/571 (90%)
 Strand = Plus / Minus

                                                                          
Query: 129    acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
              |||||||||| || |||||||||||| | ||||| ||||||||||||||||||||||| |
Sbjct: 130398 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 130339

                                                                          
Query: 189    ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
              ||||||||||||||||||| |  ||||||||||| ||||| |||||||| ||||| ||||
Sbjct: 130338 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagc 130279

                                                                          
Query: 249    cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
              ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||
Sbjct: 130278 cgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgcga 130219

                                                                          
Query: 309    acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
              ||||||||||||| |||||||||||||| |||||||||   || ||||||||||| ||||
Sbjct: 130218 acgcctcggggtcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagcgggt 130159

                                                                          
Query: 369    cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
              |||||| |||||||||||| ||||||||||  ||||| ||||||||||||||||||||||
Sbjct: 130158 cgacgacctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgagca 130099

                                                                          
Query: 429    cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
              | |||||    ||||||||||||||||||||||| |||||||  ||||| ||||||||||
Sbjct: 130098 ccacctgcaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccga 130039

                                                                          
Query: 489    ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
              |||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||||||||
Sbjct: 130038 ggtagtcgagcccgccctcgctgaagatctgcgagcccgccttgaaccacacggcctcgc 129979

                                                                          
Query: 549    cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
              |||||||||||||||| |||||||| ||||| ||||||||||||||||||||||| ||||
Sbjct: 129978 cgaacttgacgccgttccgggcgaggagctccgggaagacgcagccgagcgcgcccagca 129919

                                                                          
Query: 609    tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
              | ||||||||| ||||||||||||||||||||||||||||||| || ||||| |||||||
Sbjct: 129918 tcgcccaccgggagtggatcacctccagctcccggttcttggcgaacgtctccgggtcgg 129859

                                             
Query: 669    cagagagccccgcagtgtcccatccgtagtc 699
              | ||||||||||| |||||||| ||||||||
Sbjct: 129858 cggagagccccgcggtgtcccacccgtagtc 129828
to top
>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein
           LHCP
          Length = 967

 Score =  712 bits (359), Expect = 0.0
 Identities = 518/571 (90%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||||||||| || |||||||||||| ||||||| |||||||||||||||||||||||||
Sbjct: 860 acttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggcaa 801

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
            |||||| ||||||||||| |  |||||||| || ||||| |||||||| ||||| || |
Sbjct: 800 tgtggtcagcgaggttctcgagcgggcccttcccggtgacgatggcctggacgaagaatc 741

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           |||||||||| |||||||| ||||| || ||||||| |||||| |||||||||||| |||
Sbjct: 740 cgaacatggacaacatggcgaggcggcccttcttgagctccttgaccttgagctcgccga 681

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           | ||||||||||||||||||||||| || ||||||||||| || ||||||||||| ||||
Sbjct: 680 aggcctcggggtcgtcggcgaggcccagcgggtcgaagctgccgccggggtagagcgggt 621

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           |||||| |||||||||||||||||||||||  ||||||||||||||||||||||||||||
Sbjct: 620 cgacgacctcgccgagcgggccgccggcgatgcggtagccctcgacggcgcccatgagca 561

                                                                       
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
           |||||||||| ||||||||||| ||||||||||| ||||||| |||||| ||||| ||||
Sbjct: 560 cgacctggcaggcccagatggcaaggatgctctgcgcgtggatgaggctcgggttcccga 501

                                                                       
Query: 489 ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
           ||||||| || |||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 500 ggtagtccagcccgccctcgctgaagatctgggagccggccttgaaccacacggcctcgc 441

                                                                       
Query: 549 cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
           ||||||||||||||||||||||||| ||||| ||||||||||| ||||||||||| ||||
Sbjct: 440 cgaacttgacgccgttgcgggcgagaagctccgggaagacgcaaccgagcgcgcccagca 381

                                                                       
Query: 609 tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
           ||||||| ||||||||||||||||||||||||||||||||||| || ||||| ||||| |
Sbjct: 380 tggcccagcggcagtggatcacctccagctcccggttcttggcgaacgtctccgggtccg 321

                                          
Query: 669 cagagagccccgcagtgtcccatccgtagtc 699
           | || |||||||| |||||||| ||||||||
Sbjct: 320 ccgacagccccgcggtgtcccagccgtagtc 290
to top
>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full
           insert sequence
          Length = 1013

 Score =  712 bits (359), Expect = 0.0
 Identities = 518/571 (90%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||||||||| || |||||||||||| | ||||| ||||||||||||||||||||||| |
Sbjct: 848 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 789

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           ||||||||||||||||||| |  ||||||||||| ||||| |||||||| ||||| ||||
Sbjct: 788 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagc 729

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||
Sbjct: 728 cgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgcga 669

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           ||||||||||||| |||||||||||||| |||||||||   || ||||||||||| ||||
Sbjct: 668 acgcctcggggtcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagcgggt 609

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           |||||| |||||||||||| ||||||||||  ||||| ||||||||||||||||||||||
Sbjct: 608 cgacgacctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgagca 549

                                                                       
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
           | |||||    ||||||||||||||||||||||| |||||||  ||||| ||||||||||
Sbjct: 548 ccacctgcaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccga 489

                                                                       
Query: 489 ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
           |||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||||||||
Sbjct: 488 ggtagtcgagcccgccctcgctgaagatctgcgagcccgccttgaaccacacggcctcgc 429

                                                                       
Query: 549 cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
           |||||||||||||||| |||||||| ||||| ||||||||||||||||||||||| ||||
Sbjct: 428 cgaacttgacgccgttccgggcgaggagctccgggaagacgcagccgagcgcgcccagca 369

                                                                       
Query: 609 tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
           | ||||||||| ||||||||||||||||||||||||||||||| || ||||| |||||||
Sbjct: 368 tcgcccaccgggagtggatcacctccagctcccggttcttggcgaacgtctccgggtcgg 309

                                          
Query: 669 cagagagccccgcagtgtcccatccgtagtc 699
           | ||||||||||| |||||||| ||||||||
Sbjct: 308 cggagagccccgcggtgtcccacccgtagtc 278
to top
>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full
           insert sequence
          Length = 1021

 Score =  712 bits (359), Expect = 0.0
 Identities = 518/571 (90%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||||||||| || |||||||||||| | ||||| ||||||||||||||||||||||| |
Sbjct: 853 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 794

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           ||||||||||||||||||| |  ||||||||||| ||||| |||||||| ||||| ||||
Sbjct: 793 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagc 734

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||
Sbjct: 733 cgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgcga 674

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           ||||||||||||| |||||||||||||| |||||||||   || ||||||||||| ||||
Sbjct: 673 acgcctcggggtcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagcgggt 614

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           |||||| |||||||||||| ||||||||||  ||||| ||||||||||||||||||||||
Sbjct: 613 cgacgacctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgagca 554

                                                                       
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
           | |||||    ||||||||||||||||||||||| |||||||  ||||| ||||||||||
Sbjct: 553 ccacctgcaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccga 494

                                                                       
Query: 489 ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
           |||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||||||||
Sbjct: 493 ggtagtcgagcccgccctcgctgaagatctgcgagcccgccttgaaccacacggcctcgc 434

                                                                       
Query: 549 cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
           |||||||||||||||| |||||||| ||||| ||||||||||||||||||||||| ||||
Sbjct: 433 cgaacttgacgccgttccgggcgaggagctccgggaagacgcagccgagcgcgcccagca 374

                                                                       
Query: 609 tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
           | ||||||||| ||||||||||||||||||||||||||||||| || ||||| |||||||
Sbjct: 373 tcgcccaccgggagtggatcacctccagctcccggttcttggcgaacgtctccgggtcgg 314

                                          
Query: 669 cagagagccccgcagtgtcccatccgtagtc 699
           | ||||||||||| |||||||| ||||||||
Sbjct: 313 cggagagccccgcggtgtcccacccgtagtc 283
to top
>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full
           insert sequence
          Length = 1056

 Score =  712 bits (359), Expect = 0.0
 Identities = 518/571 (90%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||||||||| || |||||||||||| | ||||| ||||||||||||||||||||||| |
Sbjct: 855 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 796

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           ||||||||||||||||||| |  ||||||||||| ||||| |||||||| ||||| ||||
Sbjct: 795 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagc 736

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||
Sbjct: 735 cgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgcga 676

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           ||||||||||||| |||||||||||||| |||||||||   || ||||||||||| ||||
Sbjct: 675 acgcctcggggtcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagcgggt 616

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           |||||| |||||||||||| ||||||||||  ||||| ||||||||||||||||||||||
Sbjct: 615 cgacgacctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgagca 556

                                                                       
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
           | |||||    ||||||||||||||||||||||| |||||||  ||||| ||||||||||
Sbjct: 555 ccacctgcaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccga 496

                                                                       
Query: 489 ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
           |||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||||||||
Sbjct: 495 ggtagtcgagcccgccctcgctgaagatctgcgagcccgccttgaaccacacggcctcgc 436

                                                                       
Query: 549 cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
           |||||||||||||||| |||||||| ||||| ||||||||||||||||||||||| ||||
Sbjct: 435 cgaacttgacgccgttccgggcgaggagctccgggaagacgcagccgagcgcgcccagca 376

                                                                       
Query: 609 tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
           | ||||||||| ||||||||||||||||||||||||||||||| || ||||| |||||||
Sbjct: 375 tcgcccaccgggagtggatcacctccagctcccggttcttggcgaacgtctccgggtcgg 316

                                          
Query: 669 cagagagccccgcagtgtcccatccgtagtc 699
           | ||||||||||| |||||||| ||||||||
Sbjct: 315 cggagagccccgcggtgtcccacccgtagtc 285
to top
>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full
           insert sequence
          Length = 1235

 Score =  712 bits (359), Expect = 0.0
 Identities = 518/571 (90%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||||||||| || |||||||||||| | ||||| ||||||||||||||||||||||| |
Sbjct: 853 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 794

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           ||||||||||||||||||| |  ||||||||||| ||||| |||||||| ||||| ||||
Sbjct: 793 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagc 734

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||
Sbjct: 733 cgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgcga 674

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           ||||||||||||| |||||||||||||| |||||||||   || ||||||||||| ||||
Sbjct: 673 acgcctcggggtcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagcgggt 614

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           |||||| |||||||||||| ||||||||||  ||||| ||||||||||||||||||||||
Sbjct: 613 cgacgacctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgagca 554

                                                                       
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
           | |||||    ||||||||||||||||||||||| |||||||  ||||| ||||||||||
Sbjct: 553 ccacctgcaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccga 494

                                                                       
Query: 489 ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
           |||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||||||||
Sbjct: 493 ggtagtcgagcccgccctcgctgaagatctgcgagcccgccttgaaccacacggcctcgc 434

                                                                       
Query: 549 cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
           |||||||||||||||| |||||||| ||||| ||||||||||||||||||||||| ||||
Sbjct: 433 cgaacttgacgccgttccgggcgaggagctccgggaagacgcagccgagcgcgcccagca 374

                                                                       
Query: 609 tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
           | ||||||||| ||||||||||||||||||||||||||||||| || ||||| |||||||
Sbjct: 373 tcgcccaccgggagtggatcacctccagctcccggttcttggcgaacgtctccgggtcgg 314

                                          
Query: 669 cagagagccccgcagtgtcccatccgtagtc 699
           | ||||||||||| |||||||| ||||||||
Sbjct: 313 cggagagccccgcggtgtcccacccgtagtc 283
to top
>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full
           insert sequence
          Length = 1045

 Score =  704 bits (355), Expect = 0.0
 Identities = 517/571 (90%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||||||||| || |||||||||||| | ||||| ||||||||||||||||||||||| |
Sbjct: 853 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 794

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           ||||||||||||||||||| |  ||||||||||| ||||| |||||||| ||||| ||||
Sbjct: 793 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagc 734

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||
Sbjct: 733 cgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgcga 674

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           ||||||||||||| |||||||||||||| |||||||||   || ||||||||||| ||||
Sbjct: 673 acgcctcggggtcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagcgggt 614

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           |||||| |||||||||||| ||||||||||  ||||| ||||||||||||||||||||||
Sbjct: 613 cgacgacctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgagca 554

                                                                       
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
           | |||||    ||||||||||||||||||||||| |||||||  ||||| ||||||||||
Sbjct: 553 ccacctgcaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccga 494

                                                                       
Query: 489 ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
           |||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||||||||
Sbjct: 493 ggtagtcgagcccgccctcgctgaagatctgcgagcccgccttgaaccacacggcctcgc 434

                                                                       
Query: 549 cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
           |||||||||||||||| |||||||| ||||| ||||||||||||||||||||||| ||||
Sbjct: 433 cgaacttgacgccgttccgggcgaggagctccgggaagacgcagccgagcgcgcccagca 374

                                                                       
Query: 609 tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
           | ||||||||| ||||||||||||||||||||||||||||||| |  ||||| |||||||
Sbjct: 373 tcgcccaccgggagtggatcacctccagctcccggttcttggcgagcgtctccgggtcgg 314

                                          
Query: 669 cagagagccccgcagtgtcccatccgtagtc 699
           | ||||||||||| |||||||| ||||||||
Sbjct: 313 cggagagccccgcggtgtcccacccgtagtc 283
to top
>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 1022

 Score =  688 bits (347), Expect = 0.0
 Identities = 515/571 (90%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||||||||| || |||||||||||| | ||||| ||||||||||||||||||||||| |
Sbjct: 834 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 775

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           ||||||||||||||||||| |  ||||||||||| ||||| |||||||| ||||| ||||
Sbjct: 774 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagc 715

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           ||||||||||||||||||| ||||| || |||||||||||||||||||||||||| ||||
Sbjct: 714 cgaacatggagaacatggcgaggcggcctttcttgatctccttcaccttgagctccgcga 655

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           ||||||||||||| |||||||||||||| |||||||||   || ||||||||||| ||||
Sbjct: 654 acgcctcggggtcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagcgggt 595

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           |||||| |||||||||||| ||||||||||  ||||| ||||||||||||||||||||||
Sbjct: 594 cgacgacctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgagca 535

                                                                       
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
           | |||||    ||||||||||||||||||||||| |||||||  ||||| ||||||||||
Sbjct: 534 ccacctgcaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccga 475

                                                                       
Query: 489 ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
           |||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||||||||
Sbjct: 474 ggtagtcgagcccgccctcgctgaagatctgcgagcccgccttgaaccacacggcctcgc 415

                                                                       
Query: 549 cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
           |||||||||||||||| |||||||| ||||| ||||||||||||||||||||||| ||||
Sbjct: 414 cgaacttgacgccgttccgggcgaggagctccgggaagacgcagccgagcgcgcccagca 355

                                                                       
Query: 609 tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
           | ||||| ||| ||||||||| ||||||||||||||||||||| || ||||| |||||||
Sbjct: 354 tcgcccatcgggagtggatcagctccagctcccggttcttggcgaacgtctccgggtcgg 295

                                          
Query: 669 cagagagccccgcagtgtcccatccgtagtc 699
           | ||||||||||| |||||||| ||||||||
Sbjct: 294 cggagagccccgcggtgtcccacccgtagtc 264
to top
>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding protein
          Length = 1664

 Score =  684 bits (345), Expect = 0.0
 Identities = 519/577 (89%)
 Strand = Plus / Minus

                                                                        
Query: 129  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
            |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||| |
Sbjct: 1245 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 1186

                                                                        
Query: 189  ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
            ||||||||||||||||||| |  ||||||||||| ||||| |||||||| ||||| ||||
Sbjct: 1185 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagc 1126

                                                                        
Query: 249  cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
            ||||||||||||||||||| ||||| ||||||||||||| ||||||||||||||| ||| 
Sbjct: 1125 cgaacatggagaacatggcgaggcggccgttcttgatcttcttcaccttgagctccgcgc 1066

                                                                        
Query: 309  acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
            ||||||||||||| |||||||||||||| |||||||||   || |||||||| || ||||
Sbjct: 1065 acgcctcggggtcatcggcgaggccgagcgggtcgaaggcgccgccggggtacagcgggt 1006

                                                                        
Query: 369  cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
            |||||| |||||||||||| ||||| || |  ||||| ||||||||||||||||||||||
Sbjct: 1005 cgacgacctcgccgagcggcccgccagcaatccggtacccctcgacggcgcccatgagca 946

                                                                        
Query: 429  cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
            | |||||    ||||||||||||||||||||||| |||||||  ||||| ||||||||||
Sbjct: 945  ccacctgcaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccga 886

                                                                        
Query: 489  ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
            |||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||||||||
Sbjct: 885  ggtagtcgagcccgccctcgctgaagatctgcgagcccgccttgaaccacacggcctcgc 826

                                                                        
Query: 549  cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
            |||||||||||||||| |||||||| ||||| ||||||||||||||||||||||| ||||
Sbjct: 825  cgaacttgacgccgttccgggcgaggagctccgggaagacgcagccgagcgcgcccagca 766

                                                                        
Query: 609  tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
            | ||||||||| ||||||||||||||||||||||||||||||| || ||||| |||||||
Sbjct: 765  tcgcccaccgggagtggatcacctccagctcccggttcttggcgaacgtctccgggtcgg 706

                                                 
Query: 669  cagagagccccgcagtgtcccatccgtagtcaccggg 705
            | ||||||||||| |||||||| |||||||| |||||
Sbjct: 705  cggagagccccgcggtgtcccacccgtagtcgccggg 669
to top
>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding
           protein
          Length = 869

 Score =  672 bits (339), Expect = 0.0
 Identities = 513/571 (89%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||||||||||||||||||||||||  ||||||| ||||||||||||||||||||||| |
Sbjct: 808 acttgccgggcacaaagttggtggcataggcccatgcgttgttgttgacggggtcggcga 749

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           ||||||||||||||||||| |  ||||||||||| ||||| |||||||| ||||| || |
Sbjct: 748 ggtggtcggcgaggttctcgagcgggcccttgccggtgacgatggcctggacgaagaacc 689

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           ||||||||||||||||||| ||||| |||||||||| ||||||||||||||  || ||||
Sbjct: 688 cgaacatggagaacatggcgaggcggccgttcttgagctccttcaccttgacgtccgcga 629

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           | ||||| |||||||||||||||||||| ||||||||  | || ||||||||||| ||||
Sbjct: 628 aggcctcagggtcgtcggcgaggccgagcgggtcgaacgtgccgccggggtagagcgggt 569

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           |||||| ||| |||||||||||||||||||| ||||| ||||||| ||||||||||||||
Sbjct: 568 cgacgacctctccgagcgggccgccggcgacgcggtacccctcgatggcgcccatgagca 509

                                                                       
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
           |||||||||| ||||||||||||||||||||||| |||||||  ||||| ||||||||||
Sbjct: 508 cgacctggcaggcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccga 449

                                                                       
Query: 489 ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
           ||||||| || || ||||||||||||||||| || |||||||||||||| ||||||||||
Sbjct: 448 ggtagtccagcccaccctcgctgaagatctgcgacccggccttgaaccacacggcctcgc 389

                                                                       
Query: 549 cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
           ||||||||||||||||||||||||||||||| ||||| |||||||| | |||||| ||||
Sbjct: 388 cgaacttgacgccgttgcgggcgagcagctccgggaacacgcagcccaacgcgcccagca 329

                                                                       
Query: 609 tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
           ||||||| ||| ||||||| ||||||||||||||||||||||| || ||||| ||||| |
Sbjct: 328 tggcccagcgggagtggatgacctccagctcccggttcttggcgaacgtctccgggtccg 269

                                          
Query: 669 cagagagccccgcagtgtcccatccgtagtc 699
           | || |||||||| |||||||| ||||||||
Sbjct: 268 ccgacagccccgcggtgtcccagccgtagtc 238
to top
>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding protein
          Length = 1442

 Score =  652 bits (329), Expect = 0.0
 Identities = 515/577 (89%)
 Strand = Plus / Minus

                                                                        
Query: 129  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
            |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||| |
Sbjct: 1284 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 1225

                                                                        
Query: 189  ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
            ||||||||||||||||||| |  ||||||||||| ||||| |||||||| ||||| ||||
Sbjct: 1224 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagc 1165

                                                                        
Query: 249  cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
            ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||
Sbjct: 1164 cgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgcga 1105

                                                                        
Query: 309  acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
            | ||||| ||||| |||||||||||||| |||||||||   || || |||||||| ||||
Sbjct: 1104 aggcctccgggtcatcggcgaggccgagcgggtcgaaggcgccgcccgggtagagcgggt 1045

                                                                        
Query: 369  cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
            |||||| |||||||||||| |||||||| |  ||||| ||||||||||||||||||||||
Sbjct: 1044 cgacgacctcgccgagcggcccgccggcaatccggtacccctcgacggcgcccatgagca 985

                                                                        
Query: 429  cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
            | |||||    ||||||||||||||||||||||| |||||||  ||||| ||||||||||
Sbjct: 984  ccacctgcaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccga 925

                                                                        
Query: 489  ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
            |||||||||| |||||||||||||||||||| || || ||||||||||| || ||||| |
Sbjct: 924  ggtagtcgagcccgccctcgctgaagatctgcgaccccgccttgaaccacaccgcctccc 865

                                                                        
Query: 549  cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
            ||||||||||||||||||||||||| ||||| ||||| |||||||| ||| |||||||||
Sbjct: 864  cgaacttgacgccgttgcgggcgaggagctccgggaacacgcagcccagcccgccgagca 805

                                                                        
Query: 609  tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
            | ||||||| | ||||||||||||||||||||||||||||||| || ||||| |||||||
Sbjct: 804  tcgcccacctggagtggatcacctccagctcccggttcttggcgaacgtctccgggtcgg 745

                                                 
Query: 669  cagagagccccgcagtgtcccatccgtagtcaccggg 705
            | ||||||||||| |||||||| |||||||| |||||
Sbjct: 744  cggagagccccgcggtgtcccacccgtagtcgccggg 708
to top
>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds
          Length = 695

 Score =  630 bits (318), Expect = e-177
 Identities = 501/562 (89%)
 Strand = Plus / Minus

                                                                       
Query: 143 aagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgagg 202
           |||||||||||||||||||| |||||||||||||||||||| || ||||||||||| | |
Sbjct: 693 aagttggtggcgaaggcccaggcgttgttgttgacggggtcagcgaggtggtcggccaag 634

                                                                       
Query: 203 ttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaac 262
           ||||| |  || |||||||| || || |||||||| ||||| || |||||||||||||||
Sbjct: 633 ttctcgaggggtcccttgccggtcacgatggcctggacgaagaatccgaacatggagaac 574

                                                                       
Query: 263 atggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcg 322
           || || || |||||||||||||||||||||||||| ||||| ||||| || || ||||||
Sbjct: 573 atcgccagccgtccgttcttgatctccttcaccttcagctccgcgaaggcttccgggtcg 514

                                                                       
Query: 323 tcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcgacgatctcgccg 382
           || || || || || ||||||||||| || || ||||| || |||||||||| ||| |||
Sbjct: 513 tccgccagccccagcgggtcgaagctcccgcccgggtacagcgggtcgacgacctctccg 454

                                                                       
Query: 383 agcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacctggcaagcc 442
           ||||| ||||| || || | |||||||||||||||||||||||| | |||||||   |||
Sbjct: 453 agcggcccgcccgccactctgtagccctcgacggcgcccatgaggatgacctgggtggcc 394

                                                                       
Query: 443 cagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccg 502
           |||||||||||||||||||| ||||| || ||||||||||| |||||||||||||| |||
Sbjct: 393 cagatggcgaggatgctctgcgcgtgcaccaggctggggttcccgaggtagtcgagcccg 334

                                                                       
Query: 503 ccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacgccg 562
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 333 ccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacgccg 274

                                                                       
Query: 563 ttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccggcag 622
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||    |
Sbjct: 273 ttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccacctcgcg 214

                                                                       
Query: 623 tggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccccgca 682
           ||||||||||||||||| ||||||||||| ||||||||||||||||| |||||||| || 
Sbjct: 213 tggatcacctccagctcgcggttcttggcgaaggtctcggggtcggcggagagcccggcg 154

                                 
Query: 683 gtgtcccatccgtagtcaccgg 704
           |||||||| |||||||| ||||
Sbjct: 153 gtgtcccagccgtagtcgccgg 132
to top
>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor
           (Wcab) mRNA, complete cds
          Length = 918

 Score =  599 bits (302), Expect = e-168
 Identities = 506/574 (88%)
 Strand = Plus / Minus

                                                                       
Query: 126 cttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcgg 185
           ||||||||||||| ||||||||||||||||| ||||| || |||||||||||||||||||
Sbjct: 811 cttacttgccggggacaaagttggtggcgaatgcccatgcattgttgttgacggggtcgg 752

                                                                       
Query: 186 caaggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaa 245
           | | |||||| ||||||||||| | |||||||||||| ||||| || || || || || |
Sbjct: 751 cgatgtggtcagcgaggttctcaagtgggcccttgcccgtgacgatagcttggacaaaga 692

                                                                       
Query: 246 agccgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcgg 305
           |||| ||||| ||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 691 agccaaacattgagaacatggcaaggcgaccgttcttgatctccttcaccttgagctcgg 632

                                                                       
Query: 306 cgaacgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagaggg 365
           |||| ||||| ||||| ||||| | ||| || |||||||||||||| || |||||||| |
Sbjct: 631 cgaatgcctcagggtcttcggccaagccaagagggtcgaagctaccgcctgggtagagtg 572

                                                                       
Query: 366 ggtcgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatga 425
           |||| |||||||| ||||| ||||||||||| |||||||| ||||||||||| |||||||
Sbjct: 571 ggtcaacgatctcaccgagtgggccgccggcaacacggtacccctcgacggcacccatga 512

                                                                       
Query: 426 gcacgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgc 485
           ||||||||||||| ||||| || || |||||||| |||||||| || |||||||||||||
Sbjct: 511 gcacgacctggcatgcccaaatagctaggatgctttgtgcgtgcactaggctggggttgc 452

                                                                       
Query: 486 cgaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcct 545
           ||||||||||||| || ||||| || |||||||||||||||||||||||||| |||||||
Sbjct: 451 cgaggtagtcgagaccaccctcactaaagatctgggagccggccttgaaccaaacggcct 392

                                                                       
Query: 546 cgccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccga 605
           |||| ||||||||||||||||||||||||| ||| |||||||| || || || || || |
Sbjct: 391 cgccaaacttgacgccgttgcgggcgagcaactcagggaagacacaaccaagtgccccaa 332

                                                                       
Query: 606 gcatggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggt 665
           |||||||||| || |||||||||||||||||||||||||||||||  |||||||| ||||
Sbjct: 331 gcatggcccagcgacagtggatcacctccagctcccggttcttggagaaggtctccgggt 272

                                             
Query: 666 cggcagagagccccgcagtgtcccatccgtagtc 699
           | || || || || ||||||||||| || |||||
Sbjct: 271 cagccgaaagtccagcagtgtcccacccatagtc 238
to top
>emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putative chlorophyll a/b
           binding protein (cab gene)
          Length = 760

 Score =  593 bits (299), Expect = e-166
 Identities = 482/543 (88%)
 Strand = Plus / Minus

                                                                       
Query: 163 cgcgttgttgttgacggggtcggcaaggtggtcggcgaggttctccaatgggcccttgcc 222
           ||||||||||||||| |||||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 760 cgcgttgttgttgacagggtcggcaatgtggtcggcaaggttctccaatgggcccttgcc 701

                                                                       
Query: 223 agtgacaatggcctgcacgaaaaagccgaacatggagaacatggcaaggcgtccgttctt 282
            ||||||||||||||||| || ||||| ||||||||||||||||| ||||| || |||||
Sbjct: 700 ggtgacaatggcctgcacaaagaagccaaacatggagaacatggcgaggcggccattctt 641

                                                                       
Query: 283 gatctccttcaccttgagctcggcgaacgcctcggggtcgtcggcgaggccgagggggtc 342
           ||||||||| ||||||||||| || || ||||||||||||||||| ||||| || |||||
Sbjct: 640 gatctccttaaccttgagctccgcaaatgcctcggggtcgtcggccaggccaagtgggtc 581

                                                                       
Query: 343 gaagctaccaccggggtagagggggtcgacgatctcgccgagcgggccgccggcgacacg 402
            ||||| ||||| |||||||| ||||||||||||||||||||||| || || || |  ||
Sbjct: 580 aaagctgccaccagggtagagtgggtcgacgatctcgccgagcggaccaccagcaatgcg 521

                                                                       
Query: 403 gtagccctcgacggcgcccatgagcacgacctggcaagcccagatggcgaggatgctctg 462
           ||| ||||| ||||| ||||||||||| || || |||||||| |||||||||||||||||
Sbjct: 520 gtacccctcaacggcccccatgagcacaacttgacaagcccatatggcgaggatgctctg 461

                                                                       
Query: 463 tgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaagatctggga 522
            ||||||||||||||||||||||| |||||||||||||| ||||||||||| ||||| ||
Sbjct: 460 ggcgtggacgaggctggggttgccaaggtagtcgaggccaccctcgctgaaaatctgaga 401

                                                                       
Query: 523 gccggccttgaaccagacggcctcgccgaacttgacgccgttgcgggcgagcagctcggg 582
           ||| ||| ||||||||||||||||||||||||| || || |||||||| |||| ||||||
Sbjct: 400 gccagccatgaaccagacggcctcgccgaacttcacaccattgcgggcaagcaactcggg 341

                                                                       
Query: 583 gaagacgcagccgagcgcgccgagcatggcccaccggcagtggatcacctccagctcccg 642
            ||||| || || ||||| |||||||||||||| ||||||||||||||||| ||||||||
Sbjct: 340 aaagacacaaccaagcgcaccgagcatggcccatcggcagtggatcacctcgagctcccg 281

                                                                       
Query: 643 gttcttggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccgtagtcacc 702
           ||||||||| |||||||| ||||| || |||||||| || |||||||| || ||||||||
Sbjct: 280 gttcttggcgaaggtctcagggtcagccgagagcccggcggtgtcccacccatagtcacc 221

              
Query: 703 ggg 705
           |||
Sbjct: 220 ggg 218
to top
>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds
          Length = 1633

 Score =  587 bits (296), Expect = e-164
 Identities = 506/576 (87%)
 Strand = Plus / Minus

                                                                        
Query: 129  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
            |||||||||| || |||||||||||||||||||| ||||||||||||||||||||||| |
Sbjct: 1193 acttgccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcggcga 1134

                                                                        
Query: 189  ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
            | ||||| || | |||||| |  |||||||| || ||||| |||||||||||||| || |
Sbjct: 1133 gatggtccgccaagttctcgagggggcccttcccggtgacgatggcctgcacgaagaacc 1074

                                                                        
Query: 249  cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
            ||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| || |
Sbjct: 1073 cgaacatggagaacatggccaggcgtccgttcttgatctccttcaccttcagctccgcaa 1014

                                                                        
Query: 309  acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
            | ||||||||||||||||| || || || ||||||||||| || |||||||| || ||||
Sbjct: 1013 aggcctcggggtcgtcggccagccccagcgggtcgaagctgccgccggggtacagcgggt 954

                                                                        
Query: 369  cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
            |||||| |||||| || || |||||||| || |||||||| ||||||||||||||||| |
Sbjct: 953  cgacgacctcgcccagaggcccgccggccacgcggtagccttcgacggcgcccatgagga 894

                                                                        
Query: 429  cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
            | |||||    ||||||||||| ||||||||||| ||||| || |||||||||||||| |
Sbjct: 893  ccacctgcgtggcccagatggccaggatgctctgcgcgtgcaccaggctggggttgccca 834

                                                                        
Query: 489  ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
            ||||||| || || ||||||||||||||||| || || ||||||||||| ||||||||||
Sbjct: 833  ggtagtccagccccccctcgctgaagatctgcgaacccgccttgaaccacacggcctcgc 774

                                                                        
Query: 549  cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
            | ||||| ||||||||||| || |||||||| ||||| |||||||| |||||||||||||
Sbjct: 773  caaacttcacgccgttgcgcgccagcagctccgggaacacgcagcccagcgcgccgagca 714

                                                                        
Query: 609  tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
            ||||||||||   |||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 713  tggcccaccgcgcgtggatcacctccagctcccggttcttggcgaaggtctcggggtcgg 654

                                                
Query: 669  cagagagccccgcagtgtcccatccgtagtcaccgg 704
            | |||||||| || |||||||| |||||||| ||||
Sbjct: 653  ccgagagcccggcggtgtcccagccgtagtcgccgg 618
to top
>gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast chlorophyll a/b binding
           protein mRNA, complete cds
          Length = 997

 Score =  575 bits (290), Expect = e-161
 Identities = 506/578 (87%)
 Strand = Plus / Minus

                                                                       
Query: 131 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaagg 190
           |||||||| || |||||||||||||||||||| ||||||||||||||||||||||| |||
Sbjct: 867 ttgccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcggcgagg 808

                                                                       
Query: 191 tggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccg 250
           ||||||||||||||||| |  ||||| ||||| ||||| |||||||| ||||| || |||
Sbjct: 807 tggtcggcgaggttctcgatggggcctttgccggtgacgatggcctggacgaagaaaccg 748

                                                                       
Query: 251 aacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaac 310
           ||||||||||||||||| ||||| |||||||||| |||||| ||||| || |||||||| 
Sbjct: 747 aacatggagaacatggccaggcggccgttcttgagctccttaaccttcagttcggcgaag 688

                                                                       
Query: 311 gcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcg 370
           || |||||||||||||| ||||| | |||||||||||| ||||| || |||| |||||||
Sbjct: 687 gcatcggggtcgtcggccaggcccaaggggtcgaagctgccacctggatagatggggtcg 628

                                                                       
Query: 371 acgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacg 430
              ||||||||||| |||||||| || |  ||||||||||||||||| |||||||| | |
Sbjct: 627 gtaatctcgccgagtgggccgccagcaatgcggtagccctcgacggctcccatgaggatg 568

                                                                       
Query: 431 acctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgagg 490
           |||||||| |||||||||||||| |||||||| ||||||| |||||| |||||||| |||
Sbjct: 567 acctggcaggcccagatggcgagaatgctctgggcgtggatgaggcttgggttgcccagg 508

                                                                       
Query: 491 tagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccg 550
           |||||||||||||| |||||||||||||| ||||| |||||||||||||| |||||||||
Sbjct: 507 tagtcgaggccgccgtcgctgaagatctgagagcccgccttgaaccagacagcctcgccg 448

                                                                       
Query: 551 aacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatg 610
           ||||||||||||||||||| ||||||||| |||||||||||||| || || || | ||| 
Sbjct: 447 aacttgacgccgttgcgggagagcagctccgggaagacgcagcccagggctcccaacatc 388

                                                                       
Query: 611 gcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggca 670
           ||||||||  ||||||||||||||||||| | |||||| || || ||||| ||||| || 
Sbjct: 387 gcccaccgcgagtggatcacctccagctctctgttcttcgcgaacgtctccgggtccgcc 328

                                                 
Query: 671 gagagccccgcagtgtcccatccgtagtcaccgggaaa 708
           || |||||||| |||||||| |||||||| || |||||
Sbjct: 327 gacagccccgccgtgtcccacccgtagtctcccggaaa 290
to top
>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor
          Length = 2780

 Score =  567 bits (286), Expect = e-158
 Identities = 507/578 (87%), Gaps = 2/578 (0%)
 Strand = Plus / Minus

                                                                        
Query: 129  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
            |||||||||| || |||||||||||| | ||||| ||||||||||||||||||||||  |
Sbjct: 2719 acttgccggggacgaagttggtggcgtaagcccaggcgttgttgttgacggggtcggtga 2660

                                                                        
Query: 189  ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
            ||||||||||||||||||| |  ||||||||||| ||||| || ||||||||||| ||||
Sbjct: 2659 ggtggtcggcgaggttctcgatggggcccttgccggtgacgatagcctgcacgaagaagc 2600

                                                                        
Query: 249  cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
            ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 2599 cgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcggcga 2540

                                                                        
Query: 309  acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
            ||  ||| ||||||||| |||| ||||| ||||||||||| || ||  |||| || ||||
Sbjct: 2539 accgctccgggtcgtcgccgagcccgagcgggtcgaagctgccgcccaggtacagcgggt 2480

                                                                        
Query: 369  cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
            |||| | ||| |||||| |||||||||||||| |||| ||||||||||||||||||||||
Sbjct: 2479 cgaccacctccccgagccggccgccggcgacatggtacccctcgacggcgcccatgagca 2420

                                                                        
Query: 429  cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
            | |||||||| |||||||| || ||||||||||| |||||||| ||||| ||||||||| 
Sbjct: 2419 ccacctggcacgcccagatagccaggatgctctgcgcgtggacaaggctcgggttgccgg 2360

                                                                        
Query: 489  ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
            | |    ||| |||||||||||||||||||||||||| ||||||||||| ||  ||||||
Sbjct: 2359 gatgactgagcccgccctcgctgaagatctgggagcccgccttgaaccacaccccctcgc 2300

                                                                        
Query: 549  cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgc-gccgagc 607
            ||||||||||||||||||||||||||||||| ||||| ||||| |||||| |  ||| | 
Sbjct: 2299 cgaacttgacgccgttgcgggcgagcagctccgggaacacgcacccgagccctaccgcg- 2241

                                                                        
Query: 608  atggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcg 667
            |||||||| ||||||||||||||||||||||| ||||||||||| |||||||| ||||| 
Sbjct: 2240 atggcccagcggcagtggatcacctccagctcgcggttcttggcgaaggtctccgggtcc 2181

                                                  
Query: 668  gcagagagccccgcagtgtcccatccgtagtcaccggg 705
            || || |||||| | |||||||| |||||||| |||||
Sbjct: 2180 gccgacagcccctcggtgtcccacccgtagtcgccggg 2143
to top
>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds
          Length = 1191

 Score =  557 bits (281), Expect = e-155
 Identities = 502/573 (87%), Gaps = 2/573 (0%)
 Strand = Plus / Minus

                                                                       
Query: 134 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtgg 193
           |||||||| ||||||||||| | |  |||||||||||||||||| |||||||||| ||||
Sbjct: 994 ccgggcacgaagttggtggcaatgagccacgcgttgttgttgacagggtcggcaatgtgg 935

                                                                       
Query: 194 tcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaac 253
           ||||| |||| |||||||||||||||||| ||||||||||||||||| || ||||| |||
Sbjct: 934 tcggcaaggtcctccaatgggcccttgccggtgacaatggcctgcacaaagaagccaaac 875

                                                                       
Query: 254 atggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcc 313
           |||||||||||||| ||||| || |||||||||||||| ||||||||||| || || |||
Sbjct: 874 atggagaacatggcgaggcggccattcttgatctccttaaccttgagctccgcaaatgcc 815

                                                                       
Query: 314 tcggggtcg-tcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcgac 372
           | ||||||| ||||| ||||| || ||||| ||||| ||||| |||||||| ||||||||
Sbjct: 814 t-ggggtcgctcggccaggccaagtgggtcaaagctgccaccagggtagagtgggtcgac 756

                                                                       
Query: 373 gatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgac 432
           ||||||||||||||| || || || |  ||||| ||||| ||||| ||||||||||| ||
Sbjct: 755 gatctcgccgagcggaccaccagcaatgcggtacccctcaacggcccccatgagcacaac 696

                                                                       
Query: 433 ctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggta 492
            || |||||||| |||||||||| |||||| ||||||||||||||||||||||| |||||
Sbjct: 695 ttgacaagcccatatggcgaggaggctctgggcgtggacgaggctggggttgccaaggta 636

                                                                       
Query: 493 gtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaa 552
           ||||||||| || |||||||||||||| ||||| |||||||||||  |||||||||||||
Sbjct: 635 gtcgaggccaccatcgctgaagatctgagagccagccttgaaccaaccggcctcgccgaa 576

                                                                       
Query: 553 cttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggc 612
           ||| || || |||||||| |||| |||||| ||||| || || ||||| |||||||||||
Sbjct: 575 cttcacaccattgcgggcaagcaactcgggaaagacacaaccaagcgcaccgagcatggc 516

                                                                       
Query: 613 ccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcaga 672
           ||| ||||||||||||||||| ||||||||||||||||| |||||||| ||||| || ||
Sbjct: 515 ccatcggcagtggatcacctcgagctcccggttcttggcgaaggtctcagggtcagccga 456

                                            
Query: 673 gagccccgcagtgtcccatccgtagtcaccggg 705
           |||||| || |||||||| || |||||||||||
Sbjct: 455 gagcccggcggtgtcccacccatagtcaccggg 423



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 61/68 (89%), Gaps = 2/68 (2%)
 Strand = Plus / Plus

                                                                        
Query: 224  gtgacaatggcctgcacgaaaaagccgaacatggagaacatggcaaggcgtccgttcttg 283
            ||||||||||||||||| || ||||| ||||||||||||||||| ||||| || || |||
Sbjct: 1111 gtgacaatggcctgcac-aagaagcc-aacatggagaacatggcgaggcggccattattg 1168

                    
Query: 284  atctcctt 291
            ||||||||
Sbjct: 1169 atctcctt 1176
to top
>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein
          Length = 934

 Score =  541 bits (273), Expect = e-150
 Identities = 506/581 (87%), Gaps = 2/581 (0%)
 Strand = Plus / Minus

                                                                       
Query: 126 cttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcgg 185
           |||| |||||||| || ||||| ||||| || ||||| ||||||||||||||||||||||
Sbjct: 820 cttatttgccggggacgaagtttgtggcaaatgcccaagcgttgttgttgacggggtcgg 761

                                                                       
Query: 186 caaggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaa 245
           | | |||||| ||||||||||| |  ||||||||||| ||||| |||||||| || | ||
Sbjct: 760 cgatgtggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaagaa 701

                                                                       
Query: 246 agccgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcgg 305
           |||| ||||| ||||||||||||||||| ||||||||||||||||||||||||||| || 
Sbjct: 700 agccaaacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagcgcgt 641

                                                                       
Query: 306 cgaacgcctcggggtcg-tcggcgaggccgagggggtcgaagctaccaccggggtagagg 364
           |||| || | ||||||| ||||| ||||| || ||||| || || ||||| |||||||| 
Sbjct: 640 cgaatgctt-ggggtcgctcggccaggccaagtgggtcaaaccttccacccgggtagaga 582

                                                                       
Query: 365 gggtcgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatg 424
           |||||||||||||||||||| |||||||| || |||||||| ||||| || |||||||||
Sbjct: 581 gggtcgacgatctcgccgagtgggccgccagcaacacggtacccctcaacagcgcccatg 522

                                                                       
Query: 425 agcacgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttg 484
           ||||| |||||||||||||| ||||| ||||||||||| || ||||||||||| ||||||
Sbjct: 521 agcacaacctggcaagcccaaatggcaaggatgctctgagcatggacgaggcttgggttg 462

                                                                       
Query: 485 ccgaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcc 544
           ||||||||||||||||| |||||||||||||| || |||||||||||||||||||| |||
Sbjct: 461 ccgaggtagtcgaggccaccctcgctgaagatttgcgagccggccttgaaccagacagcc 402

                                                                       
Query: 545 tcgccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccg 604
           ||||||||||| ||||| |||||||| |||| ||| ||||| ||||| || || || || 
Sbjct: 401 tcgccgaacttcacgccattgcgggcaagcaactcagggaacacgcaacccagtgcacca 342

                                                                       
Query: 605 agcatggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcgggg 664
           ||||| ||||| |||||||| |||||||||| ||| |||||||| |  ||||||||||||
Sbjct: 341 agcatagcccagcggcagtgtatcacctccaactcgcggttcttcgagaaggtctcgggg 282

                                                    
Query: 665 tcggcagagagccccgcagtgtcccatccgtagtcaccggg 705
           || |||||||| || || |||||||| ||||||||||||||
Sbjct: 281 tcagcagagagtccagccgtgtcccacccgtagtcaccggg 241
to top
>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds
          Length = 1913

 Score =  525 bits (265), Expect = e-146
 Identities = 499/577 (86%)
 Strand = Plus / Minus

                                                                        
Query: 129  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
            |||||||||| || |||||||||||||||||||| |||||||||  |||||||||||| |
Sbjct: 1532 acttgccggggacgaagttggtggcgaaggcccaggcgttgttggcgacggggtcggcga 1473

                                                                        
Query: 189  ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             ||||||||| |||||||| |  ||||||||||| ||||| |||||||| ||||| ||||
Sbjct: 1472 tgtggtcggccaggttctcgatggggcccttgccggtgacgatggcctgaacgaagaagc 1413

                                                                        
Query: 249  cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
            ||||||||||||||||||| || || ||||||||||||||||||||||| ||||| ||||
Sbjct: 1412 cgaacatggagaacatggccagccgcccgttcttgatctccttcaccttcagctccgcga 1353

                                                                        
Query: 309  acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
            | ||||||||||||||||| || || || |||||||||   || ||||||||||| ||||
Sbjct: 1352 aggcctcggggtcgtcggccagccccagcgggtcgaaggccccgccggggtagagcgggt 1293

                                                                        
Query: 369  cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
            |||    ||| || ||||| |||||| | || |||||||||||||    |||||||||||
Sbjct: 1292 cgagcccctcccccagcggcccgccgcccacgcggtagccctcgatcaggcccatgagca 1233

                                                                        
Query: 429  cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
            | |||||    ||||||||||||||||||||||| |||||||| ||| |||||||||| |
Sbjct: 1232 ccacctgcgtggcccagatggcgaggatgctctgcgcgtggaccaggttggggttgccca 1173

                                                                        
Query: 489  ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
            ||||||||||||||||||||  ||||||||||| ||| |||||||||||||||||||| |
Sbjct: 1172 ggtagtcgaggccgccctcggagaagatctgggcgcccgccttgaaccagacggcctccc 1113

                                                                        
Query: 549  cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
            ||||||  || |||||   || ||||||||| ||||||| ||||||||||||||||||||
Sbjct: 1112 cgaactgcaccccgttcttggagagcagctccgggaagatgcagccgagcgcgccgagca 1053

                                                                        
Query: 609  tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
            |||||||||||| |||||| ||||||||||| ||||||||||| |||||||| |||||||
Sbjct: 1052 tggcccaccggctgtggatgacctccagctcgcggttcttggcgaaggtctccgggtcgg 993

                                                 
Query: 669  cagagagccccgcagtgtcccatccgtagtcaccggg 705
            | ||||| || || |||||||| |||||||| |||||
Sbjct: 992  cggagaggccggccgtgtcccacccgtagtcgccggg 956
to top
>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           3C (LHCP) mRNA, partial cds
          Length = 661

 Score =  521 bits (263), Expect = e-145
 Identities = 488/563 (86%)
 Strand = Plus / Minus

                                                                       
Query: 143 aagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgagg 202
           ||||||||||| || ||||| || |||||||||||||| ||||||||||| ||||| | |
Sbjct: 658 aagttggtggcaaacgcccaggcattgttgttgacgggatcggcaaggtgatcggccaag 599

                                                                       
Query: 203 ttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaac 262
           ||||||| ||| |||||||| || || || ||||| || || || |||||||| ||||||
Sbjct: 598 ttctccagtggccccttgcccgtcacgatcgcctgaacaaagaacccgaacatcgagaac 539

                                                                       
Query: 263 atggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcg 322
           || || || |  || |||||||||||||||||||| |||||||| || ||||| || |||
Sbjct: 538 atagccagcctgccattcttgatctccttcaccttcagctcggcaaaggcctctggatcg 479

                                                                       
Query: 323 tcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcgacgatctcgccg 382
           ||||||||||| | |||||||||||| || |||||||| || |||||||||| |||||||
Sbjct: 478 tcggcgaggcccaaggggtcgaagctgccgccggggtacagtgggtcgacgacctcgccg 419

                                                                       
Query: 383 agcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacctggcaagcc 442
           ||||| |||||||| || | ||| ||||||||||| |||||||| | ||||||    |||
Sbjct: 418 agcggcccgccggcaactctgtatccctcgacggcccccatgagaaggacctgagtcgcc 359

                                                                       
Query: 443 cagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccg 502
           || ||||| || ||||||||||||||||| ||||| |||||||| |||||||| |  |||
Sbjct: 358 catatggccagaatgctctgtgcgtggaccaggctagggttgcccaggtagtccaatccg 299

                                                                       
Query: 503 ccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacgccg 562
           ||||||||||||||||||| |||||||||||||||||| |||||||||||||| ||||||
Sbjct: 298 ccctcgctgaagatctgggcgccggccttgaaccagaccgcctcgccgaacttcacgccg 239

                                                                       
Query: 563 ttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccggcag 622
           ||||||||||| ||||||||||||||||||||||| ||||| ||||| ||||||| ||||
Sbjct: 238 ttgcgggcgaggagctcggggaagacgcagccgagagcgcccagcattgcccacctgcag 179

                                                                       
Query: 623 tggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccccgca 682
           ||||||||||| ||||||||||||||||| || ||||||||||| || |||||||| || 
Sbjct: 178 tggatcacctcgagctcccggttcttggcgaatgtctcggggtccgctgagagcccggcg 119

                                  
Query: 683 gtgtcccatccgtagtcaccggg 705
           |||||||| |||||||| |||||
Sbjct: 118 gtgtcccagccgtagtcgccggg 96
to top
>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b-
           binding protein ( LHCP )
          Length = 1030

 Score =  498 bits (251), Expect = e-137
 Identities = 497/579 (85%)
 Strand = Plus / Minus

                                                                       
Query: 127 ttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 186
           |||||||||||| || |||||||||||||||||||| || |||||||| |||||||||||
Sbjct: 975 ttacttgccggggacgaagttggtggcgaaggcccaggcattgttgtttacggggtcggc 916

                                                                       
Query: 187 aaggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaa 246
            || ||||| || | |||||| |  || ||||| || ||||| |||||||||||||| ||
Sbjct: 915 gagatggtccgccaagttctcgaggggccccttcccggtgacgatggcctgcacgaagaa 856

                                                                       
Query: 247 gccgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggc 306
            |||||||||||||||||||| ||||||||||||||||||||||| ||||| ||||||||
Sbjct: 855 tccgaacatggagaacatggccaggcgtccgttcttgatctccttgaccttcagctcggc 796

                                                                       
Query: 307 gaacgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggg 366
           ||| || || | |||||| ||||| ||||||||||| ||||| || |||||||| |||||
Sbjct: 795 gaaggcttccgcgtcgtccgcgagcccgagggggtcaaagctgccgccggggtacagggg 736

                                                                       
Query: 367 gtcgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgag 426
           ||| || | |||||| || || |||||||| || |||||||| |||||||| ||||||||
Sbjct: 735 gtccaccacctcgcccaggggaccgccggccacgcggtagccttcgacggcacccatgag 676

                                                                       
Query: 427 cacgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgcc 486
            || |||||||| ||||||||||| ||||||||||| |||||||| |||  |||||| ||
Sbjct: 675 gaccacctggcaggcccagatggccaggatgctctgcgcgtggaccagggaggggttccc 616

                                                                       
Query: 487 gaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctc 546
            ||||| |  || ||||||||||| ||||||||||| ||   ||||||||| ||||||||
Sbjct: 615 caggtactgcagcccgccctcgctaaagatctgggaacccttcttgaaccacacggcctc 556

                                                                       
Query: 547 gccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgag 606
           ||| |||||||||||||| |||||||| ||||| ||||||||||| |||||||| || ||
Sbjct: 555 gccaaacttgacgccgttccgggcgaggagctccgggaagacgcacccgagcgcccccag 496

                                                                       
Query: 607 catggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtc 666
           ||| ||||| || | |||||||||||||||||| ||||||||||| ||||||||||||||
Sbjct: 495 catcgcccagcgcccgtggatcacctccagctcgcggttcttggcgaaggtctcggggtc 436

                                                  
Query: 667 ggcagagagccccgcagtgtcccatccgtagtcaccggg 705
           |||   |||||| || |||||||| |||||||| |||||
Sbjct: 435 ggcgctgagcccggccgtgtcccacccgtagtctccggg 397
to top
>gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b-binding protein
           mRNA, partial cds
          Length = 575

 Score =  494 bits (249), Expect = e-136
 Identities = 414/469 (88%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||||||||| |||||||||||||| || ||||| || |||||||||||||||||||| |
Sbjct: 470 acttgccggggacaaagttggtggcaaaagcccaggcattgttgttgacggggtcggcga 411

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           |||| ||||| | |||||||||||| |||||||| || || || ||||| ||||| ||||
Sbjct: 410 ggtgatcggccaagttctccaatggccccttgccggtcacgatcgcctggacgaagaagc 351

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           |||||||||| |||||||| || |  || |||||||||||||||||||| ||||||||||
Sbjct: 350 cgaacatggataacatggccagcctgccattcttgatctccttcaccttcagctcggcga 291

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           | ||||||||||||||||||||||| || ||||||||||| || |||||||| |||||||
Sbjct: 290 aggcctcggggtcgtcggcgaggccaagcgggtcgaagctgccgccggggtaaagggggt 231

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           |||| | ||||||||| || || ||||| || | ||| ||||||||||| |||||||| |
Sbjct: 230 cgaccacctcgccgaggggcccaccggcaaccctgtatccctcgacggcccccatgagaa 171

                                                                       
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
            |||||||   ||||||||||| ||||||||||| ||||||||||||||||||||||| |
Sbjct: 170 ggacctgggtggcccagatggccaggatgctctgcgcgtggacgaggctggggttgccca 111

                                                                       
Query: 489 ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
           ||||||| |  ||||||||||||||||||||||  ||||||||||||||||| |||||||
Sbjct: 110 ggtagtccaatccgccctcgctgaagatctgggctccggccttgaaccagaccgcctcgc 51

                                                            
Query: 549 cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgag 597
           ||||||| ||||||||||||||||| |||||||||||||||||||||||
Sbjct: 50  cgaacttcacgccgttgcgggcgaggagctcggggaagacgcagccgag 2
to top
>dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-E02, full
           insert sequence
          Length = 650

 Score =  468 bits (236), Expect = e-128
 Identities = 347/384 (90%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||| |
Sbjct: 384 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 325

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           ||||||||||||||||||| |  ||||||||||| ||||| |||||||| |||||  |||
Sbjct: 324 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagcagc 265

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           ||||| ||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||
Sbjct: 264 cgaacctggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgcga 205

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           | ||||| |||||||||||||||||||| ||||||||||| || ||||||||||| ||||
Sbjct: 204 aggcctccgggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcgggt 145

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           |||||| |||||||||||| ||||||||||  ||||| ||||||||||||||||||||||
Sbjct: 144 cgacgacctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgagca 85

                                                                       
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
           | ||||||   ||||||||||||||||||||||| |||||||  ||||| ||||||||||
Sbjct: 84  ccacctggaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccga 25

                                   
Query: 489 ggtagtcgaggccgccctcgctga 512
           |||||||||| |||||||||||||
Sbjct: 24  ggtagtcgagcccgccctcgctga 1
to top
>gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           40 mRNA, complete cds
          Length = 859

 Score =  456 bits (230), Expect = e-125
 Identities = 422/478 (88%), Gaps = 6/478 (1%)
 Strand = Plus / Minus

                                                                       
Query: 233 gcctgcacgaaaaagccgaa-catggagaacatggcaaggcgt-ccgttcttgatctcct 290
           ||||| || ||||||||||| ||||||||||| ||| | || | ||||||||||||||||
Sbjct: 753 gcctggacaaaaaagccgaaacatggagaacagggccaagcctgccgttcttgatctcct 694

                                                                       
Query: 291 tcaccttgagctcggcgaacgcctcggggtcgtcggcgaggccgagggggtcgaagctac 350
           ||||||| ||||||||||| ||||||||||||||||||||||| || ||||||||||| |
Sbjct: 693 tcaccttcagctcggcgaaggcctcggggtcgtcggcgaggccaagcgggtcgaagctgc 634

                                                                       
Query: 351 caccggggtagagggggtcgacgatct-cgccgagcgggccgccggcgacacg-gtagcc 408
           | |||||||| ||||||||||| | || ||||||| || || ||||| || |  ||| ||
Sbjct: 633 cgccggggtaaagggggtcgaccaccttcgccgaggggcccaccggcaacccttgtatcc 574

                                                                       
Query: 409 ctcgacggcgccc-atgagcacgacctggcaagcccagatggcgaggatgctctgtgcgt 467
            |||||||| ||| ||||| | |||||||   ||||||||||| ||||||||||| ||||
Sbjct: 573 -tcgacggccccccatgaggaggacctgggtggcccagatggccaggatgctctgcgcgt 515

                                                                       
Query: 468 ggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaagatctgggagccgg 527
           ||||||||||||||||||| |||||||| |  ||||||||||||||||||||||  ||||
Sbjct: 514 ggacgaggctggggttgcccaggtagtccaatccgccctcgctgaagatctgggctccgg 455

                                                                       
Query: 528 ccttgaaccagacggcctcgccgaacttgacgccgttgcgggcgagcagctcggggaaga 587
           ||||||||||||| |||||||||||||| ||||||||||||||||| |||||||||||||
Sbjct: 454 ccttgaaccagaccgcctcgccgaacttcacgccgttgcgggcgaggagctcggggaaga 395

                                                                       
Query: 588 cgcagccgagcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttct 647
           |||||||||| || || ||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 394 cgcagccgagagcacccagcatggcccaccggcagtggatcacctcgagctcccggttct 335

                                                                     
Query: 648 tggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccgtagtcaccggg 705
           |||  ||||||||||||||||| |||||||| || |||||||| |||||||| |||||
Sbjct: 334 tggagaaggtctcggggtcggcggagagcccggcggtgtcccacccgtagtcgccggg 277
to top
>gb|AY109324.1| Zea mays CL187_1 mRNA sequence
          Length = 2262

 Score =  442 bits (223), Expect = e-121
 Identities = 331/367 (90%)
 Strand = Plus / Minus

                                                                        
Query: 129  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
            |||||||||| || |||||||||||| ||||||| |||||||||||||||||||||||||
Sbjct: 1808 acttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggcaa 1749

                                                                        
Query: 189  ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             |||||| ||||||||||| |  |||||||| || ||||| |||||||| ||||| || |
Sbjct: 1748 tgtggtcagcgaggttctcgagcgggcccttcccggtgacgatggcctggacgaagaatc 1689

                                                                        
Query: 249  cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
            ||||||||||||||||||| ||||| || ||||||| |||||||||||||||||| ||||
Sbjct: 1688 cgaacatggagaacatggcgaggcggcccttcttgagctccttcaccttgagctcagcga 1629

                                                                        
Query: 309  acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
            | ||||||||||||||||||||||| || ||||||||||| || ||||| ||||| ||||
Sbjct: 1628 aggcctcggggtcgtcggcgaggcccagcgggtcgaagctgccgccgggatagagcgggt 1569

                                                                        
Query: 369  cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
            |||||| |||||||||||| ||||||||||  ||||||||||||||||||||||||||||
Sbjct: 1568 cgacgacctcgccgagcggtccgccggcgatgcggtagccctcgacggcgcccatgagca 1509

                                                                        
Query: 429  cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
            |||||||||| ||||||||||||||||||||||| ||||||| |||||| |||||| |||
Sbjct: 1508 cgacctggcaggcccagatggcgaggatgctctgcgcgtggatgaggctcgggttgacga 1449

                   
Query: 489  ggtagtc 495
            |||||||
Sbjct: 1448 ggtagtc 1442



 Score =  232 bits (117), Expect = 1e-57
 Identities = 159/173 (91%)
 Strand = Plus / Minus

                                                                        
Query: 527  gccttgaaccagacggcctcgccgaacttgacgccgttgcgggcgagcagctcggggaag 586
            ||||||||||  ||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 1410 gccttgaacccaacggcctcgccgaacttgacgccgttgcgggcgagcagctccgggaag 1351

                                                                        
Query: 587  acgcagccgagcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttc 646
            ||||||||||||||||| ||||||||||| ||| ||||||||||||||||||||||||||
Sbjct: 1350 acgcagccgagcgcgcccagcatggcccagcgggagtggatcacctccagctcccggttc 1291

                                                                 
Query: 647  ttggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccgtagtc 699
            ||||| || ||||| ||||| || || |||||||| |||||||| ||||||||
Sbjct: 1290 ttggcgaacgtctccgggtccgccgacagccccgcggtgtcccagccgtagtc 1238
to top
>gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/b binding protein
           (CipLhcb1) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 975

 Score =  432 bits (218), Expect = e-118
 Identities = 485/574 (84%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| || |||||||||||| ||||||| |||||||||||||| ||||| ||||
Sbjct: 848 actttccggggacgaagttggtggcgtaggcccaggcgttgttgttgactgggtcagcaa 789

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           ||||||||||||||||||||||||| ||||| || |||||||||||||| ||||| || |
Sbjct: 788 ggtggtcggcgaggttctccaatggtccctttccggtgacaatggcctggacgaagaacc 729

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           |||||| |||||||||||| |  |  ||||||||||  ||||| ||||||||||||||||
Sbjct: 728 cgaacacggagaacatggccaacctaccgttcttgagttccttgaccttgagctcggcga 669

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           | ||||| |||||||| ||||| || |  ||||||||||| |||||||||||   |||||
Sbjct: 668 aagcctctgggtcgtcagcgagacccaatgggtcgaagctgccaccggggtaagtggggt 609

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           |   || ||| ||||| || || ||||| | |||||| |||||||||||||||||||| |
Sbjct: 608 cagtgacctcaccgagaggcccaccggcaatacggtaaccctcgacggcgcccatgagga 549

                                                                       
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
            ||| |||   ||||||||||||||||||||||| ||||||| |||||| |||||||| |
Sbjct: 548 tgacttgggtggcccagatggcgaggatgctctgagcgtggatgaggcttgggttgccca 489

                                                                       
Query: 489 ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
            ||||||||| || |||||||||||||||||||| ||||| |||||||||||||||||||
Sbjct: 488 agtagtcgagcccaccctcgctgaagatctgggaaccggctttgaaccagacggcctcgc 429

                                                                       
Query: 549 cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
           |||| || || ||||||||||  |   | ||||||||||||  ||| |  || || ||||
Sbjct: 428 cgaatttcacaccgttgcgggacaagggttcggggaagacgatgcccaaggctcccagca 369

                                                                       
Query: 609 tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
           ||||||||| | ||||||| || |||| ||| |||||| |||| |||||||| ||||| |
Sbjct: 368 tggcccacctggagtggatgacttccaactcacggttcctggcgaaggtctctgggtcag 309

                                             
Query: 669 cagagagccccgcagtgtcccatccgtagtcacc 702
           | || ||||| ||||||||||| |||||||||||
Sbjct: 308 cggaaagcccagcagtgtcccaaccgtagtcacc 275
to top
>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete
             sequence
          Length = 139771

 Score =  426 bits (215), Expect = e-116
 Identities = 482/571 (84%)
 Strand = Plus / Plus

                                                                         
Query: 129   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
             |||||||||| || |||||||||||| | ||||| |||||||||  |||||||||||| |
Sbjct: 78974 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcga 79033

                                                                         
Query: 189   ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
              |||||||  ||||||||| |  ||||||||||| ||||| |||||||| ||||| ||||
Sbjct: 79034 cgtggtcgaagaggttctcgatggggcccttgccggtgacgatggcctggacgaagaagc 79093

                                                                         
Query: 249   cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
             ||||||||||||||||||| ||||| |||||||||| |||||||||||||||||||||||
Sbjct: 79094 cgaacatggagaacatggcgaggcggccgttcttgagctccttcaccttgagctcggcga 79153

                                                                         
Query: 309   acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
             | |  || |||||||||||||||||||| |||||||||   || || ||||| |    ||
Sbjct: 79154 aggtgtcagggtcgtcggcgaggccgagcgggtcgaaggcgccgcctgggtacaccttgt 79213

                                                                         
Query: 369   cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
             ||| |  ||||||||||||||||||| |||| |||||||||||||||   ||||||||||
Sbjct: 79214 cgaggccctcgccgagcgggccgccgccgacgcggtagccctcgacgaatcccatgagca 79273

                                                                         
Query: 429   cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
             | ||||||   ||||||||||||||||||||||| ||||| || ||| ||||||| || |
Sbjct: 79274 ccacctggaccgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttcccca 79333

                                                                         
Query: 489   ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
             |||||||||| || ||||||  ||||||||| | ||||||||||||||| || ||||| |
Sbjct: 79334 ggtagtcgagccccccctcggagaagatctgcgcgccggccttgaaccacaccgcctccc 79393

                                                                         
Query: 549   cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
             ||||||| || |||||   ||  || | ||| |||||||||||||| ||||| || ||||
Sbjct: 79394 cgaacttcaccccgttcttggacaggatctccgggaagacgcagcccagcgcccccagca 79453

                                                                         
Query: 609   tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
             | ||||||||  ||||||||||||||||||||| |||| | || || ||||| |||||||
Sbjct: 79454 tcgcccaccgcgagtggatcacctccagctccctgttcctcgcgaacgtctccgggtcgg 79513

                                            
Query: 669   cagagagccccgcagtgtcccatccgtagtc 699
             | || |||||||| |||||||| ||||||||
Sbjct: 79514 ccgatagccccgccgtgtcccacccgtagtc 79544
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  426 bits (215), Expect = e-116
 Identities = 482/571 (84%)
 Strand = Plus / Minus

                                                                            
Query: 129      acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
                |||||||||| || |||||||||||| | ||||| |||||||||  |||||||||||| |
Sbjct: 21808842 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcga 21808783

                                                                            
Query: 189      ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
                 |||||||  ||||||||| |  ||||||||||| ||||| |||||||| ||||| ||||
Sbjct: 21808782 cgtggtcgaagaggttctcgatggggcccttgccggtgacgatggcctggacgaagaagc 21808723

                                                                            
Query: 249      cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
                ||||||||||||||||||| ||||| |||||||||| |||||||||||||||||||||||
Sbjct: 21808722 cgaacatggagaacatggcgaggcggccgttcttgagctccttcaccttgagctcggcga 21808663

                                                                            
Query: 309      acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
                | |  || |||||||||||||||||||| |||||||||   || || ||||| |    ||
Sbjct: 21808662 aggtgtcagggtcgtcggcgaggccgagcgggtcgaaggcgccgcctgggtacaccttgt 21808603

                                                                            
Query: 369      cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
                ||| |  ||||||||||||||||||| |||| |||||||||||||||   ||||||||||
Sbjct: 21808602 cgaggccctcgccgagcgggccgccgccgacgcggtagccctcgacgaatcccatgagca 21808543

                                                                            
Query: 429      cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
                | ||||||   ||||||||||||||||||||||| ||||| || ||| ||||||| || |
Sbjct: 21808542 ccacctggaccgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttcccca 21808483

                                                                            
Query: 489      ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
                |||||||||| || ||||||  ||||||||| | ||||||||||||||| || ||||| |
Sbjct: 21808482 ggtagtcgagccccccctcggagaagatctgcgcgccggccttgaaccacaccgcctccc 21808423

                                                                            
Query: 549      cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
                ||||||| || |||||   ||  || | ||| |||||||||||||| ||||| || ||||
Sbjct: 21808422 cgaacttcaccccgttcttggacaggatctccgggaagacgcagcccagcgcccccagca 21808363

                                                                            
Query: 609      tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
                | ||||||||  ||||||||||||||||||||| |||| | || || ||||| |||||||
Sbjct: 21808362 tcgcccaccgcgagtggatcacctccagctccctgttcctcgcgaacgtctccgggtcgg 21808303

                                               
Query: 669      cagagagccccgcagtgtcccatccgtagtc 699
                | || |||||||| |||||||| ||||||||
Sbjct: 21808302 ccgatagccccgccgtgtcccacccgtagtc 21808272
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  426 bits (215), Expect = e-116
 Identities = 482/571 (84%)
 Strand = Plus / Minus

                                                                            
Query: 129      acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
                |||||||||| || |||||||||||| | ||||| |||||||||  |||||||||||| |
Sbjct: 21801871 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcga 21801812

                                                                            
Query: 189      ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
                 |||||||  ||||||||| |  ||||||||||| ||||| |||||||| ||||| ||||
Sbjct: 21801811 cgtggtcgaagaggttctcgatggggcccttgccggtgacgatggcctggacgaagaagc 21801752

                                                                            
Query: 249      cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
                ||||||||||||||||||| ||||| |||||||||| |||||||||||||||||||||||
Sbjct: 21801751 cgaacatggagaacatggcgaggcggccgttcttgagctccttcaccttgagctcggcga 21801692

                                                                            
Query: 309      acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
                | |  || |||||||||||||||||||| |||||||||   || || ||||| |    ||
Sbjct: 21801691 aggtgtcagggtcgtcggcgaggccgagcgggtcgaaggcgccgcctgggtacaccttgt 21801632

                                                                            
Query: 369      cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
                ||| |  ||||||||||||||||||| |||| |||||||||||||||   ||||||||||
Sbjct: 21801631 cgaggccctcgccgagcgggccgccgccgacgcggtagccctcgacgaatcccatgagca 21801572

                                                                            
Query: 429      cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
                | ||||||   ||||||||||||||||||||||| ||||| || ||| ||||||| || |
Sbjct: 21801571 ccacctggaccgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttcccca 21801512

                                                                            
Query: 489      ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
                |||||||||| || ||||||  ||||||||| | ||||||||||||||| || ||||| |
Sbjct: 21801511 ggtagtcgagccccccctcggagaagatctgcgcgccggccttgaaccacaccgcctccc 21801452

                                                                            
Query: 549      cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
                ||||||| || |||||   ||  || | ||| |||||||||||||| ||||| || ||||
Sbjct: 21801451 cgaacttcaccccgttcttggacaggatctccgggaagacgcagcccagcgcccccagca 21801392

                                                                            
Query: 609      tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
                | ||||||||  ||||||||||||||||||||| |||| | || || ||||| |||||||
Sbjct: 21801391 tcgcccaccgcgagtggatcacctccagctccctgttcctcgcgaacgtctccgggtcgg 21801332

                                               
Query: 669      cagagagccccgcagtgtcccatccgtagtc 699
                | || |||||||| |||||||| ||||||||
Sbjct: 21801331 ccgatagccccgccgtgtcccacccgtagtc 21801301
to top
>dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075I09, full
           insert sequence
          Length = 1106

 Score =  418 bits (211), Expect = e-113
 Identities = 481/571 (84%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||||||||| || |||||||||||| | ||||| |||||||||  |||||||||||| |
Sbjct: 841 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcga 782

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
            |||||||  ||||||||| |  ||||||||||| ||||| |||||||| ||||| ||||
Sbjct: 781 cgtggtcgaagaggttctcgatggggcccttgccggtgacgatggcctggacgaagaagc 722

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           ||||||||||||||||||| ||||| |||||||||| |||||||||||||||||||||||
Sbjct: 721 cgaacatggagaacatggcgaggcggccgttcttgagctccttcaccttgagctcggcga 662

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           | |  || |||||||||||||||||||| |||||||||   || || ||||| |    ||
Sbjct: 661 aggtgtcagggtcgtcggcgaggccgagcgggtcgaaggcgccgcctgggtacaccttgt 602

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           ||| |  ||||||||||||||||||| |||| |||||||||||||||   ||||||||||
Sbjct: 601 cgaggccctcgccgagcgggccgccgccgacgcggtagccctcgacgaatcccatgagca 542

                                                                       
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
           | ||||||   ||||||||||||||||||||||| ||||| || ||| ||||||| || |
Sbjct: 541 ccacctggaccgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttcccca 482

                                                                       
Query: 489 ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
           |||||||||| || ||||||  ||||||||| | ||||||||||||||| || ||||| |
Sbjct: 481 ggtagtcgagccccccctcggagaagatctgcgcgccggccttgaaccacaccgcctccc 422

                                                                       
Query: 549 cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
           ||||||| || |||||   ||  || | ||| |||||||||||||| ||||| || ||||
Sbjct: 421 cgaacttcaccccgttcttggacaggatctccgggaagacgcagcccagcgcccccagca 362

                                                                       
Query: 609 tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
           | ||||||||  ||||||||||||||||||||| |||| | || || ||||| |||||||
Sbjct: 361 tcgcccaccgcgagtggatcacctccagctccctgttcctcgcgaacgtctccgggtcgg 302

                                          
Query: 669 cagagagccccgcagtgtcccatccgtagtc 699
           | || |||||||| |||||||| | ||||||
Sbjct: 301 ccgatagccccgccgtgtcccacctgtagtc 271
to top
>emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chlorophyll a/b-binding
           protein
          Length = 1126

 Score =  402 bits (203), Expect = e-109
 Identities = 437/515 (84%)
 Strand = Plus / Minus

                                                                       
Query: 131 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaagg 190
           |||||||| || ||||| |||||| | ||||| |||||||||  |||||||||||| | |
Sbjct: 824 ttgccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggcgacg 765

                                                                       
Query: 191 tggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccg 250
           ||||||  ||||||||| |  ||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 764 tggtcgaagaggttctcgatggggcccttgccggtgacgatggcctgcacgaagaagccg 705

                                                                       
Query: 251 aacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaac 310
           ||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||   
Sbjct: 704 aacatggagaacatggcaaggcggccgttcttgagctccttcaccttgagctcggcggcg 645

                                                                       
Query: 311 gcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcg 370
           |  || ||||||||||||||||| || || ||||||  ||| |||||||| |    ||||
Sbjct: 644 gtgtccgggtcgtcggcgaggcccagcggttcgaaggcaccgccggggtacaccttgtcg 585

                                                                       
Query: 371 acgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacg 430
           |     || ||||||||||| ||| |||| | |||||||||||||  |||||||||||| 
Sbjct: 584 agcccttccccgagcgggcctccgccgacgccgtagccctcgacgaagcccatgagcacc 525

                                                                       
Query: 431 acctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgagg 490
           |||||||| ||||||||||| ||||||||||||||||| || ||| ||||||| || |||
Sbjct: 524 acctggcacgcccagatggccaggatgctctgtgcgtgcaccaggttggggttccccagg 465

                                                                       
Query: 491 tagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccg 550
           ||||| || ||||||||   ||||||||| | ||||||||||||||| || |||||||||
Sbjct: 464 tagtccagcccgccctccgagaagatctgcgcgccggccttgaaccacaccgcctcgccg 405

                                                                       
Query: 551 aacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatg 610
           ||||||||||||||   ||| || | ||| ||||| |||||||| |||||||| ||||| 
Sbjct: 404 aacttgacgccgttcttggccaggatctccgggaacacgcagcccagcgcgcccagcatc 345

                                              
Query: 611 gcccaccggcagtggatcacctccagctcccggtt 645
           ||||||||| |||||||||||||||||||||||||
Sbjct: 344 gcccaccgggagtggatcacctccagctcccggtt 310
to top
>gb|AY389553.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           (CAB) mRNA, partial cds
          Length = 720

 Score =  398 bits (201), Expect = e-108
 Identities = 336/381 (88%)
 Strand = Plus / Minus

                                                                       
Query: 325 ggcgaggccgagggggtcgaagctaccaccggggtagagggggtcgacgatctcgccgag 384
           ||||||||| | |||||||||||| || |||||||| || |||||||||| |||||||||
Sbjct: 641 ggcgaggcccaaggggtcgaagctgccgccggggtacagtgggtcgacgacctcgccgag 582

                                                                       
Query: 385 cgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacctggcaagccca 444
           ||| |||||||| || | ||| ||||||||||| |||||||| | ||||||    |||||
Sbjct: 581 cggcccgccggcaactctgtatccctcgacggcccccatgagaaggacctgagtcgccca 522

                                                                       
Query: 445 gatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgcc 504
            ||||| || ||||||||||||||||| ||||| |||||||| |||||||| |  |||||
Sbjct: 521 tatggccagaatgctctgtgcgtggaccaggctagggttgcccaggtagtccaatccgcc 462

                                                                       
Query: 505 ctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacgccgtt 564
           ||||||||||||||||| |||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 461 ctcgctgaagatctgggcgccggccttgaaccagaccgcctcgccgaacttcacgccgtt 402

                                                                       
Query: 565 gcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccggcagtg 624
           ||||||||| ||||||||||||||||||||||| ||||| ||||| ||||||| ||||||
Sbjct: 401 gcgggcgaggagctcggggaagacgcagccgagagcgcccagcattgcccacctgcagtg 342

                                                                       
Query: 625 gatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccccgcagt 684
           ||||||||| ||||||||||||||||| || ||||||||||| || |||||||| || ||
Sbjct: 341 gatcacctcgagctcccggttcttggcgaatgtctcggggtccgctgagagcccggcggt 282

                                
Query: 685 gtcccatccgtagtcaccggg 705
           |||||| |||||||| |||||
Sbjct: 281 gtcccagccgtagtcgccggg 261
to top
>dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRNA for type II
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 989

 Score =  394 bits (199), Expect = e-106
 Identities = 478/571 (83%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||||||||| || |||||||||||| | | ||| |||||||||  |||||||||||  |
Sbjct: 822 acttgccggggacgaagttggtggcgtatgaccaggcgttgttggcgacggggtcggtga 763

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
            |||||||  ||||||||| |  ||||||||||| ||||| |||||||| ||||| || |
Sbjct: 762 cgtggtcgaagaggttctcgatggggcccttgccggtgacgatggcctggacgaagaatc 703

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           ||||||||||||||||||| ||||| |||||||||| |||||||||||||||||||||||
Sbjct: 702 cgaacatggagaacatggcgaggcggccgttcttgagctccttcaccttgagctcggcga 643

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           | |  || |||||||||||||||||||| |||||||||   || || ||||| |    ||
Sbjct: 642 aggtgtcagggtcgtcggcgaggccgagcgggtcgaaggcgccgcctgggtacaccttgt 583

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           ||| |  ||||||||||||||||||| |||| |||||||||||||||   ||||||||||
Sbjct: 582 cgaggccctcgccgagcgggccgccgccgacgcggtagccctcgacgaatcccatgagca 523

                                                                       
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
           | ||||||   ||||||||||||||||||||||| ||||| || ||| ||||||| || |
Sbjct: 522 ccacctggaccgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttcccca 463

                                                                       
Query: 489 ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
           |||||||||| || ||||||  ||||||||| | ||||||||||||||| || ||||| |
Sbjct: 462 ggtagtcgagccccccctcggagaagatctgcgcgccggccttgaaccacaccgcctccc 403

                                                                       
Query: 549 cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
           ||||||| || |||||   ||  || | ||| |||||||||||||| ||||| || ||||
Sbjct: 402 cgaacttcaccccgttcttggacaggatctccgggaagacgcagcccagcgcccccagca 343

                                                                       
Query: 609 tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
           | ||||||||  ||||||||| ||||||||||| |||| | || || ||||| |||||||
Sbjct: 342 tcgcccaccgcgagtggatcaactccagctccctgttcctcgcgaacgtctccgggtcgg 283

                                          
Query: 669 cagagagccccgcagtgtcccatccgtagtc 699
           | || |||||||| |||||||| ||||||||
Sbjct: 282 ccgatagccccgccgtgtcccacccgtagtc 252
to top
>gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB)
           mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1042

 Score =  385 bits (194), Expect = e-103
 Identities = 479/574 (83%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||||||||| || |||||||||||||||||||| || ||||||||||| ||||| ||||
Sbjct: 826 acttgccgggaacgaagttggtggcgaaggcccaagcattgttgttgactgggtcagcaa 767

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           ||||||| ||||||||||||||||||||||| ||||| |||||||| || || || || |
Sbjct: 766 ggtggtctgcgaggttctccaatgggccctttccagtcacaatggcttggacaaagaatc 707

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           |||||||||||||||| || |  |  ||||||||||||||||| ||||| | ||| ||||
Sbjct: 706 cgaacatggagaacatagccaatctaccgttcttgatctccttgaccttcaactcagcga 647

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           | || || ||||| || || ||||| |  |||||||||||||||||||||||||| ||||
Sbjct: 646 aggcttctgggtcttcagctaggcccaatgggtcgaagctaccaccggggtagagtgggt 587

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           ||   | ||| ||||| || || || || ||||| ||||| || |  |||||||| |  |
Sbjct: 586 cggttacctcaccgagaggcccaccagcaacacgatagccttcaatagcgcccatcaaga 527

                                                                       
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
           | |||||||||||||||||||| ||||||||||| || ||||| | ||| |||||||| |
Sbjct: 526 caacctggcaagcccagatggctaggatgctctgagcatggaccaagcttgggttgccca 467

                                                                       
Query: 489 ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
            |||||| ||||| ||||| |||||||| || |  |||||||||||||| |||||||| |
Sbjct: 466 agtagtcaaggccaccctcactgaagatttgtgcaccggccttgaaccatacggcctcac 407

                                                                       
Query: 549 cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
           |||||||||| |||||||| || |  ||||| |||||||| || || || || || | ||
Sbjct: 406 cgaacttgacaccgttgcgagccaagagctctgggaagacacatcccagagcacccaaca 347

                                                                       
Query: 609 tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
           | ||||| | ||||||||||||||| || || |||||||| ||||||||||| ||||| |
Sbjct: 346 tagcccatctgcagtggatcacctcaagttcgcggttcttagcaaaggtctctgggtcag 287

                                             
Query: 669 cagagagccccgcagtgtcccatccgtagtcacc 702
           ||||||| || ||||||||||| |||||||||||
Sbjct: 286 cagagagtccagcagtgtcccacccgtagtcacc 253
to top
>gb|AY389573.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           40 (LHCP) mRNA, partial cds
          Length = 712

 Score =  371 bits (187), Expect = 2e-99
 Identities = 392/459 (85%), Gaps = 1/459 (0%)
 Strand = Plus / Minus

                                                                       
Query: 248 ccgaacatggagaacatggcaaggcgtccgttcttgatctcc-ttcaccttgagctcggc 306
           |||||||| |||||||| || || |  || |||||||||| | |||||||| ||||||||
Sbjct: 639 ccgaacatcgagaacatagccagcctgccattcttgatcttcgttcaccttcagctcggc 580

                                                                       
Query: 307 gaacgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggg 366
            || ||||  || ||||| || ||||| || ||||||||||| || |||||||| |||||
Sbjct: 579 aaaagcctttggatcgtcagctaggcccagcgggtcgaagctgccgccggggtacagggg 520

                                                                       
Query: 367 gtcgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgag 426
           |||||| | ||||||||| ||||| ||||| || | ||| ||||| || || ||||||||
Sbjct: 519 gtcgacaacctcgccgagggggccaccggcaactctgtatccctcaacagctcccatgag 460

                                                                       
Query: 427 cacgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgcc 486
            || |||||    ||||||||||| || ||||||||||||||||| ||||| ||||| ||
Sbjct: 459 aacaacctgagttgcccagatggccagaatgctctgtgcgtggacaaggctagggtttcc 400

                                                                       
Query: 487 gaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctc 546
            |||||||| || |||||||||||||||||||| || |||||||||||||| || |||||
Sbjct: 399 caggtagtccagcccgccctcgctgaagatctgagatccggccttgaaccataccgcctc 340

                                                                       
Query: 547 gccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgag 606
           ||||||||| || ||||||||||| || ||||||||||||||||||||||| || || ||
Sbjct: 339 gccgaacttcacaccgttgcgggcaaggagctcggggaagacgcagccgagagcacccag 280

                                                                       
Query: 607 catggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtc 666
           ||| ||||||||||||||||||||||| |||||||||||||||||||| |||||||||||
Sbjct: 279 cattgcccaccggcagtggatcacctcgagctcccggttcttggcaaatgtctcggggtc 220

                                                  
Query: 667 ggcagagagccccgcagtgtcccatccgtagtcaccggg 705
            || |||||||| || |||||||| |||||||| |||||
Sbjct: 219 cgcggagagcccggcggtgtcccagccgtagtcgccggg 181
to top
>emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1050

 Score =  357 bits (180), Expect = 3e-95
 Identities = 465/560 (83%)
 Strand = Plus / Minus

                                                                       
Query: 143 aagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgagg 202
           ||||| || ||| ||||||| ||||||||| | || |||||||| ||||| || ||||| 
Sbjct: 836 aagttagtagcgtaggcccaggcgttgttggtaaccgggtcggccaggtgatcagcgaga 777

                                                                       
Query: 203 ttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaac 262
           ||||| |  || || || || ||||| |||||||| ||||| || |||||||| || |||
Sbjct: 776 ttctcgatgggtcctttaccggtgacgatggcctggacgaagaatccgaacatagaaaac 717

                                                                       
Query: 263 atggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcg 322
           ||||| |  || |||||||||| |||||||||||| ||||| ||||| || || ||||||
Sbjct: 716 atggccaaccgcccgttcttgagctccttcaccttcagctccgcgaaagcgtccgggtcg 657

                                                                       
Query: 323 tcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcgacgatctcgccg 382
           || || |||||||| ||||||||||| || |||||||||| ||||||   |||||| |||
Sbjct: 656 tcagcaaggccgagcgggtcgaagctgcccccggggtagatggggtcagtgatctctccg 597

                                                                       
Query: 383 agcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacctggcaagcc 442
           || ||||| || || | |||||||||||| |||||||||||||| | ||||||||| |||
Sbjct: 596 agagggccacctgcaatacggtagccctccacggcgcccatgagaatgacctggcatgcc 537

                                                                       
Query: 443 cagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccg 502
           ||||| || ||||||||||| ||||| |  | ||| ||||| || |||||||| ||||| 
Sbjct: 536 cagattgcaaggatgctctgggcgtgaatcaagctagggtttcccaggtagtcaaggcct 477

                                                                       
Query: 503 ccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacgccg 562
           ||||||||||||||||| |  || ||||||||||| || ||||| ||||||||||| |||
Sbjct: 476 ccctcgctgaagatctgagctcccgccttgaaccacaccgcctccccgaacttgactccg 417

                                                                       
Query: 563 ttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccggcag 622
           || | ||| || ||||| ||||| |||||||| || ||||| ||||| |||||||||| |
Sbjct: 416 tttctggccaggagctccgggaaaacgcagcccagagcgcccagcattgcccaccggctg 357

                                                                       
Query: 623 tggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccccgca 682
           |||||||| |||||||| | |||||||||||| ||||| || || || || |||||||| 
Sbjct: 356 tggatcacttccagctctctgttcttggcaaacgtctccggatctgccgaaagccccgcc 297

                               
Query: 683 gtgtcccatccgtagtcacc 702
           |||||||| |||||||||||
Sbjct: 296 gtgtcccacccgtagtcacc 277
to top
>emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1062

 Score =  357 bits (180), Expect = 3e-95
 Identities = 465/560 (83%)
 Strand = Plus / Minus

                                                                       
Query: 143 aagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgagg 202
           ||||| || ||| ||||||| ||||||||| | || |||||||| ||||| || ||||| 
Sbjct: 833 aagttagtagcgtaggcccaggcgttgttggtaaccgggtcggccaggtgatcagcgaga 774

                                                                       
Query: 203 ttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaac 262
           ||||| |  || || || || ||||| |||||||| ||||| || |||||||| || |||
Sbjct: 773 ttctcgatgggtcctttaccggtgacgatggcctggacgaagaatccgaacatagaaaac 714

                                                                       
Query: 263 atggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcg 322
           ||||| |  || |||||||||| |||||||||||| ||||| ||||| || || ||||||
Sbjct: 713 atggccaaccgcccgttcttgagctccttcaccttcagctccgcgaaagcgtccgggtcg 654

                                                                       
Query: 323 tcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcgacgatctcgccg 382
           || || |||||||| ||||||||||| || |||||||||| ||||||   |||||| |||
Sbjct: 653 tcagcaaggccgagcgggtcgaagctgcccccggggtagatggggtcagtgatctctccg 594

                                                                       
Query: 383 agcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacctggcaagcc 442
           || ||||| || || | |||||||||||| |||||||||||||| | ||||||||| |||
Sbjct: 593 agagggccacctgcaatacggtagccctccacggcgcccatgagaatgacctggcatgcc 534

                                                                       
Query: 443 cagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccg 502
           ||||| || ||||||||||| ||||| |  | ||| ||||| || |||||||| ||||| 
Sbjct: 533 cagattgcaaggatgctctgggcgtgaatcaagctagggtttcccaggtagtcaaggcct 474

                                                                       
Query: 503 ccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacgccg 562
           ||||||||||||||||| |  || ||||||||||| || ||||| ||||||||||| |||
Sbjct: 473 ccctcgctgaagatctgagctcccgccttgaaccacaccgcctccccgaacttgactccg 414

                                                                       
Query: 563 ttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccggcag 622
           || | ||| || ||||| ||||| |||||||| || ||||| ||||| |||||||||| |
Sbjct: 413 tttctggccaggagctccgggaaaacgcagcccagagcgcccagcattgcccaccggctg 354

                                                                       
Query: 623 tggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccccgca 682
           |||||||| |||||||| | |||||||||||| ||||| || || || || |||||||| 
Sbjct: 353 tggatcacttccagctctctgttcttggcaaacgtctccggatctgccgaaagccccgcc 294

                               
Query: 683 gtgtcccatccgtagtcacc 702
           |||||||| |||||||||||
Sbjct: 293 gtgtcccacccgtagtcacc 274
to top
>emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll a/b binding protein
          Length = 1361

 Score =  355 bits (179), Expect = 1e-94
 Identities = 473/571 (82%)
 Strand = Plus / Minus

                                                                        
Query: 129  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
            |||| ||||| || |||||||||||  ||||||| |||||||||||||| ||  | ||||
Sbjct: 1040 actttccggggacgaagttggtggcataggcccaggcgttgttgttgacaggtccagcaa 981

                                                                        
Query: 189  ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
            |||| |||||||||||||||||||| ||||| || |||||||||||||| || || ||||
Sbjct: 980  ggtgatcggcgaggttctccaatggaccctttccggtgacaatggcctgaacaaagaagc 921

                                                                        
Query: 249  cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
            | ||||| ||||||||||| |  |||||||||||||  ||||||||||| ||||| || |
Sbjct: 920  caaacatagagaacatggccaatcgtccgttcttgagttccttcaccttaagctcagcaa 861

                                                                        
Query: 309  acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
            | ||||| ||||| || || ||||| |  ||||||||||| ||||| |||||||  ||||
Sbjct: 860  aagcctctgggtcatcagcaaggcccaatgggtcgaagctgccacctgggtagattgggt 801

                                                                        
Query: 369  cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
            |   || ||| ||||| ||||| || || | |||||| || || ||||| ||||| || |
Sbjct: 800  cagtgacctcaccgagggggccaccagcaatacggtaaccttcaacggcacccattagga 741

                                                                        
Query: 429  cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
              || ||    ||||||||||||||||||||||| |||||||  ||||| |||||||| |
Sbjct: 740  taacttgtgtggcccagatggcgaggatgctctgggcgtggatcaggcttgggttgccca 681

                                                                        
Query: 489  ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
             ||||||||| || |||||||||||||||||||| |||||||||||||| ||||| || |
Sbjct: 680  agtagtcgagcccaccctcgctgaagatctgggacccggccttgaaccacacggcttctc 621

                                                                        
Query: 549  cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
            ||||||| || ||||||||||  |||| ||| |||||||||||||| |  || |||||||
Sbjct: 620  cgaacttcaccccgttgcgggacagcaactccgggaagacgcagcccaaggctccgagca 561

                                                                        
Query: 609  tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
            ||||||||| | |||||||||| || || || ||||||||||| ||||| || ||||| |
Sbjct: 560  tggcccacctggagtggatcacttcgagttcacggttcttggcgaaggtttctgggtctg 501

                                           
Query: 669  cagagagccccgcagtgtcccatccgtagtc 699
            | || ||||| ||||||||||| ||||||||
Sbjct: 500  cggaaagcccagcagtgtcccagccgtagtc 470
to top
>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein
          Length = 1197

 Score =  347 bits (175), Expect = 3e-92
 Identities = 475/575 (82%)
 Strand = Plus / Minus

                                                                       
Query: 131 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaagg 190
           |||||||| || |||||||||||  ||||||| ||||||||| | ||||||||||| |||
Sbjct: 884 ttgccggggacgaagttggtggcataggcccaggcgttgttgctaacggggtcggccagg 825

                                                                       
Query: 191 tggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccg 250
           || || ||||||||||| |  || || || || ||||| |||||||||||||| || |||
Sbjct: 824 tgatcagcgaggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccg 765

                                                                       
Query: 251 aacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaac 310
           |||||||| |||||||| |  || ||||||||||||||||||||||| ||||| ||||| 
Sbjct: 764 aacatggaaaacatggccaaccgcccgttcttgatctccttcaccttcagctccgcgaaa 705

                                                                       
Query: 311 gcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcg 370
           || ||||||||||| || || || || ||||||||||| || |||||||||| |||||||
Sbjct: 704 gcgtcggggtcgtcagcaagtcccagcgggtcgaagctgcccccggggtagatggggtcg 645

                                                                       
Query: 371 acgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacg 430
              | ||| || || || ||||| || | |||||||||||| |||||||||||||| | |
Sbjct: 644 gtcacctctcccagaggaccgcccgcaatacggtagccctccacggcgcccatgaggatg 585

                                                                       
Query: 431 acctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgagg 490
           |||||||| |||||||| || || |||||||| ||||| || | ||| ||||| || |||
Sbjct: 584 acctggcatgcccagattgcaagaatgctctgcgcgtgaaccaagctagggtttcccagg 525

                                                                       
Query: 491 tagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccg 550
           ||||| || || ||||||||||| ||||| |  || ||||||||||| |||||||| |||
Sbjct: 524 tagtcaagccctccctcgctgaaaatctgagctcccgccttgaaccacacggcctcaccg 465

                                                                       
Query: 551 aacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatg 610
           ||||| || || || |  || || ||||| ||||| ||||| || || ||||| ||||| 
Sbjct: 464 aactttactccatttctcgccagaagctccgggaaaacgcaacccagagcgcccagcatt 405

                                                                       
Query: 611 gcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggca 670
           |||||||||| ||||||||| |||||||| | |||||| ||||| ||||| || || || 
Sbjct: 404 gcccaccggctgtggatcacttccagctctctgttcttcgcaaaagtctctggatctgcc 345

                                              
Query: 671 gagagccccgcagtgtcccatccgtagtcaccggg 705
           || |||||||| |||||||| ||||||||||||||
Sbjct: 344 gaaagccccgccgtgtcccacccgtagtcaccggg 310
to top
>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA,
           complete cds
          Length = 998

 Score =  347 bits (175), Expect = 3e-92
 Identities = 475/575 (82%)
 Strand = Plus / Minus

                                                                       
Query: 131 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaagg 190
           |||||||| || |||||||||||| ||||||| ||||||||||| |||||||| || |||
Sbjct: 860 ttgccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtcagccagg 801

                                                                       
Query: 191 tggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccg 250
           || || | ||||||||| |  || || || || |||||||||||||||||||| || |||
Sbjct: 800 tgatcagtgaggttctcgatgggtcctttcccggtgacaatggcctgcacgaagaatccg 741

                                                                       
Query: 251 aacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaac 310
           |||||||| |||||||| |  || ||||||||||||||||||||||| ||||| ||||| 
Sbjct: 740 aacatggaaaacatggccaaccgcccgttcttgatctccttcaccttcagctccgcgaaa 681

                                                                       
Query: 311 gcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcg 370
           || || |||||||| || || || || ||||||||||| || |||||||||| |||||||
Sbjct: 680 gcgtcagggtcgtccgcaagtcccagcgggtcgaagctgcccccggggtagatggggtcg 621

                                                                       
Query: 371 acgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacg 430
              | ||| || || || ||||| || | |||||| ||||| |||||||||||||| |  
Sbjct: 620 gtcacctctcccagaggaccgcccgcaatacggtatccctccacggcgcccatgaggata 561

                                                                       
Query: 431 acctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgagg 490
           |||||||| |||||||| || || |||||||| ||||| || | ||| ||||| || |||
Sbjct: 560 acctggcatgcccagattgcaagaatgctctgcgcgtgaaccaagctagggtttcccagg 501

                                                                       
Query: 491 tagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccg 550
           ||||| || || ||||||||||| ||||| |  |||||||||||||| |||||||| |||
Sbjct: 500 tagtcaagccctccctcgctgaaaatctgagctccggccttgaaccacacggcctccccg 441

                                                                       
Query: 551 aacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatg 610
           ||||| || || || |  || || ||||| ||||| ||||| || || ||||| ||||| 
Sbjct: 440 aactttactccatttctcgccagaagctccgggaaaacgcaacccagagcgcccagcatt 381

                                                                       
Query: 611 gcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggca 670
           |||||||||||||||||||| |||||||| | |||||| ||||| ||||| || || || 
Sbjct: 380 gcccaccggcagtggatcacttccagctctctgttcttcgcaaaagtctctggatctgcc 321

                                              
Query: 671 gagagccccgcagtgtcccatccgtagtcaccggg 705
           || |||||||| |||||||| ||||||||||||||
Sbjct: 320 gaaagccccgccgtgtcccacccgtagtcaccggg 286
to top
>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein
          Length = 2574

 Score =  347 bits (175), Expect = 3e-92
 Identities = 475/575 (82%)
 Strand = Plus / Minus

                                                                        
Query: 131  ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaagg 190
            |||||||| || |||||||||||  ||||||| ||||||||| | ||||||||||| |||
Sbjct: 1962 ttgccggggacgaagttggtggcataggcccaggcgttgttgctaacggggtcggccagg 1903

                                                                        
Query: 191  tggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccg 250
            || || ||||||||||| |  || || || || ||||| |||||||||||||| || |||
Sbjct: 1902 tgatcagcgaggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccg 1843

                                                                        
Query: 251  aacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaac 310
            |||||||| |||||||| |  || ||||||||||||||||||||||| ||||| ||||| 
Sbjct: 1842 aacatggaaaacatggccaaccgcccgttcttgatctccttcaccttcagctctgcgaaa 1783

                                                                        
Query: 311  gcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcg 370
            || ||||||||||| || || || || ||||||||||| || |||||||||| |||||||
Sbjct: 1782 gcgtcggggtcgtccgcaagtcccagcgggtcgaagctgcccccggggtagatggggtcg 1723

                                                                        
Query: 371  acgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacg 430
               | ||| || || || ||||| || | |||||||||||| |||||||||||||| | |
Sbjct: 1722 gtcacctctcccagaggaccgcccgcaatacggtagccctccacggcgcccatgaggatg 1663

                                                                        
Query: 431  acctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgagg 490
            |||||||| |||||||| || || |||||||| ||||| || | ||| ||||| || |||
Sbjct: 1662 acctggcatgcccagattgcaagaatgctctgcgcgtgaaccaagctagggtttcccagg 1603

                                                                        
Query: 491  tagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccg 550
            ||||| || || ||||||||||| ||||| |  || ||||||||||| |||||||| |||
Sbjct: 1602 tagtcaagccctccctcgctgaaaatctgagctcccgccttgaaccacacggcctcaccg 1543

                                                                        
Query: 551  aacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatg 610
            ||||| || || || |  || || ||||| ||||| ||||| || || ||||| ||||| 
Sbjct: 1542 aactttactccatttctcgccagaagctccgggaaaacgcaacccagagcgcccagcatt 1483

                                                                        
Query: 611  gcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggca 670
            |||||||||| ||||||||| |||||||| | |||||| ||||| ||||| || || || 
Sbjct: 1482 gcccaccggctgtggatcacttccagctctctgttcttcgcaaaagtctctggatctgcc 1423

                                               
Query: 671  gagagccccgcagtgtcccatccgtagtcaccggg 705
            || |||||||| |||||||| ||||||||||||||
Sbjct: 1422 gaaagccccgccgtgtcccacccgtagtcaccggg 1388
to top
>gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 759

 Score =  343 bits (173), Expect = 5e-91
 Identities = 438/527 (83%)
 Strand = Plus / Minus

                                                                       
Query: 176 acggggtcggcaaggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcc 235
           ||||||||||| ||||| || ||||||||||| |  || ||||| || ||||||||||||
Sbjct: 758 acggggtcggcgaggtgatcagcgaggttctcgatgggtcccttcccggtgacaatggcc 699

                                                                       
Query: 236 tgcacgaaaaagccgaacatggagaacatggcaaggcgtccgttcttgatctccttcacc 295
           || ||||| || ||||||||||| |||||||| | ||| |||||||||||||||||||||
Sbjct: 698 tgaacgaagaatccgaacatggaaaacatggccaagcgcccgttcttgatctccttcacc 639

                                                                       
Query: 296 ttgagctcggcgaacgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccg 355
           || ||||| ||||| || ||||||||||| || || || | |||||||||||| ||||||
Sbjct: 638 ttcagctccgcgaaagcgtcggggtcgtctgcaagtcccaaggggtcgaagctgccaccg 579

                                                                       
Query: 356 gggtagagggggtcgacgatctcgccgagcgggccgccggcgacacggtagccctcgacg 415
           ||||||| |||||||   | ||| || || ||||||||||| | |||||| ||||| |||
Sbjct: 578 gggtagatggggtcggtcacctctcccagagggccgccggcaatacggtaaccctccacg 519

                                                                       
Query: 416 gcgcccatgagcacgacctggcaagcccagatggcgaggatgctctgtgcgtggacgagg 475
           ||||||||||| | ||||||||| |||||||| || || |||||||| |||||||  |||
Sbjct: 518 gcgcccatgaggatgacctggcatgcccagattgcaagaatgctctgcgcgtggataagg 459

                                                                       
Query: 476 ctggggttgccgaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaac 535
           || ||||| || |||||||| || || ||||||||||| ||||| |  || |||||||||
Sbjct: 458 ctagggtttcccaggtagtcaagycctccctcgctgaaaatctgagctcccgccttgaac 399

                                                                       
Query: 536 cagacggcctcgccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccg 595
           || || || || |||||||| || || || | ||| || ||||| ||||| ||||| || 
Sbjct: 398 cacacagcttccccgaactttactccatttctggccagaagctccgggaaaacgcaaccc 339

                                                                       
Query: 596 agcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttcttggcaaag 655
           || ||||| ||||| |||||||||||||||||||| ||||| || | |||||| ||||| 
Sbjct: 338 agagcgcccagcattgcccaccggcagtggatcacttccagttctctgttcttcgcaaaa 279

                                                          
Query: 656 gtctcggggtcggcagagagccccgcagtgtcccatccgtagtcacc 702
           ||||| || || || || |||||||| |||||||| |||||||||||
Sbjct: 278 gtctccggatccgccgaaagccccgcwgtgtcccacccgtagtcacc 232
to top
>gb|AY617096.1| Picea sitchensis chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 763

 Score =  341 bits (172), Expect = 2e-90
 Identities = 402/479 (83%)
 Strand = Plus / Minus

                                                                       
Query: 224 gtgacaatggcctgcacgaaaaagccgaacatggagaacatggcaaggcgtccgttcttg 283
           ||||| ||||||||  |||| || |||||||| || |||||||| |  || |||||||||
Sbjct: 721 gtgacgatggcctggncgaagaatccgaacatagaaaacatggccaaccgcccgttcttg 662

                                                                       
Query: 284 atctccttcaccttgagctcggcgaacgcctcggggtcgtcggcgaggccgagggggtcg 343
           | |||||||||||| ||||| ||||| || || |||||||| || |||||||| ||||||
Sbjct: 661 agctccttcaccttcagctccgcgaaagcgtccgggtcgtcagcaaggccgagcgggtcg 602

                                                                       
Query: 344 aagctaccaccggggtagagggggtcgacgatctcgccgagcgggccgccggcgacacgg 403
           ||||| || |||||||||| ||||||   |||||| ||||| ||||| || || | ||||
Sbjct: 601 aagctgcccccggggtagatggggtcagtgatctctccgagagggccacctgcaatacgg 542

                                                                       
Query: 404 tagccctcgacggcgcccatgagcacgacctggcaagcccagatggcgaggatgctctgt 463
           |||||||| |||||||||||||| | ||||||||| |||||||| || ||||||||||| 
Sbjct: 541 tagccctccacggcgcccatgagaatgacctggcatgcccagattgcaaggatgctctgg 482

                                                                       
Query: 464 gcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaagatctgggag 523
           ||||| || | ||| ||||| || |||||||| ||||| ||||||||||||||||| |  
Sbjct: 481 gcgtgaaccaagctagggtttcccaggtagtcaaggcctccctcgctgaagatctgagct 422

                                                                       
Query: 524 ccggccttgaaccagacggcctcgccgaacttgacgccgttgcgggcgagcagctcgggg 583
           || ||||||||||| || ||||| ||||||||||| ||||| | ||| || ||||| |||
Sbjct: 421 cccgccttgaaccacaccgcctccccgaacttgactccgtttctggccaggagctccggg 362

                                                                       
Query: 584 aagacgcagccgagcgcgccgagcatggcccaccggcagtggatcacctccagctcccgg 643
           || |||||||| || ||||| ||||| |||||||||| ||||||||| |||||||| | |
Sbjct: 361 aaaacgcagcccagagcgcccagcattgcccaccggctgtggatcacttccagctctctg 302

                                                                      
Query: 644 ttcttggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccgtagtcacc 702
           ||||||||||| ||||| || || || || |||||||| |||||||| |||||||||||
Sbjct: 301 ttcttggcaaacgtctccggatctgccgaaagccccgccgtgtcccacccgtagtcacc 243
to top
>emb|AJ843976.1| Plantago major partial mRNA for light harvesting protein 1 (lhc1
           gene)
          Length = 688

 Score =  339 bits (171), Expect = 8e-90
 Identities = 456/551 (82%)
 Strand = Plus / Minus

                                                                       
Query: 155 aaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgaggttctccaatggg 214
           |||||||| ||||||||||| |||||||| || |||||||| || ||||||||||| |||
Sbjct: 662 aaggcccaagcgttgttgttaacggggtctgctaggtggtcagcaaggttctccaacggg 603

                                                                       
Query: 215 cccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatggcaaggcgt 274
           ||||| || ||||| || ||||| ||||| || ||||||||||||||||||||||| |  
Sbjct: 602 ccctttccggtgacgatagcctggacgaagaatccgaacatggagaacatggcaagcctg 543

                                                                       
Query: 275 ccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcggcgaggccg 334
           |||||||||| |||||| ||||||||||| || || ||||| || || || || ||||| 
Sbjct: 542 ccgttcttgagctccttaaccttgagctcagcaaaggcctctggatcttcagcaaggccc 483

                                                                       
Query: 335 agggggtcgaagctaccaccggggtagagggggtcgacgatctcgccgagcgggccgccg 394
           |  ||||||||||| || || |||||||| ||||| || | ||| || || || || |||
Sbjct: 482 aatgggtcgaagctgcctcctgggtagagtgggtcaaccacctctccaagtggcccaccg 423

                                                                       
Query: 395 gcgacacggtagccctcgacggcgcccatgagcacgacctggcaagcccagatggcgagg 454
           || |||||||||||||| || || ||||| |  |  || |||||||||||||| || | |
Sbjct: 422 gcaacacggtagccctcaacagctcccatcaaaataacttggcaagcccagattgccaag 363

                                                                       
Query: 455 atgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaag 514
           |||||||| |||||||| | ||| ||||| || | |||||| |  || |||||||| |||
Sbjct: 362 atgctctgagcgtggaccaagcttgggtttcccaagtagtccaaaccaccctcgctaaag 303

                                                                       
Query: 515 atctgggagccggccttgaaccagacggcctcgccgaacttgacgccgttgcgggcgagc 574
           ||||| || || ||||||||||| || ||||||||||||||||| ||||| ||||| |  
Sbjct: 302 atctgtgatccagccttgaaccaaacagcctcgccgaacttgacaccgttacgggccaag 243

                                                                       
Query: 575 agctcggggaagacgcagccgagcgcgccgagcatggcccaccggcagtggatcacctcc 634
           ||||||||||| ||||| ||||| || || ||||||||||| |   ||||||||||||| 
Sbjct: 242 agctcggggaatacgcatccgagtgctccaagcatggcccatcttgagtggatcacctca 183

                                                                       
Query: 635 agctcccggttcttggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccg 694
           ||||| ||||||||||| |||||||| ||||| || ||||| || ||||||||||| |||
Sbjct: 182 agctcacggttcttggcgaaggtctctgggtcagctgagagtccagcagtgtcccagccg 123

                      
Query: 695 tagtcaccggg 705
           |||||||||||
Sbjct: 122 tagtcaccggg 112
to top
>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein
          Length = 1006

 Score =  339 bits (171), Expect = 8e-90
 Identities = 474/575 (82%)
 Strand = Plus / Minus

                                                                       
Query: 131 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaagg 190
           |||||||| || |||||||||||| ||||||| ||||||||||| |||||||| || |||
Sbjct: 869 ttgccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtcagccagg 810

                                                                       
Query: 191 tggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccg 250
           || || ||||||||||| |  || || || || |||||||||||||||||||| || |||
Sbjct: 809 tgatcagcgaggttctcgatgggtcctttcccggtgacaatggcctgcacgaagaatccg 750

                                                                       
Query: 251 aacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaac 310
           |||||||| |||||||| |  || ||||||||||||||||||||||| ||||| ||||| 
Sbjct: 749 aacatggaaaacatggccaaccgcccgttcttgatctccttcaccttcagctccgcgaaa 690

                                                                       
Query: 311 gcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcg 370
           ||||| ||||| || || || || || ||||||||||| || || ||||||| |||||||
Sbjct: 689 gcctcagggtcttccgcaagtcccagcgggtcgaagctgccccctgggtagatggggtcg 630

                                                                       
Query: 371 acgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacg 430
              | ||| || || || ||||| || | |||||| ||||| |||||||||||||| |  
Sbjct: 629 gtcacctctcccagaggaccgcccgcaatacggtatccctccacggcgcccatgaggata 570

                                                                       
Query: 431 acctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgagg 490
           |||||||| |||||||| || || |||||||| ||||| || | ||| ||||| || |||
Sbjct: 569 acctggcatgcccagattgcaagaatgctctgcgcgtgaaccaagctagggtttcccagg 510

                                                                       
Query: 491 tagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccg 550
           ||||| || || ||||||||||| ||||| |  || |||||||||||||||||||| |||
Sbjct: 509 tagtcaagccctccctcgctgaaaatctgagctcccgccttgaaccagacggcctcaccg 450

                                                                       
Query: 551 aacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatg 610
           ||||| || || || |  || || ||||| ||||| ||||| || || ||||| ||||| 
Sbjct: 449 aactttactccatttctcgccagaagctccgggaaaacgcaacccagagcgcccagcatt 390

                                                                       
Query: 611 gcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggca 670
           |||||||||||||||||||| |||||||| | |||||| |||||  |||| || || || 
Sbjct: 389 gcccaccggcagtggatcacttccagctctctgttcttcgcaaaattctctggatctgcc 330

                                              
Query: 671 gagagccccgcagtgtcccatccgtagtcaccggg 705
           || |||||||| |||||||| ||||||||||||||
Sbjct: 329 gaaagccccgccgtgtcccacccgtagtcaccggg 295
to top
>gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-1) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score =  335 bits (169), Expect = 1e-88
 Identities = 469/569 (82%)
 Strand = Plus / Minus

                                                                       
Query: 134 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtgg 193
           ||||| |||||||| |||||||| ||||| ||||||||||| |||||||| |||||||||
Sbjct: 791 ccggggacaaagtttgtggcgaaagcccaagcgttgttgttaacggggtctgcaaggtgg 732

                                                                       
Query: 194 tcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaac 253
           || || |||||||||||||| ||||| || || ||||||||||| ||||| || || |||
Sbjct: 731 tcagcaaggttctccaatggaccctttccggtaacaatggcctgaacgaagaatccaaac 672

                                                                       
Query: 254 atggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcc 313
           || |||||||| ||||| |  |||||||| |||||||| ||||||||||| || || |||
Sbjct: 671 atagagaacatagcaagtctgccgttcttaatctcctttaccttgagctcagcaaatgcc 612

                                                                       
Query: 314 tcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcgacg 373
           || ||||| || || ||||| |  ||||| ||||| ||||| |||||||| |||||||| 
Sbjct: 611 tccgggtcttcagcaaggcctaatgggtcaaagctgccaccagggtagagtgggtcgaca 552

                                                                       
Query: 374 atctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacc 433
           | ||| || || || || || || | |||||| || || ||||| ||||| |  || || 
Sbjct: 551 acctcaccaagaggtccaccagcaatacggtaaccttcaacggctcccatcaagacaact 492

                                                                       
Query: 434 tggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtag 493
           ||||||||||||||||| | |||||||||||| ||||| | ||| |||||||| | ||||
Sbjct: 491 tggcaagcccagatggccaagatgctctgtgcatggaccaagcttgggttgcccaagtag 432

                                                                       
Query: 494 tcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaac 553
           || || || |||||||||||||||||||| |||||||||||||| || ||||| ||||||
Sbjct: 431 tcaagtcctccctcgctgaagatctgggatccggccttgaaccacacagcctcaccgaac 372

                                                                       
Query: 554 ttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcc 613
           ||||| ||||| ||||  |  ||||| |||||||| || || || || || ||||| |||
Sbjct: 371 ttgacaccgttacgggacaatagctcagggaagacacatccaagagcaccaagcattgcc 312

                                                                       
Query: 614 caccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagag 673
           || | ||||||||||||||| || || ||||||||||||||||| || ||||| || || 
Sbjct: 311 catctgcagtggatcacctcgagttcacggttcttggcaaaggtttcagggtctgctgaa 252

                                        
Query: 674 agccccgcagtgtcccatccgtagtcacc 702
           || || || || ||||| |||||||||||
Sbjct: 251 agtccagcggtatcccacccgtagtcacc 223
to top
>dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-A06, full
           insert sequence
          Length = 685

 Score =  331 bits (167), Expect = 2e-87
 Identities = 347/407 (85%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||||||||| || |||||||||||| | ||||| |||||||||  |||||||||||| |
Sbjct: 416 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcga 357

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
            |||||||  ||||||||| |  ||||||||||| ||||| |||||||| ||||| ||||
Sbjct: 356 cgtggtcgaagaggttctcgatggggcccttgccggtgacgatggcctggacgaagaagc 297

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           ||||||||||||||||||| ||||| |||||||||| |||||||||||||||||||||||
Sbjct: 296 cgaacatggagaacatggcgaggcggccgttcttgagctccttcaccttgagctcggcga 237

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           | |  || |||||||||||||||||||| |||||||||   || || ||||| |    ||
Sbjct: 236 aggtgtcagggtcgtcggcgaggccgagcgggtcgaaggcgccgcctgggtacaccttgt 177

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           ||| |  ||||||||||||||||||| |||| |||||||||||||||   ||||||||||
Sbjct: 176 cgaggccctcgccgagcgggccgccgccgacgcggtagccctcgacgaatcccatgagca 117

                                                                       
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
           | ||||||   ||||||||||||||||||||||| ||||| || ||| ||||||| || |
Sbjct: 116 ccacctggaccgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttcccca 57

                                                          
Query: 489 ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaac 535
           |||||||||| || ||||||  ||||||||| | |||||||||||||
Sbjct: 56  ggtagtcgagccccccctcggagaagatctgcgcgccggccttgaac 10
to top
>gb|U21113.1|STU21113 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-4) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score =  331 bits (167), Expect = 2e-87
 Identities = 464/563 (82%)
 Strand = Plus / Minus

                                                                       
Query: 140 acaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcg 199
           |||||||| |||||| ||||||| || |||||||| |||||||| ||||||||||| || 
Sbjct: 785 acaaagtttgtggcgtaggcccaggcattgttgttaacggggtctgcaaggtggtcagca 726

                                                                       
Query: 200 aggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggag 259
           |||||||||||||| ||||| || || ||||||||||| || || || || ||||| |||
Sbjct: 725 aggttctccaatggaccctttccggtaacaatggcctgaacaaagaatccaaacatagag 666

                                                                       
Query: 260 aacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcgggg 319
           ||||| ||||| |  ||||||||||||||||| ||||||||||| || || ||||| |||
Sbjct: 665 aacatagcaagtctaccgttcttgatctcctttaccttgagctcagcaaatgcctctggg 606

                                                                       
Query: 320 tcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcgacgatctcg 379
           || || || ||||| |  ||||| ||||| |||||||||||||| |||||||  | ||| 
Sbjct: 605 tcatcagcaaggcctaacgggtcaaagctgccaccggggtagagtgggtcgataacctca 546

                                                                       
Query: 380 ccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacctggcaa 439
           || || || || || || | |||||| ||||| ||||| ||||| | ||| || ||||||
Sbjct: 545 ccaagaggtccaccagcaatacggtatccctcaacggctcccatcaacacaacttggcaa 486

                                                                       
Query: 440 gcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgagg 499
           ||||| ||||| |||||||| ||||| ||||| | ||| ||||| || | |||||| || 
Sbjct: 485 gcccaaatggccaggatgctttgtgcatggaccaagcttgggttccccaagtagtcaagt 426

                                                                       
Query: 500 ccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacg 559
           || |||||||||||||||||||| |||||||||||||| || ||||| || |||||||| 
Sbjct: 425 ccaccctcgctgaagatctgggatccggccttgaaccacacagcctcaccaaacttgaca 366

                                                                       
Query: 560 ccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccgg 619
           ||||| ||||| |  ||||| |||||||| || || || || || ||||| ||||||| |
Sbjct: 365 ccgttacgggccaagagctcagggaagacacatccaagagcaccaagcatagcccacctg 306

                                                                       
Query: 620 cagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagcccc 679
           |||||||||||||| || || ||||||||||||||||| || ||||| || || || || 
Sbjct: 305 cagtggatcacctctagttcacggttcttggcaaaggtttcagggtctgctgaaagtcca 246

                                  
Query: 680 gcagtgtcccatccgtagtcacc 702
           ||||| ||||| || ||||||||
Sbjct: 245 gcagtatcccagccatagtcacc 223
to top
>emb|X52743.1|NTCAB21 Tabacco Cab21 mRNA for major chlorophyll a/b binding protein
          Length = 953

 Score =  327 bits (165), Expect = 3e-86
 Identities = 474/577 (82%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| |||||||| |||||| | ||||| || |||||||| || ||||| ||||
Sbjct: 858 actttccggggacaaagtttgtggcgtatgcccaagcattgttgttaactgggtctgcaa 799

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           | ||||| || |||||||||||||| || || ||||| ||||||||||| || || || |
Sbjct: 798 gatggtcagcaaggttctccaatggaccttttccagtaacaatggcctgaacaaagaatc 739

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           ||||||| |||||||||||||| | ||||||||| |||||||| ||||||||||| || |
Sbjct: 738 cgaacatagagaacatggcaagtcttccgttcttaatctcctttaccttgagctcagcaa 679

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           | ||||| ||||| || |||||||| || ||||| ||||| ||||| |||||||| ||||
Sbjct: 678 atgcctctgggtcctcagcgaggcccagtgggtcaaagctgccaccagggtagagtgggt 619

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           |||| | ||| || || || || || || |||||||| ||||| ||||| ||||| |  |
Sbjct: 618 cgacaacctcaccaagaggcccaccagcaacacggtaaccctcaacggctcccatcaaga 559

                                                                       
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
             || ||||||||||||||||| | |||||| ||||| ||||| | ||| |||||||| |
Sbjct: 558 taacttggcaagcccagatggccaagatgctttgtgcatggaccaagcttgggttgccca 499

                                                                       
Query: 489 ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
            |||||| || || |||||||| ||||| ||||| || ||||||||||| || |||||||
Sbjct: 498 agtagtcaagtccaccctcgctaaagatttgggatccagccttgaaccacacagcctcgc 439

                                                                       
Query: 549 cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
           | |||||||| || || ||||| |  |||||||||||||| || || || || || ||||
Sbjct: 438 caaacttgacaccattacgggccaagagctcggggaagacacatccaagagcaccaagca 379

                                                                       
Query: 609 tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
           | ||||| | ||||||||||||||| || || ||||||||||||||||| || ||||| |
Sbjct: 378 tagcccatctgcagtggatcacctcgagttcacggttcttggcaaaggtttctgggtctg 319

                                                
Query: 669 cagagagccccgcagtgtcccatccgtagtcaccggg 705
           | || || || ||||| ||||| ||||| ||||||||
Sbjct: 318 ctgaaagtccagcagtatcccacccgtaatcaccggg 282
to top
>emb|AJ234428.1|HVU234428 Hordeum vulgare partial mRNA; clone cMWG0701.rev
          Length = 326

 Score =  325 bits (164), Expect = 1e-85
 Identities = 281/320 (87%)
 Strand = Plus / Plus

                                                                       
Query: 188 aggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaag 247
           |||||||| ||||||||||| |  |||||||| |||||||| ||||| ||||| ||  | 
Sbjct: 7   aggtggtcagcgaggttctcgagcgggcccttaccagtgacgatggcttgcacaaagtat 66

                                                                       
Query: 248 ccgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcg 307
           || |||||||| ||||| ||||| || |||||||||||||||||||||||||||||||| 
Sbjct: 67  ccaaacatggaaaacattgcaagacgaccgttcttgatctccttcaccttgagctcggca 126

                                                                       
Query: 308 aacgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagaggggg 367
           ||||||||||||||||| || ||||| |||||||||||||| ||||||||||| || |||
Sbjct: 127 aacgcctcggggtcgtctgcaaggccaagggggtcgaagctgccaccggggtatagtggg 186

                                                                       
Query: 368 tcgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagc 427
           ||||||||||| ||||| ||||| || || || ||||| |||||||| ||||||||||||
Sbjct: 187 tcgacgatctctccgagtgggccaccagcaacgcggtacccctcgacagcgcccatgagc 246

                                                                       
Query: 428 acgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccg 487
           ||||||||||||||||||||||| ||||||||||  |||||||| | ||| || ||||||
Sbjct: 247 acgacctggcaagcccagatggcaaggatgctctccgcgtggaccaagctaggattgccg 306

                               
Query: 488 aggtagtcgaggccgccctc 507
           |||||||||||||| |||||
Sbjct: 307 aggtagtcgaggccaccctc 326
to top
>emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chlorophyll a/b-binding protein
          Length = 1083

 Score =  317 bits (160), Expect = 3e-83
 Identities = 460/560 (82%)
 Strand = Plus / Minus

                                                                       
Query: 146 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgaggttc 205
           ||||||||| ||||||| || |||||||| ||||||||||| ||||| ||||||||||||
Sbjct: 873 ttggtggcgtaggcccaggcattgttgttcacggggtcggccaggtgatcggcgaggttc 814

                                                                       
Query: 206 tccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatg 265
           || |  || || ||||| || || || ||||||||||| |||||||||||||||||||||
Sbjct: 813 tcgatgggtcctttgcccgtcacgatcgcctgcacgaagaagccgaacatggagaacatg 754

                                                                       
Query: 266 gcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcg 325
           || |  ||||||||||||||||||||||| || ||||| ||||| || || |||||||| 
Sbjct: 753 gccaaccgtccgttcttgatctccttcactttcagctccgcgaaagcatccgggtcgtct 694

                                                                       
Query: 326 gcgaggccgagggggtcgaagctaccaccggggtagagggggtcgacgatctcgccgagc 385
           || || || || ||||||||| |||| ||||| ||||  ||||||   | ||| ||||| 
Sbjct: 693 gccagtcccagtgggtcgaagttaccgccgggatagatagggtcggtcacctctccgagg 634

                                                                       
Query: 386 gggccgccggcgacacggtagccctcgacggcgcccatgagcacgacctggcaagcccag 445
           || || || || |||||||||||||||| ||| |||||||| | ||||||||| ||||||
Sbjct: 633 ggcccacccgcaacacggtagccctcgatggcacccatgaggatgacctggcatgcccag 574

                                                                       
Query: 446 atggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccc 505
           ||||| || |||||||| |||||||  |     ||| | || |||||||| || || |||
Sbjct: 573 atggcaagaatgctctgggcgtggatcaattgtgggctccctaggtagtcaagccctccc 514

                                                                       
Query: 506 tcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacgccgttg 565
           |||||||||||||| |  || ||||||||||| || ||||| |||||||| || ||||| 
Sbjct: 513 tcgctgaagatctgagctcccgccttgaaccacaccgcctcaccgaactttactccgttc 454

                                                                       
Query: 566 cgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccggcagtgg 625
           |  || || ||||| ||||| ||||| ||||| ||||| ||||| ||||||||| |||||
Sbjct: 453 ctcgcaagaagctccgggaatacgcacccgagagcgcccagcatcgcccaccgggagtgg 394

                                                                       
Query: 626 atcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccccgcagtg 685
           ||||| |||||||| | |||||| || || ||||| || || || || |||||||| |||
Sbjct: 393 atcacttccagctctctgttcttcgcgaacgtctccggatccgccgacagccccgccgtg 334

                               
Query: 686 tcccatccgtagtcaccggg 705
           ||||| ||||||||||||||
Sbjct: 333 tcccacccgtagtcaccggg 314
to top
>gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score =  315 bits (159), Expect = 1e-82
 Identities = 435/527 (82%)
 Strand = Plus / Minus

                                                                       
Query: 176 acggggtcggcaaggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcc 235
           ||||||||||| ||||| || ||||||||||| |  || ||||| || ||||| ||||||
Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacgatggcc 710

                                                                       
Query: 236 tgcacgaaaaagccgaacatggagaacatggcaaggcgtccgttcttgatctccttcacc 295
           || ||||| || ||||||||||| |||||||| | ||| |||||||||||||||||||||
Sbjct: 709 tgaacgaagaatccgaacatggaaaacatggccaagcgcccgttcttgatctccttcacc 650

                                                                       
Query: 296 ttgagctcggcgaacgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccg 355
           || ||||| ||||| || ||||||||||| || || || | |||||||||||| ||||||
Sbjct: 649 ttcagctccgcgaaagcgtcggggtcgtctgcaagtcccaaggggtcgaagctgccaccg 590

                                                                       
Query: 356 gggtagagggggtcgacgatctcgccgagcgggccgccggcgacacggtagccctcgacg 415
           ||||||| |||||||   | ||| || || ||||||||||| | |||||| ||||| |||
Sbjct: 589 gggtagatggggtcggtcacctctcccagagggccgccggcaatacggtaaccctccacg 530

                                                                       
Query: 416 gcgcccatgagcacgacctggcaagcccagatggcgaggatgctctgtgcgtggacgagg 475
           ||||||||||| | ||||||||| |||||||| || || || ||||| |||||||  |||
Sbjct: 529 gcgcccatgaggatgacctggcatgcccagattgcaagaatactctgcgcgtggataagg 470

                                                                       
Query: 476 ctggggttgccgaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaac 535
           || ||||| || |||||||| || || ||||||||||| ||||| |  || |||||||||
Sbjct: 469 ctagggtttcccaggtagtcaagccctccctcgctgaaaatctgagctcccgccttgaac 410

                                                                       
Query: 536 cagacggcctcgccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccg 595
           ||||| ||||| |||||||| || || || |  || || ||||| ||||| ||||| || 
Sbjct: 409 cagactgcctccccgaactttactccatttctcgcaagaagctccgggaaaacgcaaccc 350

                                                                       
Query: 596 agcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttcttggcaaag 655
           || ||||| ||||| |||||||||||||||||||| ||||  || | |||||| || || 
Sbjct: 349 agagcgcccagcattgcccaccggcagtggatcacttccaattctctgttcttcgcgaaa 290

                                                          
Query: 656 gtctcggggtcggcagagagccccgcagtgtcccatccgtagtcacc 702
           ||||| || || || || |||||||| |||||||| |||||||||||
Sbjct: 289 gtctccggatccgccgaaagccccgctgtgtcccacccgtagtcacc 243
to top
>gb|AY617092.1| Pinus monophylla chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score =  315 bits (159), Expect = 1e-82
 Identities = 435/527 (82%)
 Strand = Plus / Minus

                                                                       
Query: 176 acggggtcggcaaggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcc 235
           ||||||||||| ||||| || ||||||||||| |  || ||||| || ||||| ||||||
Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctcgatgggtcccttcccggtgacgatggcc 710

                                                                       
Query: 236 tgcacgaaaaagccgaacatggagaacatggcaaggcgtccgttcttgatctccttcacc 295
           || ||||| || ||||||||||| |||||||| | ||| |||||||||||||||||||||
Sbjct: 709 tgkacgaagaatccgaacatggaaaacatggccaagcgcccgttcttgatctccttcacc 650

                                                                       
Query: 296 ttgagctcggcgaacgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccg 355
           || ||||| ||||| || ||||||||||| || || || | |||||||||||| ||||||
Sbjct: 649 ttcagctccgcgaaagcgtcggggtcgtctgcaagtcccaaggggtcgaagctgccaccg 590

                                                                       
Query: 356 gggtagagggggtcgacgatctcgccgagcgggccgccggcgacacggtagccctcgacg 415
           |||||||  |||||    | ||| || || ||||||||||| | |||||| ||||| |||
Sbjct: 589 gggtagatagggtctgtcacctctcccagagggccgccggcaatacggtaaccctccacg 530

                                                                       
Query: 416 gcgcccatgagcacgacctggcaagcccagatggcgaggatgctctgtgcgtggacgagg 475
           ||||||||||| | ||||||||| |||||||| || || |||||||| |||||||  |||
Sbjct: 529 gcgcccatgaggatgacctggcatgcccagattgcaagaatgctctgcgcgtggataagg 470

                                                                       
Query: 476 ctggggttgccgaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaac 535
           || ||||| || |||||||| || || ||||||||||| ||||| |  || |||||||||
Sbjct: 469 ctagggtttcccaggtagtcaagccctccctcgctgaaaatctgagctcccgccttgaac 410

                                                                       
Query: 536 cagacggcctcgccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccg 595
           || || || || |||||||| || || || |  || || ||||| ||||| ||||| || 
Sbjct: 409 cacacagcttccccgaactttactccatttctcgccagaagctcygggaaaacgcaaccc 350

                                                                       
Query: 596 agcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttcttggcaaag 655
           || ||||| ||||| |||||||||||||||||||| ||||| || | |||||| ||||| 
Sbjct: 349 agagcgcccagcattgcccaccggcagtggatcacttccagttctctgttcttcgcaaaa 290

                                                          
Query: 656 gtctcggggtcggcagagagccccgcagtgtcccatccgtagtcacc 702
           ||||| || || || || ||||||||||||||||| |||||||||||
Sbjct: 289 gtctccggatccgccgaaagccccgcagtgtcccacccgtagtcacc 243
to top
>gb|AY617084.1| Pinus contorta chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score =  313 bits (158), Expect = 4e-82
 Identities = 437/530 (82%)
 Strand = Plus / Minus

                                                                       
Query: 176 acggggtcggcaaggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcc 235
           ||||||||||| ||||| || ||||||||||| |  || || || || ||||| ||||||
Sbjct: 769 acggggtcggccaggtgatcagcgaggttctcgatgggtcctttcccggtgacgatggcc 710

                                                                       
Query: 236 tgcacgaaaaagccgaacatggagaacatggcaaggcgtccgttcttgatctccttcacc 295
           |||||||| || ||||||||||| |||||||| |  || |||||||||||||||||||||
Sbjct: 709 tgcacgaagaatccgaacatggaaaacatggccaaccgcccgttcttgatctccttcacc 650

                                                                       
Query: 296 ttgagctcggcgaacgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccg 355
           || ||||| ||||| || ||||||||||| ||||| || || ||||||||||| || |||
Sbjct: 649 ttcagctctgcgaaagcgtcggggtcgtccgcgagtcccagcgggtcgaagctgcccccg 590

                                                                       
Query: 356 gggtagagggggtcgacgatctcgccgagcgggccgccggcgacacggtagccctcgacg 415
           ||||||| |||||||   | ||| |  || || ||||| || | |||||||||||| |||
Sbjct: 589 gggtagatggggtcggtcacctctctcagaggaccgcccgcaatacggtagccctccacg 530

                                                                       
Query: 416 gcgcccatgagcacgacctggcaagcccagatggcgaggatgctctgtgcgtggacgagg 475
           ||||||||||| | ||||||||| |||||||| || || |||||||| ||||| || | |
Sbjct: 529 gcgcccatgaggatgacctggcatgcccagattgcaagaatgctctgcgcgtgaaccaag 470

                                                                       
Query: 476 ctggggttgccgaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaac 535
           || ||||| || |||||||| || || ||||||||||| ||||| |  || |||||||||
Sbjct: 469 ctagggtttcccaggtagtcaagccctccctcgctgaaaatctgagctcccgccttgaac 410

                                                                       
Query: 536 cagacggcctcgccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccg 595
           || |||||||| |||||||| || || || |  || || ||||| ||||| ||||| || 
Sbjct: 409 cacacggcctcaccgaactttactccatttctcgccagaagctccgggaaaacgcaaccc 350

                                                                       
Query: 596 agcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttcttggcaaag 655
           || ||||| ||||| |||||||||| ||||||||| |||||||| | |||||| ||||| 
Sbjct: 349 agagcgcccagcattgcccaccggctgtggatcacttccagctctctgttcttcgcaaaa 290

                                                             
Query: 656 gtctcggggtcggcagagagccccgcagtgtcccatccgtagtcaccggg 705
           ||||| || || || || |||||||| |||||||| ||||||||||||||
Sbjct: 289 gtctctggatctgccgaaagccccgccgtgtcccacccgtagtcaccggg 240
to top
>gb|AY617083.1| Pinus radiata chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score =  313 bits (158), Expect = 4e-82
 Identities = 437/530 (82%)
 Strand = Plus / Minus

                                                                       
Query: 176 acggggtcggcaaggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcc 235
           ||||||||||| ||||| || ||||||||||| |  || || || || ||||| ||||||
Sbjct: 769 acggggtcggccaggtgatcagcgaggttctcgatgggtcctttcccggtgacgatggcc 710

                                                                       
Query: 236 tgcacgaaaaagccgaacatggagaacatggcaaggcgtccgttcttgatctccttcacc 295
           |||||||| || ||||||||||| |||||||| |  || |||||||||||||||||||||
Sbjct: 709 tgcacgaagaatccgaacatggaaaacatggccaaccgcccgttcttgatctccttcacc 650

                                                                       
Query: 296 ttgagctcggcgaacgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccg 355
           || ||||| ||||| || ||||||||||| || || || || ||||||||||| || |||
Sbjct: 649 ttcagctccgcgaaagcgtcggggtcgtccgcaagtcccagcgggtcgaagctgcccccg 590

                                                                       
Query: 356 gggtagagggggtcgacgatctcgccgagcgggccgccggcgacacggtagccctcgacg 415
           ||||||| |||||||   | ||| || || || ||||| || | |||||||||||| |||
Sbjct: 589 gggtagatggggtcggtcacctctcccagaggaccgcccgcaatacggtagccctccacg 530

                                                                       
Query: 416 gcgcccatgagcacgacctggcaagcccagatggcgaggatgctctgtgcgtggacgagg 475
           ||||||||||| | ||||||||| |||||||| || || |||||||| ||||| || | |
Sbjct: 529 gcgcccatgaggatgacctggcatgcccagattgcaagaatgctctgcgcgtgaaccaag 470

                                                                       
Query: 476 ctggggttgccgaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaac 535
           || ||||| || |||||||| || || ||||||||||| ||||| |  || |||||||||
Sbjct: 469 ctagggtttcccaggtagtcaagccctccctcgctgaaaatctgagctcccgccttgaac 410

                                                                       
Query: 536 cagacggcctcgccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccg 595
           || || ||||| |||||||| || || || |  || || ||||| ||||| ||||| || 
Sbjct: 409 cacactgcctcaccgaactttactccatttctcgccagaagctccgggaaaacgcaaccc 350

                                                                       
Query: 596 agcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttcttggcaaag 655
           || ||||| ||||| |||||||||||||||||||| |||||||| | |||||| ||||| 
Sbjct: 349 agagcgcccagcattgcccaccggcagtggatcacttccagctctctgttcttcgcaaaa 290

                                                             
Query: 656 gtctcggggtcggcagagagccccgcagtgtcccatccgtagtcaccggg 705
           ||||| || || || || |||||||| |||||||| ||||||||||||||
Sbjct: 289 gtctctggatctgccgaaagccccgccgtgtcccacccgtagtcaccggg 240
to top
>gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score =  313 bits (158), Expect = 4e-82
 Identities = 437/530 (82%)
 Strand = Plus / Minus

                                                                       
Query: 176 acggggtcggcaaggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcc 235
           ||||||||||| ||||| || ||||||||||| |  || || || || ||||| ||||||
Sbjct: 769 acggggtcggccaggtgatcagcgaggttctcgatgggtcctttcccggtgacgatggcc 710

                                                                       
Query: 236 tgcacgaaaaagccgaacatggagaacatggcaaggcgtccgttcttgatctccttcacc 295
           |||||||| || ||||||||||| |||||||| |  || |||||||||||||||||||||
Sbjct: 709 tgcacgaagaatccgaacatggaaaacatggccaaccgcccgttcttgatctccttcacc 650

                                                                       
Query: 296 ttgagctcggcgaacgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccg 355
           || ||||| ||||| || ||||||||||| || || || || ||||||||||| || |||
Sbjct: 649 ttcagctccgcgaaagcgtcggggtcgtccgcaagtcccagcgggtcgaagctgcccccg 590

                                                                       
Query: 356 gggtagagggggtcgacgatctcgccgagcgggccgccggcgacacggtagccctcgacg 415
           ||||||| |||||||   | | | || || || ||||| || | |||||||||||| |||
Sbjct: 589 gggtagatggggtcggtcaccmctcccagaggaccgcccgcaatacggtagccctccacg 530

                                                                       
Query: 416 gcgcccatgagcacgacctggcaagcccagatggcgaggatgctctgtgcgtggacgagg 475
           ||||||||||| | ||||||||| |||||||| || || |||||||| ||||| || | |
Sbjct: 529 gcgcccatgaggatgacctggcatgcccagattgcaagaatgctctgcgcgtgaaccaag 470

                                                                       
Query: 476 ctggggttgccgaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaac 535
           || ||||| || |||||||| || || ||||||||||| ||||| |  || |||||||||
Sbjct: 469 ctagggtttcccaggtagtcaagccctccctcgctgaaaatctgagctcccgccttgaac 410

                                                                       
Query: 536 cagacggcctcgccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccg 595
           || |||||||| |||||||| || || || |  || || ||||| ||||| ||||| || 
Sbjct: 409 cacacggcctccccgaactttactccatttctcgccagaagctccgggaaaacgcaaccc 350

                                                                       
Query: 596 agcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttcttggcaaag 655
           || ||||| ||||| |||||||||||||||||||| |||||||| | |||||| ||||| 
Sbjct: 349 agagcgcccagcattgcccaccggcagtggatcacttccagctctctgttcttcgcaaaa 290

                                                             
Query: 656 gtctcggggtcggcagagagccccgcagtgtcccatccgtagtcaccggg 705
           ||||| || || || || |||||||| |||||||| ||||||||||||||
Sbjct: 289 gtctctggatctgccgaaagccccgccgtgtcccacccgtagtcaccggg 240
to top
>gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB3) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1011

 Score =  313 bits (158), Expect = 4e-82
 Identities = 470/574 (81%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           ||||||||||  ||||||| || ||||||||||| || |||||||| || ||||| ||||
Sbjct: 858 acttgccgggagcaaagtttgtagcgaaggcccaagcattgttgttaactgggtctgcaa 799

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           | || || ||||||||||||||||| ||||| || || |||||||| || || || || |
Sbjct: 798 gatgatcagcgaggttctccaatggaccctttccggtcacaatggcttggacaaagaacc 739

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           ||||||| |||||||| || |  |  || |||||||||||||||||||| | |||||| |
Sbjct: 738 cgaacattgagaacatagctaatctaccattcttgatctccttcaccttcaactcggcaa 679

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           | ||||| ||||| ||||| ||||| |  ||||| |||||||||||||||||||| ||||
Sbjct: 678 aggcctctgggtcctcggctaggcccaatgggtcaaagctaccaccggggtagagtgggt 619

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           |||  | ||| || || || || ||||| |||||||||||||| | ||||||||| |  |
Sbjct: 618 cgatcacctcaccaagtggcccaccggcaacacggtagccctcaatggcgcccatcaaga 559

                                                                       
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
             || || || ||||| |||||||||||||| || |||||||| |  || |||||||| |
Sbjct: 558 taacttgacatgcccaaatggcgaggatgctttgagcgtggaccaaacttgggttgccca 499

                                                                       
Query: 489 ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
            ||||||||| || ||||| || ||||| ||||  || ||||||||||| || ||||| |
Sbjct: 498 agtagtcgagtccaccctcactaaagatttgggctccagccttgaaccaaacagcctcac 439

                                                                       
Query: 549 cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
           |||| ||||| ||||||||||| |  ||||| |||||||| || || || || || | ||
Sbjct: 438 cgaatttgacaccgttgcgggccaagagctctgggaagacacatcctagagctcctaaca 379

                                                                       
Query: 609 tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
           |||||||||  |||||||||||||| ||||| |||||||| ||||| ||||||||||| |
Sbjct: 378 tggcccacctacagtggatcacctcaagctcacggttcttagcaaaagtctcggggtcag 319

                                             
Query: 669 cagagagccccgcagtgtcccatccgtagtcacc 702
           | |||||||| ||||||||||| || ||||||||
Sbjct: 318 ctgagagcccagcagtgtcccaaccatagtcacc 285
to top
>gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score =  311 bits (157), Expect = 2e-81
 Identities = 434/527 (82%)
 Strand = Plus / Minus

                                                                       
Query: 176 acggggtcggcaaggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcc 235
           ||||||||||| ||||| || ||||||||||| |  || ||||| || ||||| ||||||
Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacgatggcc 710

                                                                       
Query: 236 tgcacgaaaaagccgaacatggagaacatggcaaggcgtccgttcttgatctccttcacc 295
           |||||||| || ||||||||||| |||||||| | ||| |||||||||| ||||||||||
Sbjct: 709 tgcacgaagaatccgaacatggaaaacatggccaagcgyccgttcttgagctccttcacc 650

                                                                       
Query: 296 ttgagctcggcgaacgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccg 355
           || ||||| ||||| || ||||||||||| || || || | |||||||||||| ||||||
Sbjct: 649 ttcagctccgcgaaagcgtcggggtcgtctgcaagtcccaaggggtcgaagctgccaccg 590

                                                                       
Query: 356 gggtagagggggtcgacgatctcgccgagcgggccgccggcgacacggtagccctcgacg 415
           ||||||| |||||||   | ||| || || |||||||| || | |||||| ||||| |||
Sbjct: 589 gggtagatggggtcggtcacctctcccagagggccgccagcaatacggtaaccctccacg 530

                                                                       
Query: 416 gcgcccatgagcacgacctggcaagcccagatggcgaggatgctctgtgcgtggacgagg 475
           ||||||||||| | ||||||||| |||||||| || || |||||||| |||||||  |||
Sbjct: 529 gcgcccatgaggatgacctggcatgcccagattgcaagaatgctctgcgcgtggataagg 470

                                                                       
Query: 476 ctggggttgccgaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaac 535
           || ||||| || |||||||| || || ||||||||||| ||||| |  || |||||||||
Sbjct: 469 ctagggtttccaaggtagtcaagccctccctcgctgaaaatctgagctcccgccttgaac 410

                                                                       
Query: 536 cagacggcctcgccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccg 595
           || || ||||| |||||||| || || ||    || || ||||| ||||| ||||| || 
Sbjct: 409 cacactgcctccccgaactttactccatttttcgccagaagctccgggaaaacgcaaccc 350

                                                                       
Query: 596 agcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttcttggcaaag 655
           || ||||| ||||| |||||||||| ||||||||| ||||| || | |||||| ||||| 
Sbjct: 349 agagcgcccagcattgcccaccggctgtggatcacttccagttctctgttcttcgcaaat 290

                                                          
Query: 656 gtctcggggtcggcagagagccccgcagtgtcccatccgtagtcacc 702
           ||||| || || || || |||||||| |||||||| |||||||||||
Sbjct: 289 gtctccggatctgccgaaagccccgccgtgtcccacccgtagtcacc 243
to top
>gb|U21114.1|STU21114 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-5) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score =  311 bits (157), Expect = 2e-81
 Identities = 466/569 (81%)
 Strand = Plus / Minus

                                                                       
Query: 134 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtgg 193
           ||||| |||||||| |||||  | | ||| ||||||||||| |||||||| |||||||||
Sbjct: 791 ccgggaacaaagtttgtggcataagaccaggcgttgttgttaacggggtctgcaaggtgg 732

                                                                       
Query: 194 tcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaac 253
           || || |||||||||||||| ||||| || || ||||| ||||| ||||| || || |||
Sbjct: 731 tctgcaaggttctccaatggaccctttccggtaacaattgcctgaacgaagaatccaaac 672

                                                                       
Query: 254 atggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcc 313
           || |||||||| ||||| |  |||||||| |||||||| ||||||||||| || || |||
Sbjct: 671 atagagaacatagcaagtctgccgttcttaatctcctttaccttgagctcagcaaatgcc 612

                                                                       
Query: 314 tcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcgacg 373
           || ||||| || || ||||| |  ||||||||||| ||||| |||||||| |||||||| 
Sbjct: 611 tccgggtcttcagcaaggcctaatgggtcgaagctgccaccagggtagagtgggtcgaca 552

                                                                       
Query: 374 atctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacc 433
           | ||| || || || || || || | |||||| || || || || ||||| |  || || 
Sbjct: 551 acctcaccaagaggtccaccagcaatacggtaaccttcaacagctcccatcaagacaact 492

                                                                       
Query: 434 tggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtag 493
           ||||||||||||||||| | |||||||||||| ||||| | ||| |||||||| | ||||
Sbjct: 491 tggcaagcccagatggccaagatgctctgtgcatggaccaagcttgggttgcccaagtag 432

                                                                       
Query: 494 tcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaac 553
           || || || |||||||||||||||||||| |||||||||||||| ||| |||| ||||||
Sbjct: 431 tcaagtccaccctcgctgaagatctgggatccggccttgaaccacacgacctcaccgaac 372

                                                                       
Query: 554 ttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcc 613
           ||||| ||||| ||||| |  ||||| |||||||| || || || || || ||||| |||
Sbjct: 371 ttgacaccgttacgggccaatagctcagggaagacacatccaagagcaccaagcattgcc 312

                                                                       
Query: 614 caccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagag 673
           || | ||||||||||||||| || || ||||||||||||||||| || ||||| || || 
Sbjct: 311 catctgcagtggatcacctcgagttcacggttcttggcaaaggtttcagggtctgctgaa 252

                                        
Query: 674 agccccgcagtgtcccatccgtagtcacc 702
           || || || || ||||| |||||||||||
Sbjct: 251 agtccagcggtatcccacccgtagtcacc 223
to top
>gb|AY617091.1| Pinus strobus chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score =  307 bits (155), Expect = 3e-80
 Identities = 433/527 (82%)
 Strand = Plus / Minus

                                                                       
Query: 176 acggggtcggcaaggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcc 235
           ||||||||||| ||||| || ||||||||||| |  || ||||| || ||||| ||||||
Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacgatggcc 710

                                                                       
Query: 236 tgcacgaaaaagccgaacatggagaacatggcaaggcgtccgttcttgatctccttcacc 295
           |||||||| || ||||||||||| |||||||| | ||| |||||||||| ||||||||||
Sbjct: 709 tgcacgaagaatccgaacatggaaaacatggccaagcgcccgttcttgagctccttcacc 650

                                                                       
Query: 296 ttgagctcggcgaacgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccg 355
           || ||||| ||||| || ||||||||||| || || || | |||||||||||| ||||||
Sbjct: 649 ttcagctccgcgaaagcgtcggggtcgtctgcaagtcccaaggggtcgaagctgccaccg 590

                                                                       
Query: 356 gggtagagggggtcgacgatctcgccgagcgggccgccggcgacacggtagccctcgacg 415
           ||||||| ||||||    | ||| || || |||||||| || | |||||| ||||| |||
Sbjct: 589 gggtagatggggtcrgtcacctctcccagagggccgccagcaatacggtaaccctccacg 530

                                                                       
Query: 416 gcgcccatgagcacgacctggcaagcccagatggcgaggatgctctgtgcgtggacgagg 475
           ||||||||||| | ||||||||| |||||||| || || |||||||| |||||||  |||
Sbjct: 529 gcgcccatgaggatgacctggcatgcccagattgcaagaatgctctgcgcgtggataagg 470

                                                                       
Query: 476 ctggggttgccgaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaac 535
           || ||||| || |||||||| || || ||||||||||| ||||| |  || |||||||||
Sbjct: 469 ctagggtttcccaggtagtcaagccctccctcgctgaaaatctgagctcccgccttgaac 410

                                                                       
Query: 536 cagacggcctcgccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccg 595
           || || ||||| |||||||| || || ||    || || ||||| ||||| ||||| || 
Sbjct: 409 cacactgcctckccgaactttactccatttttcgccagaagctccgggaaaacgcaaccc 350

                                                                       
Query: 596 agcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttcttggcaaag 655
           || ||||| ||||| |||||||||| ||||||||| ||||| || | |||||| ||||| 
Sbjct: 349 agagcgcccagcattgcccaccggctgtggatcacttccagttctctgttcttcgcaaat 290

                                                          
Query: 656 gtctcggggtcggcagagagccccgcagtgtcccatccgtagtcacc 702
           ||||| || || || || |||||||| |||||||| |||||||||||
Sbjct: 289 gtctccggatccgccgaaagccccgccgtgtcccacccgtagtcacc 243
to top
>gb|AY617090.1| Pinus monticola chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score =  307 bits (155), Expect = 3e-80
 Identities = 434/527 (82%)
 Strand = Plus / Minus

                                                                       
Query: 176 acggggtcggcaaggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcc 235
           ||||||||||| ||||| || ||||||||||| |  || ||||| || ||||| ||||||
Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacgatggcc 710

                                                                       
Query: 236 tgcacgaaaaagccgaacatggagaacatggcaaggcgtccgttcttgatctccttcacc 295
           |||||||| || ||||||||||| |||||||| | ||| |||||||||| ||||||||||
Sbjct: 709 tgcacgaagaatccgaacatggaaaacatggccaagcgcccgttcttgagctccttcacc 650

                                                                       
Query: 296 ttgagctcggcgaacgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccg 355
           || ||||| ||||| || ||||||||||| || || || | |||||||||||| ||||||
Sbjct: 649 ttcagctccgcgaaagcgtcggggtcgtctgcaagtcccaaggggtcgaagctgccaccg 590

                                                                       
Query: 356 gggtagagggggtcgacgatctcgccgagcgggccgccggcgacacggtagccctcgacg 415
           ||||||| |||||||   | ||| || || |||||||| || | |||||| ||||| |||
Sbjct: 589 gggtagatggggtcggtcacctctcccagagggccgccagcaatacggtaaccctccacg 530

                                                                       
Query: 416 gcgcccatgagcacgacctggcaagcccagatggcgaggatgctctgtgcgtggacgagg 475
           ||||||||||| | ||||||||| |||||||| || || |||||||| |||||||  |||
Sbjct: 529 gcgcccatgaggatgacctggcatgcccagattgcaagaatgctctgcgcgtggataagg 470

                                                                       
Query: 476 ctggggttgccgaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaac 535
           || ||||| || |||||||| || || ||||||||||| ||||| |  || |||||||||
Sbjct: 469 ctagggtttccaaggtagtcaagccctccctcgctgaaaatctgagctcccgccttgaac 410

                                                                       
Query: 536 cagacggcctcgccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccg 595
           || || ||||| |||||||| || || ||    || || ||||| ||||| ||||| || 
Sbjct: 409 cacactgcctccccgaactttactccatttttcgccagaagctccgggaaaacgcaaccc 350

                                                                       
Query: 596 agcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttcttggcaaag 655
           || ||||| ||||| |||||||||| ||||||||| ||||| || | |||||| ||||| 
Sbjct: 349 agagcgcccagcattgcccaccggctgtggatcacttccagttctctgttcttcgcaaat 290

                                                          
Query: 656 gtctcggggtcggcagagagccccgcagtgtcccatccgtagtcacc 702
           ||||| || || || || |||||||| |||||||| |||||||||||
Sbjct: 289 gtctccggatccgccgaaagccccgccgtgtcccacccgtagtcacc 243
to top
>dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 genes for light
            harvesting chlorophyll a/b-binding protein, complete cds
          Length = 7965

 Score =  307 bits (155), Expect = 3e-80
 Identities = 470/575 (81%)
 Strand = Plus / Minus

                                                                        
Query: 134  ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtgg 193
            ||||| |||||||| |||||  ||| ||| ||||||||||| || ||||| |||||||||
Sbjct: 5125 ccggggacaaagtttgtggcataggaccaggcgttgttgttaacagggtctgcaaggtgg 5066

                                                                        
Query: 194  tcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaac 253
            || || |||||||||||||||||||| || || ||||||||||| || || || ||||||
Sbjct: 5065 tcagcaaggttctccaatgggccctttccggtaacaatggcctgaacaaagaatccgaac 5006

                                                                        
Query: 254  atggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcc 313
            || |||||||||||||| |  || |||||||||||||| || |||||||| || || |||
Sbjct: 5005 atagagaacatggcaagtctcccattcttgatctcctttactttgagctcagcaaatgcc 4946

                                                                        
Query: 314  tcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcgacg 373
            || ||||| || || || || |  ||||| ||||||||||| |||||||| |||||||| 
Sbjct: 4945 tctgggtcatcagcaagccccaatgggtcaaagctaccaccagggtagagtgggtcgaca 4886

                                                                        
Query: 374  atctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacc 433
            | ||| || || || || || || |||||||| ||||| ||||| ||||| |  |  |||
Sbjct: 4885 acctcaccaagaggtccaccagctacacggtatccctcaacggctcccatcaagataacc 4826

                                                                        
Query: 434  tggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtag 493
            ||||||||||| || || | |||||| ||||||||||  | ||| |||||||| |  |||
Sbjct: 4825 tggcaagcccatattgccaagatgctttgtgcgtggatcaagcttgggttgcccaaatag 4766

                                                                        
Query: 494  tcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaac 553
            || || || || ||||||||||| ||||| |||||||||||||| || |||||||| |||
Sbjct: 4765 tcaagtccaccatcgctgaagatttgggatccggccttgaaccacacagcctcgccaaac 4706

                                                                        
Query: 554  ttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcc 613
            || || ||||| ||||| |  |||||||||||||| || || || || || ||||| |||
Sbjct: 4705 ttaacaccgttacgggccaagagctcggggaagacacatccaagagcaccaagcatagcc 4646

                                                                        
Query: 614  caccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagag 673
            || | ||||||||||||||| ||||| ||||||||||||||||| || || || || || 
Sbjct: 4645 catctgcagtggatcacctcgagctcacggttcttggcaaaggtttctggatctgctgaa 4586

                                               
Query: 674  agccccgcagtgtcccatccgtagtcaccgggaaa 708
            || || ||||| ||||| || ||||||||||||||
Sbjct: 4585 agtccagcagtatcccacccatagtcaccgggaaa 4551



 Score =  295 bits (149), Expect = 1e-76
 Identities = 464/569 (81%)
 Strand = Plus / Minus

                                                                        
Query: 134  ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtgg 193
            ||||| |||||||| |||||| ||||||| || |||||||| || ||||| |||||||||
Sbjct: 7665 ccggggacaaagtttgtggcgtaggcccaagcattgttgttaactgggtctgcaaggtgg 7606

                                                                        
Query: 194  tcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaac 253
            || || |||||||| ||||||||||| ||||| |||||||| || || || || ||||||
Sbjct: 7605 tcagcaaggttctctaatgggccctttccagtaacaatggcttgaacaaagaatccgaac 7546

                                                                        
Query: 254  atggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcc 313
            || ||||||||||| || | ||||||||| ||||| || ||||||||||||||||| |||
Sbjct: 7545 atagagaacatggcgagtcttccgttcttaatctcttttaccttgagctcggcgaatgcc 7486

                                                                        
Query: 314  tcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcgacg 373
            || || || || || ||||| || ||||| ||||| ||||| |||||||| |||||||| 
Sbjct: 7485 tctggatcctcagcaaggcccagtgggtcaaagctgccaccagggtagagtgggtcgaca 7426

                                                                        
Query: 374  atctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacc 433
            | ||| || || || || || || |||||||| ||||| ||||| ||||| |  |  || 
Sbjct: 7425 acctcaccaagaggcccaccagcaacacggtaaccctcaacggctcccatcaagataact 7366

                                                                        
Query: 434  tggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtag 493
            ||||||||||||||||| | |||||| ||||| || || | ||| |||||||| | ||||
Sbjct: 7365 tggcaagcccagatggccaagatgctttgtgcatgcaccaagcttgggttgcccaagtag 7306

                                                                        
Query: 494  tcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaac 553
            || || || |||||||| ||||| ||||| || |||||||||||||| || ||||| |||
Sbjct: 7305 tcaagtccaccctcgctaaagatttgggatccagccttgaaccagacagcttcgccaaac 7246

                                                                        
Query: 554  ttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcc 613
            ||||| ||||| || || |  ||||| |||||||| || || || || || ||||| |||
Sbjct: 7245 ttgacaccgttacgagccaagagctcagggaagacacatccaagagcaccaagcatagcc 7186

                                                                        
Query: 614  caccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagag 673
            || | ||||||||||||||| || || ||||||||||||||||| || || || || || 
Sbjct: 7185 catctgcagtggatcacctcgagttcacggttcttggcaaaggtttctggatccgctgaa 7126

                                         
Query: 674  agccccgcagtgtcccatccgtagtcacc 702
            || || ||||| ||||| ||||| |||||
Sbjct: 7125 agtccagcagtatcccacccgtaatcacc 7097



 Score =  268 bits (135), Expect = 2e-68
 Identities = 456/563 (80%)
 Strand = Plus / Minus

                                                                        
Query: 140  acaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcg 199
            |||||||| |||||| ||| ||| ||||||||||| || ||||| ||||| ||||| || 
Sbjct: 2666 acaaagtttgtggcgtaggaccaggcgttgttgttaactgggtcagcaagatggtcagca 2607

                                                                        
Query: 200  aggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggag 259
            |||||||||||||| || || ||||| ||||||||||| || || || |||||||| |||
Sbjct: 2606 aggttctccaatggaccttttccagtaacaatggcctgaacaaagaatccgaacatagag 2547

                                                                        
Query: 260  aacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcgggg 319
            ||||||||||| |  || |||||||||||||| || |||||||| ||||| ||||| |||
Sbjct: 2546 aacatggcaagcctgccattcttgatctcctttactttgagctcagcgaatgcctctggg 2487

                                                                        
Query: 320  tcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcgacgatctcg 379
            || || || ||||| || ||||| ||||| ||||| |||||||| |||||||| | ||| 
Sbjct: 2486 tcctcagcaaggcctagtgggtcaaagctgccaccagggtagagtgggtcgacaacctca 2427

                                                                        
Query: 380  ccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacctggcaa 439
            || || || || || || |||||||| ||||| ||||| ||||| |  |  || ||||||
Sbjct: 2426 ccaagaggcccaccagcaacacggtaaccctcaacggctcccatcaagataacttggcaa 2367

                                                                        
Query: 440  gcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgagg 499
            |||||||| || | |||||| ||||||||||  | ||| || ||||| | |||||| || 
Sbjct: 2366 gcccagatagccaagatgctttgtgcgtggatcaagcttggattgcccaagtagtcaagt 2307

                                                                        
Query: 500  ccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacg 559
            || |||||||| ||||| || || || ||||||||||| || ||||| || |||||||||
Sbjct: 2306 ccaccctcgctaaagatttgtgatccagccttgaaccatacagcctcaccaaacttgacg 2247

                                                                        
Query: 560  ccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccgg 619
            || || ||||| |  ||||||||||| || || || || || || ||||| ||||| | |
Sbjct: 2246 ccattacgggccaagagctcggggaaaacacatccaagagcaccaagcatagcccatctg 2187

                                                                        
Query: 620  cagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagcccc 679
            ||||| |||||||| || || |||||||||||||| || || |||||||| || || || 
Sbjct: 2186 cagtgaatcacctcgagttcacggttcttggcaaaagtttctgggtcggctgaaagtcca 2127

                                   
Query: 680  gcagtgtcccatccgtagtcacc 702
            ||||| ||||| || ||||||||
Sbjct: 2126 gcagtatcccacccatagtcacc 2104
to top
>gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score =  305 bits (154), Expect = 1e-79
 Identities = 436/530 (82%)
 Strand = Plus / Minus

                                                                       
Query: 176 acggggtcggcaaggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcc 235
           |||||||| || ||||| || ||||||||||| |  || || || || ||||||||||||
Sbjct: 769 acggggtcagccaggtgatcagcgaggttctcgatgggtcctttcccggtgacaatggcc 710

                                                                       
Query: 236 tgcacgaaaaagccgaacatggagaacatggcaaggcgtccgttcttgatctccttcacc 295
           |||||||| || ||||||||||| |||||||| |  || |||||||||||||||||||||
Sbjct: 709 tgcacgaagaatccgaacatggaaaacatggccaaccgcccgttcttgatctccttcacc 650

                                                                       
Query: 296 ttgagctcggcgaacgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccg 355
           || ||||| ||||| || || |||||||| || || || || ||||||||||| || |||
Sbjct: 649 ttcagctccgcgaaagcgtcagggtcgtccgcaagtcccagcgggtcgaagctgcccccg 590

                                                                       
Query: 356 gggtagagggggtcgacgatctcgccgagcgggccgccggcgacacggtagccctcgacg 415
           ||||||| |||||||   | ||| || || || ||||| || | |||||| ||||| |||
Sbjct: 589 gggtagatggggtcggtcacctctcccagaggaccgcccgcaatacggtatccctccacg 530

                                                                       
Query: 416 gcgcccatgagcacgacctggcaagcccagatggcgaggatgctctgtgcgtggacgagg 475
           ||||||||||| | ||||||||| |||||||| || || |||||||| ||||| || | |
Sbjct: 529 gcgcccatgaggatgacctggcatgcccagattgcaagaatgctctgcgcgtgaaccaag 470

                                                                       
Query: 476 ctggggttgccgaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaac 535
           || ||||| || |||||||| || || ||||||||||| ||||| |  || |||||||||
Sbjct: 469 ctagggtttcctaggtagtcaagccctccctcgctgaaaatctgagctcccgccttgaac 410

                                                                       
Query: 536 cagacggcctcgccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccg 595
           || |||||||| |||||||| || || || |  || || ||||| ||||| ||||| || 
Sbjct: 409 cacacggcctcaccgaacttaactccatttctcgccagaagctccgggaaaacgcaaccc 350

                                                                       
Query: 596 agcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttcttggcaaag 655
           || ||||| ||||| |||||||||||||||||||| |||||||| | |||||| ||||| 
Sbjct: 349 agagcgcccagcattgcccaccggcagtggatcacttccagctctctgttcttcgcaaaa 290

                                                             
Query: 656 gtctcggggtcggcagagagccccgcagtgtcccatccgtagtcaccggg 705
           ||||| || || || || |||||||| |||||||| ||||||||||||||
Sbjct: 289 gtctctggatctgccgaaagccccgccgtgtcccacccgtagtcaccggg 240
to top
>dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light harvesting a/b binding
           protein, complete cds
          Length = 1055

 Score =  303 bits (153), Expect = 4e-79
 Identities = 470/573 (82%), Gaps = 2/573 (0%)
 Strand = Plus / Minus

                                                                       
Query: 134 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtgg 193
           ||||| || |||||||||||| ||||||| || |||||||| ||||||||||| ||||| 
Sbjct: 892 ccggggacgaagttggtggcgtaggcccaggcattgttgttcacggggtcggccaggtga 833

                                                                       
Query: 194 tcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaac 253
           ||||| |||||||| |  || || ||||| || || || ||||||||||| |||||||||
Sbjct: 832 tcggcaaggttctcgatgggtcctttgcccgtcacgatcgcctgcacgaagaagccgaac 773

                                                                       
Query: 254 atggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcc 313
           |||||||||||||| |  ||||||||||||||||||||||| || |  || ||||| || 
Sbjct: 772 atggagaacatggccaaccgtccgttcttgatctccttcactttcacgtccgcgaaagca 713

                                                                       
Query: 314 tcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcgacg 373
           || |||||||| || || || || ||||||||| |||| ||||| |||| |||||||   
Sbjct: 712 tccgggtcgtctgccagtcccagcgggtcgaagttaccgccgggatagatggggtcggtc 653

                                                                       
Query: 374 atctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacc 433
           | ||| ||||| || || || || |||||||||||||||| ||| |||||||| | ||||
Sbjct: 652 acctctccgaggggcccacccgcaacacggtagccctcgatggcacccatgaggatgacc 593

                                                                       
Query: 434 tggcaagcccagatggcgaggatgctctgtgcgtggacgaggctg-gggttgccgaggta 492
           ||||| ||||||||||| || |||||||| |||||||  |  ||| ||| | || |||||
Sbjct: 592 tggcatgcccagatggcaagaatgctctgggcgtggatca-actgtgggctccctaggta 534

                                                                       
Query: 493 gtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaa 552
           ||| || || ||||||||||||||||| |  || ||||||||||| || ||||| |||||
Sbjct: 533 gtcaagccctccctcgctgaagatctgagctcccgccttgaaccacaccgcctcaccgaa 474

                                                                       
Query: 553 cttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggc 612
           ||| || || || |  || || ||||| ||||| ||||| ||||| ||||| ||||| ||
Sbjct: 473 ctttactccattcctcgcaagaagctccgggaatacgcacccgagagcgcccagcatcgc 414

                                                                       
Query: 613 ccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcaga 672
           ||||||| |||||||||| |||||||| | |||||| || || ||||| || || || ||
Sbjct: 413 ccaccgggagtggatcacttccagctctctgttcttcgcgaacgtctccggatccgccga 354

                                            
Query: 673 gagccccgcagtgtcccatccgtagtcaccggg 705
            |||||||| |||||||| ||||||||||||||
Sbjct: 353 aagccccgccgtgtcccacccgtagtcaccggg 321
to top
>gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB2) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1027

 Score =  301 bits (152), Expect = 2e-78
 Identities = 464/568 (81%)
 Strand = Plus / Minus

                                                                       
Query: 141 caaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcga 200
           ||||||| |||||||||||||| || |||||||| || |||||||||||||| || || |
Sbjct: 802 caaagtttgtggcgaaggcccaagcattgttgttaactgggtcggcaaggtgatcagcaa 743

                                                                       
Query: 201 ggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggaga 260
           ||||||||||||| ||||| || || |||||||| || || || || |||||||| ||||
Sbjct: 742 ggttctccaatggaccctttccggtcacaatggcttggacaaagaacccgaacattgaga 683

                                                                       
Query: 261 acatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggt 320
           ||||||| |  |  ||||||||||||||||||||||||||||| || || ||||| ||||
Sbjct: 682 acatggctaatctaccgttcttgatctccttcaccttgagctcagcaaaagcctctgggt 623

                                                                       
Query: 321 cgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcgacgatctcgc 380
           | ||||| | ||| |  ||||| ||||||||||| |||||||| ||||||   | ||| |
Sbjct: 622 cctcggccaagcccaatgggtcaaagctaccacctgggtagagtgggtcggtcacctcac 563

                                                                       
Query: 381 cgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacctggcaag 440
           | || || || || || |||||||||||||| | ||| ||||| |  |  || || ||||
Sbjct: 562 caagtggcccaccagcaacacggtagccctcaatggcacccatcaagataacttgacaag 503

                                                                       
Query: 441 cccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggc 500
           ||||||||||||||||||| || |||||||| |  || |||||||| | ||| || || |
Sbjct: 502 cccagatggcgaggatgctttgagcgtggaccaaacttgggttgcccaagtaatcaagcc 443

                                                                       
Query: 501 cgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacgc 560
           | |||||||| ||||||||||  ||||||||||||||||| ||||| || |||||||| |
Sbjct: 442 caccctcgctaaagatctgggctccggccttgaaccagacagcctcaccaaacttgacac 383

                                                                       
Query: 561 cgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccggc 620
           ||||||| || |  || || |||||||| || || || || || | ||| ||||| ||||
Sbjct: 382 cgttgcgagccaagagttctgggaagacacatcctagagcacccaacatagcccatcggc 323

                                                                       
Query: 621 agtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccccg 680
           | || |||||||| ||||| |||||||| | ||| ||||| ||||| || || ||||| |
Sbjct: 322 aatgaatcacctcgagctcacggttcttagtaaaagtctcagggtcagccgaaagcccag 263

                                       
Query: 681 cagtgtcccatccgtagtcaccgggaaa 708
           |||||||||| |||||||||||||||||
Sbjct: 262 cagtgtcccagccgtagtcaccgggaaa 235
to top
>gb|BT014208.1| Lycopersicon esculentum clone 133385R, mRNA sequence
          Length = 958

 Score =  299 bits (151), Expect = 7e-78
 Identities = 469/575 (81%)
 Strand = Plus / Minus

                                                                       
Query: 134 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtgg 193
           ||||| |||||||| |||||||| ||||| || |||||||| |||||||| |||||||||
Sbjct: 835 ccggggacaaagtttgtggcgaaagcccaggcattgttgtttacggggtctgcaaggtgg 776

                                                                       
Query: 194 tcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaac 253
           || || |||||||||||||| ||||| || |||||||| || || || || || || |||
Sbjct: 775 tcagcaaggttctccaatggaccctttccggtgacaatagcttgaacaaagaatccaaac 716

                                                                       
Query: 254 atggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcc 313
           || |||||||| ||||| |  ||||||||||||||||| ||||||||||| || || |||
Sbjct: 715 atagagaacatagcaagtctaccgttcttgatctcctttaccttgagctcagcaaatgcc 656

                                                                       
Query: 314 tcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcgacg 373
           || ||||| || || ||||| |  ||||||||||| ||||| |||||||| |||||||| 
Sbjct: 655 tctgggtcttcagcaaggcctaatgggtcgaagctgccaccagggtagagtgggtcgaca 596

                                                                       
Query: 374 atctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacc 433
           | ||| || || || || || || | |||||| ||||| || || ||||| | ||| || 
Sbjct: 595 acctcaccaagaggtccaccagcaatacggtatccctcaacagctcccatcaacacaact 536

                                                                       
Query: 434 tggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtag 493
           ||||||||||||||||| | |||||| ||||| ||||| | ||| |||||||| | ||||
Sbjct: 535 tggcaagcccagatggccaagatgctttgtgcatggaccaagcttgggttgcccaagtag 476

                                                                       
Query: 494 tcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaac 553
           || || || || || |||||||||||||| |||||||||||||| || ||||| ||||||
Sbjct: 475 tcaagtccaccttcactgaagatctgggatccggccttgaaccacacagcctcaccgaac 416

                                                                       
Query: 554 ttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcc 613
           ||||| || || ||||| |  ||||| |||||||| || || || || || ||||| |||
Sbjct: 415 ttgacaccattacgggccaagagctcagggaagacacatccaagagcaccaagcatagcc 356

                                                                       
Query: 614 caccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagag 673
           || | ||||||||||||||| || || |||||||||||||| || || ||||| || || 
Sbjct: 355 catctgcagtggatcacctcaagttcacggttcttggcaaaagtttcagggtctgctgaa 296

                                              
Query: 674 agccccgcagtgtcccatccgtagtcaccgggaaa 708
           || || || || ||||| ||||| ||||| |||||
Sbjct: 295 agtccagcggtatcccacccgtaatcaccaggaaa 261
to top
>gb|DQ018375.1| Pinus gerardiana chloroplast putative light harvesting chlorophyll
           a/b binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 760

 Score =  299 bits (151), Expect = 7e-78
 Identities = 424/515 (82%)
 Strand = Plus / Minus

                                                                       
Query: 188 aggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaag 247
           ||||| || ||||||||||| |  || ||||| || |||||||||||||||||||| || 
Sbjct: 757 aggtgatcagcgaggttctcgatgggtccctttccggtgacaatggcctgcacgaagaat 698

                                                                       
Query: 248 ccgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcg 307
           ||||||||||| |||||||| | ||| ||||||||||||||||||||||| ||||| |||
Sbjct: 697 ccgaacatggaaaacatggccaagcgcccgttcttgatctccttcaccttcagctccgcg 638

                                                                       
Query: 308 aacgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagaggggg 367
           || || || |||||||| || || || | |||||||||||| ||||||||||||| ||||
Sbjct: 637 aaagcgtctgggtcgtctgcaagtcccaaggggtcgaagctgccaccggggtagatgggg 578

                                                                       
Query: 368 tcgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagc 427
           |||   | ||| || || |||||||| || | |||||| ||||| |||||||||||||| 
Sbjct: 577 tcggtcacctctcccagagggccgccagcaatacggtaaccctccacggcgcccatgagg 518

                                                                       
Query: 428 acgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccg 487
           | ||||||||| |||||||| || || |||||||| |||||||  ||||| ||||| || 
Sbjct: 517 atgacctggcatgcccagattgcaagaatgctctgcgcgtggataaggctagggtttccc 458

                                                                       
Query: 488 aggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcg 547
           |||||||| || || ||||||||||| ||||| |  || ||||||||||| || ||||| 
Sbjct: 457 aggtagtcaagccctccctcgctgaaaatctgagctcccgccttgaaccacactgcctcc 398

                                                                       
Query: 548 ccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagc 607
           |||||||| || || || |  || || ||||| ||||| ||||| || || ||||| |||
Sbjct: 397 ccgaactttactccatttctcgccagaagctccgggaaaacgcaacccagagcgcccagc 338

                                                                       
Query: 608 atggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcg 667
           || |||||||||||||||||||| ||||| || | |||||| ||||| ||||| || || 
Sbjct: 337 attgcccaccggcagtggatcacttccagttctctgttcttcgcaaatgtctccggatcc 278

                                              
Query: 668 gcagagagccccgcagtgtcccatccgtagtcacc 702
           || || || ||||| || ||||| |||||||||||
Sbjct: 277 gccgaaaggcccgccgtatcccacccgtagtcacc 243
to top
>gb|AY617093.1| Pinus remota chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score =  299 bits (151), Expect = 7e-78
 Identities = 433/527 (82%)
 Strand = Plus / Minus

                                                                       
Query: 176 acggggtcggcaaggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcc 235
           ||||||||||| ||||| || ||||||||||| |  || ||||| || ||||| ||||||
Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctcgatgggtcccttcccggtgacgatggcc 710

                                                                       
Query: 236 tgcacgaaaaagccgaacatggagaacatggcaaggcgtccgttcttgatctccttcacc 295
           || ||||| || ||||||||||| |||||||| | ||| |||||||||||||||||||||
Sbjct: 709 tgaacgaagaatccgaacatggaaaacatggccaagcgcccgttcttgatctccttcacc 650

                                                                       
Query: 296 ttgagctcggcgaacgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccg 355
           || ||||| ||||| || ||||||||||| || || || | |||||||||||| ||||||
Sbjct: 649 ttcagctccgcgaaagcgtcggggtcgtctgcaagtcccaaggggtcgaagctgccaccg 590

                                                                       
Query: 356 gggtagagggggtcgacgatctcgccgagcgggccgccggcgacacggtagccctcgacg 415
           |||||||  |||||    | ||| || || ||||||||||| | |||||| ||||| |||
Sbjct: 589 gggtagatagggtctgtcacctctcccagagggccgccggcaatacggtaaccctccacg 530

                                                                       
Query: 416 gcgcccatgagcacgacctggcaagcccagatggcgaggatgctctgtgcgtggacgagg 475
           ||||||||||| | ||||||||| |||||||| || || || ||||| |||||||  |||
Sbjct: 529 gcgcccatgaggatgacctggcatgcccagattgcaagaatactctgcgcgtggataagg 470

                                                                       
Query: 476 ctggggttgccgaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaac 535
           || ||||| || |||||||| || || ||||||||||| ||||| |  || |||||||||
Sbjct: 469 ctagggtttcccaggtagtcaagccctccctcgctgaaaatctgagctcccgccttgaac 410

                                                                       
Query: 536 cagacggcctcgccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccg 595
           || || || || |||||||| || || || |  || || ||||| ||||| ||||| || 
Sbjct: 409 cacacagcttccccgaactttactccatttctcgccagaagctccgggaaaacgcaaccc 350

                                                                       
Query: 596 agcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttcttggcaaag 655
           || ||||| ||||| |||||||||||||||||||| ||||  || | |||||| ||||| 
Sbjct: 349 agagcgcccagcattgcccaccggcagtggatcacttccaattctctgttcttcgcaaaa 290

                                                          
Query: 656 gtctcggggtcggcagagagccccgcagtgtcccatccgtagtcacc 702
           ||||| || || || || ||||||||||||||||| |||||||||||
Sbjct: 289 gtctccggatccgccgaaagccccgcagtgtcccacccgtagtcacc 243
to top
>gb|AY617089.1| Pinus lambertiana chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score =  299 bits (151), Expect = 7e-78
 Identities = 432/527 (81%)
 Strand = Plus / Minus

                                                                       
Query: 176 acggggtcggcaaggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcc 235
           ||||||||||| ||||| || ||||||||||| |  || ||||| || ||||| ||||||
Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacgatggcc 710

                                                                       
Query: 236 tgcacgaaaaagccgaacatggagaacatggcaaggcgtccgttcttgatctccttcacc 295
           |||||||| || ||||||||||| |||||||| | ||| |||||||||| ||||||||||
Sbjct: 709 tgcacgaagaatccgaacatggaaaacatggccaagcgcccgttcttgagctccttcacc 650

                                                                       
Query: 296 ttgagctcggcgaacgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccg 355
           || ||||| ||||| || || || ||||| || || || | |||||||||||| ||||||
Sbjct: 649 ttcagctccgcgaaagcgtcrggrtcgtctgcaagtcccaaggggtcgaagctgccaccg 590

                                                                       
Query: 356 gggtagagggggtcgacgatctcgccgagcgggccgccggcgacacggtagccctcgacg 415
           ||||||| |||||||   | ||| || || |||||||| || | |||||| ||||| |||
Sbjct: 589 gggtagatggggtcggtcacctctcccagagggccgccagcaatacggtaaccctccacg 530

                                                                       
Query: 416 gcgcccatgagcacgacctggcaagcccagatggcgaggatgctctgtgcgtggacgagg 475
           ||||||||||| | ||||||||| |||||||| || || |||||||| |||||||  |||
Sbjct: 529 gcgcccatgaggatgacctggcatgcccagattgcaagaatgctctgcgcgtggataagg 470

                                                                       
Query: 476 ctggggttgccgaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaac 535
           || ||||| || |||||||| || || ||||||||||| ||||| |  || |||||||||
Sbjct: 469 ctagggtttccaaggtagtcaagccctccctcgctgaaaatctgagctcccgccttgaac 410

                                                                       
Query: 536 cagacggcctcgccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccg 595
           || || ||||| |||||||| || || ||    || || ||||| ||||| ||||| || 
Sbjct: 409 cacactgcctccccgaactttactccatttttcgccagaagctccgggaaaacgcaaccc 350

                                                                       
Query: 596 agcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttcttggcaaag 655
           || ||||| ||||| |||||||||| ||||||||| ||||| || | |||||| ||||| 
Sbjct: 349 agrgcgcccagcattgcccaccggctgtggatcacttccagttctctgttcttcgcaaat 290

                                                          
Query: 656 gtctcggggtcggcagagagccccgcagtgtcccatccgtagtcacc 702
           ||||| || || || || |||||||| |||||||| |||||||||||
Sbjct: 289 gtctccggatccgccgaaagccccgccgtgtcccacccgtagtcacc 243
to top
>gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score =  297 bits (150), Expect = 3e-77
 Identities = 435/530 (82%)
 Strand = Plus / Minus

                                                                       
Query: 176 acggggtcggcaaggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcc 235
           |||||||| || ||||| || ||||||||||| |  || || || || ||||||||||||
Sbjct: 769 acggggtcagccaggtgatcagcgaggttctcgatgggtcctttcccggtgacaatggcc 710

                                                                       
Query: 236 tgcacgaaaaagccgaacatggagaacatggcaaggcgtccgttcttgatctccttcacc 295
           |||||||| || ||||||||||| |||||||| |  || |||||||||||||||||||||
Sbjct: 709 tgcacgaagaatccgaacatggaaaacatggccaaccgcccgttcttgatctccttcacc 650

                                                                       
Query: 296 ttgagctcggcgaacgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccg 355
           || ||||| ||||| || || |||||||| || || |  || ||||||||||| || |||
Sbjct: 649 ttcagctccgcgaaagcgtcagggtcgtccgcaagtctcagcgggtcgaagctgcccccg 590

                                                                       
Query: 356 gggtagagggggtcgacgatctcgccgagcgggccgccggcgacacggtagccctcgacg 415
           ||||||| |||||||   | ||| || || || ||||| || | |||||| ||||| |||
Sbjct: 589 gggtagatggggtcggtcacctctcccagaggaccgcccgcaatacggtatccctccacg 530

                                                                       
Query: 416 gcgcccatgagcacgacctggcaagcccagatggcgaggatgctctgtgcgtggacgagg 475
           ||||||||||| | ||||||||| |||||||| || || |||||||| ||||| || | |
Sbjct: 529 gcgcccatgaggatgacctggcatgcccagattgcaagaatgctctgcgcgtgaaccaag 470

                                                                       
Query: 476 ctggggttgccgaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaac 535
           || ||||| || |||||||| || || ||||||||||| ||||| |  || |||||||||
Sbjct: 469 ctagggtttcccaggtagtcaagccctccctcgctgaaaatctgagctcccgccttgaac 410

                                                                       
Query: 536 cagacggcctcgccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccg 595
           || |||||||| |||||||| || || || |  || || ||||| ||||| ||||| || 
Sbjct: 409 cacacggcctcaccgaacttaactccatttctagccagaagctccgggaaaacgcaaccc 350

                                                                       
Query: 596 agcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttcttggcaaag 655
           || ||||| ||||| |||||||||||||||||||| |||||||| | |||||| ||||| 
Sbjct: 349 agagcgcccagcattgcccaccggcagtggatcacttccagctctctgttcttcgcaaaa 290

                                                             
Query: 656 gtctcggggtcggcagagagccccgcagtgtcccatccgtagtcaccggg 705
           ||||| || || || || |||||||| |||||||| ||||||||||||||
Sbjct: 289 gtctctggatctgccgaaagccccgccgtgtcccacccgtagtcaccggg 240
to top
>gb|DQ418483.1| Zingiber officinale chloroplast chlorophyll a/b-binding protein
           mRNA, partial cds; nuclear gene for chloroplast product
          Length = 393

 Score =  295 bits (149), Expect = 1e-76
 Identities = 279/321 (86%), Gaps = 1/321 (0%)
 Strand = Plus / Minus

                                                                       
Query: 275 ccgttcttgatctccttcaccttgagct-cggcgaacgcctcggggtcgtcggcgaggcc 333
           ||||||||||| ||||||||||| |||| | ||||| ||||| || |||||||| || ||
Sbjct: 383 ccgttcttgatttccttcaccttcagcttccgcgaaagcctcaggatcgtcggctagacc 324

                                                                       
Query: 334 gagggggtcgaagctaccaccggggtagagggggtcgacgatctcgccgagcgggccgcc 393
            || || |||||||| || ||||||||||| |||||||| | ||| || |||||||||||
Sbjct: 323 cagcggttcgaagctccctccggggtagagcgggtcgaccacctcccctagcgggccgcc 264

                                                                       
Query: 394 ggcgacacggtagccctcgacggcgcccatgagcacgacctggcaagcccagatggcgag 453
           ||| |||||||| ||||| ||||||||||| ||||| |||||| | ||||| ||||| ||
Sbjct: 263 ggccacacggtacccctccacggcgcccatcagcaccacctgggacgcccatatggccag 204

                                                                       
Query: 454 gatgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaa 513
           ||||||||| |||||||  |||||||||||||||||||| ||||| |||||||||  |||
Sbjct: 203 gatgctctgcgcgtggatcaggctggggttgccgaggtaatcgagtccgccctcggagaa 144

                                                                       
Query: 514 gatctgggagccggccttgaaccagacggcctcgccgaacttgacgccgttgcgggcgag 573
           |||||| || |||||||||||||| || |||||||||||||||||||||||||||| |||
Sbjct: 143 gatctgcgacccggccttgaaccaaaccgcctcgccgaacttgacgccgttgcgggagag 84

                                
Query: 574 cagctcggggaagacgcagcc 594
            ||||| ||||||||||||||
Sbjct: 83  gagctccgggaagacgcagcc 63
to top
>dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting
            chlorophyll a/b-binding protein, complete cds
          Length = 7299

 Score =  295 bits (149), Expect = 1e-76
 Identities = 473/581 (81%)
 Strand = Plus / Plus

                                                                        
Query: 129  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
            |||| ||||| |||||||| |||||  ||||||| ||||||||||| || ||||| ||||
Sbjct: 1872 actttccgggaacaaagtttgtggcataggcccaagcgttgttgttaactgggtcagcaa 1931

                                                                        
Query: 189  ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
            | |||||||| |||||||||||||| ||||| || ||||| || || || ||||| || |
Sbjct: 1932 gatggtcggcaaggttctccaatggaccctttccggtgacgatagcttgaacgaagaaac 1991

                                                                        
Query: 249  cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
            | |||||||||||||| ||||| |  || |||||||||||||| ||||||||||| ||||
Sbjct: 1992 caaacatggagaacatagcaagtctaccattcttgatctcctttaccttgagctcagcga 2051

                                                                        
Query: 309  acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
            | ||||| ||||| || || || || |  || ||||| |||||||||||||| || ||||
Sbjct: 2052 aagcctctgggtcttcagcaagacccaatggatcgaaactaccaccggggtaaagtgggt 2111

                                                                        
Query: 369  cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
            | || | ||| || || || || || || |||||||| ||||| || || ||||| |  |
Sbjct: 2112 caacaacctcaccaagaggcccaccagcaacacggtaaccctcaacagctcccatcaata 2171

                                                                        
Query: 429  cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
            |||| ||||||||||| || || | |||||| |||||||| || |  || |||||||| |
Sbjct: 2172 cgacttggcaagcccaaatagccaagatgctttgtgcgtgaaccaaacttgggttgccca 2231

                                                                        
Query: 489  ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
             |||||| || || ||||||||||| |||||||| || ||||||||||| || || || |
Sbjct: 2232 agtagtcaagaccaccctcgctgaaaatctgggaaccagccttgaaccatacagcttctc 2291

                                                                        
Query: 549  cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
            |||||||||| ||||| || || |  |||||||||||||| || || || || || ||||
Sbjct: 2292 cgaacttgacaccgttacgtgccaagagctcggggaagacacaaccaagagctccaagca 2351

                                                                        
Query: 609  tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
            ||||||| | ||||||||||||||||| ||| |||||||||||||| || || || || |
Sbjct: 2352 tggcccatctgcagtggatcacctccaactcacggttcttggcaaaagtttctggatcag 2411

                                                     
Query: 669  cagagagccccgcagtgtcccatccgtagtcaccgggaaac 709
            | || || || |||||||||||||| |||||||| ||||||
Sbjct: 2412 ctgaaagtccagcagtgtcccatccatagtcacctggaaac 2452



 Score =  242 bits (122), Expect = 1e-60
 Identities = 461/574 (80%)
 Strand = Plus / Minus

                                                                        
Query: 129  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
            |||| ||||| |||||||| |||||  | ||||| || |||||||| || ||||| ||||
Sbjct: 5161 actttccgggaacaaagttagtggcatatgcccaggcattgttgttaactgggtcagcaa 5102

                                                                        
Query: 189  ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
            |||||||||| |||||||||||||| || || || ||||| || ||||| || || || |
Sbjct: 5101 ggtggtcggcaaggttctccaatggaccttttccggtgacgatagcctgaacaaagaatc 5042

                                                                        
Query: 249  cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
            | |||||||||||||||||||| |  || |||||||||||||| ||||||||||| || |
Sbjct: 5041 caaacatggagaacatggcaagtctgccattcttgatctcctttaccttgagctcagcaa 4982

                                                                        
Query: 309  acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
            | ||||| || || || || ||||| |  || |||||||| ||||||||||| || ||||
Sbjct: 4981 aagcctcaggatcttcagcaaggcccaatggatcgaagctgccaccggggtaaagtgggt 4922

                                                                        
Query: 369  cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
            | || | ||| || || || || || || |||||||| ||||| ||||| ||||| |  |
Sbjct: 4921 caacaacctcaccaagaggcccaccagcaacacggtaaccctcaacggctcccatcaata 4862

                                                                        
Query: 429  cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
              || ||||||||||||||||| |  ||||| ||||||||||| |  || |||||||| |
Sbjct: 4861 taacttggcaagcccagatggctaaaatgctttgtgcgtggaccaaacttgggttgccca 4802

                                                                        
Query: 489  ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
             |||||| || || || || ||||| || || || || ||||||||||| ||||||||||
Sbjct: 4801 agtagtcaagtccaccttcactgaaaatttgagatccagccttgaaccatacggcctcgc 4742

                                                                        
Query: 549  cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
            | ||||| || || || ||||| |  |||||||||||||| || || || || || ||||
Sbjct: 4741 caaacttaacaccattacgggccaagagctcggggaagacacaaccaagagctccaagca 4682

                                                                        
Query: 609  tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
            | ||||| | ||||||||||||||||| ||| |||||||| ||||| || || || || |
Sbjct: 4681 ttgcccatctgcagtggatcacctccaactcacggttcttagcaaaagtttctggatcag 4622

                                              
Query: 669  cagagagccccgcagtgtcccatccgtagtcacc 702
            | || || || ||||||||||| |||||||||||
Sbjct: 4621 ctgaaagtccagcagtgtcccacccgtagtcacc 4588
to top
>gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score =  291 bits (147), Expect = 2e-75
 Identities = 432/527 (81%)
 Strand = Plus / Minus

                                                                       
Query: 176 acggggtcggcaaggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcc 235
           ||||||||||| ||||| || ||||||||||| |  || ||||| || ||||| || |||
Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacgattgcc 710

                                                                       
Query: 236 tgcacgaaaaagccgaacatggagaacatggcaaggcgtccgttcttgatctccttcacc 295
           |||||||| || ||||||||||| |||||||| | ||| |||||||||| ||||||||||
Sbjct: 709 tgcacgaagaatccgaacatggaaaacatggccaagcgcccgttcttgagctccttcacc 650

                                                                       
Query: 296 ttgagctcggcgaacgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccg 355
           || ||||| ||||| || ||||||||||| || || || | |||||||||||| ||||||
Sbjct: 649 ttcagctccgcgaaagcgtcggggtcgtctgcaagtcccaaggggtcgaagctgccaccg 590

                                                                       
Query: 356 gggtagagggggtcgacgatctcgccgagcgggccgccggcgacacggtagccctcgacg 415
           ||||||| |||||||   | ||| || || |||||||| || | |||||| ||||| |||
Sbjct: 589 gggtagatggggtcggtcacctctcccagagggccgccagcaatacggtaaccctccacg 530

                                                                       
Query: 416 gcgcccatgagcacgacctggcaagcccagatggcgaggatgctctgtgcgtggacgagg 475
           ||||||||||| | ||||||||| |||||||| || || |||||||| |||||||  |||
Sbjct: 529 gcgcccatgaggatgacctggcatgcccagattgcaagaatgctctgcgcgtggataagg 470

                                                                       
Query: 476 ctggggttgccgaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaac 535
           || ||||| || |||| ||| || || ||||||||||| ||||| |  || |||||||||
Sbjct: 469 ctagggtttccaaggtggtcaagccctccctcgctgaaaatctgagctcccgccttgaac 410

                                                                       
Query: 536 cagacggcctcgccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccg 595
           || || ||||| |||||||| || || ||    || || ||||| ||||| ||||| || 
Sbjct: 409 cacactgcctccccgaactttactccatttttcgccagaagctccgggaaaacgcaaccc 350

                                                                       
Query: 596 agcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttcttggcaaag 655
           || ||||| ||||| |||||||||| ||||||||| ||||| || | |||||| ||||| 
Sbjct: 349 agagcgcccagcattgcccaccggctgtggatcacttccagttctctgttcttcgcaaat 290

                                                          
Query: 656 gtctcggggtcggcagagagccccgcagtgtcccatccgtagtcacc 702
           ||||| || || || || |||||||| |||||||| |||||||||||
Sbjct: 289 gtctccggatccgccgaaagccccgccgtgtcccacccgtagtcacc 243
to top
>gb|AY617081.1| Pinus echinata chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 762

 Score =  291 bits (147), Expect = 2e-75
 Identities = 429/523 (82%)
 Strand = Plus / Minus

                                                                       
Query: 183 cggcaaggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacga 242
           |||| ||||| || ||||||||||| |  || || || || ||||| |||||||||||||
Sbjct: 762 cggccaggtgatcagcgaggttctcgatgggtcctttcccggtgacgatggcctgcacga 703

                                                                       
Query: 243 aaaagccgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagct 302
           | || ||||||||||| |||||||| |  || ||||||||||||||||||||||| ||||
Sbjct: 702 agaatccgaacatggaaaacatggccaaccgcccgttcttgatctccttcaccttcagct 643

                                                                       
Query: 303 cggcgaacgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtaga 362
           | ||||| || ||||||||||| || || || || ||||||||||| || ||||||||||
Sbjct: 642 ccgcgaaagcgtcggggtcgtccgcaagtcccagcgggtcgaagctgcccccggggtaga 583

                                                                       
Query: 363 gggggtcgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgccca 422
            |||||||   | ||| || |  || ||||| || | |||||||||||| ||||||||||
Sbjct: 582 tggggtcggtcacctctcccaaaggaccgcccgcaatacggtagccctccacggcgccca 523

                                                                       
Query: 423 tgagcacgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggt 482
           |||| | ||||||||| |||||||| || || |||||||| ||||| || | ||| ||||
Sbjct: 522 tgaggatgacctggcatgcccagattgcaagaatgctctgcgcgtgaaccaagctagggt 463

                                                                       
Query: 483 tgccgaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacgg 542
           | || |||||||| || || ||||||||||| ||||| |  || ||||||||||| || |
Sbjct: 462 ttcccaggtagtcaagccctccctcgctgaaaatctgagctcccgccttgaaccacactg 403

                                                                       
Query: 543 cctcgccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgc 602
           |||| |||||||| || || || |  || || ||||| ||||| ||||| || || ||||
Sbjct: 402 cctcaccgaactttactccatttctygccagaagctccgggaaaacgcaacccagagcgc 343

                                                                       
Query: 603 cgagcatggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcgg 662
           | ||||| |||||||||||||||||||| |||||||| | |||||| ||||| ||||| |
Sbjct: 342 ccagcattgcccaccggcagtggatcacttccagctctctgttcttcgcaaaagtctctg 283

                                                      
Query: 663 ggtcggcagagagccccgcagtgtcccatccgtagtcaccggg 705
           | || || || |||||||| |||||||| ||||||||||||||
Sbjct: 282 gatctgccgaaagccccgccgtgtcccacccgtagtcaccggg 240
to top
>gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b binding protein
           3C-like mRNA, complete cds
          Length = 1055

 Score =  289 bits (146), Expect = 6e-75
 Identities = 476/586 (81%)
 Strand = Plus / Minus

                                                                       
Query: 124 agcttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 183
           |||| |||| ||||| |||||||| ||||| |||||||| ||||||||||| || |||||
Sbjct: 842 agctcactttccgggaacaaagtttgtggcaaaggcccaagcgttgttgttaactgggtc 783

                                                                       
Query: 184 ggcaaggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaa 243
            |||||||||||||| |||||||||||||| ||||| || |||||||| || || || ||
Sbjct: 782 agcaaggtggtcggcaaggttctccaatggaccctttccggtgacaatagcttggacaaa 723

                                                                       
Query: 244 aaagccgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctc 303
            || || ||||| |||||||| ||||| |  || |||||||| ||||| |||||||||||
Sbjct: 722 gaatccaaacatagagaacatagcaagtctgccattcttgatttccttaaccttgagctc 663

                                                                       
Query: 304 ggcgaacgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagag 363
            || || ||||| ||||| || || ||||| |  ||||| ||||||||||| ||||| ||
Sbjct: 662 agcaaaagcctctgggtcatcagcaaggcccaatgggtcaaagctaccaccagggtaaag 603

                                                                       
Query: 364 ggggtcgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccat 423
            ||||| || | ||| || || || || || || | |||||| ||||| ||||| |||||
Sbjct: 602 tgggtcaacaacctcaccaagaggcccaccagcaatacggtaaccctcaacggctcccat 543

                                                                       
Query: 424 gagcacgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggtt 483
            | ||| || |||||||||||||| || | |||||| ||||| ||||| |  || |||||
Sbjct: 542 caacacaacttggcaagcccagatagccaagatgctttgtgcatggaccaaacttgggtt 483

                                                                       
Query: 484 gccgaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggc 543
           ||| | |||||| || || ||||||||||| || ||||| || ||||||||||| || ||
Sbjct: 482 gcccaagtagtcaagtccaccctcgctgaaaatttgggatccagccttgaaccatacagc 423

                                                                       
Query: 544 ctcgccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgcc 603
            ||||| |||||||| || || ||||| |  ||||| |||||||| || || || || ||
Sbjct: 422 ttcgccaaacttgacaccattacgggccaaaagctcagggaagacacatccaagagcacc 363

                                                                       
Query: 604 gagcatggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggg 663
            ||||||||||| | ||||||||||||||| ||||| |||||||| || || || || ||
Sbjct: 362 aagcatggcccatctgcagtggatcacctcaagctcacggttcttagcgaatgtttcagg 303

                                                         
Query: 664 gtcggcagagagccccgcagtgtcccatccgtagtcaccgggaaac 709
           ||| || || || || ||||||||||||||||||||||| ||||||
Sbjct: 302 gtcagctgaaagtccagcagtgtcccatccgtagtcaccaggaaac 257
to top
>emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding protein cab 25
          Length = 1184

 Score =  287 bits (145), Expect = 2e-74
 Identities = 472/581 (81%)
 Strand = Plus / Minus

                                                                        
Query: 129  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
            |||| ||||| |||||||| ||||| ||||||||||| |||||||| |||||||| ||||
Sbjct: 1029 actttccgggaacaaagtttgtggcaaaggcccacgcattgttgttaacggggtcagcaa 970

                                                                        
Query: 189  ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
            |||| || ||||||||||||||||| || || ||||||||||| || || || || || |
Sbjct: 969  ggtgatcagcgaggttctccaatggaccttttccagtgacaatagcttgtacaaagaatc 910

                                                                        
Query: 249  cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
            | |||||||||||||| ||||| |  || ||||||||||||||||||||||||||||| |
Sbjct: 909  caaacatggagaacatagcaagtctgccattcttgatctccttcaccttgagctcggcaa 850

                                                                        
Query: 309  acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
            | || || ||||| || || || || |  ||||||||||||||||| ||||| || || |
Sbjct: 849  aagcttctgggtcatcagcaagccctaatgggtcgaagctaccaccagggtatagtggat 790

                                                                        
Query: 369  cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
            | |  | ||| ||||| || || ||||| |||||||| ||||| ||||| ||||| | ||
Sbjct: 789  caataacctcaccgagaggaccaccggcaacacggtaaccctcaacggctcccatcaaca 730

                                                                        
Query: 429  cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
            | || ||||||||||| ||||| | |||||| ||||| || || |  || |||||||| |
Sbjct: 729  caacttggcaagcccaaatggctaagatgctttgtgcatgaaccaaacttgggttgccca 670

                                                                        
Query: 489  ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
             |||||| || || || || ||||| || || || || ||||||||||| || || || |
Sbjct: 669  agtagtcaagtccaccttcactgaaaatttgagatccagccttgaaccatacagcttcac 610

                                                                        
Query: 549  cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
            |||||||||| || || ||||| |  ||||| ||||||||||| || || || || ||||
Sbjct: 609  cgaacttgacaccattacgggcaaagagctcagggaagacgcaaccaagagctccaagca 550

                                                                        
Query: 609  tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
            ||||||| | ||||||||||||||||| ||||||||||||||| || || || ||||| |
Sbjct: 549  tggcccatctgcagtggatcacctccaactcccggttcttggcgaaagtttctgggtctg 490

                                                     
Query: 669  cagagagccccgcagtgtcccatccgtagtcaccgggaaac 709
            | || || || ||||| ||||| || |||||||| ||||||
Sbjct: 489  ctgaaagtccagcagtatcccacccatagtcaccaggaaac 449
to top
>gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-2) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score =  287 bits (145), Expect = 2e-74
 Identities = 463/569 (81%)
 Strand = Plus / Minus

                                                                       
Query: 134 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtgg 193
           ||||| |||||||| ||||| |||||||| || ||||||||||| || || |||||||||
Sbjct: 791 ccgggaacaaagtttgtggcaaaggcccatgcattgttgttgactggatctgcaaggtgg 732

                                                                       
Query: 194 tcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaac 253
           || || || ||||||||||| ||||| || || |||||||| || ||||| || || |||
Sbjct: 731 tcagcaagattctccaatggaccctttccggtaacaatggcttgaacgaagaatccaaac 672

                                                                       
Query: 254 atggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcc 313
           || |||||||| ||||| |  |||||||| |||||||| || |||||||| || || |||
Sbjct: 671 atagagaacatagcaagtctgccgttcttaatctcctttactttgagctcagcaaatgcc 612

                                                                       
Query: 314 tcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcgacg 373
           || || || || || || || |  ||||| || || ||||| |||||||| |||||||||
Sbjct: 611 tctggatcatcagcaagacctaatgggtcaaaactgccaccagggtagagtgggtcgacg 552

                                                                       
Query: 374 atctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacc 433
           | ||| || || || || || || | |||||| ||||| || || ||||| | ||| || 
Sbjct: 551 acctcaccaagaggtccacctgcaatacggtatccctcaacagctcccattaacacaact 492

                                                                       
Query: 434 tggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtag 493
           ||||||||||| ||||| | |||||| ||||| ||||| | ||| |||||||| | ||||
Sbjct: 491 tggcaagcccaaatggccaagatgctttgtgcatggaccaagcttgggttgcccaagtag 432

                                                                       
Query: 494 tcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaac 553
           || || || |||||||||||||||||||| |||||||||||||| || ||||| ||||||
Sbjct: 431 tcaagtccaccctcgctgaagatctgggatccggccttgaaccacacagcctcaccgaac 372

                                                                       
Query: 554 ttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcc 613
           ||||| ||||| ||||| |  ||||| |||||||| || || || || || ||||| |||
Sbjct: 371 ttgacaccgttacgggccaagagctcagggaagacacatccaagagcaccaagcatagcc 312

                                                                       
Query: 614 caccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagag 673
           || | ||||||||||||||| || || |||||||||||||||||||| ||||| || || 
Sbjct: 311 catctgcagtggatcacctcaagttcacggttcttggcaaaggtctcagggtctgctgaa 252

                                        
Query: 674 agccccgcagtgtcccatccgtagtcacc 702
           || || || || |||||||| ||||||||
Sbjct: 251 agtccagcggtatcccatccatagtcacc 223
to top
>dbj|AB012636.1| Nicotiana sylvestris Lhcb1*1 gene for light harvesting chlorophyll
           a/b-binding protein, complete cds
          Length = 3659

 Score =  285 bits (144), Expect = 1e-73
 Identities = 429/524 (81%)
 Strand = Plus / Minus

                                                                       
Query: 134 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtgg 193
           ||||| |||||||| |||||| | ||||| || |||||||| || ||||| |||||||||
Sbjct: 927 ccggggacaaagtttgtggcgtacgcccaagcattgttgttaactgggtctgcaaggtgg 868

                                                                       
Query: 194 tcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaac 253
           || || |||||||| ||||||||||| || || |||||||| || || || || ||||||
Sbjct: 867 tcagcaaggttctctaatgggccctttccggtaacaatggcttgaacaaagaatccgaac 808

                                                                       
Query: 254 atggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcc 313
           || ||||||||||| || | ||||||||| ||||| || ||||||||||||||||| |||
Sbjct: 807 atagagaacatggcgagtcttccgttcttaatctcttttaccttgagctcggcgaatgcc 748

                                                                       
Query: 314 tcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcgacg 373
           || || || || || ||||| || ||||| ||||| ||||| |||||||| |||||||| 
Sbjct: 747 tctggatcctcagcaaggcccagtgggtcaaagctgccaccagggtagagtgggtcgaca 688

                                                                       
Query: 374 atctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacc 433
           | ||| || || || || || || |||||||| ||||| ||||| ||||| |  |  || 
Sbjct: 687 acctcaccaagaggcccaccagcaacacggtaaccctcaacggctcccatcaagataact 628

                                                                       
Query: 434 tggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtag 493
           ||||||||||||||||| | |||||| ||||| ||||| | ||| |||||||| | ||||
Sbjct: 627 tggcaagcccagatggccaagatgctttgtgcatggaccaagcttgggttgcccaagtag 568

                                                                       
Query: 494 tcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaac 553
           || || || |||||||| ||||| ||||| || |||||||||||||| || ||||| |||
Sbjct: 567 tcaagtccaccctcgctaaagatttgggatccagccttgaaccagacagcttcgccaaac 508

                                                                       
Query: 554 ttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcc 613
           ||||| ||||| || || |  ||||| |||||||| || || || || || ||||| |||
Sbjct: 507 ttgacaccgttacgagccaagagctcagggaagacacatccaagagcaccaagcatagcc 448

                                                       
Query: 614 caccggcagtggatcacctccagctcccggttcttggcaaaggt 657
           || | ||||||||||||||| || || |||||||||||||||||
Sbjct: 447 catctgcagtggatcacctcgagttcacggttcttggcaaaggt 404
to top
>gb|M14443.1|TOMCBPA Tomato chlorophyll a/b-binding protein gene Cab-1B, complete cds
          Length = 1253

 Score =  283 bits (143), Expect = 4e-73
 Identities = 467/575 (81%)
 Strand = Plus / Minus

                                                                       
Query: 134 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtgg 193
           ||||| |||||||| |||||||| ||||| || |||||||| |||||||| |||||||| 
Sbjct: 981 ccggggacaaagtttgtggcgaaagcccaggcattgttgtttacggggtctgcaaggtga 922

                                                                       
Query: 194 tcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaac 253
           || || |||||||||||||| ||||| || |||||||| || || || || || || |||
Sbjct: 921 tcagcaaggttctccaatggaccctttccggtgacaatagcttgaacaaagaatccaaac 862

                                                                       
Query: 254 atggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcc 313
           || |||||||| ||||| |  ||||||||||||||||| ||||||||||| || || |||
Sbjct: 861 atagagaacatagcaagtctaccgttcttgatctcctttaccttgagctcagcaaatgcc 802

                                                                       
Query: 314 tcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcgacg 373
           || ||||| || || ||||| |  ||||||||||| ||||| |||||||| |||||||| 
Sbjct: 801 tctgggtcttcagcaaggcctaatgggtcgaagctgccaccagggtagagtgggtcgaca 742

                                                                       
Query: 374 atctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacc 433
           | ||| || || || || || || | |||||| ||||| || || ||||| | ||| || 
Sbjct: 741 acctcaccaagaggtccaccagcaatacggtaaccctcaacagctcccatcaacacaact 682

                                                                       
Query: 434 tggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtag 493
           ||||||||||||||||| | |||||| ||||| ||||| | ||| |||||||| | ||||
Sbjct: 681 tggcaagcccagatggccaagatgctttgtgcatggaccaagcttgggttgcccaagtag 622

                                                                       
Query: 494 tcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaac 553
           || || || || || |||||||||||||| |||||||||||||| || ||||| ||||||
Sbjct: 621 tcaagtccaccttcactgaagatctgggatccggccttgaaccacacagcctcaccgaac 562

                                                                       
Query: 554 ttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcc 613
           ||||| || || ||||| |  ||||| |||||||| || || || || || ||||| |||
Sbjct: 561 ttgacaccattacgggccaagagctcagggaagacacatccaagagcaccaagcatagcc 502

                                                                       
Query: 614 caccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagag 673
           || | |||||||||||| || || || |||||||||||||| || || ||||| || || 
Sbjct: 501 catctgcagtggatcacttcaagttcacggttcttggcaaaagtttcagggtctgctgaa 442

                                              
Query: 674 agccccgcagtgtcccatccgtagtcaccgggaaa 708
           || || || || ||||| ||||| ||||| |||||
Sbjct: 441 agtccagcggtatcccacccgtaatcaccaggaaa 407
to top
>emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1078

 Score =  278 bits (140), Expect = 2e-71
 Identities = 464/572 (81%)
 Strand = Plus / Minus

                                                                       
Query: 131 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaagg 190
           ||||| || ||||||||||||||| ||||||| |||||||||||||| ||||| || |||
Sbjct: 834 ttgccagggacaaagttggtggcgtaggcccaggcgttgttgttgacagggtcagcgagg 775

                                                                       
Query: 191 tggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccg 250
           || |||||||||||||| |  || || ||||| || || |||||||| ||||| || |||
Sbjct: 774 tgatcggcgaggttctctaggggtcctttgcctgtcacgatggcctggacgaagaacccg 715

                                                                       
Query: 251 aacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaac 310
           ||||||||||||||||| |  || |||||||| | |||||||||||| ||||| ||||| 
Sbjct: 714 aacatggagaacatggccaaccgcccgttctttagctccttcaccttcagctctgcgaaa 655

                                                                       
Query: 311 gcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcg 370
           || || |||||||| ||    || |||||||||||| | |||||||| || | |||||| 
Sbjct: 654 gcgtccgggtcgtctgcccaccccagggggtcgaagttgccaccgggataaatggggtca 595

                                                                       
Query: 371 acgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacg 430
              | ||| || || || || || || |||||||||||||| | ||| |||||||| | |
Sbjct: 594 gtcacctctcccaggggtccacccgcaacacggtagccctcaatggcacccatgaggatg 535

                                                                       
Query: 431 acctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgagg 490
           |||||||| ||| ||||||| || ||||||||||||||||  |   | ||| |||| |||
Sbjct: 534 acctggcatgccaagatggcaagaatgctctgtgcgtggattaaatttgggctgcccagg 475

                                                                       
Query: 491 tagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccg 550
           ||||| || || ||||||||||||||||| |  || ||||||||||| || ||||| |||
Sbjct: 474 tagtcaagccctccctcgctgaagatctgagctcccgccttgaaccacaccgcctcaccg 415

                                                                       
Query: 551 aacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatg 610
           ||||| || ||||| | ||| || ||||| ||||| |||||||| || || || | ||||
Sbjct: 414 aactttactccgtttctggcaaggagctctgggaatacgcagcccagagcacccaacatg 355

                                                                       
Query: 611 gcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggca 670
           ||||| |||| ||||||||| |||||||| | |||||| || || ||||| || || || 
Sbjct: 354 gcccatcggccgtggatcacttccagctctctgttcttcgcgaacgtctccggatctgcc 295

                                           
Query: 671 gagagccccgcagtgtcccatccgtagtcacc 702
           || |||||||| |||||||| |||||||||||
Sbjct: 294 gacagccccgccgtgtcccacccgtagtcacc 263
to top
>gb|DQ018376.1| Pinus krempfii chloroplast putative light harvesting chlorophyll
           a/b binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 752

 Score =  274 bits (138), Expect = 4e-70
 Identities = 414/506 (81%)
 Strand = Plus / Minus

                                                                       
Query: 197 gcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatg 256
           ||||||||||| |  || |||||||| ||||| |||||||||||||| || |||||||||
Sbjct: 745 gcgaggttctcgatgggtcccttgccggtgacgatggcctgcacgaagaatccgaacatg 686

                                                                       
Query: 257 gagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcg 316
           || |||||||| | ||| |||||||||| |||||||||||| ||||| |||||||| |||
Sbjct: 685 gaaaacatggccaagcgcccgttcttgagctccttcaccttcagctccgcgaacgcgtcg 626

                                                                       
Query: 317 gggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcgacgatc 376
           |||||||| || || || | |||||||||||| ||||||||||||| ||||||    | |
Sbjct: 625 gggtcgtctgcaagtcccaaggggtcgaagctgccaccggggtagatggggtcagtcacc 566

                                                                       
Query: 377 tcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacctgg 436
           || || |  |||||||| || | ||| || ||||| |||||||||||||| | |||||||
Sbjct: 565 tctcccaaagggccgccagcaatacgataaccctccacggcgcccatgaggatgacctgg 506

                                                                       
Query: 437 caagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcg 496
           |  |||||||| || || |||||||| |||||||  ||||| ||||| || |||||||| 
Sbjct: 505 cttgcccagattgcaagaatgctctgcgcgtggataaggctagggtttcccaggtagtca 446

                                                                       
Query: 497 aggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttg 556
           || || ||||||||||| ||||| |  || ||||||||||| || ||||| |||||||| 
Sbjct: 445 agccctccctcgctgaaaatctgagctcccgccttgaaccacactgcctctccgaacttt 386

                                                                       
Query: 557 acgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccac 616
           || || || |  || || ||||| ||||| ||||| || || ||||| ||||| ||||||
Sbjct: 385 actccatttctcgccagaagctccgggaaaacgcaacccagggcgcccagcattgcccac 326

                                                                       
Query: 617 cggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagc 676
           |||| ||||||||| ||||| || | |||| | ||||| ||||| || || || || |||
Sbjct: 325 cggctgtggatcacttccagttctctgttcctcgcaaaagtctccggatccgccgaaagc 266

                                     
Query: 677 cccgcagtgtcccatccgtagtcacc 702
           ||||| |||||||| |||||||||||
Sbjct: 265 cccgccgtgtcccacccgtagtcacc 240
to top
>gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting complex II protein
           (Lhcb) mRNA, complete cds; nuclear gene for chloroplast
           product
          Length = 1024

 Score =  270 bits (136), Expect = 6e-69
 Identities = 460/564 (81%), Gaps = 8/564 (1%)
 Strand = Plus / Minus

                                                                       
Query: 146 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgaggttc 205
           ||||||||| ||||  | ||||||||| || |||||| ||| ||||||||||  ||||||
Sbjct: 775 ttggtggcgtaggcgaaggcgttgttggtgccggggttggccaggtggtcggacaggttc 716

                                                                       
Query: 206 tccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatg 265
           | ||  ||||||||||| || || |||||||| ||||| |||||||||||||||||||||
Sbjct: 715 tgcagggggcccttgccggtcacgatggcctgaacgaagaagccgaacatggagaacatg 656

                                                                       
Query: 266 gcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcg 325
           || ||||| ||||||||||||||||||||||| ||||| ||||| |  ||||||||||| 
Sbjct: 655 gccaggcggccgttcttgatctccttcaccttcagctcagcgaaggtgtcggggtcgtca 596

                                                                       
Query: 326 gcgaggccgagggggtcgaagctaccaccggggtagagggggtcgacgatctcgccgagc 385
           || ||||| |||||||||||    ||||||||||| ||   ||| | |  |||||| || 
Sbjct: 595 gccaggcccagggggtcgaacgagccaccggggtacagcttgtccaggccctcgcccagg 536

                                                                       
Query: 386 gggccgccggcgacacggtagccctcgacggcgcccatgagcacgacctggcaagcccag 445
           |||||||||  ||| ||||||||||| | ||||||||| ||||  ||||||   ||||||
Sbjct: 535 gggccgccgttgacgcggtagccctcaatggcgcccatcagcagcacctgggt-gcccag 477

                                                                       
Query: 446 -atggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgcc 504
            ||||| ||||||  ||| ||||| || ||| |||||||||| |||||||| || |||||
Sbjct: 476 gatggccaggatggactgggcgtgcaccaggttggggttgcccaggtagtccagaccgcc 417

                                                                       
Query: 505 ctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacgccgtt 564
           |||   ||||||||| |  || ||||||||||| ||||||||||||||    ||||||| 
Sbjct: 416 ctcctggaagatctgagcaccagccttgaaccacacggcctcgccgaagggcacgccgta 357

                                                                       
Query: 565 gcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccggcagtg 624
           |  | | |||||||||||||||| |||||| || ||||||||||||||||| |||  |||
Sbjct: 356 ggagcccagcagctcggggaagatgcagcccagagcgccgagcatggcccagcgggcgtg 297

                                                                       
Query: 625 gatcacctccagctcccggtt---cttggcaaaggtctcggggtcggcagagagccccgc 681
           ||||| ||||||||| ||||    ||||   |||||||| ||||| || || || || ||
Sbjct: 296 gatcagctccagctcgcggtagcgcttg---aaggtctccgggtcagcggacagaccggc 240

                                   
Query: 682 agtgtcccatccgtagtcaccggg 705
            |||||||| ||||||||||||||
Sbjct: 239 ggtgtcccagccgtagtcaccggg 216
to top
>dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-4, complete cds
          Length = 988

 Score =  270 bits (136), Expect = 6e-69
 Identities = 460/564 (81%), Gaps = 8/564 (1%)
 Strand = Plus / Minus

                                                                       
Query: 146 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgaggttc 205
           ||||||||| ||||  | ||||||||| || |||||| ||| ||||||||||  ||||||
Sbjct: 759 ttggtggcgtaggcgaaggcgttgttggtgccggggttggccaggtggtcggacaggttc 700

                                                                       
Query: 206 tccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatg 265
           | ||  ||||||||||| || || |||||||| ||||| |||||||||||||||||||||
Sbjct: 699 tgcagggggcccttgccggtcacgatggcctgaacgaagaagccgaacatggagaacatg 640

                                                                       
Query: 266 gcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcg 325
           || ||||| ||||||||||||||||||||||| ||||| ||||| |  ||||||||||| 
Sbjct: 639 gccaggcggccgttcttgatctccttcaccttcagctcagcgaaggtgtcggggtcgtca 580

                                                                       
Query: 326 gcgaggccgagggggtcgaagctaccaccggggtagagggggtcgacgatctcgccgagc 385
           || ||||| |||||||||||    ||||||||||| ||   ||| | |  |||||| || 
Sbjct: 579 gccaggcccagggggtcgaacgagccaccggggtacagcttgtccaggccctcgcccagg 520

                                                                       
Query: 386 gggccgccggcgacacggtagccctcgacggcgcccatgagcacgacctggcaagcccag 445
           |||||||||  ||| ||||||||||| | ||||||||| ||||  ||||||   ||||||
Sbjct: 519 gggccgccgttgacgcggtagccctcaatggcgcccatcagcagcacctgggt-gcccag 461

                                                                       
Query: 446 -atggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgcc 504
            ||||| ||||||  ||| ||||| || ||| |||||||||| |||||||| || |||||
Sbjct: 460 gatggccaggatggactgggcgtgcaccaggttggggttgcccaggtagtccagaccgcc 401

                                                                       
Query: 505 ctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacgccgtt 564
           |||   ||||||||| |  || ||||||||||| ||||||||||||||    ||||||| 
Sbjct: 400 ctcctggaagatctgagcaccagccttgaaccacacggcctcgccgaagggcacgccgta 341

                                                                       
Query: 565 gcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccggcagtg 624
           |  | | |||||||||||||||| |||||| || ||||||||||||||||| |||  |||
Sbjct: 340 ggagcccagcagctcggggaagatgcagcccagagcgccgagcatggcccagcgggcgtg 281

                                                                       
Query: 625 gatcacctccagctcccggtt---cttggcaaaggtctcggggtcggcagagagccccgc 681
           ||||| ||||||||| ||||    ||||   |||||||| ||||| || || || || ||
Sbjct: 280 gatcagctccagctcgcggtagcgcttg---aaggtctccgggtcagcggacagaccggc 224

                                   
Query: 682 agtgtcccatccgtagtcaccggg 705
            |||||||| ||||||||||||||
Sbjct: 223 ggtgtcccagccgtagtcaccggg 200
to top
>emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding protein cab 91R
          Length = 1173

 Score =  268 bits (135), Expect = 2e-68
 Identities = 426/523 (81%)
 Strand = Plus / Minus

                                                                        
Query: 129  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
            |||| ||||| |||||||| || ||| | | ||| ||||||||||| || ||||||||||
Sbjct: 1032 actttccggggacaaagttagttgcgtaagaccatgcgttgttgttaactgggtcggcaa 973

                                                                        
Query: 189  ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
            |||| || || ||||||||||| || ||||| ||||| || |||||||| || ||||| |
Sbjct: 972  ggtgatcagcaaggttctccaaaggaccctttccagtaacgatggcctgaacaaaaaatc 913

                                                                        
Query: 249  cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
            | |||||||| ||||| ||||| |  || |||||||||||||||||||||||||| || |
Sbjct: 912  caaacatggaaaacatagcaagtctaccattcttgatctccttcaccttgagctcagcaa 853

                                                                        
Query: 309  acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
            | ||||| ||||| || || || || |  |||||||| |||||||||||||| || ||||
Sbjct: 852  atgcctctgggtcatctgcaagacccaatgggtcgaaactaccaccggggtaaagtgggt 793

                                                                        
Query: 369  cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
            | || | ||| || || || || || || |||||||| ||||| ||||| ||||| | ||
Sbjct: 792  caacaacctcaccaagaggcccaccagcaacacggtaaccctcaacggctcccatcaaca 733

                                                                        
Query: 429  cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
            | || ||||||||||| ||||| | |||||| ||||||||||| |  || |||||||| |
Sbjct: 732  caacttggcaagcccaaatggccaagatgctttgtgcgtggaccaaacttgggttgccca 673

                                                                        
Query: 489  ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
             |||||| || || ||||||||||| || ||||| || ||||| ||||| || ||||| |
Sbjct: 672  agtagtcaagtccaccctcgctgaatatttgggatccagccttaaaccatacagcctcac 613

                                                                        
Query: 549  cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
            |||||||||| || || ||||| || || || |||||||| || || || || || ||||
Sbjct: 612  cgaacttgacaccattacgggcaaggagttcagggaagacacaaccaagagctccaagca 553

                                                       
Query: 609  tggcccaccggcagtggatcacctccagctcccggttcttggc 651
            ||||||| | ||||||||||||||||| ||| |||||||||||
Sbjct: 552  tggcccatctgcagtggatcacctccaactcacggttcttggc 510
to top
>dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3386

 Score =  268 bits (135), Expect = 2e-68
 Identities = 444/547 (81%)
 Strand = Plus / Minus

                                                                        
Query: 156  aggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgaggttctccaatgggc 215
            ||||||| ||||||||||| || ||||||||||||||||| || |||||||| ||||| |
Sbjct: 2225 aggcccaagcgttgttgttaactgggtcggcaaggtggtcagcaaggttctctaatggac 2166

                                                                        
Query: 216  ccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatggcaaggcgtc 275
            |||| || ||||| || || |||||||| || || ||||| |||||||||||||| |  |
Sbjct: 2165 cctttccggtgactatagcttgcacgaagaatccaaacatagagaacatggcaagtctac 2106

                                                                        
Query: 276  cgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcggcgaggccga 335
            | |||||||| ||||||||||||||||| ||||| ||||| ||||| || || || || |
Sbjct: 2105 cattcttgatttccttcaccttgagctcagcgaaagcctctgggtcttcagcaagaccca 2046

                                                                        
Query: 336  gggggtcgaagctaccaccggggtagagggggtcgacgatctcgccgagcgggccgccgg 395
              |||||||| |||||||| ||||| || ||||| || | ||||||||| || ||||| |
Sbjct: 2045 atgggtcgaaactaccaccagggtaaagtgggtcaacaacctcgccgagaggcccgcctg 1986

                                                                        
Query: 396  cgacacggtagccctcgacggcgcccatgagcacgacctggcaagcccagatggcgagga 455
            | |||||||| || || ||||| ||||| |  || || ||||||||||| ||||| |  |
Sbjct: 1985 caacacggtaaccttcaacggctcccatcaagacaacttggcaagcccaaatggccaaaa 1926

                                                                        
Query: 456  tgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaaga 515
            |||| ||||| ||||| |  || |||||||| | |||||| || || || |||||||| |
Sbjct: 1925 tgctttgtgcatggaccaaacttgggttgcccaagtagtcaagtccaccttcgctgaaaa 1866

                                                                        
Query: 516  tctgggagccggccttgaaccagacggcctcgccgaacttgacgccgttgcgggcgagca 575
            ||||||| || ||||||||||| || ||||| ||||||||||| ||||| || || |  |
Sbjct: 1865 tctgggatccagccttgaaccatacagcctcaccgaacttgactccgttacgagccaaga 1806

                                                                        
Query: 576  gctcggggaagacgcagccgagcgcgccgagcatggcccaccggcagtggatcacctcca 635
            | ||||||||||| || || || || || ||||||||||| | ||| |||||||||||||
Sbjct: 1805 gttcggggaagacacaaccaagagctccaagcatggcccatctgcaatggatcacctcca 1746

                                                                        
Query: 636  gctcccggttcttggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccgt 695
             ||| |||||||| ||||| || || || || || || || || |||||||||||||| |
Sbjct: 1745 actcacggttcttagcaaaagtttctggatcagctgaaagtccagcagtgtcccatccat 1686

                   
Query: 696  agtcacc 702
            | |||||
Sbjct: 1685 aatcacc 1679
to top
>emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/b binding protein
          Length = 1025

 Score =  264 bits (133), Expect = 4e-67
 Identities = 469/581 (80%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| |||||||| |||||  | | ||| ||||||||||| || ||||| ||||
Sbjct: 857 actttccgggaacaaagttagtggcataagaccaggcgttgttgttaaccgggtcagcaa 798

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           ||||||| || |||||||||||||| ||||| || ||||| || ||||| || || || |
Sbjct: 797 ggtggtcagcaaggttctccaatggaccctttccggtgacgatagcctgaacaaagaatc 738

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | |||||||||||||| ||||| |  || |||||||| ||||| ||||||||||| ||||
Sbjct: 737 caaacatggagaacatagcaagtctaccattcttgatttcctttaccttgagctcagcga 678

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           | ||||| || || || || ||||| |  ||||||||||| ||||||||||| || ||||
Sbjct: 677 aagcctctggatcttcagcaaggcccaatgggtcgaagctgccaccggggtaaagtgggt 618

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           | || | ||| ||||| || || || || |||||||| |||||||| || ||||| | ||
Sbjct: 617 caacaacctcaccgagaggtccaccagcaacacggtaaccctcgacagctcccatcaaca 558

                                                                       
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
           | || ||||||||||| ||||| | |||||| ||||||||||| |  || |||||||| |
Sbjct: 557 caacttggcaagcccaaatggccaagatgctttgtgcgtggaccaaacttgggttgccca 498

                                                                       
Query: 489 ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
            |||||| || || |||||||| || || ||||| || ||||||||||| || || || |
Sbjct: 497 agtagtcaagtccaccctcgctaaaaatttgggatccagccttgaaccatacagcttcac 438

                                                                       
Query: 549 cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
           |||||||||| || || || || |  || ||||||||||| || || || || || ||||
Sbjct: 437 cgaacttgacaccattacgtgccaagagttcggggaagacacaaccaagagctccaagca 378

                                                                       
Query: 609 tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
           ||||||| | ||||||||||||||||| ||| ||||||||||| || || || || || |
Sbjct: 377 tggcccatctgcagtggatcacctccaactcacggttcttggcgaatgtttctggatcag 318

                                                    
Query: 669 cagagagccccgcagtgtcccatccgtagtcaccgggaaac 709
           | || || || ||||||||||| ||||| ||||| ||||||
Sbjct: 317 ctgaaagtccagcagtgtcccacccgtaatcaccaggaaac 277
to top
>gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II chlorophyll a/b binding
           protein (CABII) mRNA, partial cds
          Length = 714

 Score =  264 bits (133), Expect = 4e-67
 Identities = 277/325 (85%)
 Strand = Plus / Minus

                                                                       
Query: 380 ccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacctggcaa 439
           ||||||||||||||| |||| |||||||||||||||  ||||||||||||||||||||| 
Sbjct: 325 ccgagcgggccgccgccgacgcggtagccctcgacgaagcccatgagcacgacctggcac 266

                                                                       
Query: 440 gcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgagg 499
           ||||||||||| ||||||||||| ||||| || ||| | |||||||| |||||||| || 
Sbjct: 265 gcccagatggccaggatgctctgcgcgtgcaccaggttcgggttgcccaggtagtccagc 206

                                                                       
Query: 500 ccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacg 559
           ||||||||   ||||||||| | ||||||||||||||| || ||||||||||||||||||
Sbjct: 205 ccgccctccgagaagatctgcgcgccggccttgaaccacaccgcctcgccgaacttgacg 146

                                                                       
Query: 560 ccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccgg 619
           |||||   ||| || | ||| ||||| ||||| || |||||||| ||||| |||||||| 
Sbjct: 145 ccgttcttggccaggatctccgggaacacgcaccccagcgcgcccagcatcgcccaccgc 86

                                                                       
Query: 620 cagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagcccc 679
            ||||||||||||||||||| ||||||   || || ||||| ||||| || || ||||||
Sbjct: 85  gagtggatcacctccagctcgcggttccgcgcgaacgtctccgggtccgccgacagcccc 26

                                    
Query: 680 gcagtgtcccatccgtagtcaccgg 704
           || |||||||| |||||||| ||||
Sbjct: 25  gccgtgtcccacccgtagtcgccgg 1



 Score =  149 bits (75), Expect = 1e-32
 Identities = 180/215 (83%)
 Strand = Plus / Minus

                                                                       
Query: 131 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaagg 190
           |||||||| || |||||||||||| | ||||| |||||||||  ||||||||| || |  
Sbjct: 574 ttgccggggacgaagttggtggcgtaagcccaggcgttgttggcgacggggtcagcgaca 515

                                                                       
Query: 191 tggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccg 250
           ||||||  ||||||||| |  || |||||||| ||||| |||||||| ||||| || || 
Sbjct: 514 tggtcgaagaggttctcgatgggtcccttgccggtgacgatggcctggacgaagaaccca 455

                                                                       
Query: 251 aacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaac 310
           ||||||||||||||||| ||||| |||||||||| |||||||||||||||||| |||   
Sbjct: 454 aacatggagaacatggcgaggcggccgttcttgagctccttcaccttgagctccgcggcg 395

                                              
Query: 311 gcctcggggtcgtcggcgaggccgagggggtcgaa 345
           |  |||||||| |||||||| ||||| ||||||||
Sbjct: 394 gtgtcggggtcatcggcgagcccgagcgggtcgaa 360
to top
>dbj|AB013728.1| Cryptomeria japonica mRNA for light-harvesting chlorophyll
           a/b-binding protein of photosystem II, complete cds
          Length = 935

 Score =  262 bits (132), Expect = 1e-66
 Identities = 469/580 (80%), Gaps = 1/580 (0%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| |||||||| |||||  | ||||| |||||||||||||| ||||| || |
Sbjct: 810 acttcccgggaacaaagttagtggcataagcccaggcgttgttgttgacagggtctgcca 751

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           | |||||||| | ||||||||  || || || || || || || ||||||||| | || |
Sbjct: 750 gatggtcggccaagttctccaggggaccttttccggtaacgatagcctgcacgtagaacc 691

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| || ||||| ||||| || || |||||||||||||| ||||| ||||| || |
Sbjct: 690 caaacatagaaaacatagcaagccggccattcttgatctccttaaccttaagctctgcaa 631

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           | ||||| ||||| || || | ||||||||| || ||||| |||||||| || || ||||
Sbjct: 630 aagcctcagggtcatcagccaagccgaggggatcaaagctcccaccgggataaagcgggt 571

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           |   |||||| |||||||| || || || |||||||||||||| ||||| |||||||| |
Sbjct: 570 cagtgatctccccgagcggtccaccagccacacggtagccctcaacggcacccatgagga 511

                                                                       
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
            ||||||||| ||||||||||| ||||||||||||||||| || ||||| |||||||| |
Sbjct: 510 tgacctggcatgcccagatggcaaggatgctctgtgcgtgcaccaggctagggttgccca 451

                                                                       
Query: 489 ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
             ||||| |  |||||||| ||||||||||| ||||| ||||||||||| || || || |
Sbjct: 450 aatagtccaaaccgccctcactgaagatctgtgagcccgccttgaaccaaaccgcttccc 391

                                                                       
Query: 549 cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
           ||||||| || || || |||   || ||||| ||||| ||||| ||||| || || | ||
Sbjct: 390 cgaacttcacaccatttcggctcagaagctccgggaaaacgcacccgagagctcccaaca 331

                                                                       
Query: 609 tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtc-g 667
           | |||||||||   || || || |||||||| | |||||||||||| ||||| ||||| |
Sbjct: 330 ttgcccaccgggcatgaataacttccagctctctgttcttggcaaaagtctctgggtctg 271

                                                   
Query: 668 gcagagagccccgcagtgtcccatccgtagtcaccgggaa 707
           || || || || || |||||||| ||||||||||||||||
Sbjct: 270 gctgacagaccggcggtgtcccacccgtagtcaccgggaa 231
to top
>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full
           insert sequence
          Length = 1040

 Score =  258 bits (130), Expect = 2e-65
 Identities = 196/218 (89%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||| |
Sbjct: 862 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 803

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           ||||||||   ||||||||||| ||||||||||| ||||| |||||||| ||||| ||||
Sbjct: 802 ggtggtcgagcaggttctccaaggggcccttgccggtgacgatggcctggacgaagaagc 743

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           ||||||||||||||||||| ||||| || |||||||||||||| ||||||||||||||||
Sbjct: 742 cgaacatggagaacatggcgaggcggccattcttgatctccttgaccttgagctcggcga 683

                                                 
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaag 346
           | |   |||||||||||||||||||||| |||||||||
Sbjct: 682 aggtgacggggtcgtcggcgaggccgagcgggtcgaag 645



 Score =  141 bits (71), Expect = 4e-30
 Identities = 127/143 (88%), Gaps = 2/143 (1%)
 Strand = Plus / Minus

                                                                       
Query: 401 cggtagccctcgacggcgcccatgagcacgacctggcaagcccag-atggcgaggatgct 459
           |||||||||||||||  ||||||||| ||||||||| || ||||| | ||||||||||||
Sbjct: 587 cggtagccctcgacgaggcccatgaggacgacctgg-aatcccagcacggcgaggatgct 529

                                                                       
Query: 460 ctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaagatctg 519
           ||| ||||| || ||| |||||||||||||||||||||||||||| |||  |||||||||
Sbjct: 528 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 469

                                  
Query: 520 ggagccggccttgaaccagacgg 542
           || ||||||||||||||| ||||
Sbjct: 468 ggcgccggccttgaaccacacgg 446



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 95/111 (85%)
 Strand = Plus / Minus

                                                                       
Query: 589 gcagccgagcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttctt 648
           |||||| |||||||||||||| |||||||||| |||||||||||||||| ||| |||| |
Sbjct: 396 gcagcccagcgcgccgagcatcgcccaccggccgtggatcacctccagcgccctgttcct 337

                                                              
Query: 649 ggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccgtagtc 699
            || || | ||| ||||| || ||||||||||| |||||||| || |||||
Sbjct: 336 cgcgaacgcctccgggtccgcggagagccccgccgtgtcccacccatagtc 286
to top
>gb|U21112.1|STU21112 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-3 gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score =  256 bits (129), Expect = 9e-65
 Identities = 459/569 (80%)
 Strand = Plus / Minus

                                                                       
Query: 134 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtgg 193
           ||||| |||||||| |||||  | | ||| ||||||||||| |||||||| |||||||||
Sbjct: 791 ccggggacaaagtttgtggcataagaccaggcgttgttgttaacggggtctgcaaggtgg 732

                                                                       
Query: 194 tcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaac 253
           || || |||||||||||||| ||||| || || |||||||| || ||||| || || |||
Sbjct: 731 tcagcaaggttctccaatggaccctttccggtaacaatggcttgaacgaagaatccaaac 672

                                                                       
Query: 254 atggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcc 313
           || |||||||| ||||| |  || |||||||||||||| ||||||||||| || || |||
Sbjct: 671 atagagaacatagcaagtctaccattcttgatctcctttaccttgagctcagcaaatgcc 612

                                                                       
Query: 314 tcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcgacg 373
           || ||||| || || || || |  ||||||||||| |||||||||||||| |||| ||| 
Sbjct: 611 tctgggtcatcagcaagacccaatgggtcgaagctgccaccggggtagagtgggttgaca 552

                                                                       
Query: 374 atctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacc 433
           | ||| || || || || || || | |||||| || || ||||| ||||| | ||| || 
Sbjct: 551 acctcaccaagaggtccaccagcaatacggtaaccttcaacggctcccatcaacacaact 492

                                                                       
Query: 434 tggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtag 493
           ||||||||||||||||| | |||||| ||||| ||||| |  || ||||| || | ||||
Sbjct: 491 tggcaagcccagatggccaagatgctttgtgcatggaccaaacttgggtttcccaagtag 432

                                                                       
Query: 494 tcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaac 553
           || || || ||||| | |||||| ||||| || || |||||||| || ||||| ||||||
Sbjct: 431 tcaagtccaccctcacggaagatttgggatccagctttgaaccacacagcctcaccgaac 372

                                                                       
Query: 554 ttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcc 613
           ||||| ||||| ||||| |  ||||| |||||||| || || || || || ||||| |||
Sbjct: 371 ttgacaccgttacgggccaagagctcagggaagacacatccaagagcaccaagcatagcc 312

                                                                       
Query: 614 caccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagag 673
           || | ||||||||||||||| || || ||||||||||||||||| || ||||| || || 
Sbjct: 311 catctgcagtggatcacctcgagttcacggttcttggcaaaggtttcagggtctgctgaa 252

                                        
Query: 674 agccccgcagtgtcccatccgtagtcacc 702
           || || || || ||||| |||||||||||
Sbjct: 251 agtccagcggtatcccacccgtagtcacc 223
to top
>gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvesting chlorophyll-a/b
           binding protein (LhcII-1.3) mRNA, complete cds; nuclear
           gene for chloroplast product
          Length = 1100

 Score =  254 bits (128), Expect = 3e-64
 Identities = 458/564 (81%), Gaps = 8/564 (1%)
 Strand = Plus / Minus

                                                                       
Query: 146 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgaggttc 205
           ||||||||||||||  ||||||||||   |  ||||| ||  ||||||||| | ||||||
Sbjct: 767 ttggtggcgaaggcgaacgcgttgttcacggtggggttggacaggtggtcgtccaggttc 708

                                                                       
Query: 206 tccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatg 265
           |  |  ||||||||||| || || |||||||| ||||| |||||||||||||||||||||
Sbjct: 707 tggacggggcccttgccggtcacgatggcctggacgaagaagccgaacatggagaacatg 648

                                                                       
Query: 266 gcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcg 325
           || ||||| ||||||||||||||||||||||| ||||| ||||| |  ||||||||||| 
Sbjct: 647 gccaggcggccgttcttgatctccttcaccttcagctcagcgaaggtgtcggggtcgtca 588

                                                                       
Query: 326 gcgaggccgagggggtcgaagctac-caccggggtagagggggtcgacgatctcgccgag 384
           || ||||| ||||||||||| | || | |||||||| |||||||| | |  |||||||  
Sbjct: 587 gccaggcccagggggtcgaa-cgactcgccggggtacagggggtccaggccctcgccggc 529

                                                                       
Query: 385 cgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacctggcaagccca 444
            |||||||||  ||| ||||||||||| ||   |||||| || |  |||||||| |||  
Sbjct: 528 ggggccgccgttgacgcggtagccctccaccaggcccatcaggatcacctggcaggccag 469

                                                                       
Query: 445 gatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgcc 504
           | |||||| |||| |||| ||||| || ||   ||||||||| |||||||| ||||||||
Sbjct: 468 ggtggcgacgatgttctgggcgtgcaccagagaggggttgcccaggtagtccaggccgcc 409

                                                                       
Query: 505 ctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacgccgtt 564
           ||||  ||||||||||| |||||||||||||||||| ||||||||||||| |  ||||||
Sbjct: 408 ctcggagaagatctgggcgccggccttgaaccagacagcctcgccgaactgggtgccgtt 349

                                                                       
Query: 565 gcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccggcagtg 624
              ||| ||||||||||||   | |||||| || ||||| ||||||||||| |||  |||
Sbjct: 348 cttggccagcagctcgggggtcaggcagcccagggcgcccagcatggcccagcgggcgtg 289

                                                                       
Query: 625 gatcacctccagctcccggtt---cttggcaaaggtctcggggtcggcagagagccccgc 681
           ||||| ||||||||| ||||    ||||   |||||||| ||||| || || || || ||
Sbjct: 288 gatcagctccagctcgcggtagcgcttg---aaggtctccgggtcagccgacaggccggc 232

                                   
Query: 682 agtgtcccatccgtagtcaccggg 705
            |||||||| ||||||||||||||
Sbjct: 231 ggtgtcccagccgtagtcaccggg 208
to top
>emb|X52744.1|NTCAB40 Tabacco Cab40 mRNA for major chlorophyll a/b binding protein
          Length = 1080

 Score =  250 bits (126), Expect = 5e-63
 Identities = 462/574 (80%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| |||||||| |||||  ||||||| || |||||||| || ||||| ||||
Sbjct: 865 actttccgggaacaaagtttgtggcataggcccaggcattgttgttaactgggtctgcaa 806

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           |||||||||| |||||||||||||| ||||| |||||||| || ||||| || || || |
Sbjct: 805 ggtggtcggcaaggttctccaatggaccctttccagtgacgatagcctgaacaaagaatc 746

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | |||||||| ||||| ||||| |  || |||||||||||||| ||||||||||| || |
Sbjct: 745 caaacatggaaaacatagcaagtctaccattcttgatctcctttaccttgagctcagcaa 686

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           | ||||| ||||| || || || || |  |||||||| || ||||| ||||| || ||||
Sbjct: 685 aagcctctgggtcttcagcaagtcccaatgggtcgaaactgccaccagggtaaagtgggt 626

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           | || |  || ||||| || || || || |||||||| ||||| || || ||||| | ||
Sbjct: 625 caacaacttcaccgagaggtccaccagcaacacggtaaccctcaactgctcccatcaaca 566

                                                                       
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
           | || ||||||||||| ||||| | |||||| ||||||||||| |  || |||||||| |
Sbjct: 565 caacttggcaagcccaaatggccaagatgctttgtgcgtggaccaaacttgggttgccca 506

                                                                       
Query: 489 ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
             ||||| || || |||||||| || || || || || ||||||||||| || |||||||
Sbjct: 505 aatagtcaagtccaccctcgctaaaaatttgagatccagccttgaaccatacagcctcgc 446

                                                                       
Query: 549 cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
           | |||||||| ||||| || || |  ||||| |||||||| || || || || || ||||
Sbjct: 445 caaacttgacaccgttacgtgccaagagctcagggaagacacaaccaagagctccaagca 386

                                                                       
Query: 609 tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
           ||||||| | ||||||||||||||||| ||| || ||||||||||| || || || || |
Sbjct: 385 tggcccatctgcagtggatcacctccaactcacgattcttggcaaaagtttctggatcag 326

                                             
Query: 669 cagagagccccgcagtgtcccatccgtagtcacc 702
           | || || || ||||||||||| |||||||||||
Sbjct: 325 ctgaaagtccagcagtgtcccacccgtagtcacc 292
to top
>emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/b binding protein
          Length = 964

 Score =  250 bits (126), Expect = 5e-63
 Identities = 462/574 (80%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| ||||||||||||||| ||| ||| || |||||||| || ||||| ||||
Sbjct: 869 actttccggggacaaagttggtggcgtaggaccaggcattgttgttaactgggtcagcaa 810

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           |||||||||| |||||||||||||| ||||| |||||||| || || || ||||| || |
Sbjct: 809 ggtggtcggctaggttctccaatggaccctttccagtgacgatagcttgaacgaagaatc 750

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| ||||| |  || |||||||| |  || || ||||| || || |
Sbjct: 749 caaacatagagaacatagcaagtctaccattcttgatgtgttttactttgagttcagcaa 690

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           | ||||| ||||| || || || || |  ||||| ||||| |||||||||||||| ||||
Sbjct: 689 aagcctctgggtcttcagcaagacccaatgggtcaaagctgccaccggggtagagcgggt 630

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           |||| | ||| || || ||||| || || |||||||| || ||||| || ||||| | ||
Sbjct: 629 cgacaacctcaccaagagggccaccagcaacacggtaaccttcgacagctcccatcaaca 570

                                                                       
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
           | || ||||||||||| ||||| | |||||| |||||||| || |  || |||||||| |
Sbjct: 569 caacttggcaagcccaaatggccaagatgctttgtgcgtgaaccaaacttgggttgccca 510

                                                                       
Query: 489 ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
            |||||| || || |||||||| || || ||||| || ||||||||||| || || || |
Sbjct: 509 agtagtcaagtccaccctcgctaaaaatttgggatccagccttgaaccatactgcttcac 450

                                                                       
Query: 549 cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
           | |||||||| ||||| ||||| |  |||||||||||||| || || || || || ||||
Sbjct: 449 caaacttgaccccgttacgggccaagagctcggggaagacacaaccaagagctccaagca 390

                                                                       
Query: 609 tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
           | ||||| | ||||||||||||||||| ||| || ||||||||||| || || || || |
Sbjct: 389 tagcccatctgcagtggatcacctccaactcacgattcttggcaaaagtttctggatcag 330

                                             
Query: 669 cagagagccccgcagtgtcccatccgtagtcacc 702
           | || || || |||||||||||||| ||||||||
Sbjct: 329 ctgaaagtccagcagtgtcccatccatagtcacc 296
to top
>dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene for light-harvesting
            chlorophyll a/b-binding protein 1, complete cds
          Length = 1975

 Score =  248 bits (125), Expect = 2e-62
 Identities = 458/569 (80%)
 Strand = Plus / Minus

                                                                        
Query: 131  ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaagg 190
            |||||||| || |||||||||||| | ||||| |||||||||   |||||||| || | |
Sbjct: 1848 ttgccgggaacgaagttggtggcgtatgcccatgcgttgttggcaacggggtctgccaag 1789

                                                                        
Query: 191  tggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccg 250
            ||||||   | ||||||||| |||||||||||||| ||||| ||||||||||| || |||
Sbjct: 1788 tggtcgttcaagttctccaaggggcccttgccagtcacaattgcctgcacgaagaatccg 1729

                                                                        
Query: 251  aacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaac 310
            ||||| |||||||| ||||| || ||||||||||| ||||||||||| | ||| ||||| 
Sbjct: 1728 aacatcgagaacatcgcaagtcggccgttcttgatttccttcaccttcaactcagcgaag 1669

                                                                        
Query: 311  gcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcg 370
            |  ||||||||||| || |  || | |||||||||    || |||||||||| |||||||
Sbjct: 1668 gtgtcggggtcgtcagccaaacccaaggggtcgaaagagcctccggggtagatggggtcg 1609

                                                                        
Query: 371  acgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacg 430
               |  ||||| |  || || ||||| |||||||| ||||| ||||| ||||| || |  
Sbjct: 1608 gtcacatcgcccaatggtcctccggcaacacggtacccctccacggctcccatcaggatc 1549

                                                                        
Query: 431  acctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgagg 490
            |||||||| ||||||||||| |  |||||||| ||||| || ||||| |||||||| | |
Sbjct: 1548 acctggcaggcccagatggccaaaatgctctgagcgtgcacaaggctagggttgcctaag 1489

                                                                        
Query: 491  tagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccg 550
            ||||| |  || |||||||||||||||||||  |||||||||||||| ||||||||||||
Sbjct: 1488 tagtccaaacctccctcgctgaagatctgggctccggccttgaaccacacggcctcgccg 1429

                                                                        
Query: 551  aacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatg 610
            ||||| || ||| |   ||| |||||||| |||   | ||| || || || |||||||||
Sbjct: 1428 aacttcacaccgctcttggccagcagctcaggggtcaggcaccccagagctccgagcatg 1369

                                                                        
Query: 611  gcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggca 670
            ||||| |||  |||||| ||||||| ||||| |||   ||| |||||||||||||| |  
Sbjct: 1368 gcccagcgggcgtggatgacctccaactccctgttgcgggcgaaggtctcggggtccgac 1309

                                         
Query: 671  gagagccccgcagtgtcccatccgtagtc 699
            ||||| || || |||||||| ||||||||
Sbjct: 1308 gagagtccggcggtgtcccagccgtagtc 1280
to top
>gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding protein (RCABP89) mRNA,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 1027

 Score =  246 bits (124), Expect = 8e-62
 Identities = 274/324 (84%)
 Strand = Plus / Minus

                                                                       
Query: 376 ctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacctg 435
           ||||||||||||||||||| |||| |||||||||||||||   ||||||||||| |||||
Sbjct: 583 ctcgccgagcgggccgccgccgacgcggtagccctcgacgaatcccatgagcaccacctg 524

                                                                       
Query: 436 gcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtc 495
           |   ||||||||||||||||||||||| ||||| || ||| ||||||| || ||||||||
Sbjct: 523 gaccgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttccccaggtagtc 464

                                                                       
Query: 496 gaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaactt 555
           ||| || ||||||  ||||||||| | ||||||||||||||| || ||||| ||||||||
Sbjct: 463 gagccccccctcggagaagatctgcgcgccggccttgaaccacaccgcctccccgaactt 404

                                                                       
Query: 556 gacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggccca 615
            || |||||   ||  || | ||| |||||||||||||| ||||| || ||||| |||||
Sbjct: 403 caccccgttcttggacaggatctccgggaagacgcagcccagcgcccccagcatcgccca 344

                                                                       
Query: 616 ccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagag 675
           |||  ||||||||||||||||||||| |||| | || || ||||| |||||||| || ||
Sbjct: 343 ccgcgagtggatcacctccagctccctgttcctcgcgaacgtctccgggtcggccgatag 284

                                   
Query: 676 ccccgcagtgtcccatccgtagtc 699
           |||||| |||||||| ||||||||
Sbjct: 283 ccccgccgtgtcccacccgtagtc 260



 Score =  226 bits (114), Expect = 8e-56
 Identities = 192/218 (88%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||||||||| || |||||||||||| | ||||| |||||||||  |||||||||||| |
Sbjct: 830 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcga 771

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
            |||||||  ||||||||| |  ||||||||||| ||||| |||||||| ||||| ||||
Sbjct: 770 cgtggtcgaagaggttctcgatggggcccttgccggtgacgatggcctggacgaagaagc 711

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           ||||||||||||||||||| ||||| |||||||||| |||||||||||||||||||||||
Sbjct: 710 cgaacatggagaacatggcgaggcggccgttcttgagctccttcaccttgagctcggcga 651

                                                 
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaag 346
           | |  || |||||||||||||||||||| |||||||||
Sbjct: 650 aggtgtcagggtcgtcggcgaggccgagcgggtcgaag 613
to top
>gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab-E) gene, complete cds
          Length = 1815

 Score =  240 bits (121), Expect = 5e-60
 Identities = 466/581 (80%)
 Strand = Plus / Minus

                                                                        
Query: 129  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
            |||| ||||| |||||||| |||||  | | ||| ||||||||||| || ||||| ||||
Sbjct: 1777 actttccgggaacaaagttagtggcataagaccaggcgttgttgttaaccgggtcagcaa 1718

                                                                        
Query: 189  ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
            ||||||| || |||||||||||||| ||||| || ||||| |  ||||| || || || |
Sbjct: 1717 ggtggtcagcaaggttctccaatggaccctttccggtgacgagagcctgaacaaagaatc 1658

                                                                        
Query: 249  cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
            | |||||||||||||| ||||| |  || |||||||| ||||| ||||||||||| ||||
Sbjct: 1657 caaacatggagaacatagcaagtctaccattcttgatttcctttaccttgagctcagcga 1598

                                                                        
Query: 309  acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
            | ||||| || || || || ||||| |  ||||||||||| ||||||||||| || ||||
Sbjct: 1597 aagcctctggatcttcagcaaggcccaatgggtcgaagctgccaccggggtaaagtgggt 1538

                                                                        
Query: 369  cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
            | || | ||| ||||| ||  | || || |||||||| || ||||| || ||||| | ||
Sbjct: 1537 caacaacctcaccgagaggttcaccagcaacacggtaaccttcgacagctcccatcaaca 1478

                                                                        
Query: 429  cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
            | || ||||||||||| ||||| | |||||| ||||||||||| |  || |||||||| |
Sbjct: 1477 caacttggcaagcccaaatggccaagatgctttgtgcgtggaccaaacttgggttgccca 1418

                                                                        
Query: 489  ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
             |||||| || || |||||||| || || ||||| || ||||||||||| || || || |
Sbjct: 1417 agtagtcaagtccaccctcgctaaaaatttgggatccagccttgaaccatacagcttcac 1358

                                                                        
Query: 549  cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
            |||||||||| || || || || |  || ||||||||||| || || || || || ||||
Sbjct: 1357 cgaacttgacaccattacgtgccaagagttcggggaagacacaaccaagagctccaagca 1298

                                                                        
Query: 609  tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
            ||||||| | ||||||||||||||||| ||| ||||||||||| || || || || || |
Sbjct: 1297 tggcccatctgcagtggatcacctccaactcacggttcttggcgaatgtttctggatcag 1238

                                                     
Query: 669  cagagagccccgcagtgtcccatccgtagtcaccgggaaac 709
            | || || || ||||||||||| ||||| ||||| ||||||
Sbjct: 1237 ctgaaagtccggcagtgtcccacccgtaatcaccaggaaac 1197
to top
>gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m10 (Lhcbm10) mRNA, complete cds
          Length = 1077

 Score =  238 bits (120), Expect = 2e-59
 Identities = 456/564 (80%), Gaps = 8/564 (1%)
 Strand = Plus / Minus

                                                                       
Query: 146 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgaggttc 205
           ||||||||||||||  ||||||||||   |  ||||| ||  ||||||||| | ||||||
Sbjct: 773 ttggtggcgaaggcgaacgcgttgttcacggtggggttggacaggtggtcgtccaggttc 714

                                                                       
Query: 206 tccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatg 265
           |  |  ||||||||||| || || |||||||| ||||| |||||||||||||||||||||
Sbjct: 713 tggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatggagaacatg 654

                                                                       
Query: 266 gcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcg 325
           || ||||| ||||||||||||||||||||||| ||||| ||||| |  ||||||||||| 
Sbjct: 653 gccaggcggccgttcttgatctccttcaccttcagctcagcgaaggtgtcggggtcgtca 594

                                                                       
Query: 326 gcgaggccgagggggtcgaagctac-caccggggtagagggggtcgacgatctcgccgag 384
           || ||||| ||||||||||| | || | |||||||| |||||||| | |  |||||||  
Sbjct: 593 gccaggcccagggggtcgaa-cgactcgccggggtacagggggtccaggccctcgccggc 535

                                                                       
Query: 385 cgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacctggcaagccca 444
            |||||||||  ||||||||||||||| ||   |||||| || |  |||||    |||  
Sbjct: 534 ggggccgccgttgacacggtagccctccaccaggcccatcaggataacctgaacggccag 475

                                                                       
Query: 445 gatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgcc 504
           | |||||| |||| |||| ||||| || |||  ||||||||| |||||||| ||||||||
Sbjct: 474 ggtggcgacgatgttctgggcgtgcaccagggaggggttgcccaggtagtccaggccgcc 415

                                                                       
Query: 505 ctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacgccgtt 564
           |||   ||||||||||| |||||||||||||||||| ||||||||||||| |  |||| |
Sbjct: 414 ctcagagaagatctgggcgccggccttgaaccagacagcctcgccgaactgggtgccgct 355

                                                                       
Query: 565 gcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccggcagtg 624
              ||| ||||||||||||  || |||||| || ||||| ||||||||||| |||  |||
Sbjct: 354 cttggccagcagctcgggggtgatgcagcccagagcgcccagcatggcccagcgggcgtg 295

                                                                       
Query: 625 gatcacctccagctcccggtt---cttggcaaaggtctcggggtcggcagagagccccgc 681
           ||||| ||||||||| ||||    ||||   |||||||| ||||| || || || || ||
Sbjct: 294 gatcagctccagctcgcggtagcgcttg---aaggtctccgggtcagcggacagaccggc 238

                                   
Query: 682 agtgtcccatccgtagtcaccggg 705
            |||||||| ||||||||||||||
Sbjct: 237 ggtgtcccagccgtagtcaccggg 214
to top
>emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding protein cab 13
          Length = 1019

 Score =  236 bits (119), Expect = 8e-59
 Identities = 452/563 (80%)
 Strand = Plus / Minus

                                                                       
Query: 140 acaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcg 199
           ||||| || ||||| ||||||||||| |||||||| |||||||| |||||||| || |||
Sbjct: 909 acaaaatttgtggcaaaggcccacgcattgttgttaacggggtcagcaaggtgatcagcg 850

                                                                       
Query: 200 aggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggag 259
           |||||||||||||| || || || |||||||| || || || || || || |||||||||
Sbjct: 849 aggttctccaatggaccttttccggtgacaatagcttgtacaaagaatccaaacatggag 790

                                                                       
Query: 260 aacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcgggg 319
           ||||| ||||| |  || ||||||||||||||||||| ||||||||| || || || |||
Sbjct: 789 aacatagcaagtctaccattcttgatctccttcacctcgagctcggcaaaagcttctggg 730

                                                                       
Query: 320 tcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcgacgatctcg 379
           || || || ||||| |  ||||||||||||||||| ||||| || || ||||  | ||| 
Sbjct: 729 tcatcagcaaggcctaatgggtcgaagctaccaccagggtatagtggatcgataacctca 670

                                                                       
Query: 380 ccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacctggcaa 439
           ||||| || || || || |||||||| ||||| || || ||||| | ||| || ||||||
Sbjct: 669 ccgagaggaccaccagcaacacggtaaccctcaacagctcccatcaacacaacttggcaa 610

                                                                       
Query: 440 gcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgagg 499
           ||||||||||| | |||||| |||||||| || |  || |||||||| | |||||| || 
Sbjct: 609 gcccagatggccaagatgctttgtgcgtgaaccaaacttgggttgcccaagtagtcaagt 550

                                                                       
Query: 500 ccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacg 559
           || |||||  |||| || || || || ||||||||||| || || || || |||||||| 
Sbjct: 549 ccaccctctttgaatatttgagatccagccttgaaccatacagcttcaccaaacttgaca 490

                                                                       
Query: 560 ccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccgg 619
           || || ||||| |  ||||| ||||||||||| || || || || ||||||| ||| |  
Sbjct: 489 ccattacgggcaaagagctcagggaagacgcaaccaagagctccaagcatggtccatcta 430

                                                                       
Query: 620 cagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagcccc 679
           |||||||| |||||||| | |||||||||||| || ||  | |||||||| || || || 
Sbjct: 429 cagtggattacctccagtttccggttcttggcgaaagttgctgggtcggctgaaagtcca 370

                                  
Query: 680 gcagtgtcccatccgtagtcacc 702
           ||||| |||||||| ||||||||
Sbjct: 369 gcagtatcccatccatagtcacc 347
to top
>gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene Cab-3C, complete cds
          Length = 1135

 Score =  230 bits (116), Expect = 5e-57
 Identities = 461/576 (80%)
 Strand = Plus / Minus

                                                                       
Query: 134 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtgg 193
           ||||| |||||||| |||||||||||||| || ||||| ||||| ||||| || || |||
Sbjct: 999 ccggggacaaagtttgtggcgaaggcccaagcattgttattgactgggtcagcgagatgg 940

                                                                       
Query: 194 tcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaac 253
           || || |||||||||||||| ||||| || ||||| || || || || || |||||||||
Sbjct: 939 tcagcaaggttctccaatggaccctttccggtgacgatagcttgaacaaagaagccgaac 880

                                                                       
Query: 254 atggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcc 313
           ||||||||||| ||||| |  || ||||| ||||| |||||||||||||| ||||| |||
Sbjct: 879 atggagaacatagcaagtctaccattcttaatctctttcaccttgagctcagcgaaagcc 820

                                                                       
Query: 314 tcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcgacg 373
           || ||||| || ||  |||| || ||||| ||||||||||| |||||||| ||||| || 
Sbjct: 819 tctgggtcatcagcagggcccagtgggtcaaagctaccaccagggtagagtgggtcaaca 760

                                                                       
Query: 374 atctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacc 433
           | ||| || || || || || || | |||||| ||||| ||||| ||||| | ||| || 
Sbjct: 759 acctcaccaagaggcccaccagcaatacggtaaccctcaacggctcccatcaacacaact 700

                                                                       
Query: 434 tggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtag 493
           |||||||||||||| || |  ||||| ||||| ||||| | ||| ||||| || | ||||
Sbjct: 699 tggcaagcccagatagccaaaatgctttgtgcatggaccaagcttgggtttcccaagtag 640

                                                                       
Query: 494 tcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaac 553
           || || || ||||||||||| || || || || ||||||||||| || || || ||||||
Sbjct: 639 tcaagtccaccctcgctgaaaatttgtgatccagccttgaaccatacagcttcaccgaac 580

                                                                       
Query: 554 ttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcc 613
           || || || || ||||| |  ||||||||||| || || || || || || |||||||||
Sbjct: 579 ttaacaccattacgggccaaaagctcggggaatacacatccaagagcaccaagcatggcc 520

                                                                       
Query: 614 caccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagag 673
           || |  || || || ||||||| ||| |||||||| || || || || ||||| || || 
Sbjct: 519 catctacaatgaataacctccaactcacggttcttagcgaatgtttcagggtcagctgaa 460

                                               
Query: 674 agccccgcagtgtcccatccgtagtcaccgggaaac 709
           || || ||||||||||||||||| ||||| ||||||
Sbjct: 459 agtccagcagtgtcccatccgtaatcaccaggaaac 424
to top
>dbj|AB051208.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-1.3, complete cds
          Length = 1107

 Score =  230 bits (116), Expect = 5e-57
 Identities = 406/500 (81%), Gaps = 2/500 (0%)
 Strand = Plus / Minus

                                                                       
Query: 146 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgaggttc 205
           ||||||||||||||  ||||||||||   |  ||||| ||  ||||||||| | ||||||
Sbjct: 801 ttggtggcgaaggcgaacgcgttgttcacggtggggttggacaggtggtcgtccaggttc 742

                                                                       
Query: 206 tccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatg 265
           |  |  ||||||||||| || || |||||||| ||||| |||||||||||||||||||||
Sbjct: 741 tggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatggagaacatg 682

                                                                       
Query: 266 gcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcg 325
           || ||||| ||||||||||||||||||||||| ||||| ||||| |  ||||||||||| 
Sbjct: 681 gccaggcggccgttcttgatctccttcaccttcagctcagcgaaggtgtcggggtcgtca 622

                                                                       
Query: 326 gcgaggccgagggggtcgaagctac-caccggggtagagggggtcgacgatctcgccgag 384
           || ||||| ||||||||||| | || | |||||||| |||||||| | |  |||||||  
Sbjct: 621 gccaggcccagggggtcgaa-cgactcgccggggtacagggggtccaggccctcgccggc 563

                                                                       
Query: 385 cgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacctggcaagccca 444
            |||||||||  ||||||||||||||| ||   |||||| || |  |||||    |||  
Sbjct: 562 ggggccgccgttgacacggtagccctccaccaggcccatcaggataacctgaacggccag 503

                                                                       
Query: 445 gatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgcc 504
           | |||||| |||| |||| ||||| || |||  ||||||||| |||||||| ||||||||
Sbjct: 502 ggtggcgacgatgttctgggcgtgcaccagggaggggttgcccaggtagtccaggccgcc 443

                                                                       
Query: 505 ctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacgccgtt 564
           |||   ||||||||||| |||||||||||||||||| ||||||||||||| |  |||| |
Sbjct: 442 ctcagagaagatctgggcgccggccttgaaccagacagcctcgccgaactgggtgccgct 383

                                                                       
Query: 565 gcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccggcagtg 624
              ||| ||||||||||||  || |||||| || ||||| ||||| ||||| |||  |||
Sbjct: 382 cttggccagcagctcgggggtgatgcagcccagagcgcccagcatagcccagcgggcgtg 323

                               
Query: 625 gatcacctccagctcccggt 644
           ||||| ||||||||| ||||
Sbjct: 322 gatcagctccagctcgcggt 303
to top
>gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding protein mRNA, complete cds
          Length = 1100

 Score =  222 bits (112), Expect = 1e-54
 Identities = 271/324 (83%)
 Strand = Plus / Minus

                                                                       
Query: 376 ctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacctg 435
           ||||||||||||||||||| |||| |||||||||||||||   ||||||||||| |||||
Sbjct: 590 ctcgccgagcgggccgccgccgacgcggtagccctcgacgaatcccatgagcaccacctg 531

                                                                       
Query: 436 gcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtc 495
           |   ||||||||||||||||||||||| | | | || |||  |||||| || ||||||||
Sbjct: 530 gaccgcccagatggcgaggatgctctgggggcgcaccagggcggggttccccaggtagtc 471

                                                                       
Query: 496 gaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaactt 555
           ||| || ||||||  ||||||||| | ||||||||||||||| || ||||| ||||| ||
Sbjct: 470 gagccccccctcggagaagatctgcgcgccggccttgaaccacaccgcctccccgaaatt 411

                                                                       
Query: 556 gacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggccca 615
            || |||||   ||  || | ||||||||||| |||||| ||||| || ||||| |||||
Sbjct: 410 aaccccgttcttggacaggatctcggggaagaagcagcccagcgcccccagcattgccca 351

                                                                       
Query: 616 ccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagag 675
           |||| ||||||||||||||||||||| |||| | || || ||||| |||||||| || ||
Sbjct: 350 ccgggagtggatcacctccagctccctgttcctcgcgaacgtctccgggtcggccgatag 291

                                   
Query: 676 ccccgcagtgtcccatccgtagtc 699
           |||||| |||||||| ||||||||
Sbjct: 290 ccccgccgtgtcccacccgtagtc 267



 Score =  137 bits (69), Expect = 6e-29
 Identities = 153/181 (84%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||||||||| ||||| ||||||||| | ||||| |||||||||  |||||||||||| |
Sbjct: 837 acttgccggggacaaaattggtggcgtatgcccaggcgttgttggcgacggggtcggcga 778

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
            |||||||   | |||||| |  ||||||||||| ||||| |||||||| ||||| || |
Sbjct: 777 cgtggtcgaaaaagttctcgatggggcccttgccggtgacgatggcctggacgaagaaac 718

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||||||||||||||| ||||| ||||| |||| |||||||||||||| ||| ||||
Sbjct: 717 ccaacatggagaacatggcgaggcggccgttattgaactccttcaccttgaactccgcga 658

            
Query: 309 a 309
           |
Sbjct: 657 a 657
to top
>dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3102

 Score =  222 bits (112), Expect = 1e-54
 Identities = 451/564 (79%)
 Strand = Plus / Minus

                                                                        
Query: 127  ttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 186
            |||||| ||||| |||||||| |||||  ||||||| ||||||||||| |||||||| ||
Sbjct: 2708 ttactttccggggacaaagtttgtggcataggcccaggcgttgttgttaacggggtcagc 2649

                                                                        
Query: 187  aaggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaa 246
            |||||| ||  | |||||||| ||||| || || ||||||||||| || || ||||| ||
Sbjct: 2648 aaggtgatcaacaaggttctctaatggaccttttccagtgacaatagcttgaacgaagaa 2589

                                                                        
Query: 247  gccgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggc 306
             ||||||||||||||||| ||||| |  ||||| || |||||||| ||||||||||| ||
Sbjct: 2588 tccgaacatggagaacatagcaagcctaccgtttttaatctcctttaccttgagctcagc 2529

                                                                        
Query: 307  gaacgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggg 366
             || ||||| ||||| || || || || |  ||||| |||||||||||||||||||| ||
Sbjct: 2528 aaaagcctctgggtcatcagcaagacctaatgggtcaaagctaccaccggggtagagtgg 2469

                                                                        
Query: 367  gtcgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgag 426
            ||||   | ||| || || || || || || |||||||| ||||| |  || ||||| | 
Sbjct: 2468 gtcggtaacctcaccaagaggtccaccagcaacacggtaaccctcaatagctcccatcaa 2409

                                                                        
Query: 427  cacgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgcc 486
            ||| || ||||||||||| ||||| | |||||| ||||| ||||| |  || ||||||||
Sbjct: 2408 cacaacttggcaagcccaaatggccaagatgctttgtgcatggaccaaacttgggttgcc 2349

                                                                        
Query: 487  gaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctc 546
             | |||||| || || ||||||||||| || || || || |||||||||||||| || ||
Sbjct: 2348 caagtagtcaagtccaccctcgctgaaaatttgagatccagccttgaaccagacagcttc 2289

                                                                        
Query: 547  gccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgag 606
             ||||||||||| || || || || |  || ||||||||||| || ||||| || || ||
Sbjct: 2288 accgaacttgacaccattacgagccaagagttcggggaagacacaaccgagagctccaag 2229

                                                                        
Query: 607  catggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtc 666
            ||| ||||| |  ||||| |||||||| ||||| |||||||| ||||| || || || ||
Sbjct: 2228 catagcccatctacagtgaatcacctctagctcacggttcttagcaaaagtttctggatc 2169

                                    
Query: 667  ggcagagagccccgcagtgtccca 690
             || || || || |||||||||||
Sbjct: 2168 agctgaaagtccagcagtgtccca 2145
to top
>gb|M21397.1|TOBCABA Tobacco chlorophyll a/b-binding protein (Cab-C) gene, complete cds
          Length = 1240

 Score =  220 bits (111), Expect = 5e-54
 Identities = 450/563 (79%)
 Strand = Plus / Minus

                                                                        
Query: 140  acaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcg 199
            |||||||| |||||| ||||||| |||||||| || || ||||| ||||| || ||||| 
Sbjct: 1227 acaaagtttgtggcgtaggcccatgcgttgttattaactgggtctgcaagatgatcggca 1168

                                                                        
Query: 200  aggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggag 259
            ||||| |||||||| ||||| || ||||| || ||||| ||||| || || |||||||||
Sbjct: 1167 aggttttccaatggaccctttccggtgacgatagcctgaacgaagaatccaaacatggag 1108

                                                                        
Query: 260  aacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcgggg 319
            ||||||||||| |  ||||||||||||||||| ||||||||||| || || || || |||
Sbjct: 1107 aacatggcaagtctgccgttcttgatctcctttaccttgagctcagcaaaagcttctggg 1048

                                                                        
Query: 320  tcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcgacgatctcg 379
            || || || || || |  ||||||||||||||||| ||||| || ||||| || | ||| 
Sbjct: 1047 tcttcagcaagacccaatgggtcgaagctaccaccagggtaaagtgggtcaacaacctca 988

                                                                        
Query: 380  ccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacctggcaa 439
            ||||| ||  | || || ||||| || ||||| ||||| ||||| | ||| || || |||
Sbjct: 987  ccgagaggttcaccagcaacacgataaccctcaacggctcccatcaacacaacttgacaa 928

                                                                        
Query: 440  gcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgagg 499
            ||||| ||||| |  ||||| || || ||||| |  || |||||||| | |||||| || 
Sbjct: 927  gcccaaatggccaatatgctttgagcatggaccaaacttgggttgcccaagtagtcaagt 868

                                                                        
Query: 500  ccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacg 559
            || |||| |||||| || ||||| ||  |||||||||| || ||||| |||||||| || 
Sbjct: 867  ccaccctggctgaaaatttgggatccacccttgaaccatacagcctcaccgaacttaaca 808

                                                                        
Query: 560  ccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccgg 619
            || || ||||| |  |||||||| ||||| || || || || || ||||||||||| |  
Sbjct: 807  ccattacgggccaagagctcgggaaagacacaaccaagagctccaagcatggcccatcta 748

                                                                        
Query: 620  cagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagcccc 679
            |||||||||||||||| ||| |||||||||||||| || || || || || || || || 
Sbjct: 747  cagtggatcacctccaactcacggttcttggcaaaagtttcaggatcagctgaaagtcca 688

                                   
Query: 680  gcagtgtcccatccgtagtcacc 702
            ||||| |||||||| ||||||||
Sbjct: 687  gcagtatcccatccatagtcacc 665
to top
>ref|XM_478729.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 972

 Score =  216 bits (109), Expect = 8e-53
 Identities = 178/201 (88%)
 Strand = Plus / Minus

                                                                       
Query: 146 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgaggttc 205
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 816 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 757

                                                                       
Query: 206 tccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatg 265
           ||||| ||||||||||| ||||| |||||||| ||||| |||||||||||||||||||||
Sbjct: 756 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 697

                                                                       
Query: 266 gcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcg 325
           || ||||| || |||||||||||||| ||||||||||||||||| |   |||||||||||
Sbjct: 696 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 637

                                
Query: 326 gcgaggccgagggggtcgaag 346
           ||||||||||| |||||||||
Sbjct: 636 gcgaggccgagcgggtcgaag 616



 Score =  141 bits (71), Expect = 4e-30
 Identities = 127/143 (88%), Gaps = 2/143 (1%)
 Strand = Plus / Minus

                                                                       
Query: 401 cggtagccctcgacggcgcccatgagcacgacctggcaagcccag-atggcgaggatgct 459
           |||||||||||||||  ||||||||| ||||||||| || ||||| | ||||||||||||
Sbjct: 558 cggtagccctcgacgaggcccatgaggacgacctgg-aatcccagcacggcgaggatgct 500

                                                                       
Query: 460 ctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaagatctg 519
           ||| ||||| || ||| |||||||||||||||||||||||||||| |||  |||||||||
Sbjct: 499 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 440

                                  
Query: 520 ggagccggccttgaaccagacgg 542
           || ||||||||||||||| ||||
Sbjct: 439 ggcgccggccttgaaccacacgg 417



 Score =  101 bits (51), Expect = 3e-18
 Identities = 96/111 (86%)
 Strand = Plus / Minus

                                                                       
Query: 589 gcagccgagcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttctt 648
           |||||| |||||||||||||| |||||||||| |||||||||||||||| ||| |||| |
Sbjct: 367 gcagcccagcgcgccgagcatcgcccaccggccgtggatcacctccagcgccctgttcct 308

                                                              
Query: 649 ggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccgtagtc 699
            || || | ||| ||||| || ||||||||||| |||||||| ||||||||
Sbjct: 307 cgcgaacgcctccgggtccgcggagagccccgccgtgtcccacccgtagtc 257
to top
>ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 995

 Score =  216 bits (109), Expect = 8e-53
 Identities = 178/201 (88%)
 Strand = Plus / Minus

                                                                       
Query: 146 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgaggttc 205
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 781

                                                                       
Query: 206 tccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatg 265
           ||||| ||||||||||| ||||| |||||||| ||||| |||||||||||||||||||||
Sbjct: 780 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 721

                                                                       
Query: 266 gcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcg 325
           || ||||| || |||||||||||||| ||||||||||||||||| |   |||||||||||
Sbjct: 720 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 661

                                
Query: 326 gcgaggccgagggggtcgaag 346
           ||||||||||| |||||||||
Sbjct: 660 gcgaggccgagcgggtcgaag 640



 Score =  141 bits (71), Expect = 4e-30
 Identities = 127/143 (88%), Gaps = 2/143 (1%)
 Strand = Plus / Minus

                                                                       
Query: 401 cggtagccctcgacggcgcccatgagcacgacctggcaagcccag-atggcgaggatgct 459
           |||||||||||||||  ||||||||| ||||||||| || ||||| | ||||||||||||
Sbjct: 582 cggtagccctcgacgaggcccatgaggacgacctgg-aatcccagcacggcgaggatgct 524

                                                                       
Query: 460 ctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaagatctg 519
           ||| ||||| || ||| |||||||||||||||||||||||||||| |||  |||||||||
Sbjct: 523 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 464

                                  
Query: 520 ggagccggccttgaaccagacgg 542
           || ||||||||||||||| ||||
Sbjct: 463 ggcgccggccttgaaccacacgg 441



 Score =  101 bits (51), Expect = 3e-18
 Identities = 96/111 (86%)
 Strand = Plus / Minus

                                                                       
Query: 589 gcagccgagcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttctt 648
           |||||| |||||||||||||| |||||||||| |||||||||||||||| ||| |||| |
Sbjct: 391 gcagcccagcgcgccgagcatcgcccaccggccgtggatcacctccagcgccctgttcct 332

                                                              
Query: 649 ggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccgtagtc 699
            || || | ||| ||||| || ||||||||||| |||||||| ||||||||
Sbjct: 331 cgcgaacgcctccgggtccgcggagagccccgccgtgtcccacccgtagtc 281
to top
>ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1007

 Score =  216 bits (109), Expect = 8e-53
 Identities = 178/201 (88%)
 Strand = Plus / Minus

                                                                       
Query: 146 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgaggttc 205
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 781

                                                                       
Query: 206 tccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatg 265
           ||||| ||||||||||| ||||| |||||||| ||||| |||||||||||||||||||||
Sbjct: 780 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 721

                                                                       
Query: 266 gcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcg 325
           || ||||| || |||||||||||||| ||||||||||||||||| |   |||||||||||
Sbjct: 720 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 661

                                
Query: 326 gcgaggccgagggggtcgaag 346
           ||||||||||| |||||||||
Sbjct: 660 gcgaggccgagcgggtcgaag 640



 Score =  141 bits (71), Expect = 4e-30
 Identities = 127/143 (88%), Gaps = 2/143 (1%)
 Strand = Plus / Minus

                                                                       
Query: 401 cggtagccctcgacggcgcccatgagcacgacctggcaagcccag-atggcgaggatgct 459
           |||||||||||||||  ||||||||| ||||||||| || ||||| | ||||||||||||
Sbjct: 582 cggtagccctcgacgaggcccatgaggacgacctgg-aatcccagcacggcgaggatgct 524

                                                                       
Query: 460 ctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaagatctg 519
           ||| ||||| || ||| |||||||||||||||||||||||||||| |||  |||||||||
Sbjct: 523 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 464

                                  
Query: 520 ggagccggccttgaaccagacgg 542
           || ||||||||||||||| ||||
Sbjct: 463 ggcgccggccttgaaccacacgg 441



 Score =  101 bits (51), Expect = 3e-18
 Identities = 96/111 (86%)
 Strand = Plus / Minus

                                                                       
Query: 589 gcagccgagcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttctt 648
           |||||| |||||||||||||| |||||||||| |||||||||||||||| ||| |||| |
Sbjct: 391 gcagcccagcgcgccgagcatcgcccaccggccgtggatcacctccagcgccctgttcct 332

                                                              
Query: 649 ggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccgtagtc 699
            || || | ||| ||||| || ||||||||||| |||||||| ||||||||
Sbjct: 331 cgcgaacgcctccgggtccgcggagagccccgccgtgtcccacccgtagtc 281
to top
>ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1108

 Score =  216 bits (109), Expect = 8e-53
 Identities = 178/201 (88%)
 Strand = Plus / Minus

                                                                       
Query: 146 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgaggttc 205
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 842 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 783

                                                                       
Query: 206 tccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatg 265
           ||||| ||||||||||| ||||| |||||||| ||||| |||||||||||||||||||||
Sbjct: 782 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 723

                                                                       
Query: 266 gcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcg 325
           || ||||| || |||||||||||||| ||||||||||||||||| |   |||||||||||
Sbjct: 722 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 663

                                
Query: 326 gcgaggccgagggggtcgaag 346
           ||||||||||| |||||||||
Sbjct: 662 gcgaggccgagcgggtcgaag 642



 Score =  141 bits (71), Expect = 4e-30
 Identities = 127/143 (88%), Gaps = 2/143 (1%)
 Strand = Plus / Minus

                                                                       
Query: 401 cggtagccctcgacggcgcccatgagcacgacctggcaagcccag-atggcgaggatgct 459
           |||||||||||||||  ||||||||| ||||||||| || ||||| | ||||||||||||
Sbjct: 584 cggtagccctcgacgaggcccatgaggacgacctgg-aatcccagcacggcgaggatgct 526

                                                                       
Query: 460 ctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaagatctg 519
           ||| ||||| || ||| |||||||||||||||||||||||||||| |||  |||||||||
Sbjct: 525 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 466

                                  
Query: 520 ggagccggccttgaaccagacgg 542
           || ||||||||||||||| ||||
Sbjct: 465 ggcgccggccttgaaccacacgg 443



 Score =  101 bits (51), Expect = 3e-18
 Identities = 96/111 (86%)
 Strand = Plus / Minus

                                                                       
Query: 589 gcagccgagcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttctt 648
           |||||| |||||||||||||| |||||||||| |||||||||||||||| ||| |||| |
Sbjct: 393 gcagcccagcgcgccgagcatcgcccaccggccgtggatcacctccagcgccctgttcct 334

                                                              
Query: 649 ggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccgtagtc 699
            || || | ||| ||||| || ||||||||||| |||||||| ||||||||
Sbjct: 333 cgcgaacgcctccgggtccgcggagagccccgccgtgtcccacccgtagtc 283
to top
>ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1000

 Score =  216 bits (109), Expect = 8e-53
 Identities = 178/201 (88%)
 Strand = Plus / Minus

                                                                       
Query: 146 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgaggttc 205
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786

                                                                       
Query: 206 tccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatg 265
           ||||| ||||||||||| ||||| |||||||| ||||| |||||||||||||||||||||
Sbjct: 785 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 726

                                                                       
Query: 266 gcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcg 325
           || ||||| || |||||||||||||| ||||||||||||||||| |   |||||||||||
Sbjct: 725 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 666

                                
Query: 326 gcgaggccgagggggtcgaag 346
           ||||||||||| |||||||||
Sbjct: 665 gcgaggccgagcgggtcgaag 645



 Score =  141 bits (71), Expect = 4e-30
 Identities = 127/143 (88%), Gaps = 2/143 (1%)
 Strand = Plus / Minus

                                                                       
Query: 401 cggtagccctcgacggcgcccatgagcacgacctggcaagcccag-atggcgaggatgct 459
           |||||||||||||||  ||||||||| ||||||||| || ||||| | ||||||||||||
Sbjct: 587 cggtagccctcgacgaggcccatgaggacgacctgg-aatcccagcacggcgaggatgct 529

                                                                       
Query: 460 ctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaagatctg 519
           ||| ||||| || ||| |||||||||||||||||||||||||||| |||  |||||||||
Sbjct: 528 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 469

                                  
Query: 520 ggagccggccttgaaccagacgg 542
           || ||||||||||||||| ||||
Sbjct: 468 ggcgccggccttgaaccacacgg 446



 Score =  101 bits (51), Expect = 3e-18
 Identities = 96/111 (86%)
 Strand = Plus / Minus

                                                                       
Query: 589 gcagccgagcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttctt 648
           |||||| |||||||||||||| |||||||||| |||||||||||||||| ||| |||| |
Sbjct: 396 gcagcccagcgcgccgagcatcgcccaccggccgtggatcacctccagcgccctgttcct 337

                                                              
Query: 649 ggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccgtagtc 699
            || || | ||| ||||| || ||||||||||| |||||||| ||||||||
Sbjct: 336 cgcgaacgcctccgggtccgcggagagccccgccgtgtcccacccgtagtc 286
to top
>ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1012

 Score =  216 bits (109), Expect = 8e-53
 Identities = 178/201 (88%)
 Strand = Plus / Minus

                                                                       
Query: 146 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgaggttc 205
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786

                                                                       
Query: 206 tccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatg 265
           ||||| ||||||||||| ||||| |||||||| ||||| |||||||||||||||||||||
Sbjct: 785 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 726

                                                                       
Query: 266 gcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcg 325
           || ||||| || |||||||||||||| ||||||||||||||||| |   |||||||||||
Sbjct: 725 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 666

                                
Query: 326 gcgaggccgagggggtcgaag 346
           ||||||||||| |||||||||
Sbjct: 665 gcgaggccgagcgggtcgaag 645



 Score =  141 bits (71), Expect = 4e-30
 Identities = 127/143 (88%), Gaps = 2/143 (1%)
 Strand = Plus / Minus

                                                                       
Query: 401 cggtagccctcgacggcgcccatgagcacgacctggcaagcccag-atggcgaggatgct 459
           |||||||||||||||  ||||||||| ||||||||| || ||||| | ||||||||||||
Sbjct: 587 cggtagccctcgacgaggcccatgaggacgacctgg-aatcccagcacggcgaggatgct 529

                                                                       
Query: 460 ctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaagatctg 519
           ||| ||||| || ||| |||||||||||||||||||||||||||| |||  |||||||||
Sbjct: 528 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 469

                                  
Query: 520 ggagccggccttgaaccagacgg 542
           || ||||||||||||||| ||||
Sbjct: 468 ggcgccggccttgaaccacacgg 446



 Score =  101 bits (51), Expect = 3e-18
 Identities = 96/111 (86%)
 Strand = Plus / Minus

                                                                       
Query: 589 gcagccgagcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttctt 648
           |||||| |||||||||||||| |||||||||| |||||||||||||||| ||| |||| |
Sbjct: 396 gcagcccagcgcgccgagcatcgcccaccggccgtggatcacctccagcgccctgttcct 337

                                                              
Query: 649 ggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccgtagtc 699
            || || | ||| ||||| || ||||||||||| |||||||| ||||||||
Sbjct: 336 cgcgaacgcctccgggtccgcggagagccccgccgtgtcccacccgtagtc 286
to top
>ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1032

 Score =  216 bits (109), Expect = 8e-53
 Identities = 178/201 (88%)
 Strand = Plus / Minus

                                                                       
Query: 146 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgaggttc 205
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 847 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 788

                                                                       
Query: 206 tccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatg 265
           ||||| ||||||||||| ||||| |||||||| ||||| |||||||||||||||||||||
Sbjct: 787 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 728

                                                                       
Query: 266 gcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcg 325
           || ||||| || |||||||||||||| ||||||||||||||||| |   |||||||||||
Sbjct: 727 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 668

                                
Query: 326 gcgaggccgagggggtcgaag 346
           ||||||||||| |||||||||
Sbjct: 667 gcgaggccgagcgggtcgaag 647



 Score =  141 bits (71), Expect = 4e-30
 Identities = 127/143 (88%), Gaps = 2/143 (1%)
 Strand = Plus / Minus

                                                                       
Query: 401 cggtagccctcgacggcgcccatgagcacgacctggcaagcccag-atggcgaggatgct 459
           |||||||||||||||  ||||||||| ||||||||| || ||||| | ||||||||||||
Sbjct: 589 cggtagccctcgacgaggcccatgaggacgacctgg-aatcccagcacggcgaggatgct 531

                                                                       
Query: 460 ctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaagatctg 519
           ||| ||||| || ||| |||||||||||||||||||||||||||| |||  |||||||||
Sbjct: 530 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 471

                                  
Query: 520 ggagccggccttgaaccagacgg 542
           || ||||||||||||||| ||||
Sbjct: 470 ggcgccggccttgaaccacacgg 448



 Score =  101 bits (51), Expect = 3e-18
 Identities = 96/111 (86%)
 Strand = Plus / Minus

                                                                       
Query: 589 gcagccgagcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttctt 648
           |||||| |||||||||||||| |||||||||| |||||||||||||||| ||| |||| |
Sbjct: 398 gcagcccagcgcgccgagcatcgcccaccggccgtggatcacctccagcgccctgttcct 339

                                                              
Query: 649 ggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccgtagtc 699
            || || | ||| ||||| || ||||||||||| |||||||| ||||||||
Sbjct: 338 cgcgaacgcctccgggtccgcggagagccccgccgtgtcccacccgtagtc 288
to top
>ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1159

 Score =  216 bits (109), Expect = 8e-53
 Identities = 178/201 (88%)
 Strand = Plus / Minus

                                                                       
Query: 146 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgaggttc 205
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 880 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 821

                                                                       
Query: 206 tccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatg 265
           ||||| ||||||||||| ||||| |||||||| ||||| |||||||||||||||||||||
Sbjct: 820 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 761

                                                                       
Query: 266 gcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcg 325
           || ||||| || |||||||||||||| ||||||||||||||||| |   |||||||||||
Sbjct: 760 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 701

                                
Query: 326 gcgaggccgagggggtcgaag 346
           ||||||||||| |||||||||
Sbjct: 700 gcgaggccgagcgggtcgaag 680



 Score =  141 bits (71), Expect = 4e-30
 Identities = 127/143 (88%), Gaps = 2/143 (1%)
 Strand = Plus / Minus

                                                                       
Query: 401 cggtagccctcgacggcgcccatgagcacgacctggcaagcccag-atggcgaggatgct 459
           |||||||||||||||  ||||||||| ||||||||| || ||||| | ||||||||||||
Sbjct: 622 cggtagccctcgacgaggcccatgaggacgacctgg-aatcccagcacggcgaggatgct 564

                                                                       
Query: 460 ctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaagatctg 519
           ||| ||||| || ||| |||||||||||||||||||||||||||| |||  |||||||||
Sbjct: 563 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 504

                                  
Query: 520 ggagccggccttgaaccagacgg 542
           || ||||||||||||||| ||||
Sbjct: 503 ggcgccggccttgaaccacacgg 481



 Score =  101 bits (51), Expect = 3e-18
 Identities = 96/111 (86%)
 Strand = Plus / Minus

                                                                       
Query: 589 gcagccgagcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttctt 648
           |||||| |||||||||||||| |||||||||| |||||||||||||||| ||| |||| |
Sbjct: 431 gcagcccagcgcgccgagcatcgcccaccggccgtggatcacctccagcgccctgttcct 372

                                                              
Query: 649 ggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccgtagtc 699
            || || | ||| ||||| || ||||||||||| |||||||| ||||||||
Sbjct: 371 cgcgaacgcctccgggtccgcggagagccccgccgtgtcccacccgtagtc 321
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  216 bits (109), Expect = 8e-53
 Identities = 178/201 (88%)
 Strand = Plus / Minus

                                                                            
Query: 146      ttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgaggttc 205
                ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 22434853 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 22434794

                                                                            
Query: 206      tccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatg 265
                ||||| ||||||||||| ||||| |||||||| ||||| |||||||||||||||||||||
Sbjct: 22434793 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 22434734

                                                                            
Query: 266      gcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcg 325
                || ||||| || |||||||||||||| ||||||||||||||||| |   |||||||||||
Sbjct: 22434733 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 22434674

                                     
Query: 326      gcgaggccgagggggtcgaag 346
                ||||||||||| |||||||||
Sbjct: 22434673 gcgaggccgagcgggtcgaag 22434653



 Score =  141 bits (71), Expect = 4e-30
 Identities = 127/143 (88%), Gaps = 2/143 (1%)
 Strand = Plus / Minus

                                                                            
Query: 401      cggtagccctcgacggcgcccatgagcacgacctggcaagcccag-atggcgaggatgct 459
                |||||||||||||||  ||||||||| ||||||||| || ||||| | ||||||||||||
Sbjct: 22434595 cggtagccctcgacgaggcccatgaggacgacctgg-aatcccagcacggcgaggatgct 22434537

                                                                            
Query: 460      ctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaagatctg 519
                ||| ||||| || ||| |||||||||||||||||||||||||||| |||  |||||||||
Sbjct: 22434536 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 22434477

                                       
Query: 520      ggagccggccttgaaccagacgg 542
                || ||||||||||||||| ||||
Sbjct: 22434476 ggcgccggccttgaaccacacgg 22434454



 Score =  101 bits (51), Expect = 3e-18
 Identities = 96/111 (86%)
 Strand = Plus / Minus

                                                                            
Query: 589      gcagccgagcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttctt 648
                |||||| |||||||||||||| |||||||||| |||||||||||||||| ||| |||| |
Sbjct: 22434404 gcagcccagcgcgccgagcatcgcccaccggccgtggatcacctccagcgccctgttcct 22434345

                                                                   
Query: 649      ggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccgtagtc 699
                 || || | ||| ||||| || ||||||||||| |||||||| ||||||||
Sbjct: 22434344 cgcgaacgcctccgggtccgcggagagccccgccgtgtcccacccgtagtc 22434294
to top
>dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0406F06
          Length = 144533

 Score =  216 bits (109), Expect = 8e-53
 Identities = 178/201 (88%)
 Strand = Plus / Minus

                                                                         
Query: 146   ttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgaggttc 205
             ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 95920 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 95861

                                                                         
Query: 206   tccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatg 265
             ||||| ||||||||||| ||||| |||||||| ||||| |||||||||||||||||||||
Sbjct: 95860 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 95801

                                                                         
Query: 266   gcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcg 325
             || ||||| || |||||||||||||| ||||||||||||||||| |   |||||||||||
Sbjct: 95800 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 95741

                                  
Query: 326   gcgaggccgagggggtcgaag 346
             ||||||||||| |||||||||
Sbjct: 95740 gcgaggccgagcgggtcgaag 95720



 Score =  141 bits (71), Expect = 4e-30
 Identities = 127/143 (88%), Gaps = 2/143 (1%)
 Strand = Plus / Minus

                                                                         
Query: 401   cggtagccctcgacggcgcccatgagcacgacctggcaagcccag-atggcgaggatgct 459
             |||||||||||||||  ||||||||| ||||||||| || ||||| | ||||||||||||
Sbjct: 95662 cggtagccctcgacgaggcccatgaggacgacctgg-aatcccagcacggcgaggatgct 95604

                                                                         
Query: 460   ctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaagatctg 519
             ||| ||||| || ||| |||||||||||||||||||||||||||| |||  |||||||||
Sbjct: 95603 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 95544

                                    
Query: 520   ggagccggccttgaaccagacgg 542
             || ||||||||||||||| ||||
Sbjct: 95543 ggcgccggccttgaaccacacgg 95521



 Score =  101 bits (51), Expect = 3e-18
 Identities = 96/111 (86%)
 Strand = Plus / Minus

                                                                         
Query: 589   gcagccgagcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttctt 648
             |||||| |||||||||||||| |||||||||| |||||||||||||||| ||| |||| |
Sbjct: 95471 gcagcccagcgcgccgagcatcgcccaccggccgtggatcacctccagcgccctgttcct 95412

                                                                
Query: 649   ggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccgtagtc 699
              || || | ||| ||||| || ||||||||||| |||||||| ||||||||
Sbjct: 95411 cgcgaacgcctccgggtccgcggagagccccgccgtgtcccacccgtagtc 95361
to top
>dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-206-G05, full
           insert sequence
          Length = 1012

 Score =  216 bits (109), Expect = 8e-53
 Identities = 178/201 (88%)
 Strand = Plus / Minus

                                                                       
Query: 146 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgaggttc 205
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786

                                                                       
Query: 206 tccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatg 265
           ||||| ||||||||||| ||||| |||||||| ||||| |||||||||||||||||||||
Sbjct: 785 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 726

                                                                       
Query: 266 gcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcg 325
           || ||||| || |||||||||||||| ||||||||||||||||| |   |||||||||||
Sbjct: 725 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 666

                                
Query: 326 gcgaggccgagggggtcgaag 346
           ||||||||||| |||||||||
Sbjct: 665 gcgaggccgagcgggtcgaag 645



 Score =  141 bits (71), Expect = 4e-30
 Identities = 127/143 (88%), Gaps = 2/143 (1%)
 Strand = Plus / Minus

                                                                       
Query: 401 cggtagccctcgacggcgcccatgagcacgacctggcaagcccag-atggcgaggatgct 459
           |||||||||||||||  ||||||||| ||||||||| || ||||| | ||||||||||||
Sbjct: 587 cggtagccctcgacgaggcccatgaggacgacctgg-aatcccagcacggcgaggatgct 529

                                                                       
Query: 460 ctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaagatctg 519
           ||| ||||| || ||| |||||||||||||||||||||||||||| |||  |||||||||
Sbjct: 528 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 469

                                  
Query: 520 ggagccggccttgaaccagacgg 542
           || ||||||||||||||| ||||
Sbjct: 468 ggcgccggccttgaaccacacgg 446



 Score =  101 bits (51), Expect = 3e-18
 Identities = 96/111 (86%)
 Strand = Plus / Minus

                                                                       
Query: 589 gcagccgagcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttctt 648
           |||||| |||||||||||||| |||||||||| |||||||||||||||| ||| |||| |
Sbjct: 396 gcagcccagcgcgccgagcatcgcccaccggccgtggatcacctccagcgccctgttcct 337

                                                              
Query: 649 ggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccgtagtc 699
            || || | ||| ||||| || ||||||||||| |||||||| ||||||||
Sbjct: 336 cgcgaacgcctccgggtccgcggagagccccgccgtgtcccacccgtagtc 286
to top
>dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-F03, full
           insert sequence
          Length = 1000

 Score =  216 bits (109), Expect = 8e-53
 Identities = 178/201 (88%)
 Strand = Plus / Minus

                                                                       
Query: 146 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgaggttc 205
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786

                                                                       
Query: 206 tccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatg 265
           ||||| ||||||||||| ||||| |||||||| ||||| |||||||||||||||||||||
Sbjct: 785 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 726

                                                                       
Query: 266 gcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcg 325
           || ||||| || |||||||||||||| ||||||||||||||||| |   |||||||||||
Sbjct: 725 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 666

                                
Query: 326 gcgaggccgagggggtcgaag 346
           ||||||||||| |||||||||
Sbjct: 665 gcgaggccgagcgggtcgaag 645



 Score =  141 bits (71), Expect = 4e-30
 Identities = 127/143 (88%), Gaps = 2/143 (1%)
 Strand = Plus / Minus

                                                                       
Query: 401 cggtagccctcgacggcgcccatgagcacgacctggcaagcccag-atggcgaggatgct 459
           |||||||||||||||  ||||||||| ||||||||| || ||||| | ||||||||||||
Sbjct: 587 cggtagccctcgacgaggcccatgaggacgacctgg-aatcccagcacggcgaggatgct 529

                                                                       
Query: 460 ctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaagatctg 519
           ||| ||||| || ||| |||||||||||||||||||||||||||| |||  |||||||||
Sbjct: 528 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 469

                                  
Query: 520 ggagccggccttgaaccagacgg 542
           || ||||||||||||||| ||||
Sbjct: 468 ggcgccggccttgaaccacacgg 446



 Score =  101 bits (51), Expect = 3e-18
 Identities = 96/111 (86%)
 Strand = Plus / Minus

                                                                       
Query: 589 gcagccgagcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttctt 648
           |||||| |||||||||||||| |||||||||| |||||||||||||||| ||| |||| |
Sbjct: 396 gcagcccagcgcgccgagcatcgcccaccggccgtggatcacctccagcgccctgttcct 337

                                                              
Query: 649 ggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccgtagtc 699
            || || | ||| ||||| || ||||||||||| |||||||| ||||||||
Sbjct: 336 cgcgaacgcctccgggtccgcggagagccccgccgtgtcccacccgtagtc 286
to top
>dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-C03, full
           insert sequence
          Length = 973

 Score =  216 bits (109), Expect = 8e-53
 Identities = 178/201 (88%)
 Strand = Plus / Minus

                                                                       
Query: 146 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgaggttc 205
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 816 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 757

                                                                       
Query: 206 tccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatg 265
           ||||| ||||||||||| ||||| |||||||| ||||| |||||||||||||||||||||
Sbjct: 756 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 697

                                                                       
Query: 266 gcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcg 325
           || ||||| || |||||||||||||| ||||||||||||||||| |   |||||||||||
Sbjct: 696 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 637

                                
Query: 326 gcgaggccgagggggtcgaag 346
           ||||||||||| |||||||||
Sbjct: 636 gcgaggccgagcgggtcgaag 616



 Score =  141 bits (71), Expect = 4e-30
 Identities = 127/143 (88%), Gaps = 2/143 (1%)
 Strand = Plus / Minus

                                                                       
Query: 401 cggtagccctcgacggcgcccatgagcacgacctggcaagcccag-atggcgaggatgct 459
           |||||||||||||||  ||||||||| ||||||||| || ||||| | ||||||||||||
Sbjct: 558 cggtagccctcgacgaggcccatgaggacgacctgg-aatcccagcacggcgaggatgct 500

                                                                       
Query: 460 ctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaagatctg 519
           ||| ||||| || ||| |||||||||||||||||||||||||||| |||  |||||||||
Sbjct: 499 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 440

                                  
Query: 520 ggagccggccttgaaccagacgg 542
           || ||||||||||||||| ||||
Sbjct: 439 ggcgccggccttgaaccacacgg 417



 Score =  101 bits (51), Expect = 3e-18
 Identities = 96/111 (86%)
 Strand = Plus / Minus

                                                                       
Query: 589 gcagccgagcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttctt 648
           |||||| |||||||||||||| |||||||||| |||||||||||||||| ||| |||| |
Sbjct: 367 gcagcccagcgcgccgagcatcgcccaccggccgtggatcacctccagcgccctgttcct 308

                                                              
Query: 649 ggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccgtagtc 699
            || || | ||| ||||| || ||||||||||| |||||||| ||||||||
Sbjct: 307 cgcgaacgcctccgggtccgcggagagccccgccgtgtcccacccgtagtc 257
to top
>dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C07, full
           insert sequence
          Length = 1012

 Score =  216 bits (109), Expect = 8e-53
 Identities = 178/201 (88%)
 Strand = Plus / Minus

                                                                       
Query: 146 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgaggttc 205
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786

                                                                       
Query: 206 tccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatg 265
           ||||| ||||||||||| ||||| |||||||| ||||| |||||||||||||||||||||
Sbjct: 785 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 726

                                                                       
Query: 266 gcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcg 325
           || ||||| || |||||||||||||| ||||||||||||||||| |   |||||||||||
Sbjct: 725 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 666

                                
Query: 326 gcgaggccgagggggtcgaag 346
           ||||||||||| |||||||||
Sbjct: 665 gcgaggccgagcgggtcgaag 645



 Score =  141 bits (71), Expect = 4e-30
 Identities = 127/143 (88%), Gaps = 2/143 (1%)
 Strand = Plus / Minus

                                                                       
Query: 401 cggtagccctcgacggcgcccatgagcacgacctggcaagcccag-atggcgaggatgct 459
           |||||||||||||||  ||||||||| ||||||||| || ||||| | ||||||||||||
Sbjct: 587 cggtagccctcgacgaggcccatgaggacgacctgg-aatcccagcacggcgaggatgct 529

                                                                       
Query: 460 ctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaagatctg 519
           ||| ||||| || ||| |||||||||||||||||||||||||||| |||  |||||||||
Sbjct: 528 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 469

                                  
Query: 520 ggagccggccttgaaccagacgg 542
           || ||||||||||||||| ||||
Sbjct: 468 ggcgccggccttgaaccacacgg 446



 Score =  101 bits (51), Expect = 3e-18
 Identities = 96/111 (86%)
 Strand = Plus / Minus

                                                                       
Query: 589 gcagccgagcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttctt 648
           |||||| |||||||||||||| |||||||||| |||||||||||||||| ||| |||| |
Sbjct: 396 gcagcccagcgcgccgagcatcgcccaccggccgtggatcacctccagcgccctgttcct 337

                                                              
Query: 649 ggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccgtagtc 699
            || || | ||| ||||| || ||||||||||| |||||||| ||||||||
Sbjct: 336 cgcgaacgcctccgggtccgcggagagccccgccgtgtcccacccgtagtc 286
to top
>dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-E11, full
           insert sequence
          Length = 995

 Score =  216 bits (109), Expect = 8e-53
 Identities = 178/201 (88%)
 Strand = Plus / Minus

                                                                       
Query: 146 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgaggttc 205
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 781

                                                                       
Query: 206 tccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatg 265
           ||||| ||||||||||| ||||| |||||||| ||||| |||||||||||||||||||||
Sbjct: 780 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 721

                                                                       
Query: 266 gcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcg 325
           || ||||| || |||||||||||||| ||||||||||||||||| |   |||||||||||
Sbjct: 720 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 661

                                
Query: 326 gcgaggccgagggggtcgaag 346
           ||||||||||| |||||||||
Sbjct: 660 gcgaggccgagcgggtcgaag 640



 Score =  141 bits (71), Expect = 4e-30
 Identities = 127/143 (88%), Gaps = 2/143 (1%)
 Strand = Plus / Minus

                                                                       
Query: 401 cggtagccctcgacggcgcccatgagcacgacctggcaagcccag-atggcgaggatgct 459
           |||||||||||||||  ||||||||| ||||||||| || ||||| | ||||||||||||
Sbjct: 582 cggtagccctcgacgaggcccatgaggacgacctgg-aatcccagcacggcgaggatgct 524

                                                                       
Query: 460 ctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaagatctg 519
           ||| ||||| || ||| |||||||||||||||||||||||||||| |||  |||||||||
Sbjct: 523 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 464

                                  
Query: 520 ggagccggccttgaaccagacgg 542
           || ||||||||||||||| ||||
Sbjct: 463 ggcgccggccttgaaccacacgg 441



 Score =  101 bits (51), Expect = 3e-18
 Identities = 96/111 (86%)
 Strand = Plus / Minus

                                                                       
Query: 589 gcagccgagcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttctt 648
           |||||| |||||||||||||| |||||||||| |||||||||||||||| ||| |||| |
Sbjct: 391 gcagcccagcgcgccgagcatcgcccaccggccgtggatcacctccagcgccctgttcct 332

                                                              
Query: 649 ggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccgtagtc 699
            || || | ||| ||||| || ||||||||||| |||||||| ||||||||
Sbjct: 331 cgcgaacgcctccgggtccgcggagagccccgccgtgtcccacccgtagtc 281
to top
>dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-D10, full
           insert sequence
          Length = 1007

 Score =  216 bits (109), Expect = 8e-53
 Identities = 178/201 (88%)
 Strand = Plus / Minus

                                                                       
Query: 146 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgaggttc 205
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 781

                                                                       
Query: 206 tccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatg 265
           ||||| ||||||||||| ||||| |||||||| ||||| |||||||||||||||||||||
Sbjct: 780 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 721

                                                                       
Query: 266 gcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcg 325
           || ||||| || |||||||||||||| ||||||||||||||||| |   |||||||||||
Sbjct: 720 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 661

                                
Query: 326 gcgaggccgagggggtcgaag 346
           ||||||||||| |||||||||
Sbjct: 660 gcgaggccgagcgggtcgaag 640



 Score =  141 bits (71), Expect = 4e-30
 Identities = 127/143 (88%), Gaps = 2/143 (1%)
 Strand = Plus / Minus

                                                                       
Query: 401 cggtagccctcgacggcgcccatgagcacgacctggcaagcccag-atggcgaggatgct 459
           |||||||||||||||  ||||||||| ||||||||| || ||||| | ||||||||||||
Sbjct: 582 cggtagccctcgacgaggcccatgaggacgacctgg-aatcccagcacggcgaggatgct 524

                                                                       
Query: 460 ctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaagatctg 519
           ||| ||||| || ||| |||||||||||||||||||||||||||| |||  |||||||||
Sbjct: 523 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 464

                                  
Query: 520 ggagccggccttgaaccagacgg 542
           || ||||||||||||||| ||||
Sbjct: 463 ggcgccggccttgaaccacacgg 441



 Score =  101 bits (51), Expect = 3e-18
 Identities = 96/111 (86%)
 Strand = Plus / Minus

                                                                       
Query: 589 gcagccgagcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttctt 648
           |||||| |||||||||||||| |||||||||| |||||||||||||||| ||| |||| |
Sbjct: 391 gcagcccagcgcgccgagcatcgcccaccggccgtggatcacctccagcgccctgttcct 332

                                                              
Query: 649 ggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccgtagtc 699
            || || | ||| ||||| || ||||||||||| |||||||| ||||||||
Sbjct: 331 cgcgaacgcctccgggtccgcggagagccccgccgtgtcccacccgtagtc 281
to top
>dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D02, full
           insert sequence
          Length = 1000

 Score =  216 bits (109), Expect = 8e-53
 Identities = 178/201 (88%)
 Strand = Plus / Minus

                                                                       
Query: 146 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgaggttc 205
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786

                                                                       
Query: 206 tccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatg 265
           ||||| ||||||||||| ||||| |||||||| ||||| |||||||||||||||||||||
Sbjct: 785 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 726

                                                                       
Query: 266 gcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcg 325
           || ||||| || |||||||||||||| ||||||||||||||||| |   |||||||||||
Sbjct: 725 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 666

                                
Query: 326 gcgaggccgagggggtcgaag 346
           ||||||||||| |||||||||
Sbjct: 665 gcgaggccgagcgggtcgaag 645



 Score =  141 bits (71), Expect = 4e-30
 Identities = 127/143 (88%), Gaps = 2/143 (1%)
 Strand = Plus / Minus

                                                                       
Query: 401 cggtagccctcgacggcgcccatgagcacgacctggcaagcccag-atggcgaggatgct 459
           |||||||||||||||  ||||||||| ||||||||| || ||||| | ||||||||||||
Sbjct: 587 cggtagccctcgacgaggcccatgaggacgacctgg-aatcccagcacggcgaggatgct 529

                                                                       
Query: 460 ctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaagatctg 519
           ||| ||||| || ||| |||||||||||||||||||||||||||| |||  |||||||||
Sbjct: 528 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 469

                                  
Query: 520 ggagccggccttgaaccagacgg 542
           || ||||||||||||||| ||||
Sbjct: 468 ggcgccggccttgaaccacacgg 446



 Score =  101 bits (51), Expect = 3e-18
 Identities = 96/111 (86%)
 Strand = Plus / Minus

                                                                       
Query: 589 gcagccgagcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttctt 648
           |||||| |||||||||||||| |||||||||| |||||||||||||||| ||| |||| |
Sbjct: 396 gcagcccagcgcgccgagcatcgcccaccggccgtggatcacctccagcgccctgttcct 337

                                                              
Query: 649 ggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccgtagtc 699
            || || | ||| ||||| || ||||||||||| |||||||| ||||||||
Sbjct: 336 cgcgaacgcctccgggtccgcggagagccccgccgtgtcccacccgtagtc 286
to top
>dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-G12, full
           insert sequence
          Length = 1032

 Score =  216 bits (109), Expect = 8e-53
 Identities = 178/201 (88%)
 Strand = Plus / Minus

                                                                       
Query: 146 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgaggttc 205
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 847 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 788

                                                                       
Query: 206 tccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatg 265
           ||||| ||||||||||| ||||| |||||||| ||||| |||||||||||||||||||||
Sbjct: 787 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 728

                                                                       
Query: 266 gcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcg 325
           || ||||| || |||||||||||||| ||||||||||||||||| |   |||||||||||
Sbjct: 727 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 668

                                
Query: 326 gcgaggccgagggggtcgaag 346
           ||||||||||| |||||||||
Sbjct: 667 gcgaggccgagcgggtcgaag 647



 Score =  141 bits (71), Expect = 4e-30
 Identities = 127/143 (88%), Gaps = 2/143 (1%)
 Strand = Plus / Minus

                                                                       
Query: 401 cggtagccctcgacggcgcccatgagcacgacctggcaagcccag-atggcgaggatgct 459
           |||||||||||||||  ||||||||| ||||||||| || ||||| | ||||||||||||
Sbjct: 589 cggtagccctcgacgaggcccatgaggacgacctgg-aatcccagcacggcgaggatgct 531

                                                                       
Query: 460 ctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaagatctg 519
           ||| ||||| || ||| |||||||||||||||||||||||||||| |||  |||||||||
Sbjct: 530 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 471

                                  
Query: 520 ggagccggccttgaaccagacgg 542
           || ||||||||||||||| ||||
Sbjct: 470 ggcgccggccttgaaccacacgg 448



 Score =  101 bits (51), Expect = 3e-18
 Identities = 96/111 (86%)
 Strand = Plus / Minus

                                                                       
Query: 589 gcagccgagcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttctt 648
           |||||| |||||||||||||| |||||||||| |||||||||||||||| ||| |||| |
Sbjct: 398 gcagcccagcgcgccgagcatcgcccaccggccgtggatcacctccagcgccctgttcct 339

                                                              
Query: 649 ggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccgtagtc 699
            || || | ||| ||||| || ||||||||||| |||||||| ||||||||
Sbjct: 338 cgcgaacgcctccgggtccgcggagagccccgccgtgtcccacccgtagtc 288
to top
>emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b binding protein
          Length = 1656

 Score =  214 bits (108), Expect = 3e-52
 Identities = 450/564 (79%)
 Strand = Plus / Minus

                                                                        
Query: 127  ttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 186
            |||||| ||||| |||||||| |||||  ||||||| ||||||||||| |||||||| ||
Sbjct: 1305 ttactttccggggacaaagtttgtggcataggcccaggcgttgttgttaacggggtcagc 1246

                                                                        
Query: 187  aaggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaa 246
            |||||| ||  | ||||| || ||||| || || ||||||||||| || || ||||| ||
Sbjct: 1245 aaggtgatcaacaaggttatctaatggaccttttccagtgacaatagcttgaacgaagaa 1186

                                                                        
Query: 247  gccgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggc 306
             ||||||||||||||||| ||||| |  ||||| || |||||||| ||||||||||| ||
Sbjct: 1185 tccgaacatggagaacatagcaagcctaccgtttttaatctcctttaccttgagctcagc 1126

                                                                        
Query: 307  gaacgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggg 366
             || ||||| ||||| || || || || |  ||||| |||||||||||||||||||| ||
Sbjct: 1125 aaaagcctctgggtcatcagcaagacctaatgggtcaaagctaccaccggggtagagtgg 1066

                                                                        
Query: 367  gtcgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgag 426
            ||||   | ||| || || || || || || |||||||| ||||| |  || ||||| | 
Sbjct: 1065 gtcggtaacctcaccaagaggtccaccagcaacacggtaaccctcaatagctcccatcaa 1006

                                                                        
Query: 427  cacgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgcc 486
            ||| || ||||||||||| ||||| | |||||| ||||| ||||| |  || ||||||||
Sbjct: 1005 cacaacttggcaagcccaaatggccaagatgctttgtgcatggaccaaacttgggttgcc 946

                                                                        
Query: 487  gaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctc 546
             | |||||| || || ||||||||||| || || || || |||||||||||||| || ||
Sbjct: 945  caagtagtcaagtccaccctcgctgaaaatttgagatccagccttgaaccagacagcttc 886

                                                                        
Query: 547  gccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgag 606
             ||||||||||| || || || || |  || ||||||||||| || ||||| || || ||
Sbjct: 885  accgaacttgacaccattacgagccaagagttcggggaagacacaaccgagagctccaag 826

                                                                        
Query: 607  catggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtc 666
            ||| ||||| |  ||||| |||||||| ||||| |||||||| ||||| || || || ||
Sbjct: 825  catagcccatctacagtgaatcacctctagctcacggttcttagcaaaagtttctggatc 766

                                    
Query: 667  ggcagagagccccgcagtgtccca 690
             || || || || |||||||||||
Sbjct: 765  agctgaaagtccagcagtgtccca 742
to top
>gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 986

 Score =  212 bits (107), Expect = 1e-51
 Identities = 233/275 (84%)
 Strand = Plus / Minus

                                                                       
Query: 431 acctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgagg 490
           ||||||||||||||||| || |||||||| || |||||||| ||| ||||||| || |||
Sbjct: 545 acctggcaagcccagatcgcaaggatgctttgggcgtggaccaggttggggttccccagg 486

                                                                       
Query: 491 tagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccg 550
           |||||||| || |||||   |||||||||||| |||||||||||||| || ||||| |||
Sbjct: 485 tagtcgagccctccctccgagaagatctgggacccggccttgaaccacaccgcctccccg 426

                                                                       
Query: 551 aacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatg 610
           |||| ||| |||||    |  || ||||| ||||||||||| ||||| ||||||||||||
Sbjct: 425 aactggaccccgttcttcgacaggagctccgggaagacgcaaccgagagcgccgagcatg 366

                                                                       
Query: 611 gcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggca 670
           |||||||   ||||||||||||||||||| |||||| |||| || ||||| ||||| || 
Sbjct: 365 gcccacctcgagtggatcacctccagctcacggttcctggcgaaagtctctgggtccgcc 306

                                              
Query: 671 gagagccccgcagtgtcccatccgtagtcaccggg 705
           || ||||| |||||||||||||||||||| |||||
Sbjct: 305 gacagcccagcagtgtcccatccgtagtcgccggg 271



 Score =  145 bits (73), Expect = 2e-31
 Identities = 163/193 (84%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||||||||| || ||||| |||||| | ||||| |||||||||   || || || ||||
Sbjct: 847 acttgccgggaacgaagttagtggcgtaagcccaagcgttgttggcaacaggatcagcaa 788

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
            ||||||| | |||||||| | |||||||||||| ||||| |||||||| ||||| || |
Sbjct: 787 tgtggtcgactaggttctcaactgggcccttgccggtgacgatggcctggacgaagaatc 728

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           |||||||||||||||| || || | ||| ||||||| ||||||||||||||||||||| |
Sbjct: 727 cgaacatggagaacatagctagccttccattcttgagctccttcaccttgagctcggcaa 668

                        
Query: 309 acgcctcggggtc 321
           | |||||||||||
Sbjct: 667 aggcctcggggtc 655
to top
>gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein (cab3) mRNA, nuclear
           gene encoding chloroplast protein, complete cds
          Length = 977

 Score =  212 bits (107), Expect = 1e-51
 Identities = 224/263 (85%)
 Strand = Plus / Minus

                                                                       
Query: 440 gcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgagg 499
           ||||||||||||||||||||||| |||||||| ||||| |||||||| | |||||| || 
Sbjct: 510 gcccagatggcgaggatgctctgggcgtggacaaggcttgggttgcccaagtagtccagc 451

                                                                       
Query: 500 ccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacg 559
           || |||||||||||||||||||| |||||||||||||| || || || || |||||||| 
Sbjct: 450 ccaccctcgctgaagatctgggacccggccttgaaccacacagcttctccaaacttgacc 391

                                                                       
Query: 560 ccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccgg 619
           ||||||||||  |  || ||||||||||||||||| |  || |||||||||||||||| |
Sbjct: 390 ccgttgcgggacaatagttcggggaagacgcagcccaaggccccgagcatggcccacctg 331

                                                                       
Query: 620 cagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagcccc 679
            |||||||||| || |||||  ||||  |||| ||||| || |||||||| || ||||| 
Sbjct: 330 gagtggatcacttcgagctcagggtttctggcgaaggtttctgggtcggccgaaagccca 271

                                  
Query: 680 gcagtgtcccatccgtagtcacc 702
           ||||||||||| |||||||||||
Sbjct: 270 gcagtgtcccagccgtagtcacc 248



 Score =  147 bits (74), Expect = 6e-32
 Identities = 194/234 (82%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||||||||| || |||||||||||| ||||||| || ||||||||||| ||||| ||||
Sbjct: 821 acttgccggggacgaagttggtggcgtaggcccaggcattgttgttgactgggtccgcaa 762

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           |||| || || |||||||||||||| ||||| || |||||||||||||| || || || |
Sbjct: 761 ggtgatcagcaaggttctccaatggacccttaccggtgacaatggcctgaacaaagaacc 702

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| ||||||||||| |  |  ||||||||||  ||||||||||| ||||| || |
Sbjct: 701 caaacatagagaacatggccaatctcccgttcttgagttccttcaccttaagctcagcaa 642

                                                                 
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtaga 362
           | ||||| ||||| || || ||||| |  ||||| ||||| ||||| |||||||
Sbjct: 641 aagcctctgggtcatcagcaaggcccaatgggtcaaagctgccaccagggtaga 588
to top
>gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosystem II chlorophyll
           A/B-binding protein gene, complete cds
          Length = 1260

 Score =  210 bits (106), Expect = 5e-51
 Identities = 457/574 (79%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| ||||||||||||||  ||||||| || ||||||||||| ||||| ||||
Sbjct: 990 actttccggggacaaagttggtggcataggcccaagcattgttgttgactgggtcagcaa 931

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           ||||||| || | |||||||||||| ||||| || || || |||||||| ||||| || |
Sbjct: 930 ggtggtcagccaagttctccaatggtccctttccggtcacgatggcctgaacgaagaacc 871

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           ||||||| |||||||| || |  |  |||||||||||||| |||||||||||||| ||||
Sbjct: 870 cgaacattgagaacatagccaacctaccgttcttgatctctttcaccttgagctcagcga 811

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           | ||||| ||||| || || | ||| |  ||||| ||||| ||||| ||||| |  ||||
Sbjct: 810 atgcctctgggtcatcagcaaagcccaatgggtcaaagctgccacctgggtacaatgggt 751

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           |    |  || ||||| || || ||||| | |||||||||||||||||| ||||| |  |
Sbjct: 750 cagtcacttcaccgagtggtccaccggcaatacggtagccctcgacggctcccatcaaga 691

                                                                       
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
             || ||||||||||||||||| |  ||||| || || ||||  | ||| ||||| || |
Sbjct: 690 taacttggcaagcccagatggccaaaatgctttgagcatggatcaagcttgggttaccca 631

                                                                       
Query: 489 ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
            |||||| || || ||||| |||||||| || || |||||||||||||| || || || |
Sbjct: 630 agtagtcaagtccaccctcactgaagatttgagacccggccttgaaccatacagcttcac 571

                                                                       
Query: 549 cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
           |||||||||| ||||| |  || | |||||| ||||| || || || || || || | ||
Sbjct: 570 cgaacttgacaccgttcctagccaacagctcagggaaaacacacccaagagctcccaaca 511

                                                                       
Query: 609 tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
           ||||||| | |||||| || || || ||||| |||||| | |||||||||||||| || |
Sbjct: 510 tggcccatctgcagtgaatgacttcgagctcacggttcctagcaaaggtctcgggatcag 451

                                             
Query: 669 cagagagccccgcagtgtcccatccgtagtcacc 702
           | ||||| || ||||||||||| || ||||||||
Sbjct: 450 ctgagagtccagcagtgtcccaaccatagtcacc 417
to top
>gb|AF495472.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m6 mRNA, complete cds; nuclear gene for chloroplast
           product
          Length = 1094

 Score =  208 bits (105), Expect = 2e-50
 Identities = 406/501 (81%), Gaps = 4/501 (0%)
 Strand = Plus / Minus

                                                                       
Query: 146 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgaggttc 205
           ||||||||||||||  | |||||||||  |  ||||| ||| ||||||||| | ||||||
Sbjct: 782 ttggtggcgaaggcgaaggcgttgttgacggtggggttggccaggtggtcgtccaggttc 723

                                                                       
Query: 206 tccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatg 265
           |  |  ||||||||||| || || |||||||| ||||| ||||||||||||||||||   
Sbjct: 722 tggacggggcccttgccggtcacgatggcctggacgaagaagccgaacatggagaacgat 663

                                                                       
Query: 266 gcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcg 325
           || ||||| ||||||||||||||||||||||| ||||| ||||| |  ||||||||||| 
Sbjct: 662 gccaggcggccgttcttgatctccttcaccttcagctcagcgaaggtgtcggggtcgtca 603

                                                                       
Query: 326 gcgaggccgagggggtcgaagctac-caccggggtagagggggtcgacgatctcgccgag 384
           || ||||| ||||||||||| | || | |||||||| |||||||| | |  |||||| ||
Sbjct: 602 gccaggcccagggggtcgaa-cgactcgccggggtacagggggtccaggccctcgcc-ag 545

                                                                       
Query: 385 c-gggccgccggcgacacggtagccctcgacggcgcccatgagcacgacctggcaagccc 443
           | |||||||||  ||| |||||||||||||    |||||| || | ||||||    ||| 
Sbjct: 544 cggggccgccgttgacgcggtagccctcgatcaggcccatcaggatgacctgcacggccg 485

                                                                       
Query: 444 agatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgc 503
           || |||||| |||| |||| ||||| |||||   ||||||||| |||||||| |||||||
Sbjct: 484 aggtggcgacgatgttctgggcgtgcacgagagaggggttgcccaggtagtccaggccgc 425

                                                                       
Query: 504 cctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacgccgt 563
           ||||   ||||||||||| |||||||||||||||||| |||||||||||||||  |||| 
Sbjct: 424 cctcagagaagatctgggcgccggccttgaaccagacagcctcgccgaacttggtgccgc 365

                                                                       
Query: 564 tgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccggcagt 623
           |   ||| ||||||||||||     |||||| || ||||| ||||| ||||| |||  ||
Sbjct: 364 tcttggccagcagctcgggggtctggcagcccagggcgcccagcatagcccagcgggcgt 305

                                
Query: 624 ggatcacctccagctcccggt 644
           |||||| ||||||||| ||||
Sbjct: 304 ggatcagctccagctcgcggt 284
to top
>dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C08, full
           insert sequence
          Length = 1111

 Score =  208 bits (105), Expect = 2e-50
 Identities = 177/201 (88%)
 Strand = Plus / Minus

                                                                       
Query: 146 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgaggttc 205
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786

                                                                       
Query: 206 tccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatg 265
           ||||| ||||||||||| ||||| |||||||| ||||| |||||||||||||||||||||
Sbjct: 785 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 726

                                                                       
Query: 266 gcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcg 325
           || ||||| || |||||||||||||| |||||||||| |||||| |   |||||||||||
Sbjct: 725 gcgaggcggccattcttgatctccttgaccttgagcttggcgaaggtgacggggtcgtcg 666

                                
Query: 326 gcgaggccgagggggtcgaag 346
           ||||||||||| |||||||||
Sbjct: 665 gcgaggccgagcgggtcgaag 645



 Score =  141 bits (71), Expect = 4e-30
 Identities = 127/143 (88%), Gaps = 2/143 (1%)
 Strand = Plus / Minus

                                                                       
Query: 401 cggtagccctcgacggcgcccatgagcacgacctggcaagcccag-atggcgaggatgct 459
           |||||||||||||||  ||||||||| ||||||||| || ||||| | ||||||||||||
Sbjct: 587 cggtagccctcgacgaggcccatgaggacgacctgg-aatcccagcacggcgaggatgct 529

                                                                       
Query: 460 ctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaagatctg 519
           ||| ||||| || ||| |||||||||||||||||||||||||||| |||  |||||||||
Sbjct: 528 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 469

                                  
Query: 520 ggagccggccttgaaccagacgg 542
           || ||||||||||||||| ||||
Sbjct: 468 ggcgccggccttgaaccacacgg 446



 Score =  101 bits (51), Expect = 3e-18
 Identities = 96/111 (86%)
 Strand = Plus / Minus

                                                                       
Query: 589 gcagccgagcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttctt 648
           |||||| |||||||||||||| |||||||||| |||||||||||||||| ||| |||| |
Sbjct: 396 gcagcccagcgcgccgagcatcgcccaccggccgtggatcacctccagcgccctgttcct 337

                                                              
Query: 649 ggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccgtagtc 699
            || || | ||| ||||| || ||||||||||| |||||||| ||||||||
Sbjct: 336 cgcgaacgcctccgggtccgcggagagccccgccgtgtcccacccgtagtc 286
to top
>dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023001G03, full
           insert sequence
          Length = 1107

 Score =  208 bits (105), Expect = 2e-50
 Identities = 177/201 (88%)
 Strand = Plus / Minus

                                                                       
Query: 146 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgaggttc 205
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 841 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 782

                                                                       
Query: 206 tccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatg 265
           ||||| ||||||||||| ||||| |||| ||| ||||| |||||||||||||||||||||
Sbjct: 781 tccaaggggcccttgccggtgacgatggtctggacgaagaagccgaacatggagaacatg 722

                                                                       
Query: 266 gcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcg 325
           || ||||| || |||||||||||||| ||||||||||||||||| |   |||||||||||
Sbjct: 721 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 662

                                
Query: 326 gcgaggccgagggggtcgaag 346
           ||||||||||| |||||||||
Sbjct: 661 gcgaggccgagcgggtcgaag 641



 Score =  141 bits (71), Expect = 4e-30
 Identities = 127/143 (88%), Gaps = 2/143 (1%)
 Strand = Plus / Minus

                                                                       
Query: 401 cggtagccctcgacggcgcccatgagcacgacctggcaagcccag-atggcgaggatgct 459
           |||||||||||||||  ||||||||| ||||||||| || ||||| | ||||||||||||
Sbjct: 583 cggtagccctcgacgaggcccatgaggacgacctgg-aatcccagcacggcgaggatgct 525

                                                                       
Query: 460 ctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaagatctg 519
           ||| ||||| || ||| |||||||||||||||||||||||||||| |||  |||||||||
Sbjct: 524 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 465

                                  
Query: 520 ggagccggccttgaaccagacgg 542
           || ||||||||||||||| ||||
Sbjct: 464 ggcgccggccttgaaccacacgg 442



 Score =  101 bits (51), Expect = 3e-18
 Identities = 96/111 (86%)
 Strand = Plus / Minus

                                                                       
Query: 589 gcagccgagcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttctt 648
           |||||| |||||||||||||| |||||||||| |||||||||||||||| ||| |||| |
Sbjct: 392 gcagcccagcgcgccgagcatcgcccaccggccgtggatcacctccagcgccctgttcct 333

                                                              
Query: 649 ggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccgtagtc 699
            || || | ||| ||||| || ||||||||||| |||||||| ||||||||
Sbjct: 332 cgcgaacgcctccgggtccgcggagagccccgccgtgtcccacccgtagtc 282
to top
>gb|AY112240.1| Zea mays CL187_6 mRNA sequence
          Length = 770

 Score =  206 bits (104), Expect = 7e-50
 Identities = 188/216 (87%)
 Strand = Plus / Minus

                                                                       
Query: 131 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaagg 190
           |||||||| || ||||| |||||| | ||||| |||||||||  |||||||||||| | |
Sbjct: 472 ttgccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggcgacg 413

                                                                       
Query: 191 tggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccg 250
           ||||||  ||||||||| |  ||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 412 tggtcgaagaggttctcgatggggcccttgccggtgacgatggcctgcacgaagaagccg 353

                                                                       
Query: 251 aacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaac 310
           ||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||   
Sbjct: 352 aacatggagaacatggcaaggcggccgttcttgagctccttcaccttgagctcggcggcg 293

                                               
Query: 311 gcctcggggtcgtcggcgaggccgagggggtcgaag 346
           |  || ||||||||||||||||| || |||||||||
Sbjct: 292 gtgtccgggtcgtcggcgaggcccagcgggtcgaag 257



 Score =  200 bits (101), Expect = 4e-48
 Identities = 164/185 (88%)
 Strand = Plus / Minus

                                                                       
Query: 380 ccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacctggcaa 439
           ||||||||||||||| |||| |||||||||||||||  |||||||||||| |||||||| 
Sbjct: 223 ccgagcgggccgccgccgacgcggtagccctcgacgaagcccatgagcaccacctggcac 164

                                                                       
Query: 440 gcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgagg 499
           ||||||||||| ||||||||||||||||| || ||| ||||||| || |||||||| || 
Sbjct: 163 gcccagatggccaggatgctctgtgcgtgcaccaggttggggttccccaggtagtccagc 104

                                                                       
Query: 500 ccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacg 559
           ||||||||   ||||||||| | ||||||||||||||| || ||||||||||||||||||
Sbjct: 103 ccgccctccgagaagatctgcgcgccggccttgaaccacaccgcctcgccgaacttgacg 44

                
Query: 560 ccgtt 564
           |||||
Sbjct: 43  ccgtt 39
to top
>emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putative chlorophyll A-B binding
           protein type I
          Length = 684

 Score =  202 bits (102), Expect = 1e-48
 Identities = 243/290 (83%)
 Strand = Plus / Minus

                                                                       
Query: 419 cccatgagcacgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctg 478
           ||||||||||| |||||||| |||||||||||||| |||||||||||||| |  ||| | 
Sbjct: 298 cccatgagcacaacctggcaggcccagatggcgagtatgctctgtgcgtgaatcaggtta 239

                                                                       
Query: 479 gggttgccgaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccag 538
           ||||| || |||||||||||||| |||||   ||| ||||| |  |||||||||||||| 
Sbjct: 238 gggttccccaggtagtcgaggcctccctctgagaatatctgcgccccggccttgaaccac 179

                                                                       
Query: 539 acggcctcgccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagc 598
           ||||| || || || || || |||||   ||| | |||||| ||||| ||||||||||||
Sbjct: 178 acggcttccccaaatttcaccccgtttttggccaacagctccgggaaaacgcagccgagc 119

                                                                       
Query: 599 gcgccgagcatggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtc 658
           || || | ||||||||| | ||||||||||||||||||||| |  || ||||| ||||||
Sbjct: 118 gcccccaacatggcccatctgcagtggatcacctccagctctctatttttggcgaaggtc 59

                                                             
Query: 659 tcggggtcggcagagagccccgcagtgtcccatccgtagtcaccgggaaa 708
           ||||||||||| |||||||| || |||||||| |||||||| ||||||||
Sbjct: 58  tcggggtcggccgagagcccggcggtgtcccacccgtagtctccgggaaa 9



 Score =  135 bits (68), Expect = 2e-28
 Identities = 119/136 (87%)
 Strand = Plus / Minus

                                                                       
Query: 211 tgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatggcaag 270
           ||||||||| ||||| ||||| ||||||||||| |||||||||||||||||||| || ||
Sbjct: 506 tgggcccttcccagtcacaattgcctgcacgaagaagccgaacatggagaacatcgccag 447

                                                                       
Query: 271 gcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcggcgag 330
            || |||||||| |||||||||||||| ||||| ||||||||||| ||||| ||||| ||
Sbjct: 446 ccgcccgttcttaatctccttcaccttcagctccgcgaacgcctccgggtcatcggccag 387

                           
Query: 331 gccgagggggtcgaag 346
            || || |||||||||
Sbjct: 386 ccccagtgggtcgaag 371
to top
>gb|M16058.1|CUSLHCPB Cucumber LHCP mRNA encoding chlorophyll a/b-binding protein,
           partial cds
          Length = 748

 Score =  202 bits (102), Expect = 1e-48
 Identities = 456/574 (79%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| |||||||| |||||  | ||||| || ||||||||||| ||||| || |
Sbjct: 621 actttccgggaacaaagtttgtggcatatgcccaagcattgttgttgactgggtcagcca 562

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
            |||||| || | ||| ||||| || ||||| ||||| |||||||| || ||||| || |
Sbjct: 561 agtggtcagccaagttttccaaaggaccctttccagtaacaatggcttgaacgaagaatc 502

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | |||||||| ||||| || |  | ||| ||||| | |||||| ||||| |  || ||||
Sbjct: 501 caaacatggaaaacattgccaaccttccattcttcaactccttaaccttcaattcagcga 442

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           | ||||| ||||| || || |  || |  ||||| ||||| ||||| ||||||| |||||
Sbjct: 441 aggcctctgggtcatcagccaaacccaatgggtcaaagcttccacctgggtagatggggt 382

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           |    | ||| ||||| |||||||| || | |||||| ||||||||||| ||||| | ||
Sbjct: 381 cagtcacctctccgagtgggccgccagcaatacggtaaccctcgacggcacccatcaaca 322

                                                                       
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
           | |||||||||||||||||||| |  |||||||| || ||||| | |||||||||||| |
Sbjct: 321 caacctggcaagcccagatggccaaaatgctctgagcatggaccaagctggggttgccca 262

                                                                       
Query: 489 ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
            |||||| || |||||||||||||||||||| || || ||||||||||| || ||||| |
Sbjct: 261 agtagtcaagcccgccctcgctgaagatctgagatccagccttgaaccaaacagcctcac 202

                                                                       
Query: 549 cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
           | ||||| || || ||||| |  |  ||||| ||||| || || || |  || || ||||
Sbjct: 201 caaacttcacaccattgcgagacaaaagctcagggaaaacacaccccaaagctccaagca 142

                                                                       
Query: 609 tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
           |||||||   | |||||||||| |||| ||| ||||||||||| ||||||||||| || |
Sbjct: 141 tggcccatgtggagtggatcacttccaactctcggttcttggcgaaggtctcgggatcag 82

                                             
Query: 669 cagagagccccgcagtgtcccatccgtagtcacc 702
           | || || || ||||||||||| |||||||||||
Sbjct: 81  ctgaaagtccagcagtgtcccaaccgtagtcacc 48
to top
>emb|X02359.1|PECAB22L Petunia gene for chlorophyll a/b binding protein cab 22L
          Length = 1187

 Score =  198 bits (100), Expect = 2e-47
 Identities = 409/512 (79%)
 Strand = Plus / Minus

                                                                        
Query: 140  acaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcg 199
            |||||||| || ||| ||| ||| || ||||| ||||| |||||  ||||||| || || 
Sbjct: 1021 acaaagttagtagcgtaggaccaagcattgttattgaccgggtctacaaggtgatcagca 962

                                                                        
Query: 200  aggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggag 259
            ||||| |||||||||||||| || ||||| || || || |  || || || |||||||||
Sbjct: 961  aggttttccaatgggccctttccggtgacgatagcttgaataaagaatccaaacatggag 902

                                                                        
Query: 260  aacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcgggg 319
            ||||| ||||| |  || |||||| | |||||||||||||| || || || ||||| || 
Sbjct: 901  aacatagcaagtctgccattcttggtttccttcaccttgagttcagcaaaagcctccgga 842

                                                                        
Query: 320  tcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcgacgatctcg 379
            || ||||| ||||| |  ||||||||||| ||||||||||| || |||||||| | | | 
Sbjct: 841  tcctcggcaaggcccaatgggtcgaagctgccaccggggtaaagtgggtcgacaaccaca 782

                                                                        
Query: 380  ccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacctggcaa 439
            || || || || || || |||||||| ||||| ||||| ||||| | ||  || ||||||
Sbjct: 781  ccaagaggtccaccagcaacacggtaaccctcaacggctcccatcaacaatacttggcaa 722

                                                                        
Query: 440  gcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgagg 499
            ||||||||||| | |||||| ||||||||||| |  || |||||||| | |||||| || 
Sbjct: 721  gcccagatggccaagatgctttgtgcgtggaccaaacttgggttgcccaagtagtcaagt 662

                                                                        
Query: 500  ccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacg 559
            || ||||| ||||| || || || || ||||||| ||| || ||||| || |||||||| 
Sbjct: 661  ccaccctcactgaaaatttgtgatccagccttgagccatacagcctcaccaaacttgaca 602

                                                                        
Query: 560  ccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccgg 619
            ||||| ||||| |  ||||| ||||||||||| || || || || ||||||||||| | |
Sbjct: 601  ccgttacgggcaaaaagctcagggaagacgcaaccaagagctccaagcatggcccatctg 542

                                            
Query: 620  cagtggatcacctccagctcccggttcttggc 651
            |||||||||||||||| ||| || ||||||||
Sbjct: 541  cagtggatcacctccaactcacgattcttggc 510
to top
>gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvesting complex II protein
           precursor (Lhcb2) mRNA, complete cds
          Length = 1200

 Score =  198 bits (100), Expect = 2e-47
 Identities = 429/532 (80%), Gaps = 10/532 (1%)
 Strand = Plus / Minus

                                                                       
Query: 179 gggtcggcaaggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgc 238
           |||| ||| ||||||||| | |||||||  |  ||||||||||| || || |||||||| 
Sbjct: 746 gggttggccaggtggtcgtccaggttctggacggggcccttgccggtcacgatggcctgg 687

                                                                       
Query: 239 acgaaaaagccgaacatggagaacatggc-aaggcgtccgttcttgatctccttcacctt 297
           ||||| ||||||||||||||||||||||| |||||| |||||||||||||||||||||||
Sbjct: 686 acgaagaagccgaacatggagaacatggccaaggcg-ccgttcttgatctccttcacctt 628

                                                                       
Query: 298 gagctcggcgaacgcctcggggtcgtcggcgaggccgagggggtcgaagctac-caccgg 356
            ||||| ||||| |  ||||||||||| || ||||| ||||||||||| | || | ||||
Sbjct: 627 cagctcagcgaaggtgtcggggtcgtcagccaggcccagggggtcgaa-cgactcgccgg 569

                                                                       
Query: 357 ggtagagggggtcgacgatctcgccgagcgggccgccggcgacacggtagccctcgacgg 416
           |||| |||||||| | |  ||||||   ||||||||||  ||| ||||||||||| |   
Sbjct: 568 ggtacagggggtccaggccctcgccagccgggccgccgttgacgcggtagccctcaatca 509

                                                                       
Query: 417 cgcccatgagcacgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggc 476
            |||||| || | ||||||   ||||  | |||||| |||| |||| ||||| || ||  
Sbjct: 508 ggcccataaggatgacctgcacagccagggtggcgacgatgttctgggcgtgcaccagag 449

                                                                       
Query: 477 tggggttgccgaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaacc 536
            ||||||||| |||||||| |||||||||||   ||||||||||| ||||||||||||||
Sbjct: 448 aggggttgcccaggtagtccaggccgccctcagagaagatctgggcgccggccttgaacc 389

                                                                       
Query: 537 agacggcctcgccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccga 596
           | |||||||| |||||||||  |||| |   ||| ||||||||||||   | |||||| |
Sbjct: 388 acacggcctcaccgaacttggtgccgctcttggccagcagctcgggggtcaggcagccca 329

                                                                       
Query: 597 gcgcgccgagcatggcccaccggcagtggatcacctccagctcccggtt---cttggcaa 653
           | ||||| ||||| ||||| |||  |||||||| ||||||||| ||||    ||||   |
Sbjct: 328 gggcgcccagcatagcccagcgggcgtggatcagctccagctcgcggtagcgcttg---a 272

                                                               
Query: 654 aggtctcggggtcggcagagagccccgcagtgtcccatccgtagtcaccggg 705
           ||||||| ||||| || || || || ||||||||||| |||||||| |||||
Sbjct: 271 aggtctccgggtcagccgacagaccggcagtgtcccagccgtagtcgccggg 220
to top
>gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein of PS II mRNA, partial
           cds
          Length = 551

 Score =  198 bits (100), Expect = 2e-47
 Identities = 315/387 (81%)
 Strand = Plus / Minus

                                                                       
Query: 134 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtgg 193
           ||||| || |||||||||||| | ||||| ||||||||||||||||||||||| ||||| 
Sbjct: 389 ccggggacgaagttggtggcgtaagcccaggcgttgttgttgacggggtcggccaggtga 330

                                                                       
Query: 194 tcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaac 253
           ||||||||||| || |  || || ||||| || || |||||||| ||||| || ||||||
Sbjct: 329 tcggcgaggttntcgaggggtcctttgcccgtcacgatggcctggacgaagaacccgaac 270

                                                                       
Query: 254 atggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcc 313
           |||||||||||||| |  || |||||||| | |||||||||||| ||||| ||||| || 
Sbjct: 269 atggagaacatggccaaccgcccgttctttagctccttcaccttcagctctgcgaaagcg 210

                                                                       
Query: 314 tcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcgacg 373
           || |||||||| || |  || |||||||||||| | |||||||| || | ||||||    
Sbjct: 209 tccgggtcgtctgccaaccccagggggtcgaagttgccaccgggataaatggggtcagtc 150

                                                                       
Query: 374 atctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacc 433
           | ||| || || || || || || |||||||||||||| | ||| |||||||| | ||||
Sbjct: 149 acctctcccaggggtccacccgcaacacggtagccctcaatggcacccatgaggatgacc 90

                                                                       
Query: 434 tggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtag 493
           ||||| ||||||||||| || ||||| ||||||||||| |   | ||| |||| ||||||
Sbjct: 89  tggcatgcccagatggcaagaatgctttgtgcgtggactaaatttgggctgcccaggtag 30

                                      
Query: 494 tcgaggccgccctcgctgaagatctgg 520
           || || || ||||| ||||||||||||
Sbjct: 29  tcaagccctccctcactgaagatctgg 3
to top
>gb|K00974.1|PETCAB4 Petunia major chlorophyll a/b binding protein (Cab) clone pCab4, 3'
           end
          Length = 387

 Score =  196 bits (99), Expect = 7e-47
 Identities = 312/383 (81%)
 Strand = Plus / Minus

                                                                       
Query: 140 acaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcg 199
           |||||||| |||||| ||| ||| || |||||||| || |||||||||||||||||||| 
Sbjct: 383 acaaagtttgtggcgtaggaccaagcattgttgttaactgggtcggcaaggtggtcggca 324

                                                                       
Query: 200 aggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggag 259
           |||||||||||||| ||||| ||||| ||||||||||| || ||||| || |||||||| 
Sbjct: 323 aggttctccaatggaccctttccagtaacaatggcctgaacaaaaaatccaaacatggaa 264

                                                                       
Query: 260 aacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcgggg 319
           ||||| ||||| |  || |||||||||||||||||||||||||| || || ||||| |||
Sbjct: 263 aacatagcaagtctaccattcttgatctccttcaccttgagctcagcaaatgcctctggg 204

                                                                       
Query: 320 tcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcgacgatctcg 379
           || || || || || |  || |||||||||||||| |||||||| ||||| |  | ||| 
Sbjct: 203 tcatcagcaagacccaatggatcgaagctaccaccagggtagagtgggtcaataacctca 144

                                                                       
Query: 380 ccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacctggcaa 439
           || || || || || || |||||||| ||||| ||||| ||||| | ||| || ||||||
Sbjct: 143 ccaagaggcccaccagcaacacggtaaccctcaacggctcccatcaacacaacttggcaa 84

                                                                       
Query: 440 gcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgagg 499
           |||||  |||| | |||||| |||||||| || |  || |||||||| | |||||| || 
Sbjct: 83  gcccaactggccaagatgctttgtgcgtgaaccaaacttgggttgcccaagtagtcaagt 24

                                  
Query: 500 ccgccctcgctgaagatctggga 522
            | |||||||| ||||| |||||
Sbjct: 23  tcaccctcgctaaagatttggga 1
to top
>gb|M16057.1|CUSLHCPA Cucumber LHCP mRNA encoding chlorophyll a/b-binding protein,
           partial cds
          Length = 878

 Score =  196 bits (99), Expect = 7e-47
 Identities = 435/547 (79%)
 Strand = Plus / Minus

                                                                       
Query: 156 aggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgaggttctccaatgggc 215
           ||||||| || ||||||||||| ||||| ||||| || || || |  ||||||||||| |
Sbjct: 739 aggcccaagcattgttgttgactgggtcagcaagatgatcagccaaattctccaatggac 680

                                                                       
Query: 216 ccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatggcaaggcgtc 275
           |||| || || || || ||||| || || || || |||||||||||||| || |  | ||
Sbjct: 679 cctttccggtaacgatagcctgaacaaagaatccaaacatggagaacatagctaaccttc 620

                                                                       
Query: 276 cgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcggcgaggccga 335
           | ||||||| |||||| ||||| | ||| ||||| ||||| ||||| || || |  || |
Sbjct: 619 cattcttgagctccttaaccttcaactcagcgaatgcctctgggtcatcagccaaaccca 560

                                                                       
Query: 336 gggggtcgaagctaccaccggggtagagggggtcgacgatctcgccgagcgggccgccgg 395
             ||||||||||| ||||| ||||||| ||||||    | ||| ||||| ||||| || |
Sbjct: 559 atgggtcgaagcttccacctgggtagatggggtcagtcacctctccgagtgggccaccag 500

                                                                       
Query: 396 cgacacggtagccctcgacggcgcccatgagcacgacctggcaagcccagatggcgagga 455
           | | |||||| ||||||||||| ||||| | ||| || ||||||||||||||||| |  |
Sbjct: 499 caatacggtaaccctcgacggcacccatcaacacaacttggcaagcccagatggccaaaa 440

                                                                       
Query: 456 tgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaaga 515
           ||||||| |||||||| | |||||||||||| | |||||| || ||||||||||||||||
Sbjct: 439 tgctctgagcgtggaccaagctggggttgcccaagtagtcaagcccgccctcgctgaaga 380

                                                                       
Query: 516 tctgggagccggccttgaaccagacggcctcgccgaacttgacgccgttgcgggcgagca 575
           |||| || || ||||||||||| || || || || ||||| || || || || |  |  |
Sbjct: 379 tctgcgaaccagccttgaaccacacagcttcaccaaacttcacaccattacgagacaaaa 320

                                                                       
Query: 576 gctcggggaagacgcagccgagcgcgccgagcatggcccaccggcagtggatcacctcca 635
           |||| ||||| || || || |  || || ||||||||||| | | |||||||||| ||||
Sbjct: 319 gctcagggaaaacacaccccaaagctccaagcatggcccatctggagtggatcacttcca 260

                                                                       
Query: 636 gctcccggttcttggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccgt 695
            ||| ||||||||||| ||||||||||| || || || || || ||||||||||| ||||
Sbjct: 259 actcacggttcttggcgaaggtctcgggatcagctgaaagtccagcagtgtcccaaccgt 200

                  
Query: 696 agtcacc 702
           |||||||
Sbjct: 199 agtcacc 193
to top
>gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chlorophyll a/b-binding
           polypeptide (Lhcb2) mRNA, partial cds
          Length = 873

 Score =  194 bits (98), Expect = 3e-46
 Identities = 242/290 (83%)
 Strand = Plus / Minus

                                                                       
Query: 419 cccatgagcacgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctg 478
           ||||||||||| |||||||| |||||||||||||| |||||||||||||| |  ||  ||
Sbjct: 449 cccatgagcacaacctggcaggcccagatggcgagtatgctctgtgcgtgaatcagattg 390

                                                                       
Query: 479 gggttgccgaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccag 538
           ||||| || |||||||||||||| |||||   ||| ||||| |  |||||||||||||| 
Sbjct: 389 gggttccccaggtagtcgaggcctccctctgagaatatctgagccccggccttgaaccac 330

                                                                       
Query: 539 acggcctcgccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagc 598
           ||||| || || || || || |||||   ||| | |||||| ||||| |||||||| |||
Sbjct: 329 acggcttccccaaatttcaccccgtttttggccaacagctccgggaaaacgcagcccagc 270

                                                                       
Query: 599 gcgccgagcatggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtc 658
           || || | ||||||||| | | ||||||||||||||||||| | ||| ||||| ||||||
Sbjct: 269 gcccccaacatggcccatctggagtggatcacctccagctctctgtttttggcgaaggtc 210

                                                             
Query: 659 tcggggtcggcagagagccccgcagtgtcccatccgtagtcaccgggaaa 708
           ||||| |||||||||||||| || |||||||| |||||||| ||||||||
Sbjct: 209 tcgggatcggcagagagcccggctgtgtcccacccgtagtctccgggaaa 160



 Score =  145 bits (73), Expect = 2e-31
 Identities = 184/221 (83%)
 Strand = Plus / Minus

                                                                       
Query: 126 cttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcgg 185
           |||| |||||||| || || ||||||||| ||||||| || ||||||   |||||||| |
Sbjct: 742 cttatttgccgggaacgaaattggtggcgtaggcccaggcattgttggcaacggggtccg 683

                                                                       
Query: 186 caaggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaa 245
           | | |||||||  ||| || || | ||||||||| || || || || ||||||||||| |
Sbjct: 682 ccaagtggtcgtagagattttcaattgggcccttcccggtcacgattgcctgcacgaaga 623

                                                                       
Query: 246 agccgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcgg 305
           |||||||||||||||||||||| || || |||||||| |||||||||||||| ||||| |
Sbjct: 622 agccgaacatggagaacatggccagccgcccgttctttatctccttcacctttagctccg 563

                                                    
Query: 306 cgaacgcctcggggtcgtcggcgaggccgagggggtcgaag 346
           |||| ||||| ||||||||||| || || || |||||||||
Sbjct: 562 cgaaagcctccgggtcgtcggccagtcccagtgggtcgaag 522
to top
>gb|M14449.1|TOMCBPG Tomato chlorophyll a/b-binding protein gene Cab-1D, complete cds
          Length = 351

 Score =  194 bits (98), Expect = 3e-46
 Identities = 278/338 (82%)
 Strand = Plus / Minus

                                                                       
Query: 134 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtgg 193
           ||||| |||||||| |||||| ||| ||| ||||||||||| || ||||| |||||||| 
Sbjct: 344 ccgggaacaaagttagtggcgtaggaccaggcgttgttgtttactgggtctgcaaggtga 285

                                                                       
Query: 194 tcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaac 253
           || || |||||||||||||| ||||| ||||| |||||||| || || || || || |||
Sbjct: 284 tcagcaaggttctccaatggtccctttccagtaacaatggcttgaacaaagaatccaaac 225

                                                                       
Query: 254 atggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcc 313
           || |||||||| ||||| |  |||||||| |||||||| ||||||||||| || || |||
Sbjct: 224 atagagaacatagcaagtctaccgttcttaatctccttaaccttgagctcagcaaatgcc 165

                                                                       
Query: 314 tcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcgacg 373
           || ||||| || || ||||| |  ||||||||||| |||||||||||||| ||||| || 
Sbjct: 164 tcagggtcttcagcaaggcctaatgggtcgaagcttccaccggggtagagtgggtctaca 105

                                                                       
Query: 374 atctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacc 433
           | ||| || || || || || || | |||||| || || ||||| |||||||| || || 
Sbjct: 104 acctcaccaagaggtccaccagcaatacggtaaccttcaacggctcccatgagtacaact 45

                                                 
Query: 434 tggcaagcccagatggcgaggatgctctgtgcgtggac 471
           ||||||||||||||||| | |||||||||||| |||||
Sbjct: 44  tggcaagcccagatggccaagatgctctgtgcatggac 7
to top
>dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-binding protein
           precursor, complete cds
          Length = 964

 Score =  194 bits (98), Expect = 3e-46
 Identities = 341/422 (80%)
 Strand = Plus / Minus

                                                                       
Query: 134 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtgg 193
           ||||| || |||||||||||| ||||||| |||||||||   ||||||||||| | ||||
Sbjct: 839 ccgggaacgaagttggtggcgtaggcccaggcgttgttggcaacggggtcggccaagtgg 780

                                                                       
Query: 194 tcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaac 253
           |||   | ||||||||  || ||||| ||||| || |||||||| ||||| || ||||||
Sbjct: 779 tcgttcaagttctccaggggtccctttccagtcacgatggcctggacgaagaacccgaac 720

                                                                       
Query: 254 atggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcc 313
           || ||||||||||| |  || ||||||||||||||||||||||| | ||| ||||| |  
Sbjct: 719 attgagaacatggccaatcggccgttcttgatctccttcaccttcaactcagcgaaggtg 660

                                                                       
Query: 314 tcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcgacg 373
           ||||||||||| || |  || | ||||||||||   || || ||||||| ||||||    
Sbjct: 659 tcggggtcgtcagccaaacccaaggggtcgaaggagcctcccgggtagatggggtcagta 600

                                                                       
Query: 374 atctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacc 433
           |  || ||||| || || || || |||||||| ||||||||||| ||||| || |  || 
Sbjct: 599 acgtcaccgaggggtccaccagcaacacggtaaccctcgacggctcccatcaggataact 540

                                                                       
Query: 434 tggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtag 493
           |||||||||||||| || | ||||||||| ||||| || |||||||||||||| | ||||
Sbjct: 539 tggcaagcccagatagccaagatgctctgagcgtgcacaaggctggggttgcccaagtag 480

                                                                       
Query: 494 tcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaac 553
           || |  || ||||||||||||||||| |  |||||||||||||| |||||||| ||||||
Sbjct: 479 tccaaacctccctcgctgaagatctgagctccggccttgaaccaaacggcctcaccgaac 420

             
Query: 554 tt 555
           ||
Sbjct: 419 tt 418



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 605 agcatggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcgggg 664
           ||||||||||| ||   |||||||||||| ||||| |||||   ||| ||||||||||||
Sbjct: 368 agcatggcccatcgagcgtggatcacctcgagctcgcggttgcgggcgaaggtctcgggg 309

                                                 
Query: 665 tcggcagagagccccgcagtgtcccatccgtagtcacc 702
           ||||  ||||| || ||||||||||| ||||| |||||
Sbjct: 308 tcggatgagagtccagcagtgtcccagccgtaatcacc 271
to top
>emb|X02360.1|PECAB22R Petunia gene for chlorophyll a/b binding protein cab 22R
          Length = 1187

 Score =  192 bits (97), Expect = 1e-45
 Identities = 454/573 (79%)
 Strand = Plus / Minus

                                                                        
Query: 129  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
            |||| ||||| |||||||| || ||  ||| ||| || |||||||| || || || ||||
Sbjct: 1032 actttccgggaacaaagtttgtagcataggaccatgcattgttgttaactggatcagcaa 973

                                                                        
Query: 189  ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
            |||| ||||| |||||||||||||| ||||| || ||||| || |||||||| || || |
Sbjct: 972  ggtgatcggcaaggttctccaatggaccctttccggtgacgatagcctgcacaaagaatc 913

                                                                        
Query: 249  cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
            | ||||| |||||||| ||||| |  || ||||| |||||||||||||||||||| || |
Sbjct: 912  caaacatagagaacatagcaagtctaccattcttaatctccttcaccttgagctcagcaa 853

                                                                        
Query: 309  acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
            | || |||||||| || || ||||| |  || |||||||||||||| || || || ||||
Sbjct: 852  aagcttcggggtcttcagctaggcccaatggatcgaagctaccaccaggataaagtgggt 793

                                                                        
Query: 369  cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
            | |  | ||| ||||| || || || || |||||||| ||||| || || ||||| | ||
Sbjct: 792  caataacctcaccgagaggtccaccagcaacacggtaaccctcaacagctcccatcaaca 733

                                                                        
Query: 429  cgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccga 488
            |||| ||||||||||| ||||| | |||||| |||||||| || |  || |||||||| |
Sbjct: 732  cgacttggcaagcccaaatggccaagatgctttgtgcgtgaaccaaacttgggttgccca 673

                                                                        
Query: 489  ggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgc 548
             |||||| || || ||||| ||||| || || |  || ||||||||||| || ||||| |
Sbjct: 672  agtagtcaagtccaccctcactgaaaatttgagctccagccttgaaccatacagcctcac 613

                                                                        
Query: 549  cgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagca 608
            |||| ||||  || || ||||| |  || || |||||||| || || || || || ||||
Sbjct: 612  cgaatttgataccattacgggcaaagagttcagggaagacacaaccaagagctccaagca 553

                                                                        
Query: 609  tggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcgg 668
            ||||||| |  |||||||| ||||||||||| |||||||||||||| || || || || |
Sbjct: 552  tggcccatctacagtggatgacctccagctcacggttcttggcaaaagtttcaggatcag 493

                                             
Query: 669  cagagagccccgcagtgtcccatccgtagtcac 701
            | || || || ||||| |||||||| |||||||
Sbjct: 492  ccgaaagtccagcagtatcccatccatagtcac 460
to top
>gb|M30616.1|TOMCBPC2 Tomato chlorophyll a/b-binding protein Cab-1A gene , 3' end
          Length = 351

 Score =  188 bits (95), Expect = 2e-44
 Identities = 281/343 (81%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| |||||||| ||||| || ||||| ||||||||||| || ||||| ||||
Sbjct: 349 actttccgggaacaaagtttgtggcaaatgcccaggcgttgttgtttacagggtctgcaa 290

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           |||| || || |||||||||||||| ||||| || || ||||||||||| || || || |
Sbjct: 289 ggtgatcagcaaggttctccaatggaccctttccggtaacaatggcctgaacaaagaacc 230

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| ||||| |  ||||||||||||||||| ||||| ||||| || |
Sbjct: 229 caaacatagagaacatagcaagtctgccgttcttgatctccttaaccttaagctcagcaa 170

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           | ||||| ||||| || || ||||| |  ||||||||||| |||||||||||||| ||||
Sbjct: 169 atgcctccgggtcttcagcaaggcctaatgggtcgaagctgccaccggggtagagtgggt 110

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           |||| | ||| || || || || || || |  ||||| ||||| ||||| ||||| | ||
Sbjct: 109 cgacaacctcaccaagaggtccaccagcaatgcggtatccctcaacggctcccatcaaca 50

                                                      
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgcgtggac 471
           | || ||||||||||||||||| | |||||| ||||| |||||
Sbjct: 49  caacttggcaagcccagatggccaagatgctttgtgcatggac 7
to top
>dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene for light-harvesting
            chlorophyll a/b-binding protein 2, complete cds
          Length = 3125

 Score =  186 bits (94), Expect = 7e-44
 Identities = 340/422 (80%)
 Strand = Plus / Minus

                                                                        
Query: 134  ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtgg 193
            ||||| || |||||||||||| ||||||| |||||||||   ||||||||||| | ||||
Sbjct: 3017 ccgggaacgaagttggtggcgtaggcccatgcgttgttggcaacggggtcggccaagtgg 2958

                                                                        
Query: 194  tcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaac 253
            |||   | |||||||||||||||||| || || || || ||||| ||||| || ||||||
Sbjct: 2957 tcgttcaagttctccaatgggccctttccggtcacgatagcctgaacgaagaatccgaac 2898

                                                                        
Query: 254  atggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcc 313
            || ||||||||||| |  || ||||||||||||||||||||||| | ||| ||||| |  
Sbjct: 2897 atcgagaacatggccaatcgcccgttcttgatctccttcaccttcaactcagcgaaggtg 2838

                                                                        
Query: 314  tcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcgacg 373
            ||||||||||| || |  || | |||||||||    || |||||||||| ||||||    
Sbjct: 2837 tcggggtcgtcagccaaacccaaggggtcgaatgagcctccggggtagatggggtcagtc 2778

                                                                        
Query: 374  atctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacc 433
            | ||| || |  || || ||||| |||||||| ||||| || || ||||| || |  |||
Sbjct: 2777 acctcacccaatggtccaccggcaacacggtaaccctcaacagctcccataaggataacc 2718

                                                                        
Query: 434  tggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtag 493
            ||||||||||||||||| ||||||||||| ||||| || |||||||||||||| | ||| 
Sbjct: 2717 tggcaagcccagatggccaggatgctctgagcgtgcacaaggctggggttgcccaagtaa 2658

                                                                        
Query: 494  tcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaac 553
            || || || |||||||||||||| || |  |||||||||||||| || || || ||||||
Sbjct: 2657 tcaagaccaccctcgctgaagatttgagctccggccttgaaccacacagcttcaccgaac 2598

              
Query: 554  tt 555
            ||
Sbjct: 2597 tt 2596



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 86/101 (85%)
 Strand = Plus / Minus

                                                                        
Query: 602  ccgagcatggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcg 661
            |||||||||||||| |||  ||| || ||||| ||||||| |||   |||||||||||||
Sbjct: 2549 ccgagcatggcccagcgggcgtgaataacctcaagctccctgttgcgggcaaaggtctcg 2490

                                                     
Query: 662  gggtcggcagagagccccgcagtgtcccatccgtagtcacc 702
            |||||||  ||||| || || ||||||||||||||||||||
Sbjct: 2489 gggtcggaggagagtccagcggtgtcccatccgtagtcacc 2449
to top
>gb|AF017998.1|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b binding protein (LHCPII) gene,
            complete cds
          Length = 2095

 Score =  182 bits (92), Expect = 1e-42
 Identities = 283/344 (82%), Gaps = 2/344 (0%)
 Strand = Plus / Minus

                                                                        
Query: 212  gggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatggcaagg 271
            ||||||||||| |||||||||||||||||||| || || |||||||||||||| || || 
Sbjct: 1661 gggcccttgccggtgacaatggcctgcacgaagaacccaaacatggagaacatagcgaga 1602

                                                                        
Query: 272  cgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcggcgagg 331
            || ||||||||||||||||||||||||||||||| ||| |  || |||||||| || |||
Sbjct: 1601 cgcccgttcttgatctccttcaccttgagctcggagaaggtgtcagggtcgtcagccagg 1542

                                                                        
Query: 332  ccgagggggtcgaagctaccaccggggtagagggggtcgacgatctcgccgagcgggccg 391
            || ||||||||||||  ||| |||||||  ||   ||||| |  ||| ||||| ||||| 
Sbjct: 1541 cccagggggtcgaaggcaccgccggggtgcagcttgtcgaggtcctcaccgagagggcca 1482

                                                                        
Query: 392  ccggcgacacggtagccctcgacggcgcccatgagcacgacctggcaagccca-gatggc 450
            |||  ||| ||| |  ||||| |  ||||||| ||||| ||||||| |||||| ||||||
Sbjct: 1481 ccgttgacgcggaacgcctcggcaccgcccatcagcaccacctggc-agcccaggatggc 1423

                                                                        
Query: 451  gaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgct 510
             ||||||  ||| ||||| || ||   || |||||| |||||||||||||| || |||  
Sbjct: 1422 caggatggactgggcgtgcaccagagaggagttgccaaggtagtcgaggccaccgtcggc 1363

                                                        
Query: 511  gaagatctgggagccggccttgaaccagacggcctcgccgaact 554
            ||| ||||||| |||||||||||||||||||||||| |||||||
Sbjct: 1362 gaaaatctgggcgccggccttgaaccagacggcctcaccgaact 1319



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 110/134 (82%)
 Strand = Plus / Minus

                                                                        
Query: 572  agcagctcggggaagacgcagccgagcgcgccgagcatggcccaccggcagtggatcacc 631
            ||||||||||||  |||||||||||| ||||| ||||| ||||| ||   |||||||| |
Sbjct: 1298 agcagctcgggggtgacgcagccgagagcgcccagcatagcccagcgagcgtggatcagc 1239

                                                                        
Query: 632  tccagctcccggttcttggcaaaggtctcggggtcggcagagagccccgcagtgtcccat 691
            || ||||| ||||     || ||||||||||||||||| || || || || |||||||| 
Sbjct: 1238 tcgagctcgcggtaggaagcgaaggtctcggggtcggcggacaggccggcggtgtcccag 1179

                          
Query: 692  ccgtagtcaccggg 705
            ||||||||||||||
Sbjct: 1178 ccgtagtcaccggg 1165
to top
>gb|M30620.1|TOMCBPE2 Tomato chlorophyll a/b-binding protein Cab-3A gene, 3' end
          Length = 351

 Score =  182 bits (92), Expect = 1e-42
 Identities = 197/232 (84%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| |||||||| ||||| |||||||| ||||||||||| || ||||||||||
Sbjct: 349 actttccgggaacaaagtttgtggcaaaggcccaggcgttgttgttaactgggtcggcaa 290

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
            ||||||||| |||||||||||||| ||||| || |||||||| || || || || || |
Sbjct: 289 tgtggtcggcaaggttctccaatggaccctttccggtgacaatagcttgaacaaagaatc 230

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | |||||||||||||| ||||| |  ||||||||||||||||| ||||||||||| ||||
Sbjct: 229 caaacatggagaacatagcaagtctgccgttcttgatctcctttaccttgagctcagcga 170

                                                               
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
           | ||||| ||||| || || ||||| |  ||||| ||||||||||| |||||
Sbjct: 169 aagcctctgggtcttcagcaaggcccaatgggtcaaagctaccaccagggta 118
to top
>gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 1096

 Score =  180 bits (91), Expect = 4e-42
 Identities = 242/291 (83%), Gaps = 1/291 (0%)
 Strand = Plus / Minus

                                                                       
Query: 418 gcccatgagcacgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggct 477
           |||||||||||| |||||| | ||||||||||| || |||||||| |||||||  ||| |
Sbjct: 583 gcccatgagcacaacctggaaggcccagatggccagaatgctctgcgcgtggatcaggtt 524

                                                                       
Query: 478 ggggttgccgaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaacca 537
           |||||| || |||||||||||||| |||||   ||| ||||| |  ||||||||||||||
Sbjct: 523 ggggttccccaggtagtcgaggcctccctccgcgaatatctgcgc-ccggccttgaacca 465

                                                                       
Query: 538 gacggcctcgccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgag 597
            ||||| || || || || || ||| |   ||| | |||||| ||||| |||||||||||
Sbjct: 464 cacggcttccccaaatttcaccccggttttggccaacagctccgggaaaacgcagccgag 405

                                                                       
Query: 598 cgcgccgagcatggcccaccggcagtggatcacctccagctcccggttcttggcaaaggt 657
           ||| || | ||||||||| | || |||||||||||||||||| | ||| ||||| |||||
Sbjct: 404 cgcccccaacatggcccatctgctgtggatcacctccagctctctgtttttggcgaaggt 345

                                                              
Query: 658 ctcggggtcggcagagagccccgcagtgtcccatccgtagtcaccgggaaa 708
           ||| ||||||||||||||||| || |||||||| |||||||| ||||||||
Sbjct: 344 ctcagggtcggcagagagcccggcggtgtcccacccgtagtcgccgggaaa 294



 Score =  117 bits (59), Expect = 5e-23
 Identities = 164/199 (82%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||||||||| || || ||||||||| ||||||| ||||||||| |  |||| || || |
Sbjct: 872 acttgccgggaacgaaattggtggcgtaggcccaggcgttgttggttgcgggatccgcca 813

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
            |||||||  ||| || || |  ||||||||||| || || || ||||||||||| ||||
Sbjct: 812 agtggtcgaagagattttcgatggggcccttgccggttacgattgcctgcacgaagaagc 753

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           ||||||||||||||||||| || || |||||||| | |||||||||||| ||||| || |
Sbjct: 752 cgaacatggagaacatggccagccgcccgttctttagctccttcaccttcagctccgcaa 693

                              
Query: 309 acgcctcggggtcgtcggc 327
           |||| || ||||| |||||
Sbjct: 692 acgcttccgggtcatcggc 674
to top
>gb|AF133340.1|AF133340 Phalaenopsis sp. 'KCbutterfly' putative chlorophyll a/b-binding
           protein mRNA, complete cds
          Length = 1118

 Score =  180 bits (91), Expect = 4e-42
 Identities = 238/287 (82%)
 Strand = Plus / Minus

                                                                       
Query: 140 acaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcg 199
           ||||||||||||||  | ||||| ||||| ||||| || ||||| |||||||||||||| 
Sbjct: 874 acaaagttggtggcataagcccaggcgttattgttcaccgggtcagcaaggtggtcggcc 815

                                                                       
Query: 200 aggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggag 259
           | ||||||||  || ||||| ||||||||||| |||||||||||||| || ||||| |||
Sbjct: 814 aagttctccagcggaccctttccagtgacaatcgcctgcacgaaaaaaccaaacatagag 755

                                                                       
Query: 260 aacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcgggg 319
           ||||| || || |  || ||||| | |||||||||||| ||||| || || |||||||||
Sbjct: 754 aacattgccagcctaccattctttaactccttcaccttcagctcagcaaaggcctcgggg 695

                                                                       
Query: 320 tcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcgacgatctcg 379
           |||||||| | ||| || ||||||||||||   || ||||| || ||||||  |||||||
Sbjct: 694 tcgtcggccaagcccagcgggtcgaagctattgcctgggtaaagcgggtcggtgatctcg 635

                                                          
Query: 380 ccgagcgggccgccggcgacacggtagccctcgacggcgcccatgag 426
           ||||| || |||||||| | ||| |||||||| || |||||||||||
Sbjct: 634 ccgagaggaccgccggcaatacgatagccctcaacagcgcccatgag 588



 Score =  109 bits (55), Expect = 1e-20
 Identities = 166/203 (81%)
 Strand = Plus / Minus

                                                                       
Query: 503 ccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacgccg 562
           ||||||||||||||||| || || || |||||||| || |||||||| ||||| ||||| 
Sbjct: 511 ccctcgctgaagatctgagaaccagctttgaaccacaccgcctcgccaaactttacgcca 452

                                                                       
Query: 563 ttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccggcag 622
           ||||| || |  ||||| ||||||| ||| || || || || | ||||||||||||  ||
Sbjct: 451 ttgcgagccaaaagctctgggaagatgcaacccagtgcacccaacatggcccaccgtgag 392

                                                                       
Query: 623 tggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccccgca 682
           ||||| |||||||||||||| ||||| || ||||| || ||||| || || |  || |||
Sbjct: 391 tggatgacctccagctcccgattcttagcgaaggtttctgggtccgccgacaagccagca 332

                                  
Query: 683 gtgtcccatccgtagtcaccggg 705
           |||||||| ||||| ||||||||
Sbjct: 331 gtgtcccagccgtaatcaccggg 309
to top
>gb|AY198376.1| Citrus limon chlorophyll a/b-binding protein precursor, gene,
           partial cds; nuclear gene for chloroplast product
          Length = 647

 Score =  176 bits (89), Expect = 6e-41
 Identities = 224/269 (83%)
 Strand = Plus / Minus

                                                                       
Query: 431 acctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgagg 490
           |||||||||||||||||||| | ||||||||| |||||||  | ||| ||||| || | |
Sbjct: 491 acctggcaagcccagatggccaagatgctctgggcgtggatcaagcttgggtttcccaag 432

                                                                       
Query: 491 tagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccg 550
           ||||| || |||||||||||||||||||| |  || ||||||||||| |||||||| |||
Sbjct: 431 tagtcaagcccgccctcgctgaagatctgagctcccgccttgaaccacacggcctcaccg 372

                                                                       
Query: 551 aacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatg 610
           |||||||| ||||||||||| |  ||||| ||||||||||| || || || || | ||||
Sbjct: 371 aacttgactccgttgcgggccaagagctccgggaagacgcatccaagagctcccaacatg 312

                                                                       
Query: 611 gcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggca 670
           ||||| | ||||||||| || || || || || |||||||||||||| || ||||| || 
Sbjct: 311 gcccatctgcagtggatgacttcgagttcacgattcttggcaaaggtttctgggtcagct 252

                                        
Query: 671 gagagccccgcagtgtcccatccgtagtc 699
           || ||||| || |||||||| ||||||||
Sbjct: 251 gaaagcccggctgtgtcccaaccgtagtc 223



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 278 ttcttgatctccttcaccttgagctc 303
           |||||||||||||| |||||||||||
Sbjct: 644 ttcttgatctcctttaccttgagctc 619
to top
>gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chlorophyll a/b-binding
           polypeptide (Lhcb1) mRNA, partial cds
          Length = 414

 Score =  174 bits (88), Expect = 3e-40
 Identities = 194/228 (85%), Gaps = 1/228 (0%)
 Strand = Plus / Minus

                                                                       
Query: 143 aagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgagg 202
           |||||||||||  ||||||| ||||||||||| ||||||||||| ||||| || ||||||
Sbjct: 273 aagttggtggcataggcccaggcgttgttgttaacggggtcggccaggtgatcagcgagg 214

                                                                       
Query: 203 ttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaac 262
           ||||| |  || || || || ||||| |||||||||||||| || ||||||||||| |||
Sbjct: 213 ttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatggaaaac 154

                                                                       
Query: 263 atggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcg 322
           ||||| |  || ||||||||||||||||||||||| ||||| ||||| || |||||||||
Sbjct: 153 atggccaaccgcccgttcttgatctccttcaccttcagctccgcgaaagcgtcggggtcg 94

                                                           
Query: 323 tcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcg 370
           || || || || || ||||||||||| || |||||||||| |||||||
Sbjct: 93  tcagcaagtcccagcgggtcgaagct-cccccggggtagatggggtcg 47
to top
>gb|M30622.1|TOMCBPF2 Tomato chlorophyll a/b-binding protein Cab-3B gene, 3' end
          Length = 351

 Score =  174 bits (88), Expect = 3e-40
 Identities = 196/232 (84%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| |||||||| ||||| |||||||| ||||||||||| || ||||| ||||
Sbjct: 349 actttccgggaacaaagtttgtggcaaaggcccaggcgttgttgttaactgggtcagcaa 290

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
            ||||||||| || ||||||||||| ||||| ||||||||||| || || || || ||||
Sbjct: 289 tgtggtcggcaagattctccaatggaccctttccagtgacaatagcttgaacaaagaagc 230

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | |||||||||||||| ||||| |  |||||||||||||||||||| |||||||| || |
Sbjct: 229 caaacatggagaacatagcaagtctgccgttcttgatctccttcactttgagctcagcaa 170

                                                               
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
           | ||||| ||||| || || ||||| |  ||||| ||||||||||| |||||
Sbjct: 169 aagcctctgggtcttcagcaaggcccaatgggtcaaagctaccaccagggta 118
to top
>dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT10J15, TM0007,
             complete sequence
          Length = 92741

 Score =  172 bits (87), Expect = 1e-39
 Identities = 210/251 (83%)
 Strand = Plus / Plus

                                                                         
Query: 455   atgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaag 514
             |||||||| |||||||| ||||| |||||||| | |||||| || || ||||||||||||
Sbjct: 65887 atgctctgagcgtggaccaggctcgggttgcccaagtagtcaagcccaccctcgctgaag 65946

                                                                         
Query: 515   atctgggagccggccttgaaccagacggcctcgccgaacttgacgccgttgcgggcgagc 574
             || || || || ||||||||||| || ||||| ||||| || || ||||||||||| |  
Sbjct: 65947 atttgtgacccagccttgaaccacacagcctcaccgaatttaaccccgttgcgggccaag 66006

                                                                         
Query: 575   agctcggggaagacgcagccgagcgcgccgagcatggcccaccggcagtggatcacctcc 634
             ||||| ||||| || ||||| |  || || | |||||||||||   ||||||||||||| 
Sbjct: 66007 agctctgggaaaacacagcccaaagctcccaacatggcccacctagagtggatcacctca 66066

                                                                         
Query: 635   agctcccggttcttggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccg 694
             ||||| ||||||||||| || ||||||||||| ||||| ||||| ||||||||||| |||
Sbjct: 66067 agctcacggttcttggcgaatgtctcggggtcagcagaaagcccagcagtgtcccagccg 66126

                        
Query: 695   tagtcaccggg 705
             |||||||||||
Sbjct: 66127 tagtcaccggg 66137



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 185/231 (80%)
 Strand = Plus / Plus

                                                                         
Query: 140   acaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcg 199
             ||||||||||||||  ||||||| || |||||||| || ||||| | ||||||||| || 
Sbjct: 65572 acaaagttggtggcataggcccaggcattgttgttaactgggtcagaaaggtggtctgca 65631

                                                                         
Query: 200   aggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggag 259
             ||||||||||| || ||||| || || ||||| || || || || || || ||||| |||
Sbjct: 65632 aggttctccaaaggcccctttccggtcacaatagcttgaacaaagaatccaaacattgag 65691

                                                                         
Query: 260   aacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcgggg 319
             |||||||| |  | ||| |||||||  |||||||| || ||||| || || ||||| |||
Sbjct: 65692 aacatggccaaccttccattcttgagttccttcactttaagctcagcaaaagcctctggg 65751

                                                                
Query: 320   tcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcg 370
             || || || ||||| |  ||||| ||||| ||||| |||||||| ||||||
Sbjct: 65752 tcatcagcaaggcccaatgggtcaaagctgccacctgggtagagtgggtcg 65802
to top
>emb|Z75663.1|AGCHLABBP A.graveolens mRNA for chlorophyll a/b binding protein
          Length = 963

 Score =  170 bits (86), Expect = 4e-39
 Identities = 460/582 (79%), Gaps = 2/582 (0%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| |||||||| ||||| |||||||| || |||||||| || ||||| ||||
Sbjct: 835 actttccgggaacaaagttagtggcaaaggcccaggcattgttgttaacagggtctgcaa 776

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           ||||||| || | |||||| ||||| ||||| || || ||||| || || || || || |
Sbjct: 775 ggtggtcagccaagttctctaatggaccctttccggtcacaatagcttgtacaaagaatc 716

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggc-g 307
           | ||||||||||||||||| || | ||| || || | |||||||||||| ||||| || |
Sbjct: 715 caaacatggagaacatggctagtcttccatttttcagctccttcaccttaagctctgcag 656

                                                                       
Query: 308 aacgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagaggggg 367
           | ||| || ||||| || || ||||| |  ||||| ||||| || || ||||| ||||||
Sbjct: 655 atcgc-tctgggtcttcagcaaggcctaatgggtcaaagcttcctccagggtaaaggggg 597

                                                                       
Query: 368 tcgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagc 427
           ||||| || || || || || || || || |||||||| ||||| || |||||||| |  
Sbjct: 596 tcgacaatttcccctagtggtccaccagcaacacggtaaccctcaactgcgcccatcaag 537

                                                                       
Query: 428 acgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccg 487
           | ||| ||   ||||||||| |  |  ||||| ||||| ||||| | ||| ||||| || 
Sbjct: 536 atgacttgagtagcccagatagataatatgctttgtgcatggaccaagcttgggttaccc 477

                                                                       
Query: 488 aggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcg 547
           | |||||| || || |||||||||||||| || || || ||||| ||||| || ||||||
Sbjct: 476 aagtagtcaagtccaccctcgctgaagatttgtgatccagccttaaaccacactgcctcg 417

                                                                       
Query: 548 ccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagc 607
           || |||||||| || || || || |  ||||| |||||||| || || || || || |||
Sbjct: 416 ccaaacttgacaccattacgagccaagagctcagggaagacacacccaagggctccaagc 357

                                                                       
Query: 608 atggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcg 667
           |||||||| | | |||||||||| || || || |||||||||||||| ||||| ||||| 
Sbjct: 356 atggcccatctggagtggatcacttcaagttcacggttcttggcaaaagtctcagggtca 297

                                                     
Query: 668 gcagagagccccgcagtgtcccatccgtagtcaccgggaaac 709
           || || ||||| ||||||||||| || |||||||| ||||||
Sbjct: 296 gccgaaagcccagcagtgtcccagccatagtcacctggaaac 255
to top
>gb|M23532.1|PCPCBP P.patens major chlorophyll binding protein gene, complete cds
          Length = 2544

 Score =  170 bits (86), Expect = 4e-39
 Identities = 287/354 (81%)
 Strand = Plus / Minus

                                                                        
Query: 202  gttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaa 261
            |||||||||||||||||| || || || || ||||||||||| || |||||||| || ||
Sbjct: 2368 gttctccaatgggccctttccggtcacgatcgcctgcacgaagaacccgaacatcgaaaa 2309

                                                                        
Query: 262  catggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtc 321
            ||| || |  || ||||| ||||||||||||||||| | ||| |||||||  || |||||
Sbjct: 2308 catcgccaatcgcccgtttttgatctccttcaccttcaactctgcgaacgtgtccgggtc 2249

                                                                        
Query: 322  gtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcgacgatctcgcc 381
            ||| || |  || |||||||||||    || || ||||||| ||||||    | ||||||
Sbjct: 2248 gtcagccaaacccagggggtcgaatgagcctccagggtagatggggtccgtcacctcgcc 2189

                                                                        
Query: 382  gagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacctggcaagc 441
             | ||| || || || |||||||| ||||| ||||| ||||| ||||| |||||||| ||
Sbjct: 2188 caacggtcctcccgcaacacggtacccctccacggctcccatcagcaccacctggcatgc 2129

                                                                        
Query: 442  ccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggcc 501
            |||||| || |  |||||||| ||||| || |||||||||||||| |||||||| |  ||
Sbjct: 2128 ccagatcgccaaaatgctctgagcgtgcaccaggctggggttgcccaggtagtccaaccc 2069

                                                                  
Query: 502  gccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaactt 555
             ||||||||||||||||| |  |||||||||||||| || ||||||||||||||
Sbjct: 2068 cccctcgctgaagatctgagctccggccttgaaccacaccgcctcgccgaactt 2015



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                        
Query: 622  gtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccccgc 681
            |||||| ||||||||||||| ||||  ||| || ||||| ||||| |  || || || ||
Sbjct: 1948 gtggatgacctccagctccctgttccgggcgaacgtctccgggtctgacgacagtccagc 1889

                                   
Query: 682  agtgtcccatccgtagtcaccgg 704
             ||||||||||||||||| ||||
Sbjct: 1888 ggtgtcccatccgtagtcgccgg 1866
to top
>emb|X16536.1|GMCAB5 G.max DNA for Cab5
          Length = 1467

 Score =  165 bits (83), Expect = 2e-37
 Identities = 218/263 (82%)
 Strand = Plus / Minus

                                                                       
Query: 440 gcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgagg 499
           ||||||||||| || ||||| ||||| ||||  ||||| |||||||| | |||||| || 
Sbjct: 809 gcccagatggcaagaatgctttgtgcatggatcaggcttgggttgcccaagtagtcaagc 750

                                                                       
Query: 500 ccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacg 559
           || ||||| ||||| ||||| || |||||||||||||| ||||| || ||||||||||| 
Sbjct: 749 ccaccctcactgaatatctgagacccggccttgaaccacacggcttcaccgaacttgaca 690

                                                                       
Query: 560 ccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccgg 619
           ||||||||||| |  || |||||||| || ||||| || || || | ||||||||| | |
Sbjct: 689 ccgttgcgggccaagagttcggggaaaacacagcccagggctcccaacatggcccatctg 630

                                                                       
Query: 620 cagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagcccc 679
            ||||||| || || || || |||||||||||||||||||| ||||| ||||| ||||| 
Sbjct: 629 gagtggatgacttcaagttcacggttcttggcaaaggtctctgggtcagcagaaagccca 570

                                  
Query: 680 gcagtgtcccatccgtagtcacc 702
           ||||||||||| || ||||||||
Sbjct: 569 gcagtgtcccaaccatagtcacc 547



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 111/139 (79%)
 Strand = Plus / Minus

                                                                        
Query: 129  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
            |||| ||||| |||||||| || ||  ||||||| || || ||||| || ||||| || |
Sbjct: 1120 actttccggggacaaagtttgtagcataggcccaggcattattgtttactgggtcagcta 1061

                                                                        
Query: 189  ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
            ||||||| || || || ||||| || ||||| || || ||||| ||||| || || || |
Sbjct: 1060 ggtggtcagcaagattttccaaaggtccctttcctgtcacaattgcctgaacaaagaaac 1001

                               
Query: 249  cgaacatggagaacatggc 267
            | |||||||||||||||||
Sbjct: 1000 caaacatggagaacatggc 982
to top
>gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding protein of LHCII type I
           precursor (CAB) mRNA, nuclear gene encoding chloroplast
           protein, complete cds
          Length = 1015

 Score =  165 bits (83), Expect = 2e-37
 Identities = 224/271 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgag 498
           |||||| ||||| | ||||||||| || ||||| | ||| |||||||| | |||||| ||
Sbjct: 512 agcccatatggccaagatgctctgggcatggaccaagcttgggttgcccaagtagtcaag 453

                                                                       
Query: 499 gccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgac 558
            || || ||||||||||| ||||| |||||||||||||| |||||||| ||||| |||||
Sbjct: 452 cccaccttcgctgaagatttgggatccggccttgaaccacacggcctcaccgaatttgac 393

                                                                       
Query: 559 gccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccg 618
            ||||| || || |  |||||||||||||| || || || || || ||||||||||| | 
Sbjct: 392 accgttacgagccaagagctcggggaagacacatccaagggctccaagcatggcccatct 333

                                                                       
Query: 619 gcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccc 678
           || ||| |||||||| ||||| ||||||||||| || |||||||| || ||||| || ||
Sbjct: 332 gctgtgaatcacctcaagctcacggttcttggcgaatgtctcgggatcagcagaaaggcc 273

                                          
Query: 679 cgcagtgtcccatccgtagtcaccgggaaac 709
            ||||||||||| ||||| ||||| ||||||
Sbjct: 272 agcagtgtcccaaccgtaatcacctggaaac 242



 Score =  141 bits (71), Expect = 4e-30
 Identities = 191/231 (82%)
 Strand = Plus / Minus

                                                                       
Query: 127 ttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 186
           |||||| ||||| ||||||||||||||  ||||||| || |||||||| || || || ||
Sbjct: 824 ttactttccggggacaaagttggtggcataggcccatgcattgttgttcactggatcagc 765

                                                                       
Query: 187 aaggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaa 246
           |||| ||||||| |||||||||||||||||||| || || ||||||||||| || || ||
Sbjct: 764 aagggggtcggctaggttctccaatgggccctttcctgtaacaatggcctgaacaaagaa 705

                                                                       
Query: 247 gccgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggc 306
            || ||||||||||||||||| || | ||| |||||||  ||||| ||||| ||||| ||
Sbjct: 704 accaaacatggagaacatggcgagccttccattcttgagttccttaaccttaagctcagc 645

                                                              
Query: 307 gaacgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggg 357
            || || || ||||| || || ||||| | |||||||||||| || |||||
Sbjct: 644 aaaggcttctgggtcttcagcaaggcccaaggggtcgaagcttcctccggg 594
to top
>gb|K00976.1|PETCAB102 Petunia major chlorophyll a/b binding protein (Cab) clone pCab102,
           3' end and flank
          Length = 302

 Score =  163 bits (82), Expect = 1e-36
 Identities = 154/178 (86%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| |||||||| ||||| ||||||||||| |||||||| |||||||| ||||
Sbjct: 187 actttccgggaacaaagtttgtggcaaaggcccacgcattgttgttaacggggtcagcaa 128

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           ||||||| ||||||||||||||||| || || ||||||||||| || ||||| || || |
Sbjct: 127 ggtggtcagcgaggttctccaatggaccttttccagtgacaatagcttgcacaaagaatc 68

                                                                     
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggc 306
           | ||||||||||||   ||||| |  || |||||||||||||||||||||||||||||
Sbjct: 67  caaacatggagaacgcagcaagtctaccattcttgatctccttcaccttgagctcggc 10
to top
>gb|AF479778.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m9 (Lhcbm9) mRNA, complete cds
          Length = 1221

 Score =  161 bits (81), Expect = 4e-36
 Identities = 296/357 (82%), Gaps = 8/357 (2%)
 Strand = Plus / Minus

                                                                       
Query: 212 gggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatggcaagg 271
           ||||||||||| || ||||||||||| ||||| ||||||||    ||||||||||| |||
Sbjct: 708 gggcccttgccggtcacaatggcctggacgaagaagccgaaggacgagaacatggccagg 649

                                                                       
Query: 272 cgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcggcgagg 331
           || ||||||||||||||||||||||| ||||| ||||| |  ||||||||||| || |||
Sbjct: 648 cggccgttcttgatctccttcaccttcagctcagcgaaggtgtcggggtcgtcagccagg 589

                                                                       
Query: 332 ccgagggggtcgaagctac-caccggggtagagggggtcgacgatctcgccgagc-gggc 389
           || ||||||||||| | || | |||||||| |||||||| | |  |||||| ||| ||||
Sbjct: 588 cccagggggtcgaa-cgactcgccggggtacagggggtccaggccctcgcc-agcggggc 531

                                                                       
Query: 390 cgccggcgacacggtagccctcgacggcgcccatgagcacgacctggcaagccca-gatg 448
           |||||   || ||||||||||||||   |||||  || ||||||| ||| | ||| | ||
Sbjct: 530 cgccgttaacgcggtagccctcgaccaggcccagcaggacgacct-gcacggccagggtg 472

                                                                       
Query: 449 gcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcg 508
           |||| |||| |||| |||||||  |||  ||||||||| |||||||  || |||||||| 
Sbjct: 471 gcgacgatgttctgggcgtggatcagggaggggttgcccaggtagttcagaccgccctc- 413

                                                                    
Query: 509 ctg-aagatctgggagccggccttgaaccagacggcctcgccgaacttgacgccgtt 564
           ||| |||||||||| ||||||||||||||| |||||||||||||||| ||| |||||
Sbjct: 412 ctgaaagatctgggcgccggccttgaaccacacggcctcgccgaactggacaccgtt 356



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 653 aaggtctcggggtcggcagagagccccgcagtgtcccatccgtagtcaccggg 705
           |||||||| ||||| || || || || ||||||||||| |||||||| |||||
Sbjct: 267 aaggtctccgggtcagccgacagaccggcagtgtcccagccgtagtcgccggg 215
to top
>gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/b-binding protein
           (CipLhcb1*2) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 932

 Score =  161 bits (81), Expect = 4e-36
 Identities = 126/141 (89%)
 Strand = Plus / Minus

                                                                       
Query: 127 ttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 186
           |||||| || || ||||||||||||||| ||||||| |||||||||||||| ||||||||
Sbjct: 851 ttactttccagggacaaagttggtggcgtaggcccaggcgttgttgttgacagggtcggc 792

                                                                       
Query: 187 aaggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaa 246
           |||||| ||||||||||||||||| || |||||||||||||||||||| || ||||| ||
Sbjct: 791 aaggtgatcggcgaggttctccaaaggtcccttgccagtgacaatggcttgaacgaagaa 732

                                
Query: 247 gccgaacatggagaacatggc 267
            || || ||||||||||||||
Sbjct: 731 accaaatatggagaacatggc 711



 Score =  109 bits (55), Expect = 1e-20
 Identities = 211/263 (80%)
 Strand = Plus / Minus

                                                                       
Query: 440 gcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgagg 499
           ||||||||||| |||||||||||||| ||||  ||||| |||||||| | |||||| || 
Sbjct: 538 gcccagatggcaaggatgctctgtgcatggatcaggcttgggttgcccaagtagtcaagc 479

                                                                       
Query: 500 ccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacg 559
           || ||||| ||||| ||||| || || ||||||||||| || ||||| |||||||| || 
Sbjct: 478 ccaccctcactgaatatctgagacccagccttgaaccacaccgcctccccgaacttcaca 419

                                                                       
Query: 560 ccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccgg 619
           ||||| ||||| | ||| || ||||| || || || |  || || | ||| ||||| || 
Sbjct: 418 ccgttccgggccaacagttcagggaacacacaccccaaagcccccaacatcgcccatcga 359

                                                                       
Query: 620 cagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagcccc 679
            |||||||||| ||||| || ||||||   ||||| ||||| ||||| || || ||||| 
Sbjct: 358 gagtggatcacttccagttcacggttccgagcaaatgtctccgggtcagccgaaagcccg 299

                                  
Query: 680 gcagtgtcccatccgtagtcacc 702
           ||||||||||| || ||||||||
Sbjct: 298 gcagtgtcccacccatagtcacc 276
to top
>gb|M30618.1|TOMCBPD2 Tomato chlorophyll a/b-binding protein Cab-1C gene, 3' end
          Length = 351

 Score =  161 bits (81), Expect = 4e-36
 Identities = 273/337 (81%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| |||||||| ||||| || ||||| ||||||||||| || ||||| ||||
Sbjct: 349 actttccgggaacaaagtttgtggcaaaagcccaggcgttgttgtttactgggtctgcaa 290

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           |||| || || |||||||||||||| ||||| || || |||||||| || || || || |
Sbjct: 289 ggtgatcagcaaggttctccaatggaccctttccggtaacaatggcttgaacaaagaatc 230

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| ||||| |  ||||||||||||||||| ||||||||||| || |
Sbjct: 229 caaacatagagaacatagcaagtctaccgttcttgatctcctttaccttgagctcagcaa 170

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           | ||||| ||||| || || ||||| |  ||||||||||| ||||| |||||||| ||||
Sbjct: 169 atgcctctgggtcttcagcaaggcctaatgggtcgaagcttccacctgggtagagtgggt 110

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           |||| | ||| || || || || || || | |||||| || || || || ||||| | ||
Sbjct: 109 cgacaacctcaccaagaggtccaccagcaatacggtaaccttcaacagctcccatcaaca 50

                                                
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgc 465
           | || ||||||||||| ||||| | |||||| |||||
Sbjct: 49  caacttggcaagcccaaatggccaagatgctttgtgc 13
to top
>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.3 mRNA, complete cds
          Length = 3299

 Score =  159 bits (80), Expect = 2e-35
 Identities = 194/232 (83%)
 Strand = Plus / Plus

                                                                        
Query: 129  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
            |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 2487 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 2546

                                                                        
Query: 189  ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
              |||||||||||||||||||| || ||||| || ||||| ||||| || ||||| || |
Sbjct: 2547 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatc 2606

                                                                        
Query: 249  cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
            | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 2607 caaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactctgcga 2666

                                                                
Query: 309  acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
            | |||||||||||    |||||||| |  ||||||||||| ||||| |||||
Sbjct: 2667 aagcctcggggtcagtagcgaggcccaatgggtcgaagctgccacctgggta 2718



 Score =  141 bits (71), Expect = 4e-30
 Identities = 206/251 (82%)
 Strand = Plus / Plus

                                                                        
Query: 455  atgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaag 514
            |||||||| |||||||| | ||| |||||||| | |||||| |  || || |||||||||
Sbjct: 2777 atgctctgagcgtggaccaagctcgggttgcccaagtagtccaatcctccgtcgctgaag 2836

                                                                        
Query: 515  atctgggagccggccttgaaccagacggcctcgccgaacttgacgccgttgcgggcgagc 574
            ||||| || |||||||||||||| || || || |||||||| || ||||| |  || |  
Sbjct: 2837 atctgtgaaccggccttgaaccaaaccgcttctccgaacttcactccgttcctagccaat 2896

                                                                        
Query: 575  agctcggggaagacgcagccgagcgcgccgagcatggcccaccggcagtggatcacctcc 634
            ||||| ||||| |||||||| || || |||||||||||||| | || |||||| || || 
Sbjct: 2897 agctcagggaaaacgcagcctagggctccgagcatggcccatctgctgtggataacttct 2956

                                                                        
Query: 635  agctcccggttcttggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccg 694
            ||||| |||||| |||| |||||||| |||||||| || || || || ||||||||||||
Sbjct: 2957 agctcacggttcctggcgaaggtctctgggtcggcggatagaccagcggtgtcccatccg 3016

                       
Query: 695  tagtcaccggg 705
            |||||||||||
Sbjct: 3017 tagtcaccggg 3027
to top
>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.2 mRNA, complete cds
          Length = 3338

 Score =  159 bits (80), Expect = 2e-35
 Identities = 194/232 (83%)
 Strand = Plus / Plus

                                                                        
Query: 129  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
            |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 2487 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 2546

                                                                        
Query: 189  ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
              |||||||||||||||||||| || ||||| || ||||| ||||| || ||||| || |
Sbjct: 2547 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatc 2606

                                                                        
Query: 249  cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
            | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 2607 caaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactctgcga 2666

                                                                
Query: 309  acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
            | |||||||||||    |||||||| |  ||||||||||| ||||| |||||
Sbjct: 2667 aagcctcggggtcagtagcgaggcccaatgggtcgaagctgccacctgggta 2718



 Score =  149 bits (75), Expect = 1e-32
 Identities = 219/267 (82%)
 Strand = Plus / Plus

                                                                        
Query: 439  agcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgag 498
            |||||| ||||| | ||||||||| |||||||| | ||| |||||||| | |||||| | 
Sbjct: 2800 agcccaaatggctaagatgctctgagcgtggaccaagctcgggttgcccaagtagtccaa 2859

                                                                        
Query: 499  gccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgac 558
             || || |||||||||||||| || |||||||||||||| || || || |||||||| ||
Sbjct: 2860 tcctccgtcgctgaagatctgtgaaccggccttgaaccaaaccgcttctccgaacttcac 2919

                                                                        
Query: 559  gccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccg 618
             ||||| |  || |  ||||| ||||| |||||||| || || |||||||||||||| | 
Sbjct: 2920 tccgttcctagccaatagctcagggaaaacgcagcctagggctccgagcatggcccatct 2979

                                                                        
Query: 619  gcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccc 678
            || |||||| || || ||||| |||||| |||| |||||||| |||||||| || || ||
Sbjct: 2980 gctgtggataacttctagctcacggttcctggcgaaggtctctgggtcggcggatagacc 3039

                                       
Query: 679  cgcagtgtcccatccgtagtcaccggg 705
             || |||||||||||||||||||||||
Sbjct: 3040 agcggtgtcccatccgtagtcaccggg 3066
to top
>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2)
           transcript variant AT2G34420.1 mRNA, complete cds
          Length = 1354

 Score =  159 bits (80), Expect = 2e-35
 Identities = 194/232 (83%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 851 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 792

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             |||||||||||||||||||| || ||||| || ||||| ||||| || ||||| || |
Sbjct: 791 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatc 732

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 731 caaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactctgcga 672

                                                               
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
           | |||||||||||    |||||||| |  ||||||||||| ||||| |||||
Sbjct: 671 aagcctcggggtcagtagcgaggcccaatgggtcgaagctgccacctgggta 620



 Score =  149 bits (75), Expect = 1e-32
 Identities = 219/267 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgag 498
           |||||| ||||| | ||||||||| |||||||| | ||| |||||||| | |||||| | 
Sbjct: 538 agcccaaatggctaagatgctctgagcgtggaccaagctcgggttgcccaagtagtccaa 479

                                                                       
Query: 499 gccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgac 558
            || || |||||||||||||| || |||||||||||||| || || || |||||||| ||
Sbjct: 478 tcctccgtcgctgaagatctgtgaaccggccttgaaccaaaccgcttctccgaacttcac 419

                                                                       
Query: 559 gccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccg 618
            ||||| |  || |  ||||| ||||| |||||||| || || |||||||||||||| | 
Sbjct: 418 tccgttcctagccaatagctcagggaaaacgcagcctagggctccgagcatggcccatct 359

                                                                       
Query: 619 gcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccc 678
           || |||||| || || ||||| |||||| |||| |||||||| |||||||| || || ||
Sbjct: 358 gctgtggataacttctagctcacggttcctggcgaaggtctctgggtcggcggatagacc 299

                                      
Query: 679 cgcagtgtcccatccgtagtcaccggg 705
            || |||||||||||||||||||||||
Sbjct: 298 agcggtgtcccatccgtagtcaccggg 272
to top
>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant
           AT2G34420.2 mRNA, complete cds
          Length = 1312

 Score =  159 bits (80), Expect = 2e-35
 Identities = 194/232 (83%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 809 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 750

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             |||||||||||||||||||| || ||||| || ||||| ||||| || ||||| || |
Sbjct: 749 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatc 690

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 689 caaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactctgcga 630

                                                               
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
           | |||||||||||    |||||||| |  ||||||||||| ||||| |||||
Sbjct: 629 aagcctcggggtcagtagcgaggcccaatgggtcgaagctgccacctgggta 578



 Score =  133 bits (67), Expect = 9e-28
 Identities = 202/247 (81%)
 Strand = Plus / Minus

                                                                       
Query: 459 tctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaagatct 518
           |||| |||||||| | ||| |||||||| | |||||| |  || || |||||||||||||
Sbjct: 518 tctgagcgtggaccaagctcgggttgcccaagtagtccaatcctccgtcgctgaagatct 459

                                                                       
Query: 519 gggagccggccttgaaccagacggcctcgccgaacttgacgccgttgcgggcgagcagct 578
           | || |||||||||||||| || || || |||||||| || ||||| |  || |  ||||
Sbjct: 458 gtgaaccggccttgaaccaaaccgcttctccgaacttcactccgttcctagccaatagct 399

                                                                       
Query: 579 cggggaagacgcagccgagcgcgccgagcatggcccaccggcagtggatcacctccagct 638
           | ||||| |||||||| || || |||||||||||||| | || |||||| || || ||||
Sbjct: 398 cagggaaaacgcagcctagggctccgagcatggcccatctgctgtggataacttctagct 339

                                                                       
Query: 639 cccggttcttggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccgtagt 698
           | |||||| |||| |||||||| |||||||| || || || || ||||||||||||||||
Sbjct: 338 cacggttcctggcgaaggtctctgggtcggcggatagaccagcggtgtcccatccgtagt 279

                  
Query: 699 caccggg 705
           |||||||
Sbjct: 278 caccggg 272
to top
>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 829

 Score =  159 bits (80), Expect = 2e-35
 Identities = 194/232 (83%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 737

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             |||||||||||||||||||| || ||||| || ||||| ||||| || ||||| || |
Sbjct: 736 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatc 677

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 676 caaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactctgcga 617

                                                               
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
           | |||||||||||    |||||||| |  ||||||||||| ||||| |||||
Sbjct: 616 aagcctcggggtcagtagcgaggcccaatgggtcgaagctgccacctgggta 565



 Score =  149 bits (75), Expect = 1e-32
 Identities = 219/267 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgag 498
           |||||| ||||| | ||||||||| |||||||| | ||| |||||||| | |||||| | 
Sbjct: 483 agcccaaatggctaagatgctctgagcgtggaccaagctcgggttgcccaagtagtccaa 424

                                                                       
Query: 499 gccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgac 558
            || || |||||||||||||| || |||||||||||||| || || || |||||||| ||
Sbjct: 423 tcctccgtcgctgaagatctgtgaaccggccttgaaccaaaccgcttctccgaacttcac 364

                                                                       
Query: 559 gccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccg 618
            ||||| |  || |  ||||| ||||| |||||||| || || |||||||||||||| | 
Sbjct: 363 tccgttcctagccaatagctcagggaaaacgcagcctagggctccgagcatggcccatct 304

                                                                       
Query: 619 gcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccc 678
           || |||||| || || ||||| |||||| |||| |||||||| |||||||| || || ||
Sbjct: 303 gctgtggataacttctagctcacggttcctggcgaaggtctctgggtcggcggatagacc 244

                                      
Query: 679 cgcagtgtcccatccgtagtcaccggg 705
            || |||||||||||||||||||||||
Sbjct: 243 agcggtgtcccatccgtagtcaccggg 217
to top
>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 1015

 Score =  159 bits (80), Expect = 2e-35
 Identities = 194/232 (83%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 851 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 792

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             |||||||||||||||||||| || ||||| || ||||| ||||| || ||||| || |
Sbjct: 791 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatc 732

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 731 caaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactctgcga 672

                                                               
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
           | |||||||||||    |||||||| |  ||||||||||| ||||| |||||
Sbjct: 671 aagcctcggggtcagtagcgaggcccaatgggtcgaagctgccacctgggta 620



 Score =  149 bits (75), Expect = 1e-32
 Identities = 219/267 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgag 498
           |||||| ||||| | ||||||||| |||||||| | ||| |||||||| | |||||| | 
Sbjct: 538 agcccaaatggctaagatgctctgagcgtggaccaagctcgggttgcccaagtagtccaa 479

                                                                       
Query: 499 gccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgac 558
            || || |||||||||||||| || |||||||||||||| || || || |||||||| ||
Sbjct: 478 tcctccgtcgctgaagatctgtgaaccggccttgaaccaaaccgcttctccgaacttcac 419

                                                                       
Query: 559 gccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccg 618
            ||||| |  || |  ||||| ||||| |||||||| || || |||||||||||||| | 
Sbjct: 418 tccgttcctagccaatagctcagggaaaacgcagcctagggctccgagcatggcccatct 359

                                                                       
Query: 619 gcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccc 678
           || |||||| || || ||||| |||||| |||| |||||||| |||||||| || || ||
Sbjct: 358 gctgtggataacttctagctcacggttcctggcgaaggtctctgggtcggcggatagacc 299

                                      
Query: 679 cgcagtgtcccatccgtagtcaccggg 705
            || |||||||||||||||||||||||
Sbjct: 298 agcggtgtcccatccgtagtcaccggg 272
to top
>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete
             sequence
          Length = 112763

 Score =  159 bits (80), Expect = 2e-35
 Identities = 194/232 (83%)
 Strand = Plus / Plus

                                                                         
Query: 129   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
             |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 93205 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 93264

                                                                         
Query: 189   ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
               |||||||||||||||||||| || ||||| || ||||| ||||| || ||||| || |
Sbjct: 93265 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatc 93324

                                                                         
Query: 249   cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
             | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 93325 caaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactctgcga 93384

                                                                 
Query: 309   acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
             | |||||||||||    |||||||| |  ||||||||||| ||||| |||||
Sbjct: 93385 aagcctcggggtcagtagcgaggcccaatgggtcgaagctgccacctgggta 93436



 Score =  149 bits (75), Expect = 1e-32
 Identities = 219/267 (82%)
 Strand = Plus / Plus

                                                                         
Query: 439   agcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgag 498
             |||||| ||||| | ||||||||| |||||||| | ||| |||||||| | |||||| | 
Sbjct: 93518 agcccaaatggctaagatgctctgagcgtggaccaagctcgggttgcccaagtagtccaa 93577

                                                                         
Query: 499   gccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgac 558
              || || |||||||||||||| || |||||||||||||| || || || |||||||| ||
Sbjct: 93578 tcctccgtcgctgaagatctgtgaaccggccttgaaccaaaccgcttctccgaacttcac 93637

                                                                         
Query: 559   gccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccg 618
              ||||| |  || |  ||||| ||||| |||||||| || || |||||||||||||| | 
Sbjct: 93638 tccgttcctagccaatagctcagggaaaacgcagcctagggctccgagcatggcccatct 93697

                                                                         
Query: 619   gcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccc 678
             || |||||| || || ||||| |||||| |||| |||||||| |||||||| || || ||
Sbjct: 93698 gctgtggataacttctagctcacggttcctggcgaaggtctctgggtcggcggatagacc 93757

                                        
Query: 679   cgcagtgtcccatccgtagtcaccggg 705
              || |||||||||||||||||||||||
Sbjct: 93758 agcggtgtcccatccgtagtcaccggg 93784



 Score =  143 bits (72), Expect = 9e-31
 Identities = 192/232 (82%)
 Strand = Plus / Minus

                                                                         
Query: 129   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
             |||| ||||| || |||||||| ||||||||||| || ||||||||||| || || || |
Sbjct: 96103 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 96044

                                                                         
Query: 189   ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
              |||||| |||||||||||||| || ||||| || |||||||||||||| ||||| || |
Sbjct: 96043 agtggtccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaatc 95984

                                                                         
Query: 249   cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
             | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 95983 caaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactccgcga 95924

                                                                 
Query: 309   acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
             | |||||||||||    |||||||| |  ||||||||||| ||||| |||||
Sbjct: 95923 aagcctcggggtcagtagcgaggcccaatgggtcgaagctcccacctgggta 95872



 Score =  125 bits (63), Expect = 2e-25
 Identities = 216/267 (80%)
 Strand = Plus / Minus

                                                                         
Query: 439   agcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgag 498
             |||||| ||||| | ||||||||| |||||||| | ||| |||||||| | |||||| | 
Sbjct: 95790 agcccaaatggctaagatgctctgagcgtggaccaagctcgggttgcccaagtagtccaa 95731

                                                                         
Query: 499   gccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgac 558
              || || |||||||||||||| || || ||||||||||| || || || |||||||| ||
Sbjct: 95730 tcctccgtcgctgaagatctgtgaaccagccttgaaccaaaccgcttctccgaacttcac 95671

                                                                         
Query: 559   gccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccg 618
              ||||| |  || |  ||||| ||||| |||||||| || || |||||||||||||| | 
Sbjct: 95670 tccgttcctagccaatagctcagggaaaacgcagcctagggctccgagcatggcccatct 95611

                                                                         
Query: 619   gcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccc 678
             || |||||| || || ||||| |||||| | || ||||||||||| ||||| || || ||
Sbjct: 95610 gctgtggataacttctagctcacggttcctagcgaaggtctcgggatcggcggatagacc 95551

                                        
Query: 679   cgcagtgtcccatccgtagtcaccggg 705
              ||||||||||| ||||| ||||||||
Sbjct: 95550 ggcagtgtcccacccgtaatcaccggg 95524
to top
>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete
             sequence
          Length = 93060

 Score =  159 bits (80), Expect = 2e-35
 Identities = 194/232 (83%)
 Strand = Plus / Minus

                                                                         
Query: 129   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
             |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 80997 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 80938

                                                                         
Query: 189   ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
               |||||||||||||||||||| || ||||| || ||||| ||||| || ||||| || |
Sbjct: 80937 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatc 80878

                                                                         
Query: 249   cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
             | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 80877 caaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactctgcga 80818

                                                                 
Query: 309   acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
             | |||||||||||    |||||||| |  ||||||||||| ||||| |||||
Sbjct: 80817 aagcctcggggtcagtagcgaggcccaatgggtcgaagctgccacctgggta 80766



 Score =  149 bits (75), Expect = 1e-32
 Identities = 219/267 (82%)
 Strand = Plus / Minus

                                                                         
Query: 439   agcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgag 498
             |||||| ||||| | ||||||||| |||||||| | ||| |||||||| | |||||| | 
Sbjct: 80684 agcccaaatggctaagatgctctgagcgtggaccaagctcgggttgcccaagtagtccaa 80625

                                                                         
Query: 499   gccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgac 558
              || || |||||||||||||| || |||||||||||||| || || || |||||||| ||
Sbjct: 80624 tcctccgtcgctgaagatctgtgaaccggccttgaaccaaaccgcttctccgaacttcac 80565

                                                                         
Query: 559   gccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccg 618
              ||||| |  || |  ||||| ||||| |||||||| || || |||||||||||||| | 
Sbjct: 80564 tccgttcctagccaatagctcagggaaaacgcagcctagggctccgagcatggcccatct 80505

                                                                         
Query: 619   gcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccc 678
             || |||||| || || ||||| |||||| |||| |||||||| |||||||| || || ||
Sbjct: 80504 gctgtggataacttctagctcacggttcctggcgaaggtctctgggtcggcggatagacc 80445

                                        
Query: 679   cgcagtgtcccatccgtagtcaccggg 705
              || |||||||||||||||||||||||
Sbjct: 80444 agcggtgtcccatccgtagtcaccggg 80418



 Score =  143 bits (72), Expect = 9e-31
 Identities = 192/232 (82%)
 Strand = Plus / Plus

                                                                         
Query: 129   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
             |||| ||||| || |||||||| ||||||||||| || ||||||||||| || || || |
Sbjct: 78099 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 78158

                                                                         
Query: 189   ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
              |||||| |||||||||||||| || ||||| || |||||||||||||| ||||| || |
Sbjct: 78159 agtggtccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaatc 78218

                                                                         
Query: 249   cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
             | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 78219 caaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactccgcga 78278

                                                                 
Query: 309   acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
             | |||||||||||    |||||||| |  ||||||||||| ||||| |||||
Sbjct: 78279 aagcctcggggtcagtagcgaggcccaatgggtcgaagctcccacctgggta 78330



 Score =  125 bits (63), Expect = 2e-25
 Identities = 216/267 (80%)
 Strand = Plus / Plus

                                                                         
Query: 439   agcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgag 498
             |||||| ||||| | ||||||||| |||||||| | ||| |||||||| | |||||| | 
Sbjct: 78412 agcccaaatggctaagatgctctgagcgtggaccaagctcgggttgcccaagtagtccaa 78471

                                                                         
Query: 499   gccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgac 558
              || || |||||||||||||| || || ||||||||||| || || || |||||||| ||
Sbjct: 78472 tcctccgtcgctgaagatctgtgaaccagccttgaaccaaaccgcttctccgaacttcac 78531

                                                                         
Query: 559   gccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccg 618
              ||||| |  || |  ||||| ||||| |||||||| || || |||||||||||||| | 
Sbjct: 78532 tccgttcctagccaatagctcagggaaaacgcagcctagggctccgagcatggcccatct 78591

                                                                         
Query: 619   gcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccc 678
             || |||||| || || ||||| |||||| | || ||||||||||| ||||| || || ||
Sbjct: 78592 gctgtggataacttctagctcacggttcctagcgaaggtctcgggatcggcggatagacc 78651

                                        
Query: 679   cgcagtgtcccatccgtagtcaccggg 705
              ||||||||||| ||||| ||||||||
Sbjct: 78652 ggcagtgtcccacccgtaatcaccggg 78678
to top
>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420) mRNA, complete cds
          Length = 883

 Score =  159 bits (80), Expect = 2e-35
 Identities = 194/232 (83%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 737

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             |||||||||||||||||||| || ||||| || ||||| ||||| || ||||| || |
Sbjct: 736 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatc 677

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 676 caaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactctgcga 617

                                                               
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
           | |||||||||||    |||||||| |  ||||||||||| ||||| |||||
Sbjct: 616 aagcctcggggtcagtagcgaggcccaatgggtcgaagctgccacctgggta 565



 Score =  149 bits (75), Expect = 1e-32
 Identities = 219/267 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgag 498
           |||||| ||||| | ||||||||| |||||||| | ||| |||||||| | |||||| | 
Sbjct: 483 agcccaaatggctaagatgctctgagcgtggaccaagctcgggttgcccaagtagtccaa 424

                                                                       
Query: 499 gccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgac 558
            || || |||||||||||||| || |||||||||||||| || || || |||||||| ||
Sbjct: 423 tcctccgtcgctgaagatctgtgaaccggccttgaaccaaaccgcttctccgaacttcac 364

                                                                       
Query: 559 gccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccg 618
            ||||| |  || |  ||||| ||||| |||||||| || || |||||||||||||| | 
Sbjct: 363 tccgttcctagccaatagctcagggaaaacgcagcctagggctccgagcatggcccatct 304

                                                                       
Query: 619 gcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccc 678
           || |||||| || || ||||| |||||| |||| |||||||| |||||||| || || ||
Sbjct: 303 gctgtggataacttctagctcacggttcctggcgaaggtctctgggtcggcggatagacc 244

                                      
Query: 679 cgcagtgtcccatccgtagtcaccggg 705
            || |||||||||||||||||||||||
Sbjct: 243 agcggtgtcccatccgtagtcaccggg 217
to top
>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score =  159 bits (80), Expect = 2e-35
 Identities = 194/232 (83%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 737

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             |||||||||||||||||||| || ||||| || ||||| ||||| || ||||| || |
Sbjct: 736 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatc 677

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 676 caaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactctgcga 617

                                                               
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
           | |||||||||||    |||||||| |  ||||||||||| ||||| |||||
Sbjct: 616 aagcctcggggtcagtagcgaggcccaatgggtcgaagctgccacctgggta 565



 Score =  149 bits (75), Expect = 1e-32
 Identities = 219/267 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgag 498
           |||||| ||||| | ||||||||| |||||||| | ||| |||||||| | |||||| | 
Sbjct: 483 agcccaaatggctaagatgctctgagcgtggaccaagctcgggttgcccaagtagtccaa 424

                                                                       
Query: 499 gccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgac 558
            || || |||||||||||||| || |||||||||||||| || || || |||||||| ||
Sbjct: 423 tcctccgtcgctgaagatctgtgaaccggccttgaaccaaaccgcttctccgaacttcac 364

                                                                       
Query: 559 gccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccg 618
            ||||| |  || |  ||||| ||||| |||||||| || || |||||||||||||| | 
Sbjct: 363 tccgttcctagccaatagctcagggaaaacgcagcctagggctccgagcatggcccatct 304

                                                                       
Query: 619 gcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccc 678
           || |||||| || || ||||| |||||| |||| |||||||| |||||||| || || ||
Sbjct: 303 gctgtggataacttctagctcacggttcctggcgaaggtctctgggtcggcggatagacc 244

                                      
Query: 679 cgcagtgtcccatccgtagtcaccggg 705
            || |||||||||||||||||||||||
Sbjct: 243 agcggtgtcccatccgtagtcaccggg 217
to top
>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score =  159 bits (80), Expect = 2e-35
 Identities = 194/232 (83%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 737

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             |||||||||||||||||||| || ||||| || ||||| ||||| || ||||| || |
Sbjct: 736 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatc 677

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 676 caaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactctgcga 617

                                                               
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
           | |||||||||||    |||||||| |  ||||||||||| ||||| |||||
Sbjct: 616 aagcctcggggtcagtagcgaggcccaatgggtcgaagctgccacctgggta 565



 Score =  149 bits (75), Expect = 1e-32
 Identities = 219/267 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgag 498
           |||||| ||||| | ||||||||| |||||||| | ||| |||||||| | |||||| | 
Sbjct: 483 agcccaaatggctaagatgctctgagcgtggaccaagctcgggttgcccaagtagtccaa 424

                                                                       
Query: 499 gccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgac 558
            || || |||||||||||||| || |||||||||||||| || || || |||||||| ||
Sbjct: 423 tcctccgtcgctgaagatctgtgaaccggccttgaaccaaaccgcttctccgaacttcac 364

                                                                       
Query: 559 gccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccg 618
            ||||| |  || |  ||||| ||||| |||||||| || || |||||||||||||| | 
Sbjct: 363 tccgttcctagccaatagctcagggaaaacgcagcctagggctccgagcatggcccatct 304

                                                                       
Query: 619 gcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccc 678
           || |||||| || || ||||| |||||| |||| |||||||| |||||||| || || ||
Sbjct: 303 gctgtggataacttctagctcacggttcctggcgaaggtctctgggtcggcggatagacc 244

                                      
Query: 679 cgcagtgtcccatccgtagtcaccggg 705
            || |||||||||||||||||||||||
Sbjct: 243 agcggtgtcccatccgtagtcaccggg 217
to top
>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420; T31E10.24) mRNA, complete cds
          Length = 969

 Score =  159 bits (80), Expect = 2e-35
 Identities = 194/232 (83%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 788

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             |||||||||||||||||||| || ||||| || ||||| ||||| || ||||| || |
Sbjct: 787 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatc 728

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 727 caaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactctgcga 668

                                                               
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
           | |||||||||||    |||||||| |  ||||||||||| ||||| |||||
Sbjct: 667 aagcctcggggtcagtagcgaggcccaatgggtcgaagctgccacctgggta 616



 Score =  149 bits (75), Expect = 1e-32
 Identities = 219/267 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgag 498
           |||||| ||||| | ||||||||| |||||||| | ||| |||||||| | |||||| | 
Sbjct: 534 agcccaaatggctaagatgctctgagcgtggaccaagctcgggttgcccaagtagtccaa 475

                                                                       
Query: 499 gccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgac 558
            || || |||||||||||||| || |||||||||||||| || || || |||||||| ||
Sbjct: 474 tcctccgtcgctgaagatctgtgaaccggccttgaaccaaaccgcttctccgaacttcac 415

                                                                       
Query: 559 gccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccg 618
            ||||| |  || |  ||||| ||||| |||||||| || || |||||||||||||| | 
Sbjct: 414 tccgttcctagccaatagctcagggaaaacgcagcctagggctccgagcatggcccatct 355

                                                                       
Query: 619 gcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccc 678
           || |||||| || || ||||| |||||| |||| |||||||| |||||||| || || ||
Sbjct: 354 gctgtggataacttctagctcacggttcctggcgaaggtctctgggtcggcggatagacc 295

                                      
Query: 679 cgcagtgtcccatccgtagtcaccggg 705
            || |||||||||||||||||||||||
Sbjct: 294 agcggtgtcccatccgtagtcaccggg 268
to top
>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score =  159 bits (80), Expect = 2e-35
 Identities = 194/232 (83%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 788

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             |||||||||||||||||||| || ||||| || ||||| ||||| || ||||| || |
Sbjct: 787 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatc 728

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 727 caaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactctgcga 668

                                                               
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
           | |||||||||||    |||||||| |  ||||||||||| ||||| |||||
Sbjct: 667 aagcctcggggtcagtagcgaggcccaatgggtcgaagctgccacctgggta 616



 Score =  149 bits (75), Expect = 1e-32
 Identities = 219/267 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgag 498
           |||||| ||||| | ||||||||| |||||||| | ||| |||||||| | |||||| | 
Sbjct: 534 agcccaaatggctaagatgctctgagcgtggaccaagctcgggttgcccaagtagtccaa 475

                                                                       
Query: 499 gccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgac 558
            || || |||||||||||||| || |||||||||||||| || || || |||||||| ||
Sbjct: 474 tcctccgtcgctgaagatctgtgaaccggccttgaaccaaaccgcttctccgaacttcac 415

                                                                       
Query: 559 gccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccg 618
            ||||| |  || |  ||||| ||||| |||||||| || || |||||||||||||| | 
Sbjct: 414 tccgttcctagccaatagctcagggaaaacgcagcctagggctccgagcatggcccatct 355

                                                                       
Query: 619 gcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccc 678
           || |||||| || || ||||| |||||| |||| |||||||| |||||||| || || ||
Sbjct: 354 gctgtggataacttctagctcacggttcctggcgaaggtctctgggtcggcggatagacc 295

                                      
Query: 679 cgcagtgtcccatccgtagtcaccggg 705
            || |||||||||||||||||||||||
Sbjct: 294 agcggtgtcccatccgtagtcaccggg 268
to top
>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score =  159 bits (80), Expect = 2e-35
 Identities = 194/232 (83%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 788

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             |||||||||||||||||||| || ||||| || ||||| ||||| || ||||| || |
Sbjct: 787 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatc 728

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 727 caaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactctgcga 668

                                                               
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
           | |||||||||||    |||||||| |  ||||||||||| ||||| |||||
Sbjct: 667 aagcctcggggtcagtagcgaggcccaatgggtcgaagctgccacctgggta 616



 Score =  149 bits (75), Expect = 1e-32
 Identities = 219/267 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgag 498
           |||||| ||||| | ||||||||| |||||||| | ||| |||||||| | |||||| | 
Sbjct: 534 agcccaaatggctaagatgctctgagcgtggaccaagctcgggttgcccaagtagtccaa 475

                                                                       
Query: 499 gccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgac 558
            || || |||||||||||||| || |||||||||||||| || || || |||||||| ||
Sbjct: 474 tcctccgtcgctgaagatctgtgaaccggccttgaaccaaaccgcttctccgaacttcac 415

                                                                       
Query: 559 gccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccg 618
            ||||| |  || |  ||||| ||||| |||||||| || || |||||||||||||| | 
Sbjct: 414 tccgttcctagccaatagctcagggaaaacgcagcctagggctccgagcatggcccatct 355

                                                                       
Query: 619 gcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccc 678
           || |||||| || || ||||| |||||| |||| |||||||| |||||||| || || ||
Sbjct: 354 gctgtggataacttctagctcacggttcctggcgaaggtctctgggtcggcggatagacc 295

                                      
Query: 679 cgcagtgtcccatccgtagtcaccggg 705
            || |||||||||||||||||||||||
Sbjct: 294 agcggtgtcccatccgtagtcaccggg 268
to top
>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 1024

 Score =  159 bits (80), Expect = 2e-35
 Identities = 194/232 (83%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 788

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             |||||||||||||||||||| || ||||| || ||||| ||||| || ||||| || |
Sbjct: 787 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatc 728

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 727 caaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactctgcga 668

                                                               
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
           | |||||||||||    |||||||| |  ||||||||||| ||||| |||||
Sbjct: 667 aagcctcggggtcagtagcgaggcccaatgggtcgaagctgccacctgggta 616



 Score =  149 bits (75), Expect = 1e-32
 Identities = 219/267 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgag 498
           |||||| ||||| | ||||||||| |||||||| | ||| |||||||| | |||||| | 
Sbjct: 534 agcccaaatggctaagatgctctgagcgtggaccaagctcgggttgcccaagtagtccaa 475

                                                                       
Query: 499 gccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgac 558
            || || |||||||||||||| || |||||||||||||| || || || |||||||| ||
Sbjct: 474 tcctccgtcgctgaagatctgtgaaccggccttgaaccaaaccgcttctccgaacttcac 415

                                                                       
Query: 559 gccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccg 618
            ||||| |  || |  ||||| ||||| |||||||| || || |||||||||||||| | 
Sbjct: 414 tccgttcctagccaatagctcagggaaaacgcagcctagggctccgagcatggcccatct 355

                                                                       
Query: 619 gcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccc 678
           || |||||| || || ||||| |||||| |||| |||||||| |||||||| || || ||
Sbjct: 354 gctgtggataacttctagctcacggttcctggcgaaggtctctgggtcggcggatagacc 295

                                      
Query: 679 cgcagtgtcccatccgtagtcaccggg 705
            || |||||||||||||||||||||||
Sbjct: 294 agcggtgtcccatccgtagtcaccggg 268
to top
>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 995

 Score =  159 bits (80), Expect = 2e-35
 Identities = 194/232 (83%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 788

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             |||||||||||||||||||| || ||||| || ||||| ||||| || ||||| || |
Sbjct: 787 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatc 728

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 727 caaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactctgcga 668

                                                               
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
           | |||||||||||    |||||||| |  ||||||||||| ||||| |||||
Sbjct: 667 aagcctcggggtcagtagcgaggcccaatgggtcgaagctgccacctgggta 616



 Score =  149 bits (75), Expect = 1e-32
 Identities = 219/267 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgag 498
           |||||| ||||| | ||||||||| |||||||| | ||| |||||||| | |||||| | 
Sbjct: 534 agcccaaatggctaagatgctctgagcgtggaccaagctcgggttgcccaagtagtccaa 475

                                                                       
Query: 499 gccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgac 558
            || || |||||||||||||| || |||||||||||||| || || || |||||||| ||
Sbjct: 474 tcctccgtcgctgaagatctgtgaaccggccttgaaccaaaccgcttctccgaacttcac 415

                                                                       
Query: 559 gccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccg 618
            ||||| |  || |  ||||| ||||| |||||||| || || |||||||||||||| | 
Sbjct: 414 tccgttcctagccaatagctcagggaaaacgcagcctagggctccgagcatggcccatct 355

                                                                       
Query: 619 gcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccc 678
           || |||||| || || ||||| |||||| |||| |||||||| |||||||| || || ||
Sbjct: 354 gctgtggataacttctagctcacggttcctggcgaaggtctctgggtcggcggatagacc 295

                                      
Query: 679 cgcagtgtcccatccgtagtcaccggg 705
            || |||||||||||||||||||||||
Sbjct: 294 agcggtgtcccatccgtagtcaccggg 268
to top
>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score =  159 bits (80), Expect = 2e-35
 Identities = 194/232 (83%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 788

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             |||||||||||||||||||| || ||||| || ||||| ||||| || ||||| || |
Sbjct: 787 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatc 728

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 727 caaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactctgcga 668

                                                               
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
           | |||||||||||    |||||||| |  ||||||||||| ||||| |||||
Sbjct: 667 aagcctcggggtcagtagcgaggcccaatgggtcgaagctgccacctgggta 616



 Score =  149 bits (75), Expect = 1e-32
 Identities = 219/267 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgag 498
           |||||| ||||| | ||||||||| |||||||| | ||| |||||||| | |||||| | 
Sbjct: 534 agcccaaatggctaagatgctctgagcgtggaccaagctcgggttgcccaagtagtccaa 475

                                                                       
Query: 499 gccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgac 558
            || || |||||||||||||| || |||||||||||||| || || || |||||||| ||
Sbjct: 474 tcctccgtcgctgaagatctgtgaaccggccttgaaccaaaccgcttctccgaacttcac 415

                                                                       
Query: 559 gccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccg 618
            ||||| |  || |  ||||| ||||| |||||||| || || |||||||||||||| | 
Sbjct: 414 tccgttcctagccaatagctcagggaaaacgcagcctagggctccgagcatggcccatct 355

                                                                       
Query: 619 gcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccc 678
           || |||||| || || ||||| |||||| |||| |||||||| |||||||| || || ||
Sbjct: 354 gctgtggataacttctagctcacggttcctggcgaaggtctctgggtcggcggatagacc 295

                                      
Query: 679 cgcagtgtcccatccgtagtcaccggg 705
            || |||||||||||||||||||||||
Sbjct: 294 agcggtgtcccatccgtagtcaccggg 268
to top
>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS62ZC05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 903

 Score =  159 bits (80), Expect = 2e-35
 Identities = 194/232 (83%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 828 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 769

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             |||||||||||||||||||| || ||||| || ||||| ||||| || ||||| || |
Sbjct: 768 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatc 709

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 708 caaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactctgcga 649

                                                               
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
           | |||||||||||    |||||||| |  ||||||||||| ||||| |||||
Sbjct: 648 aagcctcggggtcagtagcgaggcccaatgggtcgaagctgccacctgggta 597



 Score =  149 bits (75), Expect = 1e-32
 Identities = 219/267 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgag 498
           |||||| ||||| | ||||||||| |||||||| | ||| |||||||| | |||||| | 
Sbjct: 515 agcccaaatggctaagatgctctgagcgtggaccaagctcgggttgcccaagtagtccaa 456

                                                                       
Query: 499 gccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgac 558
            || || |||||||||||||| || |||||||||||||| || || || |||||||| ||
Sbjct: 455 tcctccgtcgctgaagatctgtgaaccggccttgaaccaaaccgcttctccgaacttcac 396

                                                                       
Query: 559 gccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccg 618
            ||||| |  || |  ||||| ||||| |||||||| || || |||||||||||||| | 
Sbjct: 395 tccgttcctagccaatagctcagggaaaacgcagcctagggctccgagcatggcccatct 336

                                                                       
Query: 619 gcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccc 678
           || |||||| || || ||||| |||||| |||| |||||||| |||||||| || || ||
Sbjct: 335 gctgtggataacttctagctcacggttcctggcgaaggtctctgggtcggcggatagacc 276

                                      
Query: 679 cgcagtgtcccatccgtagtcaccggg 705
            || |||||||||||||||||||||||
Sbjct: 275 agcggtgtcccatccgtagtcaccggg 249
to top
>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS5ZF09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 885

 Score =  159 bits (80), Expect = 2e-35
 Identities = 194/232 (83%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 831 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 772

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             |||||||||||||||||||| || ||||| || ||||| ||||| || ||||| || |
Sbjct: 771 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatc 712

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 711 caaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactctgcga 652

                                                               
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
           | |||||||||||    |||||||| |  ||||||||||| ||||| |||||
Sbjct: 651 aagcctcggggtcagtagcgaggcccaatgggtcgaagctgccacctgggta 600



 Score =  149 bits (75), Expect = 1e-32
 Identities = 219/267 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgag 498
           |||||| ||||| | ||||||||| |||||||| | ||| |||||||| | |||||| | 
Sbjct: 518 agcccaaatggctaagatgctctgagcgtggaccaagctcgggttgcccaagtagtccaa 459

                                                                       
Query: 499 gccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgac 558
            || || |||||||||||||| || |||||||||||||| || || || |||||||| ||
Sbjct: 458 tcctccgtcgctgaagatctgtgaaccggccttgaaccaaaccgcttctccgaacttcac 399

                                                                       
Query: 559 gccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccg 618
            ||||| |  || |  ||||| ||||| |||||||| || || |||||||||||||| | 
Sbjct: 398 tccgttcctagccaatagctcagggaaaacgcagcctagggctccgagcatggcccatct 339

                                                                       
Query: 619 gcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccc 678
           || |||||| || || ||||| |||||| |||| |||||||| |||||||| || || ||
Sbjct: 338 gctgtggataacttctagctcacggttcctggcgaaggtctctgggtcggcggatagacc 279

                                      
Query: 679 cgcagtgtcccatccgtagtcaccggg 705
            || |||||||||||||||||||||||
Sbjct: 278 agcggtgtcccatccgtagtcaccggg 252
to top
>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB71ZG07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 919

 Score =  159 bits (80), Expect = 2e-35
 Identities = 194/232 (83%)
 Strand = Plus / Plus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 88  actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 147

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             |||||||||||||||||||| || ||||| || ||||| ||||| || ||||| || |
Sbjct: 148 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatc 207

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 208 caaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactctgcga 267

                                                               
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
           | |||||||||||    |||||||| |  ||||||||||| ||||| |||||
Sbjct: 268 aagcctcggggtcagtagcgaggcccaatgggtcgaagctgccacctgggta 319



 Score =  141 bits (71), Expect = 4e-30
 Identities = 218/267 (81%)
 Strand = Plus / Plus

                                                                       
Query: 439 agcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgag 498
           |||||| ||||| | ||||||||| |||||||| | ||| |||||||| | |||||| | 
Sbjct: 401 agcccaaatggctaagatgctctgagcgtggaccaagctcgggttgcccaagtagtccaa 460

                                                                       
Query: 499 gccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgac 558
            || || |||||||||||||| || |||||||||||||| || || || |||||||| ||
Sbjct: 461 tcctccgtcgctgaagatctgtgaaccggccttgaaccaaaccgcttctccgaacttcac 520

                                                                       
Query: 559 gccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccg 618
            ||||| |  || |  ||||| ||||| |||||||| || || |||||||||||||| | 
Sbjct: 521 tccgttcctagccaatagctcagggaaaacgcagcctagggctccgagcatggcccatct 580

                                                                       
Query: 619 gcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccc 678
           || |||||| || || ||||| |||| | |||| |||||||| |||||||| || || ||
Sbjct: 581 gctgtggataacttctagctcacggtccctggcgaaggtctctgggtcggcggatagacc 640

                                      
Query: 679 cgcagtgtcccatccgtagtcaccggg 705
            || |||||||||||||||||||||||
Sbjct: 641 agcggtgtcccatccgtagtcaccggg 667
to top
>emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II chlorophyll a/b binding
            protein
          Length = 1405

 Score =  159 bits (80), Expect = 2e-35
 Identities = 194/232 (83%)
 Strand = Plus / Minus

                                                                        
Query: 129  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
            |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 1096 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 1037

                                                                        
Query: 189  ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
              |||||||||||||||||||| || ||||| || ||||| ||||| || ||||| || |
Sbjct: 1036 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatc 977

                                                                        
Query: 249  cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
            | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 976  caaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactctgcga 917

                                                                
Query: 309  acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
            | |||||||||||    |||||||| |  ||||||||||| ||||| |||||
Sbjct: 916  aagcctcggggtcagtagcgaggcccaatgggtcgaagctgccacctgggta 865



 Score =  149 bits (75), Expect = 1e-32
 Identities = 219/267 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgag 498
           |||||| ||||| | ||||||||| |||||||| | ||| |||||||| | |||||| | 
Sbjct: 783 agcccaaatggctaagatgctctgagcgtggaccaagctcgggttgcccaagtagtccaa 724

                                                                       
Query: 499 gccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgac 558
            || || |||||||||||||| || |||||||||||||| || || || |||||||| ||
Sbjct: 723 tcctccgtcgctgaagatctgtgaaccggccttgaaccaaaccgcttctccgaacttcac 664

                                                                       
Query: 559 gccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccg 618
            ||||| |  || |  ||||| ||||| |||||||| || || |||||||||||||| | 
Sbjct: 663 tccgttcctagccaatagctcagggaaaacgcagcctagggctccgagcatggcccatct 604

                                                                       
Query: 619 gcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccc 678
           || |||||| || || ||||| |||||| |||| |||||||| |||||||| || || ||
Sbjct: 603 gctgtggataacttctagctcacggttcctggcgaaggtctctgggtcggcggatagacc 544

                                      
Query: 679 cgcagtgtcccatccgtagtcaccggg 705
            || |||||||||||||||||||||||
Sbjct: 543 agcggtgtcccatccgtagtcaccggg 517
to top
>dbj|AB051209.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-3, complete cds
          Length = 1256

 Score =  159 bits (80), Expect = 2e-35
 Identities = 164/192 (85%)
 Strand = Plus / Minus

                                                                       
Query: 178 ggggtcggcaaggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctg 237
           ||||| ||| ||||||||| | |||||||  |  ||||||||||| || || ||||||||
Sbjct: 739 ggggttggccaggtggtcgtccaggttctggatggggcccttgccggtcacgatggcctg 680

                                                                       
Query: 238 cacgaaaaagccgaacatggagaacatggcaaggcgtccgttcttgatctccttcacctt 297
            ||||| |||||||||||||||||||| || ||||| |||||||||||||||||||||||
Sbjct: 679 gacgaagaagccgaacatggagaacatagccaggcggccgttcttgatctccttcacctt 620

                                                                       
Query: 298 gagctcggcgaacgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggg 357
            ||||| ||||| |  ||||||||||| || ||||| ||||||||||||  |||||||||
Sbjct: 619 cagctcagcgaaggtgtcggggtcgtcagccaggcccagggggtcgaaggcaccaccggg 560

                       
Query: 358 gtagagggggtc 369
           ||  ||||||||
Sbjct: 559 gtgcagggggtc 548



 Score =  111 bits (56), Expect = 3e-21
 Identities = 137/164 (83%)
 Strand = Plus / Minus

                                                                       
Query: 481 gttgccgaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagac 540
           ||||||||||||||  |||||||||||   ||||||||||| ||||||||||||||||||
Sbjct: 436 gttgccgaggtagttcaggccgccctcagcgaagatctgggcgccggccttgaaccagac 377

                                                                       
Query: 541 ggcctcgccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgc 600
            ||||| ||||||  || ||||||   ||| ||||||||||||  || |||||| || ||
Sbjct: 376 agcctcaccgaacgggatgccgttcttggccagcagctcgggggtgatgcagcccagagc 317

                                                       
Query: 601 gccgagcatggcccaccggcagtggatcacctccagctcccggt 644
           ||| ||||||||||| |||  |||||||| ||||| ||| ||||
Sbjct: 316 gcccagcatggcccagcgggcgtggatcagctccaactcgcggt 273
to top
>dbj|AB051205.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b
            binding protein LhcII-3, complete cds
          Length = 1508

 Score =  159 bits (80), Expect = 2e-35
 Identities = 164/192 (85%)
 Strand = Plus / Minus

                                                                        
Query: 178  ggggtcggcaaggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctg 237
            ||||| ||| ||||||||| | |||||||  |  ||||||||||| || || ||||||||
Sbjct: 1420 ggggttggccaggtggtcgtccaggttctggatggggcccttgccggtcacgatggcctg 1361

                                                                        
Query: 238  cacgaaaaagccgaacatggagaacatggcaaggcgtccgttcttgatctccttcacctt 297
             ||||| |||||||||||||||||||| || ||||| |||||||||||||||||||||||
Sbjct: 1360 gacgaagaagccgaacatggagaacatagccaggcggccgttcttgatctccttcacctt 1301

                                                                        
Query: 298  gagctcggcgaacgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggg 357
             ||||| ||||| |  ||||||||||| || ||||| ||||||||||||  |||||||||
Sbjct: 1300 cagctcagcgaaggtgtcggggtcgtcagccaggcccagggggtcgaaggcaccaccggg 1241

                        
Query: 358  gtagagggggtc 369
            ||  ||||||||
Sbjct: 1240 gtgcagggggtc 1229



 Score =  111 bits (56), Expect = 3e-21
 Identities = 137/164 (83%)
 Strand = Plus / Minus

                                                                       
Query: 481 gttgccgaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagac 540
           ||||||||||||||  |||||||||||   ||||||||||| ||||||||||||||||||
Sbjct: 884 gttgccgaggtagttcaggccgccctcagcgaagatctgggcgccggccttgaaccagac 825

                                                                       
Query: 541 ggcctcgccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgc 600
            ||||| ||||||  || ||||||   ||| ||||||||||||  || |||||| || ||
Sbjct: 824 agcctcaccgaacgggatgccgttcttggccagcagctcgggggtgatgcagcccagagc 765

                                                       
Query: 601 gccgagcatggcccaccggcagtggatcacctccagctcccggt 644
           ||| ||||||||||| |||  |||||||| ||||| ||| ||||
Sbjct: 764 gcccagcatggcccagcgggcgtggatcagctccaactcgcggt 721
to top
>gb|AF479779.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m7 (Lhcbm7) mRNA, complete cds
          Length = 1016

 Score =  157 bits (79), Expect = 6e-35
 Identities = 222/267 (83%), Gaps = 2/267 (0%)
 Strand = Plus / Minus

                                                                       
Query: 146 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgaggttc 205
           ||||||||||||||  ||||||||||   |  ||||| ||  ||||||||| | ||||||
Sbjct: 772 ttggtggcgaaggcgaacgcgttgttcacggtggggttggacaggtggtcgtccaggttc 713

                                                                       
Query: 206 tccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatg 265
           |  |  ||||||||||| || || |||||||| ||||| |||||||||||||||||||||
Sbjct: 712 tggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatggagaacatg 653

                                                                       
Query: 266 gcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcg 325
           || ||||| ||||||||||||||||||||||| ||||| ||||| |  ||||||||||| 
Sbjct: 652 gccaggcggccgttcttgatctccttcaccttcagctcagcgaaggtgtcggggtcgtca 593

                                                                       
Query: 326 gcgaggccgagggggtcgaagctac-caccggggtagagggggtcgacgatctcgccgag 384
           || ||||| ||||||||||| | || | |||||||| |||||||| | |  |||||||  
Sbjct: 592 gccaggcccagggggtcgaa-cgactcgccggggtacagggggtccaggccctcgccggc 534

                                      
Query: 385 cgggccgccggcgacacggtagccctc 411
            |||||||||  |||||||||||||||
Sbjct: 533 ggggccgccgttgacacggtagccctc 507



 Score =  117 bits (59), Expect = 5e-23
 Identities = 140/167 (83%)
 Strand = Plus / Minus

                                                                       
Query: 478 ggggttgccgaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaacca 537
           ||||||||| |||||||| |||||||||||   ||||||||||| |||||||||||||||
Sbjct: 437 ggggttgcccaggtagtccaggccgccctcagagaagatctgggcgccggccttgaacca 378

                                                                       
Query: 538 gacggcctcgccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgag 597
           ||| ||||||||||||| |  |||| |   ||| ||||||||||||  || |||||| ||
Sbjct: 377 gacagcctcgccgaactgggtgccgctcttggccagcagctcgggggtgatgcagcccag 318

                                                          
Query: 598 cgcgccgagcatggcccaccggcagtggatcacctccagctcccggt 644
            ||||| ||||| ||||| |||  |||||||| ||||||||| ||||
Sbjct: 317 agcgcccagcatagcccagcgggcgtggatcagctccagctcgcggt 271
to top
>emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b binding protein
          Length = 1011

 Score =  157 bits (79), Expect = 6e-35
 Identities = 157/183 (85%)
 Strand = Plus / Minus

                                                                       
Query: 164 gcgttgttgttgacggggtcggcaaggtggtcggcgaggttctccaatgggcccttgcca 223
           ||||||||| || ||||||| || |||||||| || |||||||  |  ||||||||||| 
Sbjct: 766 gcgttgttggtgccggggtcagccaggtggtcagccaggttctggatggggcccttgccg 707

                                                                       
Query: 224 gtgacaatggcctgcacgaaaaagccgaacatggagaacatggcaaggcgtccgttcttg 283
           || || |||||||||||||| ||||||||   |||||||||||||||||| |||||||||
Sbjct: 706 gtcacgatggcctgcacgaagaagccgaagcaggagaacatggcaaggcggccgttcttg 647

                                                                       
Query: 284 atctccttcaccttgagctcggcgaacgcctcggggtcgtcggcgaggccgagggggtcg 343
           |||||||||||||||||||| ||||| |  |||||||| || || ||||| |||||||||
Sbjct: 646 atctccttcaccttgagctcagcgaaggtgtcggggtcatcagccaggcccagggggtcg 587

              
Query: 344 aag 346
           |||
Sbjct: 586 aag 584



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 478 ggggttgccgaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaacca 537
           |||| |||| |||||||| ||||| ||||||  |||||||||||  ||||||||||||||
Sbjct: 452 ggggctgcccaggtagtccaggccaccctcggagaagatctgggcaccggccttgaacca 393

                                
Query: 538 gacggcctcgccgaacttgac 558
            |||| |||||||||||||||
Sbjct: 392 cacgggctcgccgaacttgac 372



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 72/84 (85%)
 Strand = Plus / Minus

                                                                       
Query: 622 gtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccccgc 681
           |||||||||||||||||| |||| |||    |||||||||||||| || || || || ||
Sbjct: 305 gtggatcacctccagctcacggtacttcttgaaggtctcggggtcagcggacagaccagc 246

                                   
Query: 682 agtgtcccatccgtagtcaccggg 705
           ||||||||| ||||||||||||||
Sbjct: 245 agtgtcccagccgtagtcaccggg 222
to top
>emb|AJ318069.1|STU318069 Solanum tuberosum mRNA for ferredoxin-thioredoxin-reductase
           catalytic subunit B (ftrbpot gene)
          Length = 701

 Score =  157 bits (79), Expect = 6e-35
 Identities = 200/239 (83%), Gaps = 1/239 (0%)
 Strand = Plus / Plus

                                                                       
Query: 134 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtgg 193
           ||||| |||||||| |||||||| ||| | ||||||||||| |||||||| |||||||||
Sbjct: 6   ccggggacaaagtttgtggcgaaagccaa-gcgttgttgttaacggggtctgcaaggtgg 64

                                                                       
Query: 194 tcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaac 253
           || || |||||||||||||| ||||| || || ||||||||||| ||||| || || |||
Sbjct: 65  tcagcaaggttctccaatggaccctttccggtaacaatggcctgaacgaagaatccaaac 124

                                                                       
Query: 254 atggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcc 313
           || |||||||| ||||| |  |||||||| |||||||| || |||||||| || || |||
Sbjct: 125 atagagaacatagcaagtctgccgttcttaatctcctttactttgagctcagcaaatgcc 184

                                                                      
Query: 314 tcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggtcgac 372
           || ||||| || || ||||| |  ||||| ||||| ||||| |||||||| ||||||||
Sbjct: 185 tctgggtcttcagcaaggcctaatgggtcaaagctgccaccagggtagagtgggtcgac 243



 Score =  145 bits (73), Expect = 2e-31
 Identities = 222/269 (82%), Gaps = 2/269 (0%)
 Strand = Plus / Plus

                                                                       
Query: 434 tggcaagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtag 493
           ||||||||||||||||| | |||||||||||| ||||| | ||| |||||||| | ||||
Sbjct: 304 tggcaagcccagatggccaagatgctctgtgcatggaccaagcttgggttgcccaagtag 363

                                                                       
Query: 494 tcgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaac 553
           || || || |||||||||||||| ||||| |||||||||||||| || ||||| ||||||
Sbjct: 364 tcaagtccaccctcgctgaagatgtgggatccggccttgaaccacacagcctcaccgaac 423

                                                                       
Query: 554 ttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcc 613
           ||||| || || ||||| |  ||||| |||||||| ||  | || || || ||||| | |
Sbjct: 424 ttgacaccattacgggccaatagctcagggaagacaca-tcaagagcaccaagcatag-c 481

                                                                       
Query: 614 caccggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagag 673
           || | ||||||||||||||| || || ||||||||||||||||| || ||||| || || 
Sbjct: 482 catctgcagtggatcacctcgagttcacggttcttggcaaaggtttcagggtctgctgaa 541

                                        
Query: 674 agccccgcagtgtcccatccgtagtcacc 702
           || || || || ||||| |||||||||||
Sbjct: 542 agtccagcggtatcccacccgtagtcacc 570
to top
>dbj|AB051204.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b
            binding protein LhcII-1.3, complete cds
          Length = 1835

 Score =  157 bits (79), Expect = 6e-35
 Identities = 222/267 (83%), Gaps = 2/267 (0%)
 Strand = Plus / Minus

                                                                        
Query: 146  ttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgaggttc 205
            ||||||||||||||  ||||||||||   |  ||||| ||  ||||||||| | ||||||
Sbjct: 1643 ttggtggcgaaggcgaacgcgttgttcacggtggggttggacaggtggtcgtccaggttc 1584

                                                                        
Query: 206  tccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatg 265
            |  |  ||||||||||| || || |||||||| ||||| |||||||||||||||||||||
Sbjct: 1583 tggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatggagaacatg 1524

                                                                        
Query: 266  gcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcg 325
            || ||||| ||||||||||||||||||||||| ||||| ||||| |  ||||||||||| 
Sbjct: 1523 gccaggcggccgttcttgatctccttcaccttcagctcagcgaaggtgtcggggtcgtca 1464

                                                                        
Query: 326  gcgaggccgagggggtcgaagctac-caccggggtagagggggtcgacgatctcgccgag 384
            || ||||| ||||||||||| | || | |||||||| |||||||| | |  |||||||  
Sbjct: 1463 gccaggcccagggggtcgaa-cgactcgccggggtacagggggtccaggccctcgccggc 1405

                                       
Query: 385  cgggccgccggcgacacggtagccctc 411
             |||||||||  |||||||||||||||
Sbjct: 1404 ggggccgccgttgacacggtagccctc 1378



 Score =  123 bits (62), Expect = 8e-25
 Identities = 164/198 (82%)
 Strand = Plus / Minus

                                                                        
Query: 447  tggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccct 506
            |||||| |||| |||| ||||| || |||  ||||||||| |||||||| ||||||||||
Sbjct: 1128 tggcgacgatgttctgggcgtgcaccagggaggggttgcccaggtagtccaggccgccct 1069

                                                                        
Query: 507  cgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacgccgttgc 566
            |   ||||||||||| |||||||||||||||||| ||||||||||||| |  |||| |  
Sbjct: 1068 cagagaagatctgggcgccggccttgaaccagacagcctcgccgaactgggtgccgctct 1009

                                                                        
Query: 567  gggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccggcagtgga 626
             ||| ||||||||||||  || |||||| || ||||| ||||| ||||| |||  |||||
Sbjct: 1008 tggccagcagctcgggggtgatgcagcccagagcgcccagcatagcccagcgggcgtgga 949

                              
Query: 627  tcacctccagctcccggt 644
            ||| ||||||||| ||||
Sbjct: 948  tcagctccagctcgcggt 931
to top
>gb|K00975.1|PETCAB10 Petunia major chlorophyll a/b binding protein (Cab) clone pCab10,
           3' end and flank
          Length = 367

 Score =  155 bits (78), Expect = 2e-34
 Identities = 189/226 (83%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| |||||||| |||||| ||| ||| ||||||||||| || || |||||||
Sbjct: 229 actttccgggaacaaagtttgtggcgtaggaccaagcgttgttgttaactggatcggcaa 170

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           | ||||| || |||||||||||||| ||||| || ||||| || ||||| || ||||| |
Sbjct: 169 gatggtcagcaaggttctccaatggaccctttccggtgacgatagcctgaacaaaaaatc 110

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | |||||||||||||| ||||| |  || |||||||||||||||||||||||||| || |
Sbjct: 109 caaacatggagaacatagcaagtctaccattcttgatctccttcaccttgagctcagcaa 50

                                                         
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccacc 354
           | || || ||||| ||||| ||||| |  || ||||||||||||||
Sbjct: 49  atgcttctgggtcatcggcaaggcctaatggatcgaagctaccacc 4
to top
>emb|AJ538931.1|NTA538931 Nicotiana tabacum cDNA-AFLP-fragment BT21-M1-005
          Length = 332

 Score =  153 bits (77), Expect = 9e-34
 Identities = 239/293 (81%)
 Strand = Plus / Minus

                                                                       
Query: 179 gggtcggcaaggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgc 238
           ||||| |||||||||||||| |||||||||||||| ||||| |||||||| || ||||| 
Sbjct: 327 gggtcagcaaggtggtcggcaaggttctccaatggaccctttccagtgacgatagcctga 268

                                                                       
Query: 239 acgaaaaagccgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttg 298
           || || || || |||||||||||||| ||||| |  || |||||||||||||| ||||||
Sbjct: 267 acaaagaatccaaacatggagaacatagcaagtctaccattcttgatctcctttaccttg 208

                                                                       
Query: 299 agctcggcgaacgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccgggg 358
           ||||| || || ||||| ||||| || || || || |  |||||||| || ||||| |||
Sbjct: 207 agctcagcaaaagcctctgggtcttcagcaagacccaatgggtcgaaactgccaccaggg 148

                                                                       
Query: 359 tagagggggtcgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcg 418
           || || ||||| || |  || ||||| || || || || |||||||| ||||| ||||| 
Sbjct: 147 taaagtgggtcaacaacttcaccgagaggtccaccagcaacacggtaaccctcaacggct 88

                                                                
Query: 419 cccatgagcacgacctggcaagcccagatggcgaggatgctctgtgcgtggac 471
           ||||| ||||| || ||||||||||| ||||| |  ||||| |||||||||||
Sbjct: 87  cccatcagcacaacttggcaagcccaaatggccaaaatgctttgtgcgtggac 35
to top
>emb|AJ538840.1|NTA538840 Nicotiana tabacum cDNA-AFLP-fragment BT2-M11-016
          Length = 315

 Score =  153 bits (77), Expect = 9e-34
 Identities = 239/293 (81%)
 Strand = Plus / Minus

                                                                       
Query: 179 gggtcggcaaggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgc 238
           ||||| |||||||||||||| |||||||||||||| ||||| |||||||| || ||||| 
Sbjct: 310 gggtcagcaaggtggtcggcaaggttctccaatggaccctttccagtgacgatagcctga 251

                                                                       
Query: 239 acgaaaaagccgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttg 298
           || || || || |||||||||||||| ||||| |  || |||||||||||||| ||||||
Sbjct: 250 acaaagaatccaaacatggagaacatagcaagtctaccattcttgatctcctttaccttg 191

                                                                       
Query: 299 agctcggcgaacgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccgggg 358
           ||||| || || ||||| ||||| || || || || |  |||||||| || ||||| |||
Sbjct: 190 agctcagcaaaagcctctgggtcttcagcaagtcccaatgggtcgaaactgccaccaggg 131

                                                                       
Query: 359 tagagggggtcgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcg 418
           || || ||||| || |  |||||||| || || || || |||||||| ||||| ||||| 
Sbjct: 130 taaagtgggtcaacaacttcgccgagaggtccaccagcaacacggtaaccctcaacggct 71

                                                                
Query: 419 cccatgagcacgacctggcaagcccagatggcgaggatgctctgtgcgtggac 471
           ||||| | ||| || ||||||||||| ||||| |  ||||| |||||||||||
Sbjct: 70  cccatcaacacaacttggcaagcccaaatggccaaaatgctttgtgcgtggac 18
to top
>gb|M16887.1|SIPCAB White campion chlorophyll a/b-binding protein precursor (CAB) mRNA,
           partial cds
          Length = 642

 Score =  153 bits (77), Expect = 9e-34
 Identities = 266/329 (80%)
 Strand = Plus / Minus

                                                                       
Query: 377 tcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacctgg 436
           ||||| || ||||||||  | |||||||| || ||||| ||||||||||| || || |||
Sbjct: 572 tcgcccagtgggccgccaccaacacggtacccttcgacagcgcccatgaggacaacttgg 513

                                                                       
Query: 437 caagcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcg 496
           |||||||||||||| || |||||||| || ||||| ||| | |||||||| |||||||| 
Sbjct: 512 caagcccagatggctagaatgctctgagcatggaccaggtttgggttgccaaggtagtca 453

                                                                       
Query: 497 aggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttg 556
           || || |||||   ||| ||||| || || ||||||||||| || ||||| || || |||
Sbjct: 452 agaccaccctcttggaatatctgagaccctgccttgaaccaaactgcctctccaaatttg 393

                                                                       
Query: 557 acgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccac 616
           || |||||    || || ||||||||||| ||||| || || || || ||||| ||||| 
Sbjct: 392 actccgttcttagccaggagctcggggaaaacgcatccaagggcaccaagcattgcccat 333

                                                                       
Query: 617 cggcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagc 676
           | ||||||||||||||| ||||| |||||||| || || || || ||||| || ||||| 
Sbjct: 332 ctgcagtggatcacctctagctcacggttcttagcgaatgtttctgggtcagctgagagt 273

                                        
Query: 677 cccgcagtgtcccatccgtagtcaccggg 705
           || ||||||||||| ||||| ||||||||
Sbjct: 272 ccagcagtgtcccaaccgtaatcaccggg 244
to top
>gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 1042

 Score =  151 bits (76), Expect = 4e-33
 Identities = 169/200 (84%)
 Strand = Plus / Minus

                                                                       
Query: 506 tcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacgccgttg 565
           |||||||||||||| || |||||||||||||| || ||||| ||||||||||| ||||| 
Sbjct: 494 tcgctgaagatctgcgaaccggccttgaaccaaaccgcctctccgaacttgactccgttc 435

                                                                       
Query: 566 cgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccggcagtgg 625
           | ||| | |||||| |||||||||||||| || || |||||||||||||||| |||||||
Sbjct: 434 ctggccaacagctccgggaagacgcagcctagggcaccgagcatggcccacctgcagtgg 375

                                                                       
Query: 626 atcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccccgcagtg 685
           || || || ||||| |||||| |  | || ||||||||  |||| ||||| || || |||
Sbjct: 374 ataacttctagctcacggttcctcacgaacgtctcgggtacggctgagagacctgcggtg 315

                               
Query: 686 tcccatccgtagtcaccggg 705
           |||||||||||||| |||||
Sbjct: 314 tcccatccgtagtctccggg 295



 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 136/169 (80%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| || |||||||| || |||||||| || |||||||| || || || || |
Sbjct: 874 actttccgggaacgaagttggtagcaaaggcccatgcattgttgttaactggatcagcca 815

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             ||||| || || |||||||| || ||||| ||||||||||| || || || || || |
Sbjct: 814 aatggtcagcaagattctccaaaggtcccttaccagtgacaatagcttgaacaaagaatc 755

                                                            
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcacctt 297
           | ||||| |||||||| || |  | ||||||||||||||||||||||||
Sbjct: 754 caaacatagagaacatagccaatcttccgttcttgatctccttcacctt 706
to top
>gb|AF330793.1|AF330793 Chlamydomonas reinhardtii light-harvesting complex II protein
           precursor (cabII-2) mRNA, complete cds
          Length = 1068

 Score =  151 bits (76), Expect = 4e-33
 Identities = 163/192 (84%)
 Strand = Plus / Minus

                                                                       
Query: 178 ggggtcggcaaggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctg 237
           ||||| ||| ||||||||| | |||||||  |  ||||||||||| || || ||||||||
Sbjct: 723 ggggttggccaggtggtcgtccaggttctggatggggcccttgccggtcacgatggcctg 664

                                                                       
Query: 238 cacgaaaaagccgaacatggagaacatggcaaggcgtccgttcttgatctccttcacctt 297
            ||||| |||||||||||||||||||| || ||||| |||||||||||||||||||||||
Sbjct: 663 gacgaagaagccgaacatggagaacatagccaggcggccgttcttgatctccttcacctt 604

                                                                       
Query: 298 gagctcggcgaacgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggg 357
            ||||| ||||| |  ||||||||||| || ||||| |||||||| |||  |||||||||
Sbjct: 603 cagctcagcgaaggtgtcggggtcgtcagccaggcccagggggtcaaaggcaccaccggg 544

                       
Query: 358 gtagagggggtc 369
           ||  ||||||||
Sbjct: 543 gtgcagggggtc 532



 Score =  119 bits (60), Expect = 1e-23
 Identities = 138/164 (84%)
 Strand = Plus / Minus

                                                                       
Query: 481 gttgccgaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccagac 540
           ||||||||||||||  |||||||||||   ||||||||||| ||||||||||||||||||
Sbjct: 420 gttgccgaggtagttcaggccgccctcagcgaagatctgggcgccggccttgaaccagac 361

                                                                       
Query: 541 ggcctcgccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgc 600
            ||||| ||||||  || ||||||   ||| ||||||||||||  || |||||| || ||
Sbjct: 360 agcctcaccgaacgggatgccgttcttggccagcagctcgggggtgatgcagcccagagc 301

                                                       
Query: 601 gccgagcatggcccaccggcagtggatcacctccagctcccggt 644
           ||| ||||||||||| |||  |||||||| ||||||||| ||||
Sbjct: 300 gcccagcatggcccagcgggcgtggatcagctccagctcgcggt 257
to top
>gb|K00972.1|PETCAB146 Petunia major chlorophyll a/b binding protein (Cab) clone pCab146,
           3' end and flank
          Length = 498

 Score =  151 bits (76), Expect = 4e-33
 Identities = 274/340 (80%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| |||||||| || ||  ||| ||| || |||||||| || || || ||||
Sbjct: 376 actttccgggaacaaagtttgtagcataggaccatgcattgttgttaactggatcagcaa 317

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           |||||||||| |||||||||||||| ||||| || ||||| || |||||||| || || |
Sbjct: 316 ggtggtcggcaaggttctccaatggaccctttccggtgacgatagcctgcacaaagaatc 257

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| ||||| |  || ||||| |||||||||||||||||||| || |
Sbjct: 256 caaacatagagaacatagcaagtctaccattcttaatctccttcaccttgagctcagcaa 197

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           | || |||||||| || || ||||| |  || |||||||||||||| || || || ||||
Sbjct: 196 aagcttcggggtcttcagctaggcccaatggatcgaagctaccaccaggataaagtgggt 137

                                                                       
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagca 428
           | |  | ||| ||||| || || || || |||||||| ||||| || || ||||| | ||
Sbjct: 136 caataacctcaccgagaggtccaccagcaacacggtaaccctcaacagctcccatcaaca 77

                                                   
Query: 429 cgacctggcaagcccagatggcgaggatgctctgtgcgtg 468
           |||| ||||||||||| ||||| | |||||| ||||||||
Sbjct: 76  cgacttggcaagcccaaatggccaagatgctttgtgcgtg 37
to top
>gb|AF104631.3| Chlamydomonas reinhardtii light harvesting complex II protein
           precursor (Lhcb3) mRNA, complete cds
          Length = 1314

 Score =  149 bits (75), Expect = 1e-32
 Identities = 120/135 (88%)
 Strand = Plus / Minus

                                                                       
Query: 212 gggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatggcaagg 271
           ||||||||||| || || |||||||| ||||| ||||||||||||||||||||||| |||
Sbjct: 761 gggcccttgccggtcacgatggcctggacgaagaagccgaacatggagaacatggccagg 702

                                                                       
Query: 272 cgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcggcgagg 331
           || ||||||||||||||||||||||| ||||| ||||| || |||||||| || || |||
Sbjct: 701 cggccgttcttgatctccttcaccttcagctcagcgaaagcatcggggtcctcagccagg 642

                          
Query: 332 ccgagggggtcgaag 346
           || ||||||||||||
Sbjct: 641 cccagggggtcgaag 627



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 157/198 (79%)
 Strand = Plus / Minus

                                                                       
Query: 447 tggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccct 506
           |||| ||||||  ||| ||||| || |||| ||||||||| |||||||| ||||||||||
Sbjct: 523 tggccaggatggactgggcgtgcaccaggccggggttgcccaggtagtccaggccgccct 464

                                                                       
Query: 507 cgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacgccgttgc 566
           ||  ||||||||| |  || ||||||||||| |||| |||  |||    |  ||||||  
Sbjct: 463 cggcgaagatctgagcaccagccttgaaccacacgggctcaacgatgggggtgccgttct 404

                                                                       
Query: 567 gggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccggcagtgga 626
            ||| ||||||||||||  || |||||| || ||||| ||||| ||||| |||  |||||
Sbjct: 403 tggccagcagctcgggggtgatgcagcccagagcgcccagcatagcccagcgggcgtgga 344

                             
Query: 627 tcacctccagctcccggt 644
           ||| ||||||||| ||||
Sbjct: 343 tcagctccagctcgcggt 326
to top
>emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL5ZG08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 911

 Score =  149 bits (75), Expect = 1e-32
 Identities = 180/215 (83%)
 Strand = Plus / Minus

                                                                       
Query: 146 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgaggttc 205
           ||||||||||||||||| |||||||||||||| |||||||| |  |||||||||||||||
Sbjct: 814 ttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaatggtcggcgaggttc 755

                                                                       
Query: 206 tccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatg 265
           ||||| || ||||| || ||||| ||||| || ||||| || || ||||| |||||||| 
Sbjct: 754 tccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagagaacata 695

                                                                       
Query: 266 gcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcg 325
           || |  | ||||||||||| |||||||||||| | ||| ||||| |||||||||||    
Sbjct: 694 gccaaccttccgttcttgagctccttcaccttcaactctgcgaaagcctcggggtcagta 635

                                              
Query: 326 gcgaggccgagggggtcgaagctaccaccggggta 360
           |||||||| |  ||||||||||| ||||| |||||
Sbjct: 634 gcgaggcccaatgggtcgaagctgccacctgggta 600



 Score =  127 bits (64), Expect = 5e-26
 Identities = 205/252 (81%)
 Strand = Plus / Minus

                                                                       
Query: 454 gatgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaa 513
           ||||||||| |||||||| | ||| |||||||| | |||||| |  || || ||||||||
Sbjct: 503 gatgctctgagcgtggaccaagctcgggttgcccaagtagtccaatcctccgtcgctgaa 444

                                                                       
Query: 514 gatctgggagccggccttgaaccagacggcctcgccgaacttgacgccgttgcgggcgag 573
           |||||| || |||||||||||||| || || || |||||||| || ||||| |  || | 
Sbjct: 443 gatctgtgaaccggccttgaaccaaaccgcttctccgaacttcactccgttcctagccaa 384

                                                                       
Query: 574 cagctcggggaagacgcagccgagcgcgccgagcatggcccaccggcagtggatcacctc 633
            ||||| ||||| |||||||| || || |||||||||||||| | || |||||| || ||
Sbjct: 383 tagctcagggaaaacgcagcctagggctccgagcatggcccatctgctgtggataacttc 324

                                                                       
Query: 634 cagctcccggttcttggcaaaggtctcggggtcggcagagagccccgcagtgtcccatcc 693
             |||| |||||| |||| ||||| || |||||||| || || || || |||||||||||
Sbjct: 323 tcgctcacggttcctggcgaaggtttctgggtcggcggatagaccagcggtgtcccatcc 264

                       
Query: 694 gtagtcaccggg 705
           ||||||||||||
Sbjct: 263 gtagtcaccggg 252
to top
>emb|X16535.1|GMCAB4 G.max DNA for Cab4
          Length = 1470

 Score =  149 bits (75), Expect = 1e-32
 Identities = 216/263 (82%)
 Strand = Plus / Minus

                                                                       
Query: 440 gcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgagg 499
           ||||||||||| || ||||| ||||| ||||  ||||| |||||||| | |||||| || 
Sbjct: 812 gcccagatggcaagaatgctttgtgcatggatcaggcttgggttgcccaagtagtcaagc 753

                                                                       
Query: 500 ccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacg 559
           |||||||| ||||| ||||| || |||||||||||||| |||||||| || |||||||| 
Sbjct: 752 ccgccctcactgaatatctgagacccggccttgaaccacacggcctcaccaaacttgact 693

                                                                       
Query: 560 ccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccgg 619
           ||||||||||  |  || || ||||| || ||||| |  || || | ||||||||| | |
Sbjct: 692 ccgttgcgggacaagagttcagggaaaacacagcccaaggctcccaacatggcccatctg 633

                                                                       
Query: 620 cagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagcccc 679
            ||||||| || ||||| || ||||| |||||||||||||| ||||| ||||| ||||| 
Sbjct: 632 gagtggatgacttccagttcacggtttttggcaaaggtctctgggtcagcagaaagccca 573

                                  
Query: 680 gcagtgtcccatccgtagtcacc 702
           ||||||||||| || ||||||||
Sbjct: 572 gcagtgtcccaaccatagtcacc 550



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 155/193 (80%)
 Strand = Plus / Minus

                                                                        
Query: 129  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
            |||| ||||| |||||||| |||||  ||||||| || |||||||| || ||||| ||||
Sbjct: 1123 actttccggggacaaagtttgtggcataggcccaagcattgttgttcactgggtcagcaa 1064

                                                                        
Query: 189  ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
            |||| || || ||||| || || || ||||| || || ||||| ||||| || || || |
Sbjct: 1063 ggtgatcagcaaggttttctaagggtccctttcctgtcacaattgcctgaacaaagaatc 1004

                                                                        
Query: 249  cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
            | ||||||||||||||||| |  |  || ||||||| |||||||||||| ||||| || |
Sbjct: 1003 caaacatggagaacatggccaacctaccattcttgagctccttcaccttcagctcagcaa 944

                         
Query: 309  acgcctcggggtc 321
            | ||||| |||||
Sbjct: 943  aagcctctgggtc 931
to top
>gb|AF495473.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
            m1 gene, complete cds; nuclear gene for chloroplast
            product
          Length = 1934

 Score =  147 bits (74), Expect = 6e-32
 Identities = 119/134 (88%)
 Strand = Plus / Minus

                                                                        
Query: 212  gggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatggcaagg 271
            ||||||||||| || || |||||||| ||||| ||||||||||||||||||||||| |||
Sbjct: 1417 gggcccttgccggtcacgatggcctgaacgaagaagccgaacatggagaacatggccagg 1358

                                                                        
Query: 272  cgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcggcgagg 331
            || ||||||||||||||||||||||| ||||| ||||| |  ||||||||||| || |||
Sbjct: 1357 cggccgttcttgatctccttcaccttcagctcagcgaaggtgtcggggtcgtcagccagg 1298

                          
Query: 332  ccgagggggtcgaa 345
            || |||||||||||
Sbjct: 1297 cccagggggtcgaa 1284



 Score =  131 bits (66), Expect = 3e-27
 Identities = 221/270 (81%), Gaps = 2/270 (0%)
 Strand = Plus / Minus

                                                                        
Query: 376  ctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacctg 435
            |||||| || |||||||||  ||| ||||||||||| | ||||||||| ||||  |||||
Sbjct: 1105 ctcgcccagggggccgccgttgacgcggtagccctcaatggcgcccatcagcagcacctg 1046

                                                                        
Query: 436  gcaagcccag-atggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagt 494
            |   |||||| ||||| ||||||  ||| ||||| || ||| |||||||||| |||||||
Sbjct: 1045 ggt-gcccaggatggccaggatggactgggcgtgcaccaggttggggttgcccaggtagt 987

                                                                        
Query: 495  cgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaact 554
            | || ||||||||   ||||||||| |  || ||||||||||| ||||||||||||||  
Sbjct: 986  ccagaccgccctcctggaagatctgagcaccagccttgaaccacacggcctcgccgaagg 927

                                                                        
Query: 555  tgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggccc 614
              ||||||| |  | | |||||||||||||||| |||||| || ||||||||||||||||
Sbjct: 926  gcacgccgtaggagcccagcagctcggggaagatgcagcccagagcgccgagcatggccc 867

                                          
Query: 615  accggcagtggatcacctccagctcccggt 644
            | |||  |||||||| ||||||||| ||||
Sbjct: 866  agcgggcgtggatcagctccagctcgcggt 837
to top
>emb|X63197.1|HVLHBC H.vulgare lhbC mRNA for type III LHCII CAB precursor protein
          Length = 928

 Score =  147 bits (74), Expect = 6e-32
 Identities = 173/206 (83%)
 Strand = Plus / Minus

                                                                       
Query: 141 caaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcga 200
           |||| |||||||||||  |||| || || |||  ||| |||||| | |||||||||   |
Sbjct: 823 caaatttggtggcgaaaacccatgcattattggcgacagggtcgtcgaggtggtcgaaca 764

                                                                       
Query: 201 ggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggaga 260
           |||||||||||||||||||||| ||||| || || |||||||| || |||||||| ||||
Sbjct: 763 ggttctccaatgggcccttgccggtgacgatagcttgcacgaagaacccgaacatagaga 704

                                                                       
Query: 261 acatggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggt 320
           |||||||||| || || |||||||||||||||||||| ||||| ||||| |   | ||||
Sbjct: 703 acatggcaagacggccattcttgatctccttcaccttaagctccgcgaaggtaacagggt 644

                                     
Query: 321 cgtcggcgaggccgagggggtcgaag 346
           ||||||| |||||||| |||||||||
Sbjct: 643 cgtcggcaaggccgagcgggtcgaag 618



 Score =  109 bits (55), Expect = 1e-20
 Identities = 115/135 (85%)
 Strand = Plus / Minus

                                                                       
Query: 571 gagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccggcagtggatcac 630
           ||||| ||||||||||||||| || || ||||||||||| |||||||||| |||||||||
Sbjct: 387 gagcacctcggggaagacgcacccaagagcgccgagcatcgcccaccggccgtggatcac 328

                                                                       
Query: 631 ctccagctcccggttcttggcaaaggtctcggggtcggcagagagccccgcagtgtccca 690
           ||| ||| ||| |||| | || || | ||| ||||||||||| ||||| || ||||||||
Sbjct: 327 ctctagcgccctgttcctagcgaacgcctccgggtcggcagaaagcccggcggtgtccca 268

                          
Query: 691 tccgtagtcaccggg 705
            |||||||| |||||
Sbjct: 267 gccgtagtcgccggg 253



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 79/91 (86%)
 Strand = Plus / Minus

                                                                       
Query: 452 aggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctg 511
           ||||||||||| |||||||| ||| ||||||| || ||||| ||||| || |||||   |
Sbjct: 509 aggatgctctgcgcgtggacaaggttggggttcccaaggtaatcgagaccaccctcagag 450

                                          
Query: 512 aagatctgggagccggccttgaaccagacgg 542
           |||||||| ||||||||||||||||||||||
Sbjct: 449 aagatctgagagccggccttgaaccagacgg 419
to top
>dbj|AB051206.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b
            binding protein LhcII-4, complete cds
          Length = 1781

 Score =  147 bits (74), Expect = 6e-32
 Identities = 119/134 (88%)
 Strand = Plus / Minus

                                                                        
Query: 212  gggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatggcaagg 271
            ||||||||||| || || |||||||| ||||| ||||||||||||||||||||||| |||
Sbjct: 1330 gggcccttgccggtcacgatggcctgaacgaagaagccgaacatggagaacatggccagg 1271

                                                                        
Query: 272  cgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcggcgagg 331
            || ||||||||||||||||||||||| ||||| ||||| |  ||||||||||| || |||
Sbjct: 1270 cggccgttcttgatctccttcaccttcagctcagcgaaggtgtcggggtcgtcagccagg 1211

                          
Query: 332  ccgagggggtcgaa 345
            || |||||||||||
Sbjct: 1210 cccagggggtcgaa 1197



 Score =  131 bits (66), Expect = 3e-27
 Identities = 221/270 (81%), Gaps = 2/270 (0%)
 Strand = Plus / Minus

                                                                        
Query: 376  ctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccatgagcacgacctg 435
            |||||| || |||||||||  ||| ||||||||||| | ||||||||| ||||  |||||
Sbjct: 1018 ctcgcccagggggccgccgttgacgcggtagccctcaatggcgcccatcagcagcacctg 959

                                                                        
Query: 436  gcaagcccag-atggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagt 494
            |   |||||| ||||| ||||||  ||| ||||| || ||| |||||||||| |||||||
Sbjct: 958  ggt-gcccaggatggccaggatggactgggcgtgcaccaggttggggttgcccaggtagt 900

                                                                        
Query: 495  cgaggccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaact 554
            | || ||||||||   ||||||||| |  || ||||||||||| ||||||||||||||  
Sbjct: 899  ccagaccgccctcctggaagatctgagcaccagccttgaaccacacggcctcgccgaagg 840

                                                                        
Query: 555  tgacgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggccc 614
              ||||||| |  | | |||||||||||||||| |||||| || ||||||||||||||||
Sbjct: 839  gcacgccgtaggagcccagcagctcggggaagatgcagcccagagcgccgagcatggccc 780

                                          
Query: 615  accggcagtggatcacctccagctcccggt 644
            | |||  |||||||| ||||||||| ||||
Sbjct: 779  agcgggcgtggatcagctccagctcgcggt 750
to top
>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1)
           mRNA, complete cds
          Length = 1008

 Score =  143 bits (72), Expect = 9e-31
 Identities = 192/232 (82%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| || |||||||| ||||||||||| || ||||||||||| || || || |
Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 802

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
            |||||| |||||||||||||| || ||||| || |||||||||||||| ||||| || |
Sbjct: 801 agtggtccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaatc 742

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 741 caaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactccgcga 682

                                                               
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
           | |||||||||||    |||||||| |  ||||||||||| ||||| |||||
Sbjct: 681 aagcctcggggtcagtagcgaggcccaatgggtcgaagctcccacctgggta 630



 Score =  125 bits (63), Expect = 2e-25
 Identities = 216/267 (80%)
 Strand = Plus / Minus

                                                                       
Query: 439 agcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgag 498
           |||||| ||||| | ||||||||| |||||||| | ||| |||||||| | |||||| | 
Sbjct: 548 agcccaaatggctaagatgctctgagcgtggaccaagctcgggttgcccaagtagtccaa 489

                                                                       
Query: 499 gccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgac 558
            || || |||||||||||||| || || ||||||||||| || || || |||||||| ||
Sbjct: 488 tcctccgtcgctgaagatctgtgaaccagccttgaaccaaaccgcttctccgaacttcac 429

                                                                       
Query: 559 gccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccg 618
            ||||| |  || |  ||||| ||||| |||||||| || || |||||||||||||| | 
Sbjct: 428 tccgttcctagccaatagctcagggaaaacgcagcctagggctccgagcatggcccatct 369

                                                                       
Query: 619 gcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccc 678
           || |||||| || || ||||| |||||| | || ||||||||||| ||||| || || ||
Sbjct: 368 gctgtggataacttctagctcacggttcctagcgaaggtctcgggatcggcggatagacc 309

                                      
Query: 679 cgcagtgtcccatccgtagtcaccggg 705
            ||||||||||| ||||| ||||||||
Sbjct: 308 ggcagtgtcccacccgtaatcaccggg 282
to top
>gb|AF339687.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 851

 Score =  143 bits (72), Expect = 9e-31
 Identities = 192/232 (82%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| || |||||||| ||||||||||| || ||||||||||| || || || |
Sbjct: 799 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 740

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
            |||||| |||||||||||||| || ||||| || |||||||||||||| ||||| || |
Sbjct: 739 agtggtccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaatc 680

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 679 caaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactccgcga 620

                                                               
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
           | |||||||||||    |||||||| |  ||||||||||| ||||| |||||
Sbjct: 619 aagcctcggggtcagtagcgaggcccaatgggtcgaagctcccacctgggta 568



 Score =  125 bits (63), Expect = 2e-25
 Identities = 216/267 (80%)
 Strand = Plus / Minus

                                                                       
Query: 439 agcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgag 498
           |||||| ||||| | ||||||||| |||||||| | ||| |||||||| | |||||| | 
Sbjct: 486 agcccaaatggctaagatgctctgagcgtggaccaagctcgggttgcccaagtagtccaa 427

                                                                       
Query: 499 gccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgac 558
            || || |||||||||||||| || || ||||||||||| || || || |||||||| ||
Sbjct: 426 tcctccgtcgctgaagatctgtgaaccagccttgaaccaaaccgcttctccgaacttcac 367

                                                                       
Query: 559 gccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccg 618
            ||||| |  || |  ||||| ||||| |||||||| || || |||||||||||||| | 
Sbjct: 366 tccgttcctagccaatagctcagggaaaacgcagcctagggctccgagcatggcccatct 307

                                                                       
Query: 619 gcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccc 678
           || |||||| || || ||||| |||||| | || ||||||||||| ||||| || || ||
Sbjct: 306 gctgtggataacttctagctcacggttcctagcgaaggtctcgggatcggcggatagacc 247

                                      
Query: 679 cgcagtgtcccatccgtagtcaccggg 705
            ||||||||||| ||||| ||||||||
Sbjct: 246 ggcagtgtcccacccgtaatcaccggg 220
to top
>gb|AF326864.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 1019

 Score =  143 bits (72), Expect = 9e-31
 Identities = 192/232 (82%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| || |||||||| ||||||||||| || ||||||||||| || || || |
Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 802

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
            |||||| |||||||||||||| || ||||| || |||||||||||||| ||||| || |
Sbjct: 801 agtggtccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaatc 742

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 741 caaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactccgcga 682

                                                               
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
           | |||||||||||    |||||||| |  ||||||||||| ||||| |||||
Sbjct: 681 aagcctcggggtcagtagcgaggcccaatgggtcgaagctcccacctgggta 630



 Score =  125 bits (63), Expect = 2e-25
 Identities = 216/267 (80%)
 Strand = Plus / Minus

                                                                       
Query: 439 agcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgag 498
           |||||| ||||| | ||||||||| |||||||| | ||| |||||||| | |||||| | 
Sbjct: 548 agcccaaatggctaagatgctctgagcgtggaccaagctcgggttgcccaagtagtccaa 489

                                                                       
Query: 499 gccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgac 558
            || || |||||||||||||| || || ||||||||||| || || || |||||||| ||
Sbjct: 488 tcctccgtcgctgaagatctgtgaaccagccttgaaccaaaccgcttctccgaacttcac 429

                                                                       
Query: 559 gccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccg 618
            ||||| |  || |  ||||| ||||| |||||||| || || |||||||||||||| | 
Sbjct: 428 tccgttcctagccaatagctcagggaaaacgcagcctagggctccgagcatggcccatct 369

                                                                       
Query: 619 gcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccc 678
           || |||||| || || ||||| |||||| | || ||||||||||| ||||| || || ||
Sbjct: 368 gctgtggataacttctagctcacggttcctagcgaaggtctcgggatcggcggatagacc 309

                                      
Query: 679 cgcagtgtcccatccgtagtcaccggg 705
            ||||||||||| ||||| ||||||||
Sbjct: 308 ggcagtgtcccacccgtaatcaccggg 282
to top
>gb|AY120776.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 1003

 Score =  143 bits (72), Expect = 9e-31
 Identities = 192/232 (82%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| || |||||||| ||||||||||| || ||||||||||| || || || |
Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 802

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
            |||||| |||||||||||||| || ||||| || |||||||||||||| ||||| || |
Sbjct: 801 agtggtccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaatc 742

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 741 caaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactccgcga 682

                                                               
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
           | |||||||||||    |||||||| |  ||||||||||| ||||| |||||
Sbjct: 681 aagcctcggggtcagtagcgaggcccaatgggtcgaagctcccacctgggta 630



 Score =  125 bits (63), Expect = 2e-25
 Identities = 216/267 (80%)
 Strand = Plus / Minus

                                                                       
Query: 439 agcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgag 498
           |||||| ||||| | ||||||||| |||||||| | ||| |||||||| | |||||| | 
Sbjct: 548 agcccaaatggctaagatgctctgagcgtggaccaagctcgggttgcccaagtagtccaa 489

                                                                       
Query: 499 gccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgac 558
            || || |||||||||||||| || || ||||||||||| || || || |||||||| ||
Sbjct: 488 tcctccgtcgctgaagatctgtgaaccagccttgaaccaaaccgcttctccgaacttcac 429

                                                                       
Query: 559 gccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccg 618
            ||||| |  || |  ||||| ||||| |||||||| || || |||||||||||||| | 
Sbjct: 428 tccgttcctagccaatagctcagggaaaacgcagcctagggctccgagcatggcccatct 369

                                                                       
Query: 619 gcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccc 678
           || |||||| || || ||||| |||||| | || ||||||||||| ||||| || || ||
Sbjct: 368 gctgtggataacttctagctcacggttcctagcgaaggtctcgggatcggcggatagacc 309

                                      
Query: 679 cgcagtgtcccatccgtagtcaccggg 705
            ||||||||||| ||||| ||||||||
Sbjct: 308 ggcagtgtcccacccgtaatcaccggg 282
to top
>gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430/T31E10.23) mRNA, complete
           cds
          Length = 1009

 Score =  143 bits (72), Expect = 9e-31
 Identities = 192/232 (82%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| || |||||||| ||||||||||| || ||||||||||| || || || |
Sbjct: 867 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 808

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
            |||||| |||||||||||||| || ||||| || |||||||||||||| ||||| || |
Sbjct: 807 agtggtccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaatc 748

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 747 caaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactccgcga 688

                                                               
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
           | |||||||||||    |||||||| |  ||||||||||| ||||| |||||
Sbjct: 687 aagcctcggggtcagtagcgaggcccaatgggtcgaagctcccacctgggta 636



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 163/201 (81%), Gaps = 1/201 (0%)
 Strand = Plus / Minus

                                                                       
Query: 506 tcgctgaagatctgggagccggccttgaacc-agacggcctcgccgaacttgacgccgtt 564
           |||||||||||||| || || ||| |||||| | ||||| || |||||||| || |||||
Sbjct: 482 tcgctgaagatctgtgaaccagccctgaacccaaacggcttctccgaacttcactccgtt 423

                                                                       
Query: 565 gcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccggcagtg 624
            |  || |  ||||| ||||| |||||||| || || |||||||||||||| | || |||
Sbjct: 422 cctagccaatagctcagggaaaacgcagcctagggctccgagcatggcccatctgctgtg 363

                                                                       
Query: 625 gatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccccgcagt 684
           ||| || || ||||| |||||| | || ||||||||||| ||||| || || || |||||
Sbjct: 362 gataacttctagctcacggttcctagcgaaggtctcgggatcggcggatagaccggcagt 303

                                
Query: 685 gtcccatccgtagtcaccggg 705
           |||||| ||||| ||||||||
Sbjct: 302 gtcccacccgtaatcaccggg 282
to top
>emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS41ZH03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 638

 Score =  143 bits (72), Expect = 9e-31
 Identities = 192/232 (82%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| || |||||||| ||||||||||| || ||||||||||| || || || |
Sbjct: 519 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 460

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
            |||||| |||||||||||||| || ||||| || |||||||||||||| ||||| || |
Sbjct: 459 agtggtccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaatc 400

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 399 caaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactccgcga 340

                                                               
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
           | |||||||||||    |||||||| |  ||||||||||| ||||| |||||
Sbjct: 339 aagcctcggggtcagtagcgaggcccaatgggtcgaagctcccacctgggta 288



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 143/178 (80%), Gaps = 1/178 (0%)
 Strand = Plus / Minus

                                                                       
Query: 439 agcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgag 498
           |||||| ||||| | ||||||||| |||||||| | ||| |||||||| | |||||| | 
Sbjct: 206 agcccaaatggctaagatgctctgagcgtggaccaagctcgggttgcccaagtagtccaa 147

                                                                       
Query: 499 gccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaactt-ga 557
            || || |||||||||||||| || || ||||||||||| || || || ||||||||  |
Sbjct: 146 tcctccgtcgctgaagatctgtgaaccagccttgaaccaaaccgcttctccgaacttcta 87

                                                                     
Query: 558 cgccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggccca 615
           | ||||| |  || |  ||||| ||||| |||||||| || || ||||||||||||||
Sbjct: 86  ctccgttcctagccaatagctcagggaaaacgcagcctagggctccgagcatggccca 29
to top
>emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL46ZF04 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 959

 Score =  143 bits (72), Expect = 9e-31
 Identities = 192/232 (82%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| || |||||||||||| ||||||| |||||||||| ||| |||||||| |
Sbjct: 838 actttccggggacgaagttggtggcggaggcccaagcgttgttgtagactgggtcggcca 779

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             |||||||||||||||||||| || ||||| || ||||| ||||| || ||||| || |
Sbjct: 778 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatc 719

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 718 caaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactctgcga 659

                                                               
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
           | |||||||||||    |||||||| |  ||||||||||| ||||| |||||
Sbjct: 658 aagcctcggggtcagtagcgaggcccaatgggtcgaagctgccacctgggta 607



 Score =  117 bits (59), Expect = 5e-23
 Identities = 215/267 (80%)
 Strand = Plus / Minus

                                                                       
Query: 439 agcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgag 498
           |||||| ||||| | ||||||||| |||||||| | ||| |||||||| | |||||| | 
Sbjct: 525 agcccaaatggctaagatgctctgagcgtggaccaagctcgggttgcccaagtagtccaa 466

                                                                       
Query: 499 gccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgac 558
            || || |||||| || |||| |  |||||||||||||| || || || |||||||| ||
Sbjct: 465 tcctccgtcgctgtagttctgtgtaccggccttgaaccaaaccgcttctccgaactttac 406

                                                                       
Query: 559 gccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccg 618
            ||||| |  || |  ||||| ||||| |||||||| || || |||||||||||||| | 
Sbjct: 405 tccgttcctagccaatagctcagggaaaacgcagcctagggctccgagcatggcccatct 346

                                                                       
Query: 619 gcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccc 678
           || |||||| || || ||||| |||||| |||| ||||| || |||||||| || || ||
Sbjct: 345 gctgtggataacttctagctcacggttcctggcgaaggtttctgggtcggcggatagacc 286

                                      
Query: 679 cgcagtgtcccatccgtagtcaccggg 705
            || |||||||||||||||||||||||
Sbjct: 285 agcggtgtcccatccgtagtcaccggg 259
to top
>gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete sequence
          Length = 979

 Score =  143 bits (72), Expect = 9e-31
 Identities = 192/232 (82%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| || |||||||| ||||||||||| || ||||||||||| || || || |
Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 802

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
            |||||| |||||||||||||| || ||||| || |||||||||||||| ||||| || |
Sbjct: 801 agtggtccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaatc 742

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 741 caaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactccgcga 682

                                                               
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
           | |||||||||||    |||||||| |  ||||||||||| ||||| |||||
Sbjct: 681 aagcctcggggtcagtagcgaggcccaatgggtcgaagctcccacctgggta 630



 Score =  117 bits (59), Expect = 5e-23
 Identities = 215/267 (80%)
 Strand = Plus / Minus

                                                                       
Query: 439 agcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgag 498
           |||||| ||||| | ||||||||| |||||||| | ||| |||||||| | |||||| | 
Sbjct: 548 agcccaaatggctaagatgctctgagcgtggaccaagctcgggttgcccaagtagtccaa 489

                                                                       
Query: 499 gccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgac 558
            || || |||||||||||||| || || ||||||||||| || || || |||||||  ||
Sbjct: 488 tcctccgtcgctgaagatctgtgaaccagccttgaaccaaaccgcttctccgaactctac 429

                                                                       
Query: 559 gccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccg 618
            ||||| |  || |  ||||| ||||| |||||||| || || |||||||||||||| | 
Sbjct: 428 tccgttcctagccaatagctcagggaaaacgcagcctagggctccgagcatggcccatct 369

                                                                       
Query: 619 gcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccc 678
           || |||||| || || ||||| |||||| | || ||||||||||| ||||| || || ||
Sbjct: 368 gctgtggataacttctagctcacggttcctagcgaaggtctcgggatcggcggatagacc 309

                                      
Query: 679 cgcagtgtcccatccgtagtcaccggg 705
            ||||||||||| ||||| ||||||||
Sbjct: 308 ggcagtgtcccacccgtaatcaccggg 282
to top
>emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II type I chlorophyll a/b
            binding protein
          Length = 1301

 Score =  143 bits (72), Expect = 9e-31
 Identities = 192/232 (82%)
 Strand = Plus / Minus

                                                                        
Query: 129  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
            |||| ||||| || |||||||| ||||||||||| || ||||||||||| || || || |
Sbjct: 1099 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 1040

                                                                        
Query: 189  ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             |||||| |||||||||||||| || ||||| || |||||||||||||| ||||| || |
Sbjct: 1039 agtggtccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaatc 980

                                                                        
Query: 249  cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
            | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 979  caaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactccgcga 920

                                                                
Query: 309  acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
            | |||||||||||    |||||||| |  ||||||||||| ||||| |||||
Sbjct: 919  aagcctcggggtcagtagcgaggcccaatgggtcgaagctcccacctgggta 868



 Score =  125 bits (63), Expect = 2e-25
 Identities = 216/267 (80%)
 Strand = Plus / Minus

                                                                       
Query: 439 agcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgag 498
           |||||| ||||| | ||||||||| |||||||| | ||| |||||||| | |||||| | 
Sbjct: 786 agcccaaatggctaagatgctctgagcgtggaccaagctcgggttgcccaagtagtccaa 727

                                                                       
Query: 499 gccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgac 558
            || || |||||||||||||| || || ||||||||||| || || || |||||||| ||
Sbjct: 726 tcctccgtcgctgaagatctgtgaaccagccttgaaccaaaccgcttctccgaacttcac 667

                                                                       
Query: 559 gccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccg 618
            ||||| |  || |  ||||| ||||| |||||||| || || |||||||||||||| | 
Sbjct: 666 tccgttcctagccaatagctcagggaaaacgcagcctagggctccgagcatggcccatct 607

                                                                       
Query: 619 gcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccc 678
           || |||||| || || ||||| |||||| | || ||||||||||| ||||| || || ||
Sbjct: 606 gctgtggataacttctagctcacggttcctagcgaaggtctcgggatcggcggatagacc 547

                                      
Query: 679 cgcagtgtcccatccgtagtcaccggg 705
            ||||||||||| ||||| ||||||||
Sbjct: 546 ggcagtgtcccacccgtaatcaccggg 520
to top
>gb|BT002103.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 853

 Score =  143 bits (72), Expect = 9e-31
 Identities = 192/232 (82%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| || |||||||| ||||||||||| || ||||||||||| || || || |
Sbjct: 799 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 740

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
            |||||| |||||||||||||| || ||||| || |||||||||||||| ||||| || |
Sbjct: 739 agtggtccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaatc 680

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 679 caaacatagagaacatagccaaccttccgttcttgagctccttcaccttcaactccgcga 620

                                                               
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
           | |||||||||||    |||||||| |  ||||||||||| ||||| |||||
Sbjct: 619 aagcctcggggtcagtagcgaggcccaatgggtcgaagctcccacctgggta 568



 Score =  125 bits (63), Expect = 2e-25
 Identities = 216/267 (80%)
 Strand = Plus / Minus

                                                                       
Query: 439 agcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgag 498
           |||||| ||||| | ||||||||| |||||||| | ||| |||||||| | |||||| | 
Sbjct: 486 agcccaaatggctaagatgctctgagcgtggaccaagctcgggttgcccaagtagtccaa 427

                                                                       
Query: 499 gccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgac 558
            || || |||||||||||||| || || ||||||||||| || || || |||||||| ||
Sbjct: 426 tcctccgtcgctgaagatctgtgaaccagccttgaaccaaaccgcttctccgaacttcac 367

                                                                       
Query: 559 gccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccg 618
            ||||| |  || |  ||||| ||||| |||||||| || || |||||||||||||| | 
Sbjct: 366 tccgttcctagccaatagctcagggaaaacgcagcctagggctccgagcatggcccatct 307

                                                                       
Query: 619 gcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccc 678
           || |||||| || || ||||| |||||| | || ||||||||||| ||||| || || ||
Sbjct: 306 gctgtggataacttctagctcacggttcctagcgaaggtctcgggatcggcggatagacc 247

                                      
Query: 679 cgcagtgtcccatccgtagtcaccggg 705
            ||||||||||| ||||| ||||||||
Sbjct: 246 ggcagtgtcccacccgtaatcaccggg 220
to top
>gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence
          Length = 775

 Score =  141 bits (71), Expect = 4e-30
 Identities = 162/193 (83%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| || || || |
Sbjct: 630 actttccggggacgaagttggtggcgaaggcccatgcgttgttgttgactggatcagcca 571

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             ||||||||||||||||||||||| ||||| || ||||| ||||| || ||||| || |
Sbjct: 570 aatggtcggcgaggttctccaatggtccctttccggtgacgatggcttgaacgaagaatc 511

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||| |||| ||||||| | ||| ||||
Sbjct: 510 caaacatagagaacatagccaaccttccgttcttgagctccktcaccttcaactctgcga 451

                        
Query: 309 acgcctcggggtc 321
           | |||||||||||
Sbjct: 450 aagcctcggggtc 438



 Score =  115 bits (58), Expect = 2e-22
 Identities = 213/266 (80%)
 Strand = Plus / Minus

                                                                       
Query: 440 gcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgagg 499
           ||||| ||||| | ||||||||| |||||||| | ||| |||||||| | |||||| |  
Sbjct: 316 gcccaaatggctaagatgctctgagcgtggaccaagctcgggttgcccaagtagtccaat 257

                                                                       
Query: 500 ccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacg 559
           || || |||||||||||||| || |||| ||||||||| || || || || ||||| || 
Sbjct: 256 cctccgtcgctgaagatctgtgaaccggycttgaaccaaaccgcttctccraacttcact 197

                                                                       
Query: 560 ccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccgg 619
           ||||| |  || |  ||||| ||||| |||||||| || || |||||||||||||| | |
Sbjct: 196 ccgttcctagccaagagctcagggaaaacgcagcctagggctccgagcatggcccatctg 137

                                                                       
Query: 620 cagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagcccc 679
           | |||||| || || ||||| |||||| |||| |||||||| || || || || || || 
Sbjct: 136 ctgtggataacttctagctcacggttcctggcgaaggtctctggatcagcggatagaccg 77

                                     
Query: 680 gcagtgtcccatccgtagtcaccggg 705
           || ||||||||||| |||||||||||
Sbjct: 76  gcggtgtcccatccatagtcaccggg 51
to top
>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 980

 Score =  141 bits (71), Expect = 4e-30
 Identities = 218/267 (81%)
 Strand = Plus / Minus

                                                                       
Query: 439 agcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgag 498
           |||||| ||||| | |||||||||||||||||| | ||| ||||| || | |||||||||
Sbjct: 528 agcccaaatggctaagatgctctgtgcgtggaccaagctcgggtttcccaagtagtcgag 469

                                                                       
Query: 499 gccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgac 558
            || || |||||||||||||| || || ||||||||||| || || || |||||||| ||
Sbjct: 468 ccctccttcgctgaagatctgtgaaccagccttgaaccaaacagcttctccgaacttcac 409

                                                                       
Query: 559 gccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccg 618
            ||||| |  || |  || || ||||| || ||||| || || || ||||||||||| | 
Sbjct: 408 tccgttcctagccaaaagttcagggaaaacacagcctagggctccaagcatggcccatct 349

                                                                       
Query: 619 gcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccc 678
           ||||||||| || || ||||| |||||| |||| |||||||||||||| || || || ||
Sbjct: 348 gcagtggataacttctagctcacggttcctggcgaaggtctcggggtcagcggaaagacc 289

                                      
Query: 679 cgcagtgtcccatccgtagtcaccggg 705
            || |||||||||||||||||||||||
Sbjct: 288 ggcggtgtcccatccgtagtcaccggg 262



 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 157/194 (80%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| || ||||||||||| |||||||| || ||||||||||| || || || |
Sbjct: 841 actttccggggacgaagttggtggcaaaggcccatgcattgttgttgactggatcagcca 782

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             ||||| || || |||||||| || ||||| || ||||| || ||||| ||||| || |
Sbjct: 781 aatggtcagcaagattctccaacggtccctttccggtgacgatagcctgaacgaagaatc 722

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | |||||||||||||||||||||||| | ||| ||||
Sbjct: 721 caaacatagagaacatagccaaccttccgttcttgatctccttcaccttcaactccgcga 662

                         
Query: 309 acgcctcggggtcg 322
           | || || ||||||
Sbjct: 661 aagcttctgggtcg 648
to top
>emb|X68333.1|HHLHC H.helix mRNA for light harvesting chlorophyll a/b binding protein
          Length = 686

 Score =  141 bits (71), Expect = 4e-30
 Identities = 239/295 (81%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| ||||||||||||||  ||||||| || |||||||| || || || ||||
Sbjct: 580 actttccggggacaaagttggtggcataggcccatgcattgttgtttactggatcagcaa 521

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           | |||||||| |||||||||||||| ||||| || || ||||||||||| || || || |
Sbjct: 520 gatggtcggctaggttctccaatggaccctttcctgtaacaatggcctgaacaaagaaac 461

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | |||||||||||||||||||| | ||| |||||||  ||||| ||||| ||||| || |
Sbjct: 460 caaacatggagaacatggcaagtcttccattcttgagttccttaaccttaagctcagcaa 401

                                                                       
Query: 309 acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggtagagggggt 368
           | || || ||||| || || ||||| |  |||||||| || || |||||||| || ||||
Sbjct: 400 aggcttctgggtcctcagcaaggcctaatgggtcgaaacttcctccggggtaaagtgggt 341

                                                                  
Query: 369 cgacgatctcgccgagcgggccgccggcgacacggtagccctcgacggcgcccat 423
           | || | ||| ||||| || || ||||| | |||||| ||||| ||||| |||||
Sbjct: 340 caacaacctcaccgagtggtccaccggcaatacggtaaccctcaacggcacccat 286



 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 125/152 (82%)
 Strand = Plus / Minus

                                                                       
Query: 527 gccttgaaccagacggcctcgccgaacttgacgccgttgcgggcgagcagctcggggaag 586
           ||||||||||| || ||||| ||||| ||||| ||||| ||||| |  |||||||| |||
Sbjct: 182 gccttgaaccacacagcctcaccgaatttgacaccgttacgggccaagagctcgggaaag 123

                                                                       
Query: 587 acgcagccgagcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttc 646
           || ||||| || || || ||||| ||||| |  | |||||||||||| ||||| ||||||
Sbjct: 122 acacagccaagggctccaagcatagcccatctactgtggatcacctcgagctcacggttc 63

                                           
Query: 647 ttggcaaaggtctcggggtcggcagagagccc 678
           ||||| || |||||||| || ||||| |||||
Sbjct: 62  ttggcgaaagtctcgggatcagcagaaagccc 31
to top
>gb|U01964.1|GMU01964 Glycine max cv. Dare photosystem II type I chlorophyll a/b-binding
            protein (lhcb1*7) gene, complete cds
          Length = 1882

 Score =  141 bits (71), Expect = 4e-30
 Identities = 215/263 (81%)
 Strand = Plus / Minus

                                                                        
Query: 440  gcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgagg 499
            ||||||||||| || ||||| ||||| ||||  ||||| |||||||| | |||||| || 
Sbjct: 1239 gcccagatggcaagaatgctttgtgcatggatcaggcttgggttgcccaagtagtcaagc 1180

                                                                        
Query: 500  ccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacg 559
            || ||||| ||||| ||||| || |||||||||||||| ||||||||||| |||||||| 
Sbjct: 1179 ccaccctcactgaatatctgagacccggccttgaaccacacggcctcgccaaacttgact 1120

                                                                        
Query: 560  ccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccgg 619
            ||||||||||  |  || || ||||| || ||||| |  || || | ||||||||| | |
Sbjct: 1119 ccgttgcgggacaagagttcagggaaaacacagcccaaggctcccaacatggcccatctg 1060

                                                                        
Query: 620  cagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagcccc 679
             ||||||| || ||||| || ||||| |||||||| ||||| ||||| ||||| ||||| 
Sbjct: 1059 gagtggatgacttccagttcacggtttttggcaaaagtctctgggtcagcagaaagccca 1000

                                   
Query: 680  gcagtgtcccatccgtagtcacc 702
            ||||||||||| || ||||||||
Sbjct: 999  gcagtgtcccaaccatagtcacc 977



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 114/139 (82%)
 Strand = Plus / Minus

                                                                        
Query: 129  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
            |||| ||||| |||||||| |||||  | ||||| || ||||||||||| ||||| ||||
Sbjct: 1550 actttccgggaacaaagtttgtggcataagcccaagcattgttgttgactgggtcagcaa 1491

                                                                        
Query: 189  ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
            |||| || || ||||| ||||| || ||||| || || ||||| ||||| || || || |
Sbjct: 1490 ggtgatcagcaaggttttccaagggtccctttcctgtcacaattgcctgaacaaagaaac 1431

                               
Query: 249  cgaacatggagaacatggc 267
            | |||||||||||||||||
Sbjct: 1430 caaacatggagaacatggc 1412
to top
>dbj|AB012639.1| Nicotiana sylvestris Lhcb1*7 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3663

 Score =  141 bits (71), Expect = 4e-30
 Identities = 422/539 (78%)
 Strand = Plus / Minus

                                                                        
Query: 170  ttgttgacggggtcggcaaggtggtcggcgaggttctccaatgggcccttgccagtgaca 229
            ||||| |||||||| ||||| ||||| || |||||||||||||| ||||| |||||||| 
Sbjct: 3306 ttgttaacggggtctgcaagatggtcagcaaggttctccaatggaccctttccagtgacg 3247

                                                                        
Query: 230  atggcctgcacgaaaaagccgaacatggagaacatggcaaggcgtccgttcttgatctcc 289
            || || || || || || || |||||||||||||| ||||| |  || |||||||| |||
Sbjct: 3246 atagcttgaacaaagaatccaaacatggagaacatagcaagtctgccattcttgatttcc 3187

                                                                        
Query: 290  ttcaccttgagctcggcgaacgcctcggggtcgtcggcgaggccgagggggtcgaagcta 349
            || || || ||||| || || || || ||||| || || || || |  || ||||| |||
Sbjct: 3186 tttactttaagctcagcaaaagcttccgggtcatccgcaagacccaatggatcgaaacta 3127

                                                                        
Query: 350  ccaccggggtagagggggtcgacgatctcgccgagcgggccgccggcgacacggtagccc 409
            || || ||||| || ||||| || | ||| || || || || || || |||||||| |||
Sbjct: 3126 ccgccagggtaaagtgggtcaacaacctcaccaagaggcccaccagcaacacggtaaccc 3067

                                                                        
Query: 410  tcgacggcgcccatgagcacgacctggcaagcccagatggcgaggatgctctgtgcgtgg 469
            |||||||| ||||| | ||| || ||||||||||| || || | |||||| |||||||||
Sbjct: 3066 tcgacggctcccatcaacacaacttggcaagcccaaattgccaagatgctttgtgcgtgg 3007

                                                                        
Query: 470  acgaggctggggttgccgaggtagtcgaggccgccctcgctgaagatctgggagccggcc 529
            || |  || |||||||| |  ||||| || || ||||| || || ||||| || || || 
Sbjct: 3006 accaaacttgggttgcccaaatagtcaagtccaccctcactaaaaatctgtgatccagct 2947

                                                                        
Query: 530  ttgaaccagacggcctcgccgaacttgacgccgttgcgggcgagcagctcggggaagacg 589
            |||||||| || || || ||||| ||||| ||||| ||||| |  ||||| || ||||||
Sbjct: 2946 ttgaaccatacagcttcaccgaatttgacaccgttacgggctaagagctcaggaaagacg 2887

                                                                        
Query: 590  cagccgagcgcgccgagcatggcccaccggcagtggatcacctccagctcccggttcttg 649
            || || || || || ||||||||||| | |||||| || ||||| ||||| ||||| |||
Sbjct: 2886 caaccaagagctccaagcatggcccatctgcagtgaataacctctagctcacggtttttg 2827

                                                                       
Query: 650  gcaaaggtctcggggtcggcagagagccccgcagtgtcccatccgtagtcaccgggaaa 708
            ||||| || || || ||||| || || || ||||| ||||| || || ||||| |||||
Sbjct: 2826 gcaaaagtttctggatcggccgaaagtccagcagtatcccaaccataatcaccaggaaa 2768
to top
>emb|Z49749.1|PMLHCABBP P.menziesii mRNA for light-harvesting chlorophyll a/b binding
           protein of photosystem II
          Length = 772

 Score =  139 bits (70), Expect = 1e-29
 Identities = 235/290 (81%)
 Strand = Plus / Minus

                                                                       
Query: 419 cccatgagcacgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctg 478
           ||||||||||| || ||| | ||||||||||| || |||||||| |||||||  ||| ||
Sbjct: 415 cccatgagcacaacttggaaggcccagatggctagaatgctctgcgcgtggatcaggttg 356

                                                                       
Query: 479 gggttgccgaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccag 538
           ||||| || |||||||||||||| |||||   ||| ||||| |  |||||||| ||||| 
Sbjct: 355 gggtttcccaggtagtcgaggcctccctccgagaatatctgcgccccggccttaaaccac 296

                                                                       
Query: 539 acggcctcgccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagc 598
           ||||| || || || ||||| |||||   ||| | |||||| ||||| || |||||||||
Sbjct: 295 acggcttctccaaatttgaccccgtttttggccaacagctccgggaaaacacagccgagc 236

                                                                       
Query: 599 gcgccgagcatggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtc 658
           || || | ||| ||||| | || |||||||||||||||||| |  || ||||| ||||||
Sbjct: 235 gctcccaacatcgcccatctgctgtggatcacctccagctctctatttttggcgaaggtc 176

                                                             
Query: 659 tcggggtcggcagagagccccgcagtgtcccatccgtagtcaccgggaaa 708
           || |||||||| ||||| || || |||||||| ||||| || ||||||||
Sbjct: 175 tctgggtcggccgagagtccggcggtgtcccacccgtaatccccgggaaa 126



 Score =  111 bits (56), Expect = 3e-21
 Identities = 101/116 (87%)
 Strand = Plus / Minus

                                                                       
Query: 212 gggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatggcaagg 271
           ||||||||||| || || || ||||||||||| |||||||||||||||||||| || || 
Sbjct: 622 gggcccttgccggtcacgattgcctgcacgaagaagccgaacatggagaacatcgccagc 563

                                                                   
Query: 272 cgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcggc 327
           || |||||||| | |||||||||||| ||||| ||||| ||||| |||||||||||
Sbjct: 562 cgcccgttctttagctccttcaccttcagctccgcgaaggcctctgggtcgtcggc 507
to top
>dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chlorophyll a/b-binding
            protein, complete cds
          Length = 1500

 Score =  137 bits (69), Expect = 6e-29
 Identities = 246/305 (80%)
 Strand = Plus / Minus

                                                                        
Query: 398  acacggtagccctcgacggcgcccatgagcacgacctggcaagcccagatggcgaggatg 457
            |||||||| ||||| || |||||||| || | ||||||||| ||||| ||||| |  |||
Sbjct: 1048 acacggtacccctcaacagcgcccataaggatgacctggcaggcccaaatggccaaaatg 989

                                                                        
Query: 458  ctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaagatc 517
            || || |||||||| ||||| |||||||| || || || |||||||| |||  |||||||
Sbjct: 988  ctttgagcgtggacaaggctcgggttgccaagataatcaaggccgccatcggcgaagatc 929

                                                                        
Query: 518  tgggagccggccttgaaccagacggcctcgccgaacttgacgccgttgcgggcgagcagc 577
            |||||||| ||||||||||| || ||||| || |||||||| |||||    || ||||||
Sbjct: 928  tgggagccagccttgaaccacacagcctcaccaaacttgacaccgttctttgccagcagc 869

                                                                        
Query: 578  tcggggaagacgcagccgagcgcgccgagcatggcccaccggcagtggatcacctccagc 637
            |||||    || ||||| |  || || | ||||||||| | | | |||||||||||||||
Sbjct: 868  tcgggcgtcacacagcccaaggctcccaacatggcccatctggaatggatcacctccagc 809

                                                                        
Query: 638  tcccggttcttggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccgtag 697
            |||| ||||||||| |||||||| ||||| || || || || || |||||||| || |||
Sbjct: 808  tccctgttcttggcgaaggtctctgggtctgcggacagaccagctgtgtcccacccatag 749

                 
Query: 698  tcacc 702
            |||||
Sbjct: 748  tcacc 744



 Score =  133 bits (67), Expect = 9e-28
 Identities = 187/227 (82%)
 Strand = Plus / Minus

                                                                        
Query: 143  aagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgagg 202
            |||||||||||| | ||||| |||||||||  |  ||| ||||| | ||||||||  | |
Sbjct: 1378 aagttggtggcgtaagcccaggcgttgttgacggtgggatcggccaagtggtcggacaag 1319

                                                                        
Query: 203  ttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaac 262
            ||||| |  |||||||| || |||||||||||||| || || || |||||||||||||||
Sbjct: 1318 ttctcgatggggccctttccggtgacaatggcctgaacaaagaaaccgaacatggagaac 1259

                                                                        
Query: 263  atggcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcg 322
            || || || |  |||||||| | |||||||||||| | ||||||||| ||||| ||||||
Sbjct: 1258 atagccagcctaccgttcttcaactccttcaccttcaactcggcgaaagcctctgggtcg 1199

                                                           
Query: 323  tcggcgaggccgagggggtcgaagctaccaccggggtagagggggtc 369
            || || | ||||||||||||||||   ||||||||||||| ||||||
Sbjct: 1198 tcagccaagccgagggggtcgaaggagccaccggggtagatggggtc 1152
to top
>gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence
          Length = 827

 Score =  135 bits (68), Expect = 2e-28
 Identities = 167/200 (83%)
 Strand = Plus / Minus

                                                                       
Query: 506 tcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacgccgttg 565
           ||||||||||| || || || ||||||||||| || ||||| ||||||||||| ||||| 
Sbjct: 250 tcgctgaagatttgtgaacctgccttgaaccaaaccgcctctccgaacttgactccgttc 191

                                                                       
Query: 566 cgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccggcagtgg 625
           | ||| |  ||||| |||||||||||||| || || |||||||||||||||| || ||||
Sbjct: 190 ctggccaaaagctcagggaagacgcagcctagggctccgagcatggcccacctgctgtgg 131

                                                                       
Query: 626 atcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccccgcagtg 685
           || || || ||||| |||||| | ||||| ||||||||||| || || || || || |||
Sbjct: 130 ataacttctagctcacggttccttgcaaatgtctcggggtcagcggataggccagctgtg 71

                               
Query: 686 tcccatccgtagtcaccggg 705
           |||||||||||||| |||||
Sbjct: 70  tcccatccgtagtctccggg 51



 Score =  107 bits (54), Expect = 5e-20
 Identities = 159/194 (81%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| ||||||||||||||||||||||| ||||||||||| || || ||||| |
Sbjct: 630 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 571

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             ||||| || || |||||||| || ||||| |||||||| ||||| || || || || |
Sbjct: 570 aatggtcagcaagattctccaacggtcccttaccagtgacgatggcttgaacaaagaatc 511

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||  |||||||||||| | ||| ||||
Sbjct: 510 caaacatagagaacatagctaatcttccgttcttgggctccttcacctttaactcagcga 451

                         
Query: 309 acgcctcggggtcg 322
           | ||||| ||||||
Sbjct: 450 aggcctctgggtcg 437
to top
>gb|M21396.1|SOYCBPA Soybean light-harvesting chlorophyll a/b-binding protein (LHCPII)
           mRNA, 3' end
          Length = 911

 Score =  135 bits (68), Expect = 2e-28
 Identities = 217/264 (82%), Gaps = 2/264 (0%)
 Strand = Plus / Minus

                                                                       
Query: 440 gcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgagg 499
           ||||||||||| || ||||| ||||| ||||  |||||  ||||||| | |||||| || 
Sbjct: 427 gcccagatggcaagaatgctttgtgcatggatcaggctttggttgcccaagtagtcaagc 368

                                                                       
Query: 500 ccgccctcgctgaagatctgggagccggccttgaacca-gacggcctcgccgaacttgac 558
           || ||||| ||||| ||||| || |||||||||||||| |||| | || |||||||||||
Sbjct: 367 ccaccctcactgaatatctgagacccggccttgaaccacgacg-cttcaccgaacttgac 309

                                                                       
Query: 559 gccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccg 618
            ||||||||||| |  || |||||||| || ||||| || || || | ||||||||| | 
Sbjct: 308 accgttgcgggccaagagttcggggaaaacacagcccagggctcccaacatggcccatct 249

                                                                       
Query: 619 gcagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagccc 678
           | ||||||| || || || || |||||||||||||||||||| ||||| ||||| |||||
Sbjct: 248 ggagtggatgacttcaagttcacggttcttggcaaaggtctctgggtcagcagaaagccc 189

                                   
Query: 679 cgcagtgtcccatccgtagtcacc 702
            ||||||||||| || ||||||||
Sbjct: 188 agcagtgtcccaaccatagtcacc 165



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 133/169 (78%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| |||||||| || ||  ||||||| || || ||||| || || || || |
Sbjct: 738 actttccggggacaaagtttgtagcataggcccaggcattattgtttactggttcagcta 679

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
           ||||||| || || || ||||| || ||||| || || ||||| ||||| || || || |
Sbjct: 678 ggtggtcagcaagattttccaaaggtccctttcctgtcacaattgcctgaacaaagaaac 619

                                                            
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcacctt 297
           | ||||||||||||||||| |  |  || ||||||||||| ||||||||
Sbjct: 618 caaacatggagaacatggccaacctaccattcttgatctctttcacctt 570
to top
>gb|M24072.1|CRECABA C.reinhardtii encoding chlorophyll a/b-binding protein (cabII-1)
            gene, complete cds
          Length = 2290

 Score =  135 bits (68), Expect = 2e-28
 Identities = 167/200 (83%)
 Strand = Plus / Minus

                                                                        
Query: 146  ttggtggcgaaggcccacgcgttgttgttgacggggtcggcaaggtggtcggcgaggttc 205
            ||||||||||||||  | |||||||||  |  ||||| ||| ||||||||| | ||||||
Sbjct: 1803 ttggtggcgaaggcgaaggcgttgttgacggtggggttggccaggtggtcgtccaggttc 1744

                                                                        
Query: 206  tccaatgggcccttgccagtgacaatggcctgcacgaaaaagccgaacatggagaacatg 265
            |  |  ||||||||||| || || |||||||| ||||| ||||||||||||||||||   
Sbjct: 1743 tggacggggcccttgccggtcacgatggcctggacgaagaagccgaacatggagaacgat 1684

                                                                        
Query: 266  gcaaggcgtccgttcttgatctccttcaccttgagctcggcgaacgcctcggggtcgtcg 325
            || ||||| ||||||||||||||||||||||| ||||| ||||| |  ||||||||||| 
Sbjct: 1683 gccaggcggccgttcttgatctccttcaccttcagctcagcgaaggtgtcggggtcgtca 1624

                                
Query: 326  gcgaggccgagggggtcgaa 345
            || ||||| |||||||||||
Sbjct: 1623 gccaggcccagggggtcgaa 1604



 Score =  115 bits (58), Expect = 2e-22
 Identities = 163/198 (82%)
 Strand = Plus / Minus

                                                                        
Query: 447  tggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccct 506
            |||||| |||| |||| ||||| |||||   ||||||||| |||||||| ||||||||||
Sbjct: 1256 tggcgacgatgttctgggcgtgcacgagagaggggttgcccaggtagtccaggccgccct 1197

                                                                        
Query: 507  cgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacgccgttgc 566
            |   ||||||||||| |||||||||||||||||| |||||||||||||||  |||| |  
Sbjct: 1196 cagagaagatctgggcgccggccttgaaccagacagcctcgccgaacttggtgccgctct 1137

                                                                        
Query: 567  gggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccggcagtgga 626
             ||| ||||||||||||     |||||| || ||||| ||||| ||||| |||  |||||
Sbjct: 1136 tggccagcagctcgggggtctggcagcccagggcgcccagcatagcccagcgggcgtgga 1077

                              
Query: 627  tcacctccagctcccggt 644
            ||| ||||||||| ||||
Sbjct: 1076 tcagctccagctcgcggt 1059
to top
>ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BINDING PROTEIN 1);
           chlorophyll binding AT1G29930 (CAB1) mRNA, complete cds
          Length = 1044

 Score =  133 bits (67), Expect = 9e-28
 Identities = 205/251 (81%)
 Strand = Plus / Minus

                                                                       
Query: 455 atgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaag 514
           |||||||| ||||| || | ||| ||||| || | ||| ||||| || || |||||||||
Sbjct: 539 atgctctgagcgtgaaccaagctagggtttcccaagtaatcgagccctccatcgctgaag 480

                                                                       
Query: 515 atctgggagccggccttgaaccagacggcctcgccgaacttgacgccgttgcgggcgagc 574
           ||||| || |||||||||||||| || ||||| ||||||||||| ||||| |  || |  
Sbjct: 479 atctgtgaaccggccttgaaccaaaccgcctctccgaacttgactccgtttctagccaaa 420

                                                                       
Query: 575 agctcggggaagacgcagccgagcgcgccgagcatggcccaccggcagtggatcacctcc 634
           ||||| |||||||||||||| || || |||||||||||||||| || |||||| || || 
Sbjct: 419 agctcagggaagacgcagcctagggctccgagcatggcccacctgctgtggataacttct 360

                                                                       
Query: 635 agctcccggttcttggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccg 694
           || || |||||| | || || ||||||||||| || || || || || ||||||||||||
Sbjct: 359 agttcacggttccttgcgaatgtctcggggtcagctgaaagtccggcggtgtcccatccg 300

                      
Query: 695 tagtcaccggg 705
           ||||| |||||
Sbjct: 299 tagtctccggg 289



 Score =  115 bits (58), Expect = 2e-22
 Identities = 160/194 (82%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| ||||||||||||||||||||||| ||||||||||| || || ||||| |
Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 809

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             ||||| || |||||||| |  || ||||| |||||||| ||||| || ||||| || |
Sbjct: 808 aatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaagaatc 749

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 748 caaacatagagaacatagccaatcttccgttcttgagctccttcaccttcaactcagcga 689

                         
Query: 309 acgcctcggggtcg 322
           | ||||| ||||||
Sbjct: 688 atgcctctgggtcg 675
to top
>gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein
           (At1g29930) mRNA, complete cds
          Length = 835

 Score =  133 bits (67), Expect = 9e-28
 Identities = 205/251 (81%)
 Strand = Plus / Minus

                                                                       
Query: 455 atgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaag 514
           |||||||| ||||| || | ||| ||||| || | ||| ||||| || || |||||||||
Sbjct: 473 atgctctgagcgtgaaccaagctagggtttcccaagtaatcgagccctccatcgctgaag 414

                                                                       
Query: 515 atctgggagccggccttgaaccagacggcctcgccgaacttgacgccgttgcgggcgagc 574
           ||||| || |||||||||||||| || ||||| ||||||||||| ||||| |  || |  
Sbjct: 413 atctgtgaaccggccttgaaccaaaccgcctctccgaacttgactccgtttctagccaaa 354

                                                                       
Query: 575 agctcggggaagacgcagccgagcgcgccgagcatggcccaccggcagtggatcacctcc 634
           ||||| |||||||||||||| || || |||||||||||||||| || |||||| || || 
Sbjct: 353 agctcagggaagacgcagcctagggctccgagcatggcccacctgctgtggataacttct 294

                                                                       
Query: 635 agctcccggttcttggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccg 694
           || || |||||| | || || ||||||||||| || || || || || ||||||||||||
Sbjct: 293 agttcacggttccttgcgaatgtctcggggtcagctgaaagtccggcggtgtcccatccg 234

                      
Query: 695 tagtcaccggg 705
           ||||| |||||
Sbjct: 233 tagtctccggg 223



 Score =  115 bits (58), Expect = 2e-22
 Identities = 160/194 (82%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| ||||||||||||||||||||||| ||||||||||| || || ||||| |
Sbjct: 802 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 743

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             ||||| || |||||||| |  || ||||| |||||||| ||||| || ||||| || |
Sbjct: 742 aatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaagaatc 683

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 682 caaacatagagaacatagccaatcttccgttcttgagctccttcaccttcaactcagcga 623

                         
Query: 309 acgcctcggggtcg 322
           | ||||| ||||||
Sbjct: 622 atgcctctgggtcg 609
to top
>gb|AY050935.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At1g29930) mRNA, complete cds
          Length = 1014

 Score =  133 bits (67), Expect = 9e-28
 Identities = 205/251 (81%)
 Strand = Plus / Minus

                                                                       
Query: 455 atgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaag 514
           |||||||| ||||| || | ||| ||||| || | ||| ||||| || || |||||||||
Sbjct: 539 atgctctgagcgtgaaccaagctagggtttcccaagtaatcgagccctccatcgctgaag 480

                                                                       
Query: 515 atctgggagccggccttgaaccagacggcctcgccgaacttgacgccgttgcgggcgagc 574
           ||||| || |||||||||||||| || ||||| ||||||||||| ||||| |  || |  
Sbjct: 479 atctgtgaaccggccttgaaccaaaccgcctctccgaacttgactccgtttctagccaaa 420

                                                                       
Query: 575 agctcggggaagacgcagccgagcgcgccgagcatggcccaccggcagtggatcacctcc 634
           ||||| |||||||||||||| || || |||||||||||||||| || |||||| || || 
Sbjct: 419 agctcagggaagacgcagcctagggctccgagcatggcccacctgctgtggataacttct 360

                                                                       
Query: 635 agctcccggttcttggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccg 694
           || || |||||| | || || ||||||||||| || || || || || ||||||||||||
Sbjct: 359 agttcacggttccttgcgaatgtctcggggtcagctgaaagtccggcggtgtcccatccg 300

                      
Query: 695 tagtcaccggg 705
           ||||| |||||
Sbjct: 299 tagtctccggg 289



 Score =  115 bits (58), Expect = 2e-22
 Identities = 160/194 (82%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| ||||||||||||||||||||||| ||||||||||| || || ||||| |
Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 809

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             ||||| || |||||||| |  || ||||| |||||||| ||||| || ||||| || |
Sbjct: 808 aatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaagaatc 749

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 748 caaacatagagaacatagccaatcttccgttcttgagctccttcaccttcaactcagcga 689

                         
Query: 309 acgcctcggggtcg 322
           | ||||| ||||||
Sbjct: 688 atgcctctgggtcg 675
to top
>gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1019

 Score =  133 bits (67), Expect = 9e-28
 Identities = 205/251 (81%)
 Strand = Plus / Minus

                                                                       
Query: 455 atgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaag 514
           |||||||| ||||| || | ||| ||||| || | ||| ||||| || || |||||||||
Sbjct: 539 atgctctgagcgtgaaccaagctagggtttcccaagtaatcgagccctccatcgctgaag 480

                                                                       
Query: 515 atctgggagccggccttgaaccagacggcctcgccgaacttgacgccgttgcgggcgagc 574
           ||||| || |||||||||||||| || ||||| ||||||||||| ||||| |  || |  
Sbjct: 479 atctgtgaaccggccttgaaccaaaccgcctctccgaacttgactccgtttctagccaaa 420

                                                                       
Query: 575 agctcggggaagacgcagccgagcgcgccgagcatggcccaccggcagtggatcacctcc 634
           ||||| |||||||||||||| || || |||||||||||||||| || |||||| || || 
Sbjct: 419 agctcagggaagacgcagcctagggctccgagcatggcccacctgctgtggataacttct 360

                                                                       
Query: 635 agctcccggttcttggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccg 694
           || || |||||| | || || ||||||||||| || || || || || ||||||||||||
Sbjct: 359 agttcacggttccttgcgaatgtctcggggtcagctgaaagtccggcggtgtcccatccg 300

                      
Query: 695 tagtcaccggg 705
           ||||| |||||
Sbjct: 299 tagtctccggg 289



 Score =  115 bits (58), Expect = 2e-22
 Identities = 160/194 (82%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| ||||||||||||||||||||||| ||||||||||| || || ||||| |
Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 809

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             ||||| || |||||||| |  || ||||| |||||||| ||||| || ||||| || |
Sbjct: 808 aatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaagaatc 749

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 748 caaacatagagaacatagccaatcttccgttcttgagctccttcaccttcaactcagcga 689

                         
Query: 309 acgcctcggggtcg 322
           | ||||| ||||||
Sbjct: 688 atgcctctgggtcg 675
to top
>gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1045

 Score =  133 bits (67), Expect = 9e-28
 Identities = 205/251 (81%)
 Strand = Plus / Minus

                                                                       
Query: 455 atgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaag 514
           |||||||| ||||| || | ||| ||||| || | ||| ||||| || || |||||||||
Sbjct: 539 atgctctgagcgtgaaccaagctagggtttcccaagtaatcgagccctccatcgctgaag 480

                                                                       
Query: 515 atctgggagccggccttgaaccagacggcctcgccgaacttgacgccgttgcgggcgagc 574
           ||||| || |||||||||||||| || ||||| ||||||||||| ||||| |  || |  
Sbjct: 479 atctgtgaaccggccttgaaccaaaccgcctctccgaacttgactccgtttctagccaaa 420

                                                                       
Query: 575 agctcggggaagacgcagccgagcgcgccgagcatggcccaccggcagtggatcacctcc 634
           ||||| |||||||||||||| || || |||||||||||||||| || |||||| || || 
Sbjct: 419 agctcagggaagacgcagcctagggctccgagcatggcccacctgctgtggataacttct 360

                                                                       
Query: 635 agctcccggttcttggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccg 694
           || || |||||| | || || ||||||||||| || || || || || ||||||||||||
Sbjct: 359 agttcacggttccttgcgaatgtctcggggtcagctgaaagtccggcggtgtcccatccg 300

                      
Query: 695 tagtcaccggg 705
           ||||| |||||
Sbjct: 299 tagtctccggg 289



 Score =  115 bits (58), Expect = 2e-22
 Identities = 160/194 (82%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| ||||||||||||||||||||||| ||||||||||| || || ||||| |
Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 809

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             ||||| || |||||||| |  || ||||| |||||||| ||||| || ||||| || |
Sbjct: 808 aatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaagaatc 749

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 748 caaacatagagaacatagccaatcttccgttcttgagctccttcaccttcaactcagcga 689

                         
Query: 309 acgcctcggggtcg 322
           | ||||| ||||||
Sbjct: 688 atgcctctgggtcg 675
to top
>gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 999

 Score =  133 bits (67), Expect = 9e-28
 Identities = 205/251 (81%)
 Strand = Plus / Minus

                                                                       
Query: 455 atgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaag 514
           |||||||| ||||| || | ||| ||||| || | ||| ||||| || || |||||||||
Sbjct: 539 atgctctgagcgtgaaccaagctagggtttcccaagtaatcgagccctccatcgctgaag 480

                                                                       
Query: 515 atctgggagccggccttgaaccagacggcctcgccgaacttgacgccgttgcgggcgagc 574
           ||||| || |||||||||||||| || ||||| ||||||||||| ||||| |  || |  
Sbjct: 479 atctgtgaaccggccttgaaccaaaccgcctctccgaacttgactccgtttctagccaaa 420

                                                                       
Query: 575 agctcggggaagacgcagccgagcgcgccgagcatggcccaccggcagtggatcacctcc 634
           ||||| |||||||||||||| || || |||||||||||||||| || |||||| || || 
Sbjct: 419 agctcagggaagacgcagcctagggctccgagcatggcccacctgctgtggataacttct 360

                                                                       
Query: 635 agctcccggttcttggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccg 694
           || || |||||| | || || ||||||||||| || || || || || ||||||||||||
Sbjct: 359 agttcacggttccttgcgaatgtctcggggtcagctgaaagtccggcggtgtcccatccg 300

                      
Query: 695 tagtcaccggg 705
           ||||| |||||
Sbjct: 299 tagtctccggg 289



 Score =  115 bits (58), Expect = 2e-22
 Identities = 160/194 (82%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| ||||||||||||||||||||||| ||||||||||| || || ||||| |
Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 809

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             ||||| || |||||||| |  || ||||| |||||||| ||||| || ||||| || |
Sbjct: 808 aatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaagaatc 749

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 748 caaacatagagaacatagccaatcttccgttcttgagctccttcaccttcaactcagcga 689

                         
Query: 309 acgcctcggggtcg 322
           | ||||| ||||||
Sbjct: 688 atgcctctgggtcg 675
to top
>emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS89ZA03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 930

 Score =  133 bits (67), Expect = 9e-28
 Identities = 205/251 (81%)
 Strand = Plus / Minus

                                                                       
Query: 455 atgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaag 514
           |||||||| ||||| || | ||| ||||| || | ||| ||||| || || |||||||||
Sbjct: 508 atgctctgagcgtgaaccaagctagggtttcccaagtaatcgagccctccatcgctgaag 449

                                                                       
Query: 515 atctgggagccggccttgaaccagacggcctcgccgaacttgacgccgttgcgggcgagc 574
           ||||| || |||||||||||||| || ||||| ||||||||||| ||||| |  || |  
Sbjct: 448 atctgtgaaccggccttgaaccaaaccgcctctccgaacttgactccgtttctagccaaa 389

                                                                       
Query: 575 agctcggggaagacgcagccgagcgcgccgagcatggcccaccggcagtggatcacctcc 634
           ||||| |||||||||||||| || || |||||||||||||||| || |||||| || || 
Sbjct: 388 agctcagggaagacgcagcctagggctccgagcatggcccacctgctgtggataacttct 329

                                                                       
Query: 635 agctcccggttcttggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccg 694
           || || |||||| | || || ||||||||||| || || || || || ||||||||||||
Sbjct: 328 agttcacggttccttgcgaatgtctcggggtcagctgaaagtccggcggtgtcccatccg 269

                      
Query: 695 tagtcaccggg 705
           ||||| |||||
Sbjct: 268 tagtctccggg 258



 Score =  115 bits (58), Expect = 2e-22
 Identities = 160/194 (82%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| ||||||||||||||||||||||| ||||||||||| || || ||||| |
Sbjct: 837 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 778

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             ||||| || |||||||| |  || ||||| |||||||| ||||| || ||||| || |
Sbjct: 777 aatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaagaatc 718

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 717 caaacatagagaacatagccaatcttccgttcttgagctccttcaccttcaactcagcga 658

                         
Query: 309 acgcctcggggtcg 322
           | ||||| ||||||
Sbjct: 657 atgcctctgggtcg 644
to top
>emb|BX819530.1|CNS0A9V8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB87ZE01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 291

 Score =  133 bits (67), Expect = 9e-28
 Identities = 142/167 (85%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 167 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 108

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             |||||||||||||||||||| || ||||| || ||||| ||||| || ||||| || |
Sbjct: 107 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatc 48

                                                          
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcacc 295
           | ||||| |||||||| || |  | ||||||||||| ||||||||||
Sbjct: 47  caaacatagagaacatagccaaccttccgttcttgagctccttcacc 1
to top
>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence,
           complete sequence
          Length = 82053

 Score =  133 bits (67), Expect = 9e-28
 Identities = 205/251 (81%)
 Strand = Plus / Minus

                                                                       
Query: 455 atgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaag 514
           |||||||| ||||| || | ||| ||||| || | ||| ||||| || || |||||||||
Sbjct: 419 atgctctgagcgtgaaccaagctagggtttcccaagtaatcgagccctccatcgctgaag 360

                                                                       
Query: 515 atctgggagccggccttgaaccagacggcctcgccgaacttgacgccgttgcgggcgagc 574
           ||||| || |||||||||||||| || ||||| ||||||||||| ||||| |  || |  
Sbjct: 359 atctgtgaaccggccttgaaccaaaccgcctctccgaacttgactccgtttctagccaaa 300

                                                                       
Query: 575 agctcggggaagacgcagccgagcgcgccgagcatggcccaccggcagtggatcacctcc 634
           ||||| |||||||||||||| || || |||||||||||||||| || |||||| || || 
Sbjct: 299 agctcagggaagacgcagcctagggctccgagcatggcccacctgctgtggataacttct 240

                                                                       
Query: 635 agctcccggttcttggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccg 694
           || || |||||| | || || ||||||||||| || || || || || ||||||||||||
Sbjct: 239 agttcacggttccttgcgaatgtctcggggtcagctgaaagtccggcggtgtcccatccg 180

                      
Query: 695 tagtcaccggg 705
           ||||| |||||
Sbjct: 179 tagtctccggg 169



 Score =  115 bits (58), Expect = 2e-22
 Identities = 160/194 (82%)
 Strand = Plus / Minus

                                                                       
Query: 129 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
           |||| ||||| ||||||||||||||||||||||| ||||||||||| || || ||||| |
Sbjct: 748 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 689

                                                                       
Query: 189 ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             ||||| || |||||||| |  || ||||| |||||||| ||||| || ||||| || |
Sbjct: 688 aatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaagaatc 629

                                                                       
Query: 249 cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
           | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 628 caaacatagagaacatagccaatcttccgttcttgagctccttcaccttcaactcagcga 569

                         
Query: 309 acgcctcggggtcg 322
           | ||||| ||||||
Sbjct: 568 atgcctctgggtcg 555
to top
>gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N18 genomic sequence, complete
             sequence
          Length = 101075

 Score =  133 bits (67), Expect = 9e-28
 Identities = 205/251 (81%)
 Strand = Plus / Plus

                                                                         
Query: 455   atgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaag 514
             |||||||| ||||| || | ||| ||||| || | ||| ||||| || || |||||||||
Sbjct: 16442 atgctctgagcgtgaaccaagctagggtttcccaagtaatcgagccctccatcgctgaag 16501

                                                                         
Query: 515   atctgggagccggccttgaaccagacggcctcgccgaacttgacgccgttgcgggcgagc 574
             ||||| || |||||||||||||| || ||||| ||||||||||| ||||| |  || |  
Sbjct: 16502 atctgtgaaccggccttgaaccaaaccgcctctccgaacttgactccgtttctagccaaa 16561

                                                                         
Query: 575   agctcggggaagacgcagccgagcgcgccgagcatggcccaccggcagtggatcacctcc 634
             ||||| |||||||||||||| || || |||||||||||||||| || |||||| || || 
Sbjct: 16562 agctcagggaagacgcagcctagggctccgagcatggcccacctgctgtggataacttct 16621

                                                                         
Query: 635   agctcccggttcttggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccg 694
             || || |||||| | || || ||||||||||| || || || || || ||||||||||||
Sbjct: 16622 agttcacggttccttgcgaatgtctcggggtcagctgaaagtccggcggtgtcccatccg 16681

                        
Query: 695   tagtcaccggg 705
             ||||| |||||
Sbjct: 16682 tagtctccggg 16692



 Score =  129 bits (65), Expect = 1e-26
 Identities = 200/245 (81%)
 Strand = Plus / Minus

                                                                         
Query: 455   atgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaag 514
             |||||||| ||||| || | ||| ||||| || | ||| ||||| || || |||||||||
Sbjct: 19565 atgctctgagcgtgaaccaagctagggtttcccaagtaatcgagccctccatcgctgaag 19506

                                                                         
Query: 515   atctgggagccggccttgaaccagacggcctcgccgaacttgacgccgttgcgggcgagc 574
             ||||| || || ||||||||||| || ||||| || |||||||| ||||| | ||| |  
Sbjct: 19505 atctgtgaaccagccttgaaccaaactgcctctccaaacttgactccgttcctggccaaa 19446

                                                                         
Query: 575   agctcggggaagacgcagccgagcgcgccgagcatggcccaccggcagtggatcacctcc 634
             ||||| |||||||||||||| || || |||||||||||||||| || |||||| || || 
Sbjct: 19445 agctcagggaagacgcagcctagggctccgagcatggcccacctgctgtggataacttct 19386

                                                                         
Query: 635   agctcccggttcttggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccg 694
             ||||| |||||| | || || ||||||||||| || || || || || ||||||||||||
Sbjct: 19385 agctcacggttccttgcgaatgtctcggggtcagcggatagaccagctgtgtcccatccg 19326

                  
Query: 695   tagtc 699
             |||||
Sbjct: 19325 tagtc 19321



 Score =  127 bits (64), Expect = 5e-26
 Identities = 190/232 (81%)
 Strand = Plus / Minus

                                                                         
Query: 129   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
             |||| ||||| ||||||||||| ||||||||||| |||||||||||||| || ||||| |
Sbjct: 22540 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggcca 22481

                                                                         
Query: 189   ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
               ||||| || |||||||| |  || ||||| |||||||||||||| || ||||| || |
Sbjct: 22480 aatggtcagcaaggttctctatcggtcccttaccagtgacaatggcttgaacgaagaatc 22421

                                                                         
Query: 249   cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
             | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 22420 caaacatagagaacatagccaatcttccgttcttgagctccttcaccttcaactccgcga 22361

                                                                 
Query: 309   acgcctcggggtcgtcggcgaggccgagggggtcgaagctaccaccggggta 360
             | ||||| ||||||   || || || |  ||||||||||| |||||||||||
Sbjct: 22360 aagcctctgggtcggtagcaagacccaatgggtcgaagctgccaccggggta 22309



 Score =  125 bits (63), Expect = 2e-25
 Identities = 204/251 (81%)
 Strand = Plus / Minus

                                                                         
Query: 455   atgctctgtgcgtggacgaggctggggttgccgaggtagtcgaggccgccctcgctgaag 514
             |||||||| |||||||| | ||| ||||| || | ||| ||||| || || ||||| |||
Sbjct: 22211 atgctctgagcgtggaccaagctagggtttcccaagtaatcgagtcctccatcgctaaag 22152

                                                                         
Query: 515   atctgggagccggccttgaaccagacggcctcgccgaacttgacgccgttgcgggcgagc 574
             ||||| || |||||||||||||| || ||||| ||||||||||| ||||| |  || |  
Sbjct: 22151 atctgtgaaccggccttgaaccaaaccgcctctccgaacttgactccgttcctagccaaa 22092

                                                                         
Query: 575   agctcggggaagacgcagccgagcgcgccgagcatggcccaccggcagtggatcacctcc 634
             ||||| |||||||||||||| || || |||||||| ||||||| || |||||| || || 
Sbjct: 22091 agctcagggaagacgcagcctagggctccgagcatagcccacctgctgtggataacttct 22032

                                                                         
Query: 635   agctcccggttcttggcaaaggtctcggggtcggcagagagccccgcagtgtcccatccg 694
             ||||| |||||| | || || |||||||| || || || || || || ||||||||||||
Sbjct: 22031 agctcacggttccttgcgaatgtctcgggatcagctgaaagtccagcggtgtcccatccg 21972

                        
Query: 695   tagtcaccggg 705
             ||||| |||||
Sbjct: 21971 tagtctccggg 21961



 Score =  115 bits (58), Expect = 2e-22
 Identities = 160/194 (82%)
 Strand = Plus / Plus

                                                                         
Query: 129   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
             |||| ||||| ||||||||||||||||||||||| ||||||||||| || || ||||| |
Sbjct: 16113 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 16172

                                                                         
Query: 189   ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
               ||||| || |||||||| |  || ||||| |||||||| ||||| || ||||| || |
Sbjct: 16173 aatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaagaatc 16232

                                                                         
Query: 249   cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
             | ||||| |||||||| || |  | ||||||||||| |||||||||||| | ||| ||||
Sbjct: 16233 caaacatagagaacatagccaatcttccgttcttgagctccttcaccttcaactcagcga 16292

                           
Query: 309   acgcctcggggtcg 322
             | ||||| ||||||
Sbjct: 16293 atgcctctgggtcg 16306



 Score =  107 bits (54), Expect = 5e-20
 Identities = 159/194 (81%)
 Strand = Plus / Minus

                                                                         
Query: 129   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
             |||| ||||| |||||||||||||| |||||||| |||||||||||||| || ||||| |
Sbjct: 19894 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 19835

                                                                         
Query: 189   ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
               ||||| || |||||||| |  || ||||| |||||||| ||||| || ||||| || |
Sbjct: 19834 aatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaagaatc 19775

                                                                         
Query: 249   cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
             | ||||| |||||||| || |  | ||||||||||| |||||| ||||| | ||| ||||
Sbjct: 19774 caaacatagagaacatagccaatcttccgttcttgagctcctttaccttcaactcagcga 19715

                           
Query: 309   acgcctcggggtcg 322
             | ||||| ||||||
Sbjct: 19714 aggcctctgggtcg 19701
to top
>emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding protein
          Length = 2774

 Score =  131 bits (66), Expect = 3e-27
 Identities = 216/266 (81%)
 Strand = Plus / Minus

                                                                        
Query: 440  gcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgagg 499
            ||||| ||||| | ||||||||| |||||||| | ||| |||||||| | |||||| || 
Sbjct: 2060 gcccaaatggctaagatgctctgagcgtggaccaagcttgggttgcccaagtagtcaagt 2001

                                                                        
Query: 500  ccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacg 559
            || || |||||||||||||| || |||||||||||||| || || || ||||||||||| 
Sbjct: 2000 cctccttcgctgaagatctgtgaaccggccttgaaccaaaccgcttctccgaacttgact 1941

                                                                        
Query: 560  ccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccgg 619
            ||||| || || |  ||||| ||||| ||||| || || || |||||||||||||| | |
Sbjct: 1940 ccgttacgagccaatagctcagggaaaacgcaacctagggctccgagcatggcccatctg 1881

                                                                        
Query: 620  cagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagcccc 679
            |||||||| || || ||||| |||||  | || || ||||||||||| || || || || 
Sbjct: 1880 cagtggataacttctagctcacggtttctagcgaaagtctcggggtcagctgatagacca 1821

                                      
Query: 680  gcagtgtcccatccgtagtcaccggg 705
            || ||||||||||| ||||| |||||
Sbjct: 1820 gcggtgtcccatccatagtctccggg 1795



 Score =  113 bits (57), Expect = 8e-22
 Identities = 150/181 (82%)
 Strand = Plus / Minus

                                                                        
Query: 129  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
            |||| ||||| || |||||||||||||||||||| |||||||||||||| || || || |
Sbjct: 2374 actttccggggacgaagttggtggcgaaggcccatgcgttgttgttgactggatcagcca 2315

                                                                        
Query: 189  ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
              ||||||||||| |||||||| || ||||| || ||||| || ||||| || || || |
Sbjct: 2314 aatggtcggcgagattctccaacggtccctttccggtgacgatagcctgaacaaagaatc 2255

                                                                        
Query: 249  cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
            | ||||| |||||||| || |  | ||||||||| |||||||||||||| | ||||||||
Sbjct: 2254 caaacatagagaacatagccaaccttccgttcttaatctccttcaccttcaactcggcga 2195

             
Query: 309  a 309
            |
Sbjct: 2194 a 2194
to top
>emb|X61915.1|PTCABP P.thunbergii cab gene
          Length = 5419

 Score =  131 bits (66), Expect = 3e-27
 Identities = 234/290 (80%)
 Strand = Plus / Minus

                                                                        
Query: 419  cccatgagcacgacctggcaagcccagatggcgaggatgctctgtgcgtggacgaggctg 478
            |||||||| || |||||||| ||||||||||| || |||||||| |||||||  ||| ||
Sbjct: 2777 cccatgagaacaacctggcaggcccagatggctagaatgctctgcgcgtggatcaggttg 2718

                                                                        
Query: 479  gggttgccgaggtagtcgaggccgccctcgctgaagatctgggagccggccttgaaccag 538
            ||||| || |||||||| ||||| |||||   ||| ||||| |  |||||||||||||| 
Sbjct: 2717 gggttccccaggtagtcaaggcctccctctgagaatatctgcgccccggccttgaaccac 2658

                                                                        
Query: 539  acggcctcgccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagccgagc 598
            || || || || || || || || ||   ||| | |||||| ||||| | ||||||||| 
Sbjct: 2657 acagcttccccaaatttcaccccatttttggccaacagctccgggaaaaggcagccgagg 2598

                                                                        
Query: 599  gcgccgagcatggcccaccggcagtggatcacctccagctcccggttcttggcaaaggtc 658
            || || | ||||||||| | ||||||||||||||||||||| | ||| || || ||||||
Sbjct: 2597 gctcccaacatggcccatctgcagtggatcacctccagctctctgttttttgcgaaggtc 2538

                                                              
Query: 659  tcggggtcggcagagagccccgcagtgtcccatccgtagtcaccgggaaa 708
            || || || || ||||| || ||||||||||| |||||||| ||||||||
Sbjct: 2537 tctggatccgccgagaggccggcagtgtcccacccgtagtcgccgggaaa 2488



 Score =  123 bits (62), Expect = 8e-25
 Identities = 179/218 (82%)
 Strand = Plus / Minus

                                                                        
Query: 129  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
            ||||||| || || || ||||||||| ||||||| || ||||||   |||||||| || |
Sbjct: 3067 acttgccaggaacgaaattggtggcgtaggcccaggcattgttggcaacggggtccgcca 3008

                                                                        
Query: 189  ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
             |||||||  ||| || || |  |||||||| || || || || ||||| ||||| || |
Sbjct: 3007 agtggtcgtagagattttcaatggggcccttcccggtcacgattgcctgaacgaagaaac 2948

                                                                        
Query: 249  cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
            ||||||||||||||||||| || || |||||||| |||||||||||||| ||||| ||||
Sbjct: 2947 cgaacatggagaacatggccagccgaccgttcttaatctccttcaccttcagctccgcga 2888

                                                  
Query: 309  acgcctcggggtcgtcggcgaggccgagggggtcgaag 346
            | ||||||||||||||||| || || || |||||||||
Sbjct: 2887 aggcctcggggtcgtcggccagccccagtgggtcgaag 2850
to top
>emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b-binding polypeptide
          Length = 2775

 Score =  131 bits (66), Expect = 3e-27
 Identities = 216/266 (81%)
 Strand = Plus / Minus

                                                                        
Query: 440  gcccagatggcgaggatgctctgtgcgtggacgaggctggggttgccgaggtagtcgagg 499
            ||||| ||||| | ||||||||| |||||||| | ||| |||||||| | |||||| || 
Sbjct: 2061 gcccaaatggctaagatgctctgagcgtggaccaagcttgggttgcccaagtagtcaagt 2002

                                                                        
Query: 500  ccgccctcgctgaagatctgggagccggccttgaaccagacggcctcgccgaacttgacg 559
            || || |||||||||||||| || |||||||||||||| || || || ||||||||||| 
Sbjct: 2001 cctccttcgctgaagatctgtgaaccggccttgaaccaaaccgcttctccgaacttgact 1942

                                                                        
Query: 560  ccgttgcgggcgagcagctcggggaagacgcagccgagcgcgccgagcatggcccaccgg 619
            ||||| || || |  ||||| ||||| ||||| || || || |||||||||||||| | |
Sbjct: 1941 ccgttacgagccaatagctcagggaaaacgcaacctagggctccgagcatggcccatctg 1882

                                                                        
Query: 620  cagtggatcacctccagctcccggttcttggcaaaggtctcggggtcggcagagagcccc 679
            |||||||| || || ||||| |||||  | || || ||||||||||| || || || || 
Sbjct: 1881 cagtggataacttctagctcacggtttctagcgaaagtctcggggtcagctgatagacca 1822

                                      
Query: 680  gcagtgtcccatccgtagtcaccggg 705
            || ||||||||||| ||||| |||||
Sbjct: 1821 gcggtgtcccatccatagtctccggg 1796



 Score =  113 bits (57), Expect = 8e-22
 Identities = 150/181 (82%)
 Strand = Plus / Minus

                                                                        
Query: 129  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaa 188
            |||| ||||| || |||||||||||||||||||| |||||||||||||| || || || |
Sbjct: 2375 actttccggggacgaagttggtggcgaaggcccatgcgttgttgttgactggatcagcca 2316

                                                                        
Query: 189  ggtggtcggcgaggttctccaatgggcccttgccagtgacaatggcctgcacgaaaaagc 248
              ||||||||||| |||||||| || ||||| || ||||| || ||||| || || || |
Sbjct: 2315 aatggtcggcgagattctccaacggtccctttccggtgacgatagcctgaacaaagaatc 2256

                                                                        
Query: 249  cgaacatggagaacatggcaaggcgtccgttcttgatctccttcaccttgagctcggcga 308
            | ||||| |||||||| || |  | ||||||||| |||||||||||||| | ||||||||
Sbjct: 2255 caaacatagagaacatagccaaccttccgttcttaatctccttcaccttcaactcggcga 2196

             
Query: 309  a 309
            |
Sbjct: 2195 a 2195


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,449,538
Number of Sequences: 3902068
Number of extensions: 4449538
Number of successful extensions: 87780
Number of sequences better than 10.0: 545
Number of HSP's better than 10.0 without gapping: 548
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 83532
Number of HSP's gapped (non-prelim): 3918
length of query: 709
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 686
effective length of database: 17,143,297,704
effective search space: 11760302224944
effective search space used: 11760302224944
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top