ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal39l06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AJ234431.1|HVU234431 Hordeum vulgare partial mRNA; clone cMW... 676 0.0
2emb|AJ606022.1| Triticum aestivum partial mRNA for putative micr... 123 5e-25
3ref|NM_189035.2| Oryza sativa (japonica cultivar-group), mRNA 46 0.087
4dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.087
5dbj|AP004708.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.087
6dbj|AK066731.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.087
7dbj|AK066492.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.087
8ref|NG_005550.2| Homo sapiens neuroblastoma breakpoint family, m... 42 1.4
9emb|AL732363.8| Human DNA sequence from clone RP11-744H18 on chr... 42 1.4
10gb|AC129338.2| Homo sapiens BAC clone RP11-51A19 from UL, comple... 42 1.4
11gb|AC127701.2| Homo sapiens BAC clone RP11-79F18 from UL, comple... 42 1.4
12gb|AC163282.3| Mus musculus BAC clone RP23-454I20 from chromosom... 42 1.4
13gb|AC011293.5|AC011293 Homo sapiens BAC clone RP11-75F5 from Y, ... 42 1.4
14gb|AC019340.6| Homo sapiens BAC clone RP11-715L17 from 7, comple... 42 1.4
15emb|CT030161.10| Mouse DNA sequence from clone RP23-235H10 on ch... 42 1.4
16gb|AC134594.5| Mus musculus BAC clone RP23-388B6 from 12, comple... 42 1.4
17gb|AC150278.1| Pan troglodytes BAC clone CH251-126G17 from Y, co... 40 5.4
18gb|AC134879.3| Homo sapiens BAC clone RP11-295P22 from Y, comple... 40 5.4
19emb|AL133216.10| Human DNA sequence from clone RP11-291L22 on ch... 40 5.4
20dbj|BS000654.1| Pan troglodytes chromosome Y clone:PTB-129E12, c... 40 5.4
21gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 40 5.4
22gb|AC026405.5| Homo sapiens chromosome 5 clone CTC-347N9, comple... 40 5.4
23gb|AC172374.4| Pan troglodytes BAC clone CH251-119H6 from chromo... 40 5.4
24gb|AC018696.4| Homo sapiens BAC clone RP11-575H3 from 2, complet... 40 5.4
25gb|AC150909.3| Pan troglodytes BAC clone CH251-1056O7 from chrom... 40 5.4
26gb|AC156805.2| Pan troglodytes BAC clone CH251-830G14 from chrom... 40 5.4
27gb|AC137499.2| Homo sapiens chromosome 16 clone RP11-317D10, com... 40 5.4
28gb|AC130474.12| Mus musculus chromosome 7, clone RP23-178C20, co... 40 5.4

>emb|AJ234431.1|HVU234431 Hordeum vulgare partial mRNA; clone cMWG0705
          Length = 634

 Score =  676 bits (341), Expect = 0.0
 Identities = 387/405 (95%), Gaps = 3/405 (0%)
 Strand = Plus / Minus

                                                                       
Query: 1   tttattccccctttacc-gttaatcttacaaaattcttcc-tcnnnnnnntacctccctc 58
           ||||||||||||||||| |||||||||||||||||||||| ||       ||||||||||
Sbjct: 610 tttattccccctttaccagttaatcttacaaaattcttccatcaaaaaaatacctccctc 551

                                                                       
Query: 59  taacgccgaccgacgtaaactactgccccgtcgtcgtcgcggcgacacctagattgattg 118
           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 550 taacgccgaccgaagtaaactactgccccgtcgtcgtcgcggcgacacctagattgattg 491

                                                                       
Query: 119 atcggagttccttaggtacgtacgtacagtgccttaattagttacatgatggactcgaat 178
           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 490 ahcggagttccttaggtacgtacgtacagtgccttaattagttacatgatggactcgaat 431

                                                                       
Query: 179 ggaatgatcccaatggaacctatatgtacacatggagcagcacagcgcagcgcaggagca 238
           |||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||
Sbjct: 430 ggaatgatcccaatggaacctatatgtacacatggagcagcacagcgca-svcaggagca 372

                                                                       
Query: 239 ccggtgaacaggatggccgaggcacctcgcttcctgttatcaccaggccatcgattggct 298
           |||||||||||||||||||||||||||||    |||||||||||||||||||||||||||
Sbjct: 371 ccggtgaacaggatggccgaggcacctcgyyynctgttatcaccaggccatcgattggct 312

                                                                       
Query: 299 gaggtagagcggggttgggcatggacagacggcctgtgtgtggttacaccttacattgaa 358
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 311 gaggtagagcggggttgggcatggacagacggcctgtgtgtggttacaccttacattgaa 252

                                                        
Query: 359 gggcttacatctcgctgagcaagttgctgatcttgcggagctcgg 403
           |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 251 gggcttacatctcgctgagcaagttgctgatcttgcggagctcgg 207



to top

>emb|AJ606022.1| Triticum aestivum partial mRNA for putative microtubule-associated
           protein (p0700D12.21 gene)
          Length = 628

 Score =  123 bits (62), Expect = 5e-25
 Identities = 69/70 (98%), Gaps = 1/70 (1%)
 Strand = Plus / Minus

                                                                       
Query: 114 gattgatcggagttccttaggtacgtacgtaca-gtgccttaattagttacatgatggac 172
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 613 gattgatcggagttccttaggtacgtacgtacaagtgccttaattagttacatgatggac 554

                     
Query: 173 tcgaatggaa 182
           ||||||||||
Sbjct: 553 tcgaatggaa 544



 Score =  103 bits (52), Expect = 4e-19
 Identities = 157/187 (83%), Gaps = 15/187 (8%)
 Strand = Plus / Minus

                                                                       
Query: 225 gcagcgcaggagcaccggtgaacaggatggccgaggcacctcgcttcctgttatcacca- 283
           |||||||||||||||||||| ||| ||||||||||||||||||||   ||||||||||| 
Sbjct: 525 gcagcgcaggagcaccggtggacaagatggccgaggcacctcgct---tgttatcaccag 469

                                                                       
Query: 284 ---ggccatcgattggctgaggtagagcggggt----tgggcatggacagacggcctgtg 336
              ||||||||| || ||||| ||||| |||||    |||||| | ||||||||||||||
Sbjct: 468 gcaggccatcgactg-ctgagctagagaggggtgggttgggcaggaacagacggcctgtg 410

                                                                       
Query: 337 tgtggttacaccttacattgaagggcttacatctcgctgagcaagttgctgatcttgcgg 396
            ||  |  | |||||||| || ||   |||||||||||||||||||||||||||||||||
Sbjct: 409 ggta-tgccgccttacatggatggc--tacatctcgctgagcaagttgctgatcttgcgg 353

                  
Query: 397 agctcgg 403
           |||||||
Sbjct: 352 agctcgg 346



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 81/97 (83%), Gaps = 13/97 (13%)
 Strand = Plus / Minus

                                                                       
Query: 190 aatggaacctatatgtacacatggagcagcacagcgcagcgcaggagcaccggtgaacag 249
           ||||||||||||||||||| ||||||||||          ||||||||||||||| ||| 
Sbjct: 550 aatggaacctatatgtacatatggagcagc----------gcaggagcaccggtggacaa 501

                                                
Query: 250 gatggccgaggcacctcgcttcctgttatcaccaggc 286
           ||||||||||||||||||||   ||||||||||||||
Sbjct: 500 gatggccgaggcacctcgct---tgttatcaccaggc 467



to top

>ref|NM_189035.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 3246

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 363  ttacatctcgctgagcaagttgctgatcttgcggagctc 401
            |||||||||||| ||||  |||||||||||||| |||||
Sbjct: 2943 ttacatctcgctcagcagattgctgatcttgcgaagctc 2905



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                       
Query: 363      ttacatctcgctgagcaagttgctgatcttgcggagctc 401
                |||||||||||| ||||  |||||||||||||| |||||
Sbjct: 25709930 ttacatctcgctcagcagattgctgatcttgcgaagctc 25709892



to top

>dbj|AP004708.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0700D12
          Length = 145177

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                    
Query: 363   ttacatctcgctgagcaagttgctgatcttgcggagctc 401
             |||||||||||| ||||  |||||||||||||| |||||
Sbjct: 87678 ttacatctcgctcagcagattgctgatcttgcgaagctc 87640



to top

>dbj|AK066731.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013074L23, full
            insert sequence
          Length = 3245

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 363  ttacatctcgctgagcaagttgctgatcttgcggagctc 401
            |||||||||||| ||||  |||||||||||||| |||||
Sbjct: 2942 ttacatctcgctcagcagattgctgatcttgcgaagctc 2904



to top

>dbj|AK066492.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013074C01, full
            insert sequence
          Length = 1612

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 363  ttacatctcgctgagcaagttgctgatcttgcggagctc 401
            |||||||||||| ||||  |||||||||||||| |||||
Sbjct: 1309 ttacatctcgctcagcagattgctgatcttgcgaagctc 1271



to top

>ref|NG_005550.2| Homo sapiens neuroblastoma breakpoint family, member 17 (pseudogene)
             (NBPF17P) on chromosome 1
          Length = 64687

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 167   atggactcgaatggaatgatc 187
             |||||||||||||||||||||
Sbjct: 54839 atggactcgaatggaatgatc 54859



to top

>emb|AL732363.8| Human DNA sequence from clone RP11-744H18 on chromosome 1 Contains a
             phosphodiesterase 4D interacting protein (myomegalin)
             (PDE4DIP) pseudogene and the 3' end of a novel pseudogene,
             complete sequence
          Length = 106538

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 167   atggactcgaatggaatgatc 187
             |||||||||||||||||||||
Sbjct: 30920 atggactcgaatggaatgatc 30900



to top

>gb|AC129338.2| Homo sapiens BAC clone RP11-51A19 from UL, complete sequence
          Length = 169277

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 167 atggactcgaatggaatgatc 187
           |||||||||||||||||||||
Sbjct: 12  atggactcgaatggaatgatc 32



to top

>gb|AC127701.2| Homo sapiens BAC clone RP11-79F18 from UL, complete sequence
          Length = 161405

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 167    atggactcgaatggaatgatc 187
              |||||||||||||||||||||
Sbjct: 144918 atggactcgaatggaatgatc 144898



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 167    atggactcgaatggaatgatc 187
              |||||||||||||||||||||
Sbjct: 102208 atggactcgaatggaatgatc 102188



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 167   atggactcgaatggaatgatc 187
             |||||||||||||||||||||
Sbjct: 16295 atggactcgaatggaatgatc 16315



to top

>gb|AC163282.3| Mus musculus BAC clone RP23-454I20 from chromosome 12, complete sequence
          Length = 202583

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 213    gagcagcacagcgcagcgcag 233
              |||||||||||||||||||||
Sbjct: 160618 gagcagcacagcgcagcgcag 160598



to top

>gb|AC011293.5|AC011293 Homo sapiens BAC clone RP11-75F5 from Y, complete sequence
          Length = 159722

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 167   atggactcgaatggaatgatc 187
             |||||||||||||||||||||
Sbjct: 33888 atggactcgaatggaatgatc 33908



to top

>gb|AC019340.6| Homo sapiens BAC clone RP11-715L17 from 7, complete sequence
          Length = 190137

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 167   atggactcgaatggaatgatc 187
             |||||||||||||||||||||
Sbjct: 71803 atggactcgaatggaatgatc 71823



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 167   atggactcgaatggaatgatc 187
             |||||||||||||||||||||
Sbjct: 29093 atggactcgaatggaatgatc 29113



to top

>emb|CT030161.10| Mouse DNA sequence from clone RP23-235H10 on chromosome 12, complete
              sequence
          Length = 234471

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 213    gagcagcacagcgcagcgcag 233
              |||||||||||||||||||||
Sbjct: 219228 gagcagcacagcgcagcgcag 219248



to top

>gb|AC134594.5| Mus musculus BAC clone RP23-388B6 from 12, complete sequence
          Length = 194521

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 213    gagcagcacagcgcagcgcag 233
              |||||||||||||||||||||
Sbjct: 173302 gagcagcacagcgcagcgcag 173322



to top

>gb|AC150278.1| Pan troglodytes BAC clone CH251-126G17 from Y, complete sequence
          Length = 171976

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 167 atggactcgaatggaatgat 186
           ||||||||||||||||||||
Sbjct: 516 atggactcgaatggaatgat 535



to top

>gb|AC134879.3| Homo sapiens BAC clone RP11-295P22 from Y, complete sequence
          Length = 205515

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 165   tgatggactcgaatggaatg 184
             ||||||||||||||||||||
Sbjct: 99013 tgatggactcgaatggaatg 98994



to top

>emb|AL133216.10| Human DNA sequence from clone RP11-291L22 on chromosome 10 Contains the
              3' end of a gene for a novel protein similar to
              17-beta-hydroxysteroid dehydrogenase type 7 (HSD17B7), the
              gene for a novel protein similar to CDC10 cell division
              cycle 10, homolog (S. cerevisiae) (CDC10), a novel gene, a
              novel gene containing FLJ14186, a capicua homolog
              (Drosophila) (CIC) pseudogene and a CpG island, complete
              sequence
          Length = 166835

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 165    tgatggactcgaatggaatg 184
              ||||||||||||||||||||
Sbjct: 166206 tgatggactcgaatggaatg 166225



to top

>dbj|BS000654.1| Pan troglodytes chromosome Y clone:PTB-129E12, complete sequences
          Length = 193714

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 165    tgatggactcgaatggaatg 184
              ||||||||||||||||||||
Sbjct: 169111 tgatggactcgaatggaatg 169092



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 167   atggactcgaatggaatgat 186
             ||||||||||||||||||||
Sbjct: 96751 atggactcgaatggaatgat 96732



to top

>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 165     tgatggactcgaatggaatg 184
               ||||||||||||||||||||
Sbjct: 6013860 tgatggactcgaatggaatg 6013841



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 167     atggactcgaatggaatgat 186
               ||||||||||||||||||||
Sbjct: 5941535 atggactcgaatggaatgat 5941516



to top

>gb|AC026405.5| Homo sapiens chromosome 5 clone CTC-347N9, complete sequence
          Length = 168779

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 381   gttgctgatcttgcggagct 400
             ||||||||||||||||||||
Sbjct: 73548 gttgctgatcttgcggagct 73529



to top

>gb|AC172374.4| Pan troglodytes BAC clone CH251-119H6 from chromosome y, complete
             sequence
          Length = 176115

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 165   tgatggactcgaatggaatg 184
             ||||||||||||||||||||
Sbjct: 47526 tgatggactcgaatggaatg 47507



to top

>gb|AC018696.4| Homo sapiens BAC clone RP11-575H3 from 2, complete sequence
          Length = 194995

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 167    atggactcgaatggaatgatccca 190
              ||||||||||||||||| ||||||
Sbjct: 177512 atggactcgaatggaatcatccca 177535



to top

>gb|AC150909.3| Pan troglodytes BAC clone CH251-1056O7 from chromosome y, complete
              sequence
          Length = 178039

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 165    tgatggactcgaatggaatg 184
              ||||||||||||||||||||
Sbjct: 174567 tgatggactcgaatggaatg 174548



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 167    atggactcgaatggaatgat 186
              ||||||||||||||||||||
Sbjct: 102242 atggactcgaatggaatgat 102223



to top

>gb|AC156805.2| Pan troglodytes BAC clone CH251-830G14 from chromosome y, complete
              sequence
          Length = 230623

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 167    atggactcgaatggaatgat 186
              ||||||||||||||||||||
Sbjct: 167411 atggactcgaatggaatgat 167430



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 165   tgatggactcgaatggaatg 184
             ||||||||||||||||||||
Sbjct: 95086 tgatggactcgaatggaatg 95105



to top

>gb|AC137499.2| Homo sapiens chromosome 16 clone RP11-317D10, complete sequence
          Length = 159831

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 167   atggactcgaatggaatgat 186
             ||||||||||||||||||||
Sbjct: 34768 atggactcgaatggaatgat 34787



to top

>gb|AC130474.12| Mus musculus chromosome 7, clone RP23-178C20, complete sequence
          Length = 232792

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 372    gctgagcaagttgctgatct 391
              ||||||||||||||||||||
Sbjct: 129193 gctgagcaagttgctgatct 129174


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,552,410
Number of Sequences: 3902068
Number of extensions: 2552410
Number of successful extensions: 51608
Number of sequences better than 10.0: 28
Number of HSP's better than 10.0 without gapping: 28
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 48194
Number of HSP's gapped (non-prelim): 3410
length of query: 403
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 381
effective length of database: 17,147,199,772
effective search space: 6533083113132
effective search space used: 6533083113132
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top