>gb|CP000127.1| Nitrosococcus oceani ATCC 19707, complete genome
          Length = 3481691

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 203     atctatgcacgggcagtggt 222
               ||||||||||||||||||||
Sbjct: 3319923 atctatgcacgggcagtggt 3319904

>gb|AC122458.3| Mus musculus BAC clone RP24-270D10 from chromosome 8, complete sequence
          Length = 185268

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 290    tgtgcatgcatgagcaggtgtgca 313
              |||||||||||||||| |||||||
Sbjct: 129597 tgtgcatgcatgagcatgtgtgca 129574

>gb|AC118012.9| Mus musculus chromosome 8, clone RP23-454D11, complete sequence
          Length = 192971

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 241    cagtttctaggcatgcacat 260
              ||||||||||||||||||||
Sbjct: 119619 cagtttctaggcatgcacat 119638

>gb|AC123869.4| Mus musculus BAC clone RP23-245M16 from 12, complete sequence
          Length = 167795

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 20    catacaaacatgtacaaaca 39
             ||||||||||||||||||||
Sbjct: 86549 catacaaacatgtacaaaca 86530

>emb|AL133476.17| Human DNA sequence from clone RP11-156G14 on chromosome 9p13.1-13.3
             Contains the 3' end of a novel gene, a protein associated
             with PRK1 (AWP1) pseudogene, a novel gene  (KIAA0375), a
             ribosomal protein L36a (L44L, RPL44) (RPL36A) pseudogene, 
             a novel gene, a ribosomal protein S29 (RPS29) pseudogene
             and a CpG island, complete sequence
          Length = 153826

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 119   tacaacatatgtgagaagtcaaaa 142
             |||||||||||||||||| |||||
Sbjct: 81586 tacaacatatgtgagaagccaaaa 81609

>gb|AC016839.12| Homo sapiens chromosome 18, clone RP11-399L5, complete sequence
          Length = 152689

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 227   ccatgatcttgcaccagtttctag 250
             ||||||||| ||||||||||||||
Sbjct: 24989 ccatgatctggcaccagtttctag 24966

>gb|AC114478.2| Homo sapiens chromosome 3 clone RP11-333K5, complete sequence
          Length = 158276

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 21    atacaaacatgtacaaacag 40
             ||||||||||||||||||||
Sbjct: 18994 atacaaacatgtacaaacag 18975

>gb|AF334828.1| Homo sapiens cartilage-hair hypoplasia region gene sequence
          Length = 83958

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 119  tacaacatatgtgagaagtcaaaa 142
            |||||||||||||||||| |||||
Sbjct: 3037 tacaacatatgtgagaagccaaaa 3060

>gb|AC025775.6| Homo sapiens chromosome 5 clone CTD-2299B9, complete sequence
          Length = 95782

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   attgttggatgtcatctgtg 175
             ||||||||||||||||||||
Sbjct: 62153 attgttggatgtcatctgtg 62172

>gb|AC099560.2| Homo sapiens chromosome 3 clone RP11-761N21, complete sequence
          Length = 192169

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 20    catacaaacatgtacaaaca 39
             ||||||||||||||||||||
Sbjct: 91770 catacaaacatgtacaaaca 91751

>gb|AC160649.2| Pan troglodytes BAC clone CH251-568N12 from chromosome unknown,
             complete sequence
          Length = 192241

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 21    atacaaacatgtacaaacag 40
             ||||||||||||||||||||
Sbjct: 95016 atacaaacatgtacaaacag 94997

>gb|AC155247.2| Mus musculus BAC clone RP24-302C23 from chromosome 12, complete sequence
          Length = 144348

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 20     catacaaacatgtacaaaca 39
              ||||||||||||||||||||
Sbjct: 142770 catacaaacatgtacaaaca 142789

>gb|AC091021.8| Homo sapiens chromosome 18, clone RP11-786F14, complete sequence
          Length = 196622

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 227   ccatgatcttgcaccagtttctag 250
             ||||||||| ||||||||||||||
Sbjct: 11864 ccatgatctggcaccagtttctag 11887

>emb|AL162759.4|CNS01RHZ Human chromosome 14 DNA sequence BAC R-785G15 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 174273

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 21    atacaaacatgtacaaacag 40
             ||||||||||||||||||||
Sbjct: 23961 atacaaacatgtacaaacag 23980

>emb|BX001041.6| Zebrafish DNA sequence from clone CH211-62M7, complete sequence
          Length = 167472

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 167    tcatctgtgctctccatgga 186
              ||||||||||||||||||||
Sbjct: 110831 tcatctgtgctctccatgga 110850


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,013,099
Number of Sequences: 3902068
Number of extensions: 3013099
Number of successful extensions: 67287
Number of sequences better than 10.0: 15
Number of HSP's better than 10.0 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 67254
Number of HSP's gapped (non-prelim): 33
length of query: 316
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 294
effective length of database: 17,147,199,772
effective search space: 5041276732968
effective search space used: 5041276732968
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)