>gb|AC121523.6| Mus musculus chromosome 18, clone RP24-92N23, complete sequence
          Length = 202346

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 12     tttccacgtgaatgtcctcc 31
              ||||||||||||||||||||
Sbjct: 165111 tttccacgtgaatgtcctcc 165130

>gb|AC164101.4| Mus musculus BAC clone RP23-421F16 from chromosome 8, complete sequence
          Length = 218236

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 47    ttctgtccagagacggcatacac 69
             |||||| ||||||||||||||||
Sbjct: 24402 ttctgtgcagagacggcatacac 24380

>gb|AC122804.4| Mus musculus BAC clone RP23-296J10 from 6, complete sequence
          Length = 205659

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 42   ctgcattctgtccagagac 60
            |||||||||||||||||||
Sbjct: 7322 ctgcattctgtccagagac 7304

>emb|AL805944.8| Mouse DNA sequence from clone RP24-387A5 on chromosome 4 Contains a novel
              pseudogene, complete sequence
          Length = 195873

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 12     tttccacgtgaatgtcctc 30
              |||||||||||||||||||
Sbjct: 190322 tttccacgtgaatgtcctc 190304

>gb|AC114486.2| Homo sapiens chromosome 1 clone RP11-371A23, complete sequence
          Length = 179070

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 21     gaatgtcctccttcctcat 39
              |||||||||||||||||||
Sbjct: 102865 gaatgtcctccttcctcat 102883

>dbj|AK007800.1| Mus musculus 10 day old male pancreas cDNA, RIKEN full-length
            enriched library, clone:1810047B09 product:hypothetical
            Thioredoxin-like structure containing protein, full
            insert sequence
          Length = 2175

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 42   ctgcattctgtccagagac 60
            |||||||||||||||||||
Sbjct: 1997 ctgcattctgtccagagac 1979

>gb|AC125341.4| Mus musculus BAC clone RP24-459O3 from 6, complete sequence
          Length = 167607

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 42     ctgcattctgtccagagac 60
              |||||||||||||||||||
Sbjct: 131050 ctgcattctgtccagagac 131032


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,071,118
Number of Sequences: 3902068
Number of extensions: 1071118
Number of successful extensions: 85510
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 85496
Number of HSP's gapped (non-prelim): 14
length of query: 147
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 126
effective length of database: 17,151,101,840
effective search space: 2161038831840
effective search space used: 2161038831840
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)