ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbaal39g12 |
|---|---|
| Clone Library Name | barley_pub |
>gb|BT008940.1| Triticum aestivum clone wdi1c.pk007.m16:fis, full insert mRNA sequence Length = 1878 Score = 478 bits (241), Expect = e-131 Identities = 316/341 (92%) Strand = Plus / Minus Query: 235 ggcctgaagctacaaactgctacgcggttgcatgcatgtcaagacctcggccttgagctc 294 |||||||||||||||||||||| ||||||||||||| | |||||||| |||||| ||||| Sbjct: 1655 ggcctgaagctacaaactgctatgcggttgcatgcaagccaagaccttggccttcagctc 1596 Query: 295 ctctcttctaattttgcctgtggtggtcactgggaacggcctactccaatgataatatag 354 ||||||| |||||||||||||||||||||||||||||||||||||||| |||| ||||| Sbjct: 1595 ctctcttttaattttgcctgtggtggtcactgggaacggcctactccagtgatgatataa 1536 Query: 355 ccttggtaccttgaatctgctcagattttttatcctgcagtgctcttgaaggatatgagc 414 ||||| |||||||||||||||||||||||||||||||| | |||||||||||||||||| Sbjct: 1535 tcttggcaccttgaatctgctcagattttttatcctgcaatactcttgaaggatatgagc 1476 Query: 415 agacacttccttgccttctccttggtgctcagctgttgcatcaacccatctccagccatc 474 ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 1475 agacacttcattgccttctccttggtgctcagctgttgcatcaacccatctccagtcatc 1416 Query: 475 cttgatgctaacacaagaaacaattttctccccaaggcgactatccggtacaccgaaaac 534 ||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| Sbjct: 1415 tctgatgctaagacaagcaacaattttctccccaaggcgactatccggtacaccgaaaac 1356 Query: 535 cacagctttagctacccctgggtgctgtgataacactaatt 575 ||||||| |||||||||||| ||| || || | |||||||| Sbjct: 1355 cacagctgtagctacccctgagtgttgcgacagcactaatt 1315
>dbj|AK065929.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013044N22, full insert sequence Length = 1869 Score = 170 bits (86), Expect = 3e-39 Identities = 221/266 (83%) Strand = Plus / Minus Query: 296 tctcttctaattttgcctgtggtggtcactgggaacggcctactccaatgataatatagc 355 |||||||||||||| ||||| || |||||||| || || ||||||| |||||||||| | Sbjct: 1652 tctcttctaattttccctgttgttgtcactggaaatggtttactccactgataatatatc 1593 Query: 356 cttggtaccttgaatctgctcagattttttatcctgcagtgctcttgaaggatatgagca 415 ||||| |||||||||||||||| || ||| | | ||| || |||||||| || || ||| Sbjct: 1592 cttggcaccttgaatctgctcaatttgtttgtacggcaatggtcttgaagcatctgtgca 1533 Query: 416 gacacttccttgccttctccttggtgctcagctgttgcatcaacccatctccagccatcc 475 || ||||| ||||||| || | |||| ||||| ||||||||||||| ||||||||||| Sbjct: 1532 gagacttctctgccttcccccttgtgcacagctcttgcatcaacccagttccagccatcc 1473 Query: 476 ttgatgctaacacaagaaacaattttctccccaaggcgactatccggtacaccgaaaacc 535 ||||||||||||| | ||||||||||||||| || ||||||||||| | || | ||| Sbjct: 1472 ctgatgctaacacaggcaacaattttctccccgagacgactatccggcatgccaatcacc 1413 Query: 536 acagctttagctacccctgggtgctg 561 || |||||||||| ||||||||||| Sbjct: 1412 acggctttagctagacctgggtgctg 1387
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 111 bits (56), Expect = 3e-21 Identities = 137/164 (83%) Strand = Plus / Plus Query: 398 tcttgaaggatatgagcagacacttccttgccttctccttggtgctcagctgttgcatca 457 |||||||| || || ||||| ||||| ||||||| || | |||| ||||| |||||||| Sbjct: 1710866 tcttgaagcatctgtgcagagacttctctgccttcccccttgtgcacagctcttgcatca 1710925 Query: 458 acccatctccagccatccttgatgctaacacaagaaacaattttctccccaaggcgacta 517 ||||| ||||||||||| ||||||||||||| | ||||||||||||||| || |||||| Sbjct: 1710926 acccagttccagccatccctgatgctaacacaggcaacaattttctccccgagacgacta 1710985 Query: 518 tccggtacaccgaaaaccacagctttagctacccctgggtgctg 561 ||||| | || | ||||| |||||||||| ||||||||||| Sbjct: 1710986 tccggcatgccaatcaccacggctttagctagacctgggtgctg 1711029 Score = 75.8 bits (38), Expect = 1e-10 Identities = 68/78 (87%) Strand = Plus / Plus Query: 296 tctcttctaattttgcctgtggtggtcactgggaacggcctactccaatgataatatagc 355 |||||||||||||| ||||| || |||||||| || || ||||||| |||||||||| | Sbjct: 1710369 tctcttctaattttccctgttgttgtcactggaaatggtttactccactgataatatatc 1710428 Query: 356 cttggtaccttgaatctg 373 ||||| |||||||||||| Sbjct: 1710429 cttggcaccttgaatctg 1710446
>dbj|AP004591.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0582D05 Length = 150483 Score = 111 bits (56), Expect = 3e-21 Identities = 137/164 (83%) Strand = Plus / Plus Query: 398 tcttgaaggatatgagcagacacttccttgccttctccttggtgctcagctgttgcatca 457 |||||||| || || ||||| ||||| ||||||| || | |||| ||||| |||||||| Sbjct: 110366 tcttgaagcatctgtgcagagacttctctgccttcccccttgtgcacagctcttgcatca 110425 Query: 458 acccatctccagccatccttgatgctaacacaagaaacaattttctccccaaggcgacta 517 ||||| ||||||||||| ||||||||||||| | ||||||||||||||| || |||||| Sbjct: 110426 acccagttccagccatccctgatgctaacacaggcaacaattttctccccgagacgacta 110485 Query: 518 tccggtacaccgaaaaccacagctttagctacccctgggtgctg 561 ||||| | || | ||||| |||||||||| ||||||||||| Sbjct: 110486 tccggcatgccaatcaccacggctttagctagacctgggtgctg 110529 Score = 75.8 bits (38), Expect = 1e-10 Identities = 68/78 (87%) Strand = Plus / Plus Query: 296 tctcttctaattttgcctgtggtggtcactgggaacggcctactccaatgataatatagc 355 |||||||||||||| ||||| || |||||||| || || ||||||| |||||||||| | Sbjct: 109869 tctcttctaattttccctgttgttgtcactggaaatggtttactccactgataatatatc 109928 Query: 356 cttggtaccttgaatctg 373 ||||| |||||||||||| Sbjct: 109929 cttggcaccttgaatctg 109946
>gb|AC145687.4| Pan troglodytes BAC clone CH251-281C1 from X, complete sequence Length = 138000 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 400 ttgaaggatatgagcagacacttc 423 |||||||||||||||||||||||| Sbjct: 24372 ttgaaggatatgagcagacacttc 24349
>gb|AC004936.2| Homo sapiens PAC clone RP5-959C21 from 7, complete sequence Length = 139949 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttcc 424 |||||||||||||||||||||||| Sbjct: 6029 tgaaggatatgagcagacacttcc 6006
>gb|AC093832.2| Homo sapiens BAC clone RP11-402L11 from 4, complete sequence Length = 187232 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 400 ttgaaggatatgagcagacacttc 423 |||||||||||||||||||||||| Sbjct: 107791 ttgaaggatatgagcagacacttc 107768
>gb|AC005023.1|AC005023 Homo sapiens BAC clone GS1-421I3 from Xq25-q26, complete sequence Length = 170967 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 400 ttgaaggatatgagcagacacttc 423 |||||||||||||||||||||||| Sbjct: 157027 ttgaaggatatgagcagacacttc 157050
>gb|AC186551.1| Pan troglodytes chromosome 7 clone CH251-720G4, complete sequence Length = 173362 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 22124 tgaaggatatgagcagacacttc 22102
>gb|AC148876.2| Pan troglodytes BAC clone CH251-50I16 from Y, complete sequence Length = 182194 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 65164 tgaaggatatgagcagacacttc 65186
>gb|AC146453.3| Pan troglodytes BAC clone CH251-510F17 from Y, complete sequence Length = 215114 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 58857 tgaaggatatgagcagacacttc 58835
>gb|AC147675.2| Pan troglodytes BAC clone CH251-6P20 from Y, complete sequence Length = 166567 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 160298 tgaaggatatgagcagacacttc 160320
>gb|AC018360.16| Homo sapiens 3 BAC RP11-67D16 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 179993 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 20168 tgaaggatatgagcagacacttc 20190
>gb|AC073332.13| Homo sapiens BAC clone RP11-435M6 from 7, complete sequence Length = 132191 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 84739 tgaaggatatgagcagacacttc 84761 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 87799 aaggatatgagcagacacttc 87819
>emb|AL590987.8| Human DNA sequence from clone RP11-427G13 on chromosome 1, complete sequence Length = 81490 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 72411 tgaaggatatgagcagacacttc 72433
>emb|AL360270.18| Human DNA sequence from clone RP11-96K19 on chromosome 1 Contains a putative novel transcript, a gene for a novel protein (FLJ11269), a processed pseudogene for cyclin T2 (CCNT2) and a CpG island, complete sequence Length = 172805 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 136149 tgaaggatatgagcagacacttc 136127
>emb|AL158043.14| Human DNA sequence from clone RP11-5N23 on chromosome 10p14-15.3 Contains the 5' end of the PRKCQ gene for protein kinase C, theta, a novel gene and a CpG island, complete sequence Length = 132741 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 62543 tgaaggatatgagcagacacttc 62565
>emb|AL157360.8| Human DNA sequence from clone RP11-111C7 on chromosome 13, complete sequence Length = 148861 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 62587 tgaaggatatgagcagacacttc 62565
>emb|AL139192.8| Human DNA sequence from clone RP11-515I23 on chromosome Xq13.2-21.2 Contains the 5' end of a novel gene, complete sequence Length = 94056 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 241 tgaaggatatgagcagacacttc 219
>emb|AL133513.12| Human DNA sequence from clone RP11-400G3 on chromosome 10 Contains the 3' end of the CYP2C19 gene for cytochrome P450 family 2 subfamily C polypeptide 19, a cytochrome P450 family 2 subfamily C pseudogene, a ribosomal protein L7a (RPL7A) pseudogene, complete sequence Length = 139744 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 109536 tgaaggatatgagcagacacttc 109558
>emb|AL078601.10|HSJ232L24 Human DNA sequence from clone RP1-232L24 on chromosome 6q13-15 Contains a DBI diazepam binding inhibitor pseudogene (DBI), part of a novel gene and a high-mobility group (nonhistone chromosomal) protein 17 (HMG17) pseudogene, complete sequence Length = 97004 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 83194 tgaaggatatgagcagacacttc 83216
>gb|AC090133.6| Homo sapiens chromosome 8, clone RP11-813L8, complete sequence Length = 201279 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 13329 tgaaggatatgagcagacacttc 13351
>dbj|BS000655.1| Pan troglodytes chromosome Y clone:PTB-215M20, complete sequences Length = 152092 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 77272 tgaaggatatgagcagacacttc 77294
>dbj|BS000623.1| Pan troglodytes chromosome Y clone:PTBY-008C04, complete sequences Length = 106416 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 94443 tgaaggatatgagcagacacttc 94421
>dbj|BS000615.1| Pan troglodytes chromosome Y clone:PTBY-009P07, complete sequences Length = 105898 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 81647 tgaaggatatgagcagacacttc 81669
>dbj|BS000566.1| Pan troglodytes chromosome Y clone:PTFY-001D15, complete sequences Length = 42798 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 8745 tgaaggatatgagcagacacttc 8767
>dbj|BS000609.1| Pan troglodytes chromosome Y clone:PTB-217K15, complete sequences Length = 146625 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 27113 tgaaggatatgagcagacacttc 27091
>dbj|BS000596.1| Pan troglodytes chromosome Y clone:PTB-130H13, complete sequences Length = 182507 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 110899 tgaaggatatgagcagacacttc 110877
>gb|AC104956.6| Homo sapiens chromosome 18, clone RP11-646H8, complete sequence Length = 157587 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 7697 tgaaggatatgagcagacacttc 7675
>gb|AC025888.8| Homo sapiens chromosome 18, clone RP11-479H18, complete sequence Length = 178201 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 158138 tgaaggatatgagcagacacttc 158116
>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence Length = 23952694 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 22629192 tgaaggatatgagcagacacttc 22629214 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 21971237 tgaaggatatgagcagacacttc 21971259 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 21617526 tgaaggatatgagcagacacttc 21617504 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 10366411 gaaggatatgagcagacacttc 10366390 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 5306315 gaaggatatgagcagacacttc 5306336 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 3892998 gaaggatatgagcagacacttc 3893019 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 3832475 gaaggatatgagcagacacttc 3832496
>gb|AC023310.4| Homo sapiens chromosome 15, clone RP11-336L20, complete sequence Length = 177355 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 23744 tgaaggatatgagcagacacttc 23722
>gb|AC108164.5| Homo sapiens BAC clone RP11-714F4 from 4, complete sequence Length = 111729 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 5707 tgaaggatatgagcagacacttc 5685
>gb|AC105273.2| Homo sapiens chromosome 1 clone RP4-716B13, complete sequence Length = 138485 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 42165 tgaaggatatgagcagacacttc 42143
>gb|AC104384.3| Homo sapiens chromosome 8, clone CTD-2381M20, complete sequence Length = 163996 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 88703 tgaaggatatgagcagacacttc 88681
>gb|AC094098.4| Homo sapiens chromosome 5 clone RP11-141F7, complete sequence Length = 138425 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 79684 tgaaggatatgagcagacacttc 79662
>gb|AC097512.2| Homo sapiens BAC clone RP11-412P11 from 4, complete sequence Length = 149282 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 21396 tgaaggatatgagcagacacttc 21374
>gb|AC021733.12| Homo sapiens chromosome 8, clone RP11-775B15, complete sequence Length = 158341 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 132475 tgaaggatatgagcagacacttc 132453
>gb|AC100757.2| Homo sapiens chromosome 15, clone RP11-566K19, complete sequence Length = 171987 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 7721 tgaaggatatgagcagacacttc 7699
>gb|AC091977.3| Homo sapiens chromosome 5 clone RP11-528L24, complete sequence Length = 183494 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 26778 tgaaggatatgagcagacacttc 26756
>gb|AC011059.8| Homo sapiens chromosome 18, clone RP11-11F23, complete sequence Length = 143799 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 55539 tgaaggatatgagcagacacttc 55517
>gb|AC087808.2| Homo sapiens chromosome 8, clone RP11-89A16, complete sequence Length = 189878 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 156396 tgaaggatatgagcagacacttc 156374
>gb|AC034238.4| Homo sapiens chromosome 5 clone CTD-2313F11, complete sequence Length = 117583 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 95873 tgaaggatatgagcagacacttc 95851
>gb|AC151479.4| Pan troglodytes BAC clone CH251-656P8 from chromosome y, complete sequence Length = 179557 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 43259 tgaaggatatgagcagacacttc 43281
>gb|AC107048.3| Homo sapiens BAC clone RP11-21I10 from 4, complete sequence Length = 86165 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 12778 tgaaggatatgagcagacacttc 12756
>gb|AC069336.7| Homo sapiens BAC clone RP11-728F15 from 2, complete sequence Length = 85735 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 35485 tgaaggatatgagcagacacttc 35507
>gb|AC010956.12|AC010956 Homo sapiens, clone RP11-5N23, complete sequence Length = 163805 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 93617 tgaaggatatgagcagacacttc 93639
>gb|AC007601.7| Homo sapiens chromosome 16 clone RP11-276H1, complete sequence Length = 161864 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 72070 tgaaggatatgagcagacacttc 72092
>gb|AC007247.5|AC007247 Homo sapiens BAC clone RP11-305H21 from Y, complete sequence Length = 116788 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 3893 tgaaggatatgagcagacacttc 3871
>gb|AF188029.5| Homo sapiens chromosome 8 clone GS1-56L10 map p22-p21, complete sequence Length = 106784 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 36755 tgaaggatatgagcagacacttc 36733
>gb|AC132153.2| Homo sapiens BAC clone RP11-111G13 from 2, complete sequence Length = 154924 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 79413 tgaaggatatgagcagacacttc 79435
>gb|AC010135.3|AC010135 Homo sapiens BAC clone RP11-128D13 from Y, complete sequence Length = 176951 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 159852 tgaaggatatgagcagacacttc 159874
>gb|AC134676.5| Homo sapiens chromosome 15, clone CTD-2290E14, complete sequence Length = 93881 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 51251 tgaaggatatgagcagacacttc 51229
>gb|AC012486.9| Homo sapiens BAC clone RP11-84A12 from 2, complete sequence Length = 170220 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 11986 tgaaggatatgagcagacacttc 11964
>gb|AC136687.6| Homo sapiens chromosome 15, clone RP11-439M15, complete sequence Length = 180708 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 170255 tgaaggatatgagcagacacttc 170277
>gb|AC022469.5|AC022469 Homo sapiens chromosome 14 clone RP11-588P7 map 14q31, complete sequence Length = 159891 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 110869 tgaaggatatgagcagacacttc 110847
>gb|AC134393.6| Homo sapiens chromosome 15, clone CTC-803A3, complete sequence Length = 132353 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 51334 tgaaggatatgagcagacacttc 51312
>gb|AC131280.9| Homo sapiens chromosome 15, clone RP11-467L19, complete sequence Length = 194754 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 139849 tgaaggatatgagcagacacttc 139871
>gb|AC068630.21| Homo sapiens 3 BAC RP11-289N10 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 164161 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 68027 tgaaggatatgagcagacacttc 68049
>gb|AC159015.2| Pan troglodytes BAC clone CH251-675K5 from chromosome y, complete sequence Length = 213574 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 6228 tgaaggatatgagcagacacttc 6250
>gb|AC018663.3|AC018663 Human Chromosome 7 clone RP11-288A3, complete sequence Length = 170423 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 121358 tgaaggatatgagcagacacttc 121336
>emb|AL136297.3|CNS01DW1 Human chromosome 14 DNA sequence BAC R-60K23 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 163918 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 156844 tgaaggatatgagcagacacttc 156866
>emb|AL138479.4|CNS01DWS Human chromosome 14 DNA sequence BAC R-242G5 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 165228 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 153122 tgaaggatatgagcagacacttc 153100
>dbj|AP001660.1| Homo sapiens genomic DNA, chromosome 21q, section 4/105 Length = 340000 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 203211 tgaaggatatgagcagacacttc 203233
>dbj|AP000676.6| Homo sapiens genomic DNA, chromosome 11 clone:RP11-665E10, complete sequence Length = 161280 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 22595 tgaaggatatgagcagacacttc 22573
>dbj|AP000756.6| Homo sapiens genomic DNA, chromosome 11 clone:RP11-720D4, complete sequence Length = 170977 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 152779 tgaaggatatgagcagacacttc 152757
>emb|AL078615.2|HS98L15 Homo sapiens chromosome 21 PAC RPCIP704L1598Q2, complete sequence Length = 116189 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 14645 tgaaggatatgagcagacacttc 14667
>emb|AL160451.2|HS49E3 Homo sapiens chromosome 21 PAC RPCIP704E349Q2, complete sequence Length = 105570 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 401 tgaaggatatgagcagacacttc 423 ||||||||||||||||||||||| Sbjct: 102458 tgaaggatatgagcagacacttc 102480
>gb|AF402959.1| Oryza sativa chromosome 4 clones V17 and 214, genomic sequence Length = 64224 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 110 caagatttgaatcttggtggac 131 |||||||||||||||||||||| Sbjct: 30952 caagatttgaatcttggtggac 30973
>gb|AC147140.4| Pan troglodytes BAC clone CH251-329N7 from Y, complete sequence Length = 149061 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 144063 gaaggatatgagcagacacttc 144042
>gb|AC147154.4| Pan troglodytes BAC clone CH251-175E24 from Y, complete sequence Length = 157260 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 55456 gaaggatatgagcagacacttc 55435
>gb|AC147119.2| Pan troglodytes BAC clone CH251-518N19 from Y, complete sequence Length = 241976 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 138466 gaaggatatgagcagacacttc 138445
>gb|AC160564.2| Pan troglodytes BAC clone CH251-542C24 from chromosome 5, complete sequence Length = 177047 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacactt 422 |||||||||||||||||||||| Sbjct: 94730 tgaaggatatgagcagacactt 94709
>gb|AC155230.2| Mus musculus BAC clone RP24-335J14 from chromosome 12, complete sequence Length = 135049 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 489 aagaaacaattttctccccaag 510 |||||||||||||||||||||| Sbjct: 122636 aagaaacaattttctccccaag 122657
>gb|U91324.1|HUU91324 Homo sapiens Chromosome 16 BAC clone CIT987-SKA-100B4 ~complete genomic sequence, complete sequence Length = 174826 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 84427 gaaggatatgagcagacacttc 84448 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 31671 aaggatatgagcagacacttc 31691
>gb|AC135253.2| Homo sapiens 3 BAC RP11-324L7 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 154492 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 116663 gaaggatatgagcagacacttc 116642
>gb|AC079796.5| Homo sapiens BAC clone RP11-612L3 from 7, complete sequence Length = 129320 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 66001 gaaggatatgagcagacacttc 66022
>emb|AL589987.25| Human DNA sequence from clone RP11-364B14 on chromosome X Contains a novel gene, a heterogeneous nuclear ribonucleoprotein A3 (HNRPA3) pseudogene, a novel pseudogene and a CpG island, complete sequence Length = 143770 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 45187 gaaggatatgagcagacacttc 45166
>emb|AL590452.12| Human DNA sequence from clone RP11-326G21 on chromosome 1 Contains the 5' end of the PDE4DIP gene for phosphodiesterase 4D interacting protein (myomegalin) and a CpG island, complete sequence Length = 156813 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 150902 gaaggatatgagcagacacttc 150923
>emb|AL512504.9| Human DNA sequence from clone RP11-325E14 on chromosome X Contains a heterogeneous nuclear ribonucleoprotein H3 (2H9) (HNRPH3) pseudogene, a WW domain binding protein 11 (WBP11) pseudogene, a hexokinase 2 (HK2) pseudogene, a proteasome (prosome, macropain) subunit, alpha type, 1 (PSMA1) pseudogene, the 3' end of the gene for a novel WD repeat domain protein and three CpG islands, complete sequence Length = 223078 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 156745 gaaggatatgagcagacacttc 156766
>emb|AL160266.25| Human DNA sequence from clone RP5-1068F3 on chromosome X, complete sequence Length = 134124 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 73150 gaaggatatgagcagacacttc 73129
>emb|AL158819.14| Human DNA sequence from clone RP11-382F24 on chromosome X Contains a NADH dehydrogenase 2 (MTND2) pseudogene, a NADH dehydrogenase 1 (MTND1) pseudogene, the gene for PAGE-5 protein (PAGE-5) and two novel genes, complete sequence Length = 174913 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 64487 gaaggatatgagcagacacttc 64508
>emb|AL157877.11| Human DNA sequence from clone RP11-2P5 on chromosome 13 Contains the 5' end of a novel gene, the gene for suppressor of G2 allele of SKP1, S. cerevisiae, the 5' end of a gene similar to TPTE and PTEN homologous inositol lipid phosphatase (TPIP) , a pseudogene similar to part of regulator of G-protein signalling 17 (RGS17), the WBP4 gene for WW domain binding protein 4 (formin binding protein 21) and 4 CpG islands, complete sequence Length = 198567 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 147833 gaaggatatgagcagacacttc 147812
>emb|AL022717.2|HS201D7 Human DNA sequence from clone RP1-201D7 on chromosome 6p22.1-22.3 Contains part of a novel gene (FLJ20342), complete sequence Length = 100733 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 43361 gaaggatatgagcagacacttc 43340
>gb|AC114322.2| Homo sapiens chromosome 5 clone RP11-74D3, complete sequence Length = 133348 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 129445 gaaggatatgagcagacacttc 129466
>gb|AC104995.4| Homo sapiens chromosome 8, clone RP11-1130I3, complete sequence Length = 159240 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 86446 gaaggatatgagcagacacttc 86425
>gb|AC093430.3| Homo sapiens chromosome 1 clone RP11-171B15, complete sequence Length = 153414 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 17814 gaaggatatgagcagacacttc 17793
>gb|AC023170.10| Homo sapiens chromosome 10 clone RP11-373P23, complete sequence Length = 195448 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 111194 gaaggatatgagcagacacttc 111215
>gb|AC098651.3| Homo sapiens chromosome 1 clone RP11-548C21, complete sequence Length = 78483 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 25190 gaaggatatgagcagacacttc 25169
>gb|AC095036.2| Homo sapiens chromosome 1 clone RP11-320E2, complete sequence Length = 191499 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 174891 gaaggatatgagcagacacttc 174912
>gb|AC025772.6| Homo sapiens chromosome 5 clone CTD-2229C24, complete sequence Length = 31085 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 22026 gaaggatatgagcagacacttc 22047
>gb|AC105193.4| Homo sapiens chromosome 8, clone RP11-379M16, complete sequence Length = 171256 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 2757 gaaggatatgagcagacacttc 2736
>gb|AC174482.4| Pan troglodytes BAC clone CH251-527O19 from chromosome y, complete sequence Length = 189332 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 85818 gaaggatatgagcagacacttc 85797
>gb|AC012337.8| Homo sapiens chromosome , clone RP11-119O22, complete sequence Length = 171695 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 12799 gaaggatatgagcagacacttc 12820
>gb|AC026827.6| Homo sapiens chromosome 8, clone RP11-678C14, complete sequence Length = 186183 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 58036 gaaggatatgagcagacacttc 58057
>gb|AC159623.3| Mus musculus BAC clone RP24-308O7 from chromosome 12, complete sequence Length = 165043 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 489 aagaaacaattttctccccaag 510 |||||||||||||||||||||| Sbjct: 145918 aagaaacaattttctccccaag 145897
>gb|AC026398.5| Homo sapiens chromosome 5 clone CTB-127M13, complete sequence Length = 88783 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 79982 gaaggatatgagcagacacttc 80003
>gb|AC024941.30|AC024941 Homo sapiens 12 BAC RP11-900F13 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 172246 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 151338 gaaggatatgagcagacacttc 151317
>gb|AC073538.5|AC073538 Homo sapiens chromosome 5 clone CTD-2338P8, complete sequence Length = 98291 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 17208 gaaggatatgagcagacacttc 17229
>gb|AC016705.4|AC016705 Homo sapiens BAC clone RP11-210M15 from 15, complete sequence Length = 177964 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 21073 gaaggatatgagcagacacttc 21052
>gb|AC011930.5|AC011930 Homo sapiens, clone RP11-16B21, complete sequence Length = 164168 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 6737 gaaggatatgagcagacacttc 6758
>gb|AC092635.2| Homo sapiens BAC clone RP11-342E23 from 2, complete sequence Length = 125316 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 4039 gaaggatatgagcagacacttc 4018
>gb|AC093843.2| Homo sapiens BAC clone RP11-444B5 from 2, complete sequence Length = 86897 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 401 tgaaggatatgagcagacactt 422 |||||||||||||||||||||| Sbjct: 67667 tgaaggatatgagcagacactt 67688
>gb|AC009238.4| Homo sapiens BAC clone RP11-468G5 from 2, complete sequence Length = 202361 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 187346 gaaggatatgagcagacacttc 187367
>gb|AC133477.2| Homo sapiens 3 BAC RP11-364M20 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 101061 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacactt 422 |||||||||||||||||||||| Sbjct: 61977 tgaaggatatgagcagacactt 61956
>gb|AC136759.4| Homo sapiens chromosome 11, clone RP11-114J20, complete sequence Length = 152269 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 21780 gaaggatatgagcagacacttc 21759
>gb|AC006452.5| Homo sapiens PAC clone RP4-592P3 from 7, complete sequence Length = 121705 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 101427 gaaggatatgagcagacacttc 101406
>gb|AC078820.28| Homo sapiens 12 BAC RP11-114H23 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 164812 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 15630 gaaggatatgagcagacacttc 15609
>gb|AC146246.4| Pan troglodytes BAC clone clone CH251-154C4 from y, complete sequence Length = 149616 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 94092 gaaggatatgagcagacacttc 94113
>dbj|BS000115.1| Pan troglodytes chromosome 22 clone:PTB-047E23, map 22, complete sequences Length = 150496 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 108350 gaaggatatgagcagacacttc 108371
>dbj|BS000147.1| Pan troglodytes chromosome 22 clone:PTB-072G02, map 22, complete sequences Length = 179346 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 71380 gaaggatatgagcagacacttc 71359
>dbj|BS000072.1| Pan troglodytes chromosome 22 clone:RP43-156P08, map 22, complete sequences Length = 155118 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 55424 gaaggatatgagcagacacttc 55403
>dbj|BS000071.1| Pan troglodytes chromosome 22 clone:RP43-104O21, map 22, complete sequences Length = 153441 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 137605 gaaggatatgagcagacacttc 137584
>emb|CT737354.2| Human DNA sequence from clone XX-HCC1954_39C20, complete sequence Length = 148559 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 35427 gaaggatatgagcagacacttc 35406 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttcc 424 |||||||||||| ||||||||||| Sbjct: 116064 tgaaggatatgaacagacacttcc 116041
>emb|AL160471.5|CNS01RH4 Human chromosome 14 DNA sequence BAC R-304L20 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 193559 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 80627 gaaggatatgagcagacacttc 80606
>gb|AC006556.3|AC006556 Homo sapiens, clone hRPK.37_A_1, complete sequence Length = 156833 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 138553 gaaggatatgagcagacacttc 138532
>emb|AL352982.3|CNS05TBY Human chromosome 14 DNA sequence Partial sequence from BAC R-661F4 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 157058 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 55611 gaaggatatgagcagacacttc 55632
>dbj|AP002812.3| Homo sapiens genomic DNA, chromosome 11q clone:RP11-91P24, complete sequences Length = 169250 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 126490 gaaggatatgagcagacacttc 126511
>gb|AC006133.1|AC006133 Homo sapiens chromosome 19, cosmid R30692, complete sequence Length = 43859 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 18505 gaaggatatgagcagacacttc 18484
>emb|CT005243.3| Pan troglodytes chromosome X clone RP43-008I08 map Xq28, complete sequence Length = 180222 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 83109 gaaggatatgagcagacacttc 83088
>dbj|AP005356.2| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1198A4, complete sequence Length = 159758 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 158052 gaaggatatgagcagacacttc 158073
>dbj|AP004286.2| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1425B2, complete sequence Length = 175274 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 402 gaaggatatgagcagacacttc 423 |||||||||||||||||||||| Sbjct: 89724 gaaggatatgagcagacacttc 89745
>gb|U39743.2| Caenorhabditis elegans cosmid R173, complete sequence Length = 34861 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Plus Query: 5 attaacttttatttttacaaaatggtgtt 33 ||||||| ||||||||||||||| ||||| Sbjct: 21665 attaactcttatttttacaaaattgtgtt 21693
>gb|AC142497.3| Homo sapiens chromosome X clone RP11-959H17 map p11.23, complete sequence Length = 147127 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 100726 aaggatatgagcagacacttc 100706
>gb|AC142496.2| Homo sapiens chromosome X clone RP1-8N8 map p11.23, complete sequence Length = 119525 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 23445 aaggatatgagcagacacttc 23425
>gb|AC102483.8| Mus musculus chromosome 1, clone RP24-450F12, complete sequence Length = 167656 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 414 cagacacttccttgccttctc 434 ||||||||||||||||||||| Sbjct: 96430 cagacacttccttgccttctc 96450
>gb|DQ478408.1| Homo sapiens neighbor of BRCA1 gene 1 (NBR1) gene, partial cds; neighbor of BRCA1 gene 2 (NBR2) gene, complete cds; and early onset breast cancer 1 (BRCA1) gene, partial cds Length = 150505 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 60931 aaggatatgagcagacacttc 60911
>gb|DQ190457.1| Homo sapiens clone mck41_A neighbor of BRCA1 gene 1 (NBR1) gene, partial cds; hypothetical protein LOC10230 (NBR2) gene, complete cds; and breast cancer 1 early onset (BRCA1) gene, partial cds Length = 147576 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 57999 aaggatatgagcagacacttc 57979
>gb|DQ190456.1| Homo sapiens clone mck578_U neighbor of BRCA1 gene 1 (NBR1) gene, partial cds; and hypothetical protein LOC10230 (NBR2) and breast cancer 1 early onset (BRCA1) genes, complete cds Length = 150669 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 58035 aaggatatgagcagacacttc 58015
>gb|DQ190455.1| Homo sapiens clone mck554_A neighbor of BRCA1 gene 1 (NBR1) gene, partial cds; and hypothetical protein LOC10230 (NBR2) and breast cancer 1 early onset (BRCA1) genes, complete cds Length = 155470 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 60604 aaggatatgagcagacacttc 60584
>gb|DQ190454.1| Homo sapiens clone mck43_A neighbor of BRCA1 gene 1 (NBR1) gene, partial cds; and hypothetical protein LOC10230 (NBR2) and breast cancer 1 early onset (BRCA1) genes, complete cds Length = 150582 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 53456 aaggatatgagcagacacttc 53436
>gb|DQ190453.1| Homo sapiens clone mck55_A neighbor of BRCA1 gene 1 (NBR1) gene, partial cds; and hypothetical protein LOC10230 (NBR2) and breast cancer 1 early onset (BRCA1) genes, complete cds Length = 156879 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 59304 aaggatatgagcagacacttc 59284
>gb|DQ190452.1| Homo sapiens clone mck94_A neighbor of BRCA1 gene 1 (NBR1) gene, partial cds; and hypothetical protein LOC10230 (NBR2) and breast cancer 1 early onset (BRCA1) genes, complete cds Length = 156121 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 56941 aaggatatgagcagacacttc 56921
>gb|DQ190451.1| Homo sapiens clone mck47_A neighbor of BRCA1 gene 1 (NBR1) gene, partial cds; and hypothetical protein LOC10230 (NBR2) and breast cancer 1 early onset (BRCA1) genes, complete cds Length = 161765 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 57014 aaggatatgagcagacacttc 56994
>gb|DQ190450.1| Homo sapiens clone mck432_A neighbor of BRCA1 gene 1 (NBR1) gene, partial cds; and hypothetical protein LOC10230 (NBR2) and breast cancer 1 early onset (BRCA1) genes, complete cds Length = 167910 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 57884 aaggatatgagcagacacttc 57864
>gb|AC073221.9| Homo sapiens BAC clone RP11-543D8 from 7, complete sequence Length = 94027 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 13301 aaggatatgagcagacacttc 13281
>gb|AY525610.1| Homo sapiens progesterone receptor (PGR) gene, complete cds Length = 96124 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 26126 aaggatatgagcagacacttc 26106
>gb|AC004451.2| Homo sapiens PAC clone RP4-789N1 from 7, complete sequence Length = 108642 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 50067 aaggatatgagcagacacttc 50047
>gb|AC004848.1| Homo sapiens PAC clone RP4-649P17 from 7, complete sequence Length = 135214 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 23191 aaggatatgagcagacacttc 23211
>gb|AC146275.2| Pan troglodytes BAC clone RP43-30A5 from 7, complete sequence Length = 179711 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 12100 aaggatatgagcagacacttc 12080
>gb|AC002519.1|HUAC002519 Human Chromosome 16 BAC clone CIT987SK-A-355G7, complete sequence Length = 139958 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 87937 aaggatatgagcagacacttc 87957
>gb|AC073903.8| Homo sapiens BAC clone RP11-564F5 from 7, complete sequence Length = 80531 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 49076 aaggatatgagcagacacttc 49056
>gb|AC146161.2| Pan troglodytes BAC clone RP43-1G6 from 7, complete sequence Length = 205885 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 128698 aaggatatgagcagacacttc 128718
>emb|X12824.1|MMTKP Mouse thymidine kinase gene promoter Length = 491 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 66 ggcttgtgggcatcctaaaat 86 ||||||||||||||||||||| Sbjct: 208 ggcttgtgggcatcctaaaat 228
>emb|Z98303.1|HS140H19 Human DNA sequence from clone GS1-140H19 on chromosome Xq24-25, complete sequence Length = 16463 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 9644 aaggatatgagcagacacttc 9664
>emb|Z99572.1|HS86F14 Human DNA sequence from clone RP1-86F14 on chromosome 1q23-24 Contains the F5 gene for coagulation factor V (proaccelerin labile factor) and the 3' end of the SELP gene for selectin P (granule membrane protein 140kDa antigen CD62), complete sequence Length = 106571 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 16480 aaggatatgagcagacacttc 16500
>emb|BX276092.9| Human DNA sequence from clone RP11-402P6 on chromosome X Contains five novel genes, five NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa (NDUFA4) pseudogenes and two CpG islands, complete sequence Length = 201575 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 155766 aaggatatgagcagacacttc 155746
>emb|AL731567.6| Human DNA sequence from clone RP11-67C2 on chromosome 10 Contains the ALOX5 gene for arachidonate 5-lipoxygenase, a novel gene, the 3' end of a gene for cellular modulator of immune recognition (c-MIR) and five CpG islands, complete sequence Length = 129266 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 75067 aaggatatgagcagacacttc 75087
>emb|AL627390.7| Human DNA sequence from clone RP13-278H16 on chromosome X Contains part of the TEX11 gene for testis expressed sequence 11 and a novel pseudogene, complete sequence Length = 175660 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 8524 aaggatatgagcagacacttc 8544
>emb|AL603831.23| Human DNA sequence from clone RP11-486H9 on chromosome 10 Contains the 3' end of the gene for adenovirus 5 E1A binding protein (BS69), the gene for a novel protein (KIAA0934) and four CpG islands, complete sequence Length = 179755 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 14866 aaggatatgagcagacacttc 14886
>emb|AL591718.14| Human DNA sequence from clone RP11-399A15 on chromosome 6 Contains the 5' end of HCRTR2 gene for hypocretin (orexin) receptor 2, complete sequence Length = 159698 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 89302 aaggatatgagcagacacttc 89282
>emb|AL591587.9| Human DNA sequence from clone RP11-315O19 on chromosome X Contains a IMP (inosine monophosphate) dehydrogenase 1 (IMPDH1) pseudogene, complete sequence Length = 78767 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 5563 aaggatatgagcagacacttc 5543
>emb|AL592043.7| Human DNA sequence from clone RP11-281B1 on chromosome Xp21.3-22.12 Contains part of a novel gene, an arginine/serine-rich splicing factor 2 (SFRS2) pseudogene and a CpG island, complete sequence Length = 184391 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 133635 aaggatatgagcagacacttc 133655
>emb|AL592483.6| Human DNA sequence from clone RP11-815M8 on chromosome 1 Contains the 3' end of a novel gene, complete sequence Length = 123556 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 115884 aaggatatgagcagacacttc 115904
>emb|AL592049.3| Human DNA sequence from clone RP11-747I9 on chromosome Xq11.1-12 Contains a novel pseudogene, complete sequence Length = 104353 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 87963 aaggatatgagcagacacttc 87943
>emb|AL591344.1| Human DNA sequence from clone RP11-260H5 on chromosome 6 Contains the 3' end of the gene for RU2 (RU2S), complete sequence Length = 63676 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 44431 aaggatatgagcagacacttc 44451
>emb|AL589963.7| Human DNA sequence from clone RP11-133I21 on chromosome 6 Contains part of the gene for a novel protein containing CH domains (contains KIAA1756, FLJ30878 and the likely ortholog of rat CPG2) and part of a novel gene, complete sequence Length = 86565 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 37563 aaggatatgagcagacacttc 37583
>emb|AL590809.5| Human DNA sequence from clone RP11-733H21 on chromosome Xq23-24, complete sequence Length = 105329 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 7934 aaggatatgagcagacacttc 7954
>emb|AL591046.4| Human DNA sequence from clone RP11-96O10 on chromosome 6, complete sequence Length = 194466 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 91717 aaggatatgagcagacacttc 91697
>emb|AL590222.4| Human DNA sequence from clone RP11-159L8 on chromosome Xq13.2-21.2 Contains the gene for a putative purinergic receptor (FKSG79), complete sequence Length = 166810 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 104958 aaggatatgagcagacacttc 104938
>emb|AL589952.2| Human DNA sequence from clone RP11-122L16 on chromosome 6, complete sequence Length = 40893 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 39809 aaggatatgagcagacacttc 39829
>emb|AL512882.5| Human DNA sequence from clone RP11-441A11 on chromosome X Contains a mannose-6-phosphate receptor (cation dependent) (M6PR) pseudogene, complete sequence Length = 39954 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 35190 aaggatatgagcagacacttc 35170
>emb|AL445231.8| Human DNA sequence from clone RP11-27K13 on chromosome 1 Contains the 3' end of the PTGFRN gene for prostaglandin F2 receptor negative regulator, the IGSF2 gene for immunoglobulin superfamily member 2, a novel gene (FLJ42338), the 5' end of the TTF2 gene for RNA polymerase II transcription termination factor and a CpG island, complete sequence Length = 126847 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 43957 aaggatatgagcagacacttc 43977
>emb|AL445990.7| Human DNA sequence from clone RP11-103A6 on chromosome 1 Contains part of the DNM3 gene for dynamin 3, complete sequence Length = 42418 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 549 aaggatatgagcagacacttc 569
>emb|AL390955.20| Human DNA sequence from clone RP5-933K21 on chromosome 6q25.2-26 Contains the 5' end of the C6orf35 gene for chromosome 6 open reading frame 35 (BM033), a steroid dehydrogenase homolog pseudogene and a CpG island, complete sequence Length = 56813 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 31305 aaggatatgagcagacacttc 31325
>emb|AL391002.9| Human DNA sequence from clone RP11-490H23 on chromosome Xq25-26.1, complete sequence Length = 85637 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 402 gaaggatatgagcagacactt 422 ||||||||||||||||||||| Sbjct: 63738 gaaggatatgagcagacactt 63718
>emb|AL356059.27| Human DNA sequence from clone RP11-192G4 on chromosome 1 Contains part of the COL24A1 gene for collagen type XXIV alpha 1, complete sequence Length = 76418 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 59150 aaggatatgagcagacacttc 59130
>emb|AL356454.15| Human DNA sequence from clone RP11-458J24 on chromosome 6, complete sequence Length = 174333 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 131547 aaggatatgagcagacacttc 131567
>emb|AL356284.11| Human DNA sequence from clone RP11-438E12 on chromosome 9, complete sequence Length = 180611 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 179563 aaggatatgagcagacacttc 179583
>emb|AL354820.18| Human DNA sequence from clone RP11-550E22 on chromosome 13 Contains part of a novel gene, the 5' end of the DDX26 gene for DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26 (HDB, DBI-1, DICE1, NOTCHL2,Notchl2, DKFZP434B105), part of a novel gene, a ribosomal protein S4, X-linked (RPS4X) pseudogene, a small nuclear ribonucleoprotein polypeptide G pseudogene and a CpG island, complete sequence Length = 165987 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 121209 aaggatatgagcagacacttc 121229
>emb|AL353590.14| Human DNA sequence from clone RP11-420P23 on chromosome 9, complete sequence Length = 159927 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 952 aaggatatgagcagacacttc 972
>emb|AL354828.12| Human DNA sequence from clone RP11-274P12 on chromosome 13 Contains a ferritin heavy polypeptide 1 (FTH1) pseudogene and a DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 39 (DDX39) (DDXL, MGC8471, MGC8203) pseudogene, complete sequence Length = 168114 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacacttcct 425 |||||||||||| |||||||||||| Sbjct: 35132 tgaaggatatgaacagacacttcct 35108
>emb|AL354829.8| Human DNA sequence from clone RP11-218B22 on chromosome 13 Contains the 3' end of the DIAPH3 gene for diaphanous homolog 3 (Drosophila), complete sequence Length = 154212 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 399 cttgaaggatatgagcagacacttc 423 |||||||||||||| |||||||||| Sbjct: 56867 cttgaaggatatgaacagacacttc 56843
>emb|AL160010.14| Human DNA sequence from clone RP11-146P20 on chromosome 10 Contains part of the gene for VPS10 domain receptor protein SORCS 1, complete sequence Length = 158724 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 40139 aaggatatgagcagacacttc 40119
>emb|AL161935.10| Human DNA sequence from clone RP11-472N13 on chromosome 10 Contains the 3' end of the TCF8 gene for transcription factor 8 (represses interleukin 2 expression), two novel genes, the glutamate dehydrogenase pseudogene 5 (GLUDP5) and a CpG island, complete sequence Length = 191824 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 118075 aaggatatgagcagacacttc 118055
>gb|AC099535.2| Homo sapiens chromosome 3 clone RP11-2G22, complete sequence Length = 181720 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 6318 aaggatatgagcagacacttc 6338
>emb|AL139135.15| Human DNA sequence from clone RP11-463J7 on chromosome 1q31.1-31.3 Contains a coronin actin binding protein 1C (CORO1C) pseudogene, the 3' end of a novel gene and a glycine cleavage system protein H (aminomethyl carrier) (GCSH) pseudogene, complete sequence Length = 165919 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 55367 aaggatatgagcagacacttc 55347
>gb|AC098652.2| Homo sapiens chromosome 1 clone RP11-24D16, complete sequence Length = 156393 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 152879 aaggatatgagcagacacttc 152899
>emb|AL137843.4| Human DNA sequence from clone RP3-377O6 on chromosome Xq22.2-23 Contains a thyroid autoantigen 70kDa (Ku antigen) (G22P1) pseudogene, complete sequence Length = 133402 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 111209 aaggatatgagcagacacttc 111229
>emb|AL121999.18|HSJ543J13 Human DNA sequence from clone RP4-543J13 on chromosome 1p13.1-13.3 Contains a novel gene, complete sequence Length = 137490 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 132870 aaggatatgagcagacacttc 132890
>emb|AL133457.8| Human DNA sequence from clone RP1-149C7 on chromosome 6q15-16.3 Contains STSs and GSSs, complete sequence Length = 85467 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 21051 aaggatatgagcagacacttc 21071
>emb|AL121973.2|HSJ401O12 Human DNA sequence from clone RP3-401O12 on chromosome 6p11.2-21.1, complete sequence Length = 82922 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 40310 aaggatatgagcagacacttc 40290
>emb|AL049634.8|HSJ576H24 Human DNA sequence from clone RP4-576H24 on chromosome 20 Contains the PTPNS1L12 gene for protein tyrosine phosphatase (non-receptor type substrate 1-like 2), a PTPNS pseudogene and part of the SIRPB1 gene for signal regulatory protein beta 1, complete sequence Length = 115478 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 402 gaaggatatgagcagacactt 422 ||||||||||||||||||||| Sbjct: 45330 gaaggatatgagcagacactt 45310
>emb|AL050401.5|HSJ519P24 Human DNA sequence from clone RP3-519P24 on chromosome Xq22.1-23 Contains part of the IL1RAPL2 gene for interleukin 1 receptor accessory protein-like 2 and a prohibitin (PHB) pseudogene, complete sequence Length = 112203 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 61769 aaggatatgagcagacacttc 61789
>emb|AL035494.8|HS635G19 Human DNA sequence from clone RP4-635G19 on chromosome Xq22.1-22.3 Contains a laminin receptor 1 (ribosomal protein SA, 67kDa)(LAMR1) pseudogene, a novel Brain expressed X-linked like family protein (FLJ10097) and a CpG island, complete sequence Length = 69648 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 47489 aaggatatgagcagacacttc 47469
>gb|AC133142.2| Homo sapiens chromosome 3 clone RP11-478I1, complete sequence Length = 19658 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 3772 aaggatatgagcagacacttc 3752
>gb|AC099742.2| Papio anubis clone RP41-167P22, complete sequence Length = 171612 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 14926 aaggatatgagcagacacttc 14946
>gb|AC107313.5| Homo sapiens 3 BAC RP11-572L16 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 192509 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 125107 aaggatatgagcagacacttc 125087
>emb|AL954238.1| Pan troglodytes chromosome 22 clone RP43-006A20 map 22q22.2-q22.3, complete sequence Length = 165383 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 34511 aaggatatgagcagacacttc 34491
>gb|AC093230.2| Homo sapiens chromosome 19 clone LLNLF-130H12, complete sequence Length = 46127 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 18960 aaggatatgagcagacacttc 18980 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 10867 aaggatatgagcagacacttc 10887
>gb|AC087348.6| Homo sapiens chromosome 8, clone RP11-333H13, complete sequence Length = 173380 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 125928 aaggatatgagcagacacttc 125948
>gb|AC092909.6| Homo sapiens 3q BAC RP11-620O17 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 165589 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 73431 aaggatatgagcagacacttc 73451
>gb|AC129415.1| Homo sapiens 3 BAC RP11-382L10 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 110116 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 93627 aaggatatgagcagacacttc 93647
>gb|AC125610.4| Homo sapiens 3 BAC RP11-189B7 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 159706 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 147947 aaggatatgagcagacacttc 147927
>gb|AC117397.2| Homo sapiens 3 BAC RP11-92D20 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 128398 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 63614 aaggatatgagcagacacttc 63594
>dbj|AK125782.1| Homo sapiens cDNA FLJ43794 fis, clone TESTI4000068 Length = 4048 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 402 gaaggatatgagcagacactt 422 ||||||||||||||||||||| Sbjct: 2928 gaaggatatgagcagacactt 2948
>gb|AC182462.3| Pan troglodytes BAC clone CH251-572M16 from chromosome 1, complete sequence Length = 158275 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 15427 aaggatatgagcagacacttc 15407
>gb|AC114806.5| Homo sapiens BAC clone RP11-1251F13 from 4, complete sequence Length = 138121 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 124825 aaggatatgagcagacacttc 124845 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 8679 aaggatatgagcagacacttc 8699
>gb|AC096541.2| Homo sapiens chromosome 1 clone RP11-330M19, complete sequence Length = 200368 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 197510 aaggatatgagcagacacttc 197530
>gb|AC092765.2| Homo sapiens chromosome 1 clone RP11-400N13, complete sequence Length = 188261 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 27311 aaggatatgagcagacacttc 27331
>gb|AC114275.2| Homo sapiens chromosome 5 clone CTC-345E17, complete sequence Length = 51932 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 402 gaaggatatgagcagacactt 422 ||||||||||||||||||||| Sbjct: 9080 gaaggatatgagcagacactt 9100
>gb|AC093006.4| Homo sapiens 3 BAC RP11-394D14 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 215577 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 32771 aaggatatgagcagacacttc 32751
>gb|AC117523.2| Homo sapiens chromosome 5 clone RP11-1084O22, complete sequence Length = 124957 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 63613 aaggatatgagcagacacttc 63593
>gb|AC117398.3| Homo sapiens 3 BAC RP11-715A9 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 109182 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 40134 aaggatatgagcagacacttc 40154
>gb|AC020980.6| Homo sapiens chromosome 5 clone RPCI-1_167G20, complete sequence Length = 175177 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 94829 aaggatatgagcagacacttc 94809
>gb|AC010242.7| Homo sapiens chromosome 5 clone CTC-359E10, complete sequence Length = 174293 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 142478 aaggatatgagcagacacttc 142498
>gb|AC023902.7| Homo sapiens chromosome 10 clone RP11-152G7, complete sequence Length = 187490 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 182357 aaggatatgagcagacacttc 182337
>gb|AC104816.4| Homo sapiens BAC clone RP11-690I4 from 4, complete sequence Length = 169243 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 78950 aaggatatgagcagacacttc 78930
>gb|AC082650.6| Homo sapiens BAC clone RP11-419L4 from 4, complete sequence Length = 169408 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 88976 aaggatatgagcagacacttc 88996
>gb|AC009191.5| Homo sapiens chromosome 5 clone RPCI-1_220J2, complete sequence Length = 51111 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 402 gaaggatatgagcagacactt 422 ||||||||||||||||||||| Sbjct: 33532 gaaggatatgagcagacactt 33512
>gb|AC084290.15| Homo sapiens 12 BAC RP11-568G5 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 55001 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 8350 aaggatatgagcagacacttc 8370
>gb|AC099051.2| Homo sapiens chromosome 3 clone RP11-416A9, complete sequence Length = 174372 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 14645 aaggatatgagcagacacttc 14665
>gb|AC073535.3| Homo sapiens chromosome 19 clone CTD-2037K13, complete sequence Length = 150840 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 107803 aaggatatgagcagacacttc 107823
>gb|AC078873.22| Homo sapiens 12q BAC RP11-916O13 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 190073 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 67887 aaggatatgagcagacacttc 67867
>gb|AC087863.10| Homo sapiens 12q BAC RP11-357K6 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 179876 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 156087 aaggatatgagcagacacttc 156107
>gb|AC079383.17| Homo sapiens Xp BAC RP11-30A20 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 151276 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 401 tgaaggatatgagcagacact 421 ||||||||||||||||||||| Sbjct: 94271 tgaaggatatgagcagacact 94291
>gb|AC093880.4| Homo sapiens BAC clone RP11-651C2 from 4, complete sequence Length = 169968 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 48909 aaggatatgagcagacacttc 48929
>gb|AC021127.9| Homo sapiens BAC clone RP11-377G16 from 4, complete sequence Length = 194158 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 170051 aaggatatgagcagacacttc 170031
>gb|AC092629.2| Homo sapiens BAC clone RP11-280J8 from 4, complete sequence Length = 148673 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 401 tgaaggatatgagcagacact 421 ||||||||||||||||||||| Sbjct: 91696 tgaaggatatgagcagacact 91676
>gb|AC097494.3| Homo sapiens BAC clone RP11-273B19 from 4, complete sequence Length = 144135 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 37779 aaggatatgagcagacacttc 37799
>gb|AC095049.3| Homo sapiens BAC clone RP11-263F19 from 4, complete sequence Length = 86308 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 66977 aaggatatgagcagacacttc 66997
>gb|AC055707.33| Homo sapiens 12 BAC RP11-877E17 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 138370 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 3090 aaggatatgagcagacacttc 3110
>gb|AC018356.26| Homo sapiens 3 BAC RP11-258G22 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 120846 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 10572 aaggatatgagcagacacttc 10552
>gb|AC097488.2| Homo sapiens BAC clone RP11-218C23 from 4, complete sequence Length = 175970 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 27504 aaggatatgagcagacacttc 27524
>gb|AC068802.29| Homo sapiens 12 BAC RP11-510P12 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 129350 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 81644 aaggatatgagcagacacttc 81624
>gb|AC094096.2| Homo sapiens chromosome 5 clone RP11-11P11, complete sequence Length = 156194 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 102163 aaggatatgagcagacacttc 102143
>gb|AC079090.4| Homo sapiens chromosome 15, clone RP11-268O3, complete sequence Length = 158510 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 3819 aaggatatgagcagacacttc 3799
>gb|AC021590.10| Homo sapiens chromosome 8, clone RP11-143H8, complete sequence Length = 171427 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 17696 aaggatatgagcagacacttc 17716
>gb|AC020936.5| Homo sapiens chromosome 5 clone CTD-2291O8, complete sequence Length = 162884 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Plus Query: 3 ttattaacttttatttttacaaaatggtg 31 |||||||||||| || ||||||||||||| Sbjct: 18260 ttattaactttttttattacaaaatggtg 18288
>gb|AC021701.8| Homo sapiens chromosome 18, clone RP11-704G7, complete sequence Length = 170311 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 24782 aaggatatgagcagacacttc 24762
>gb|AC013807.9| Homo sapiens chromosome , clone RP11-21B14, complete sequence Length = 188367 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 160402 aaggatatgagcagacacttc 160382
>gb|AC074331.2|AC074331 Homo sapiens chromosome 19, BAC CTC-204F22 (BC228680), complete sequence Length = 156321 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 122285 aaggatatgagcagacacttc 122305
>gb|AC010230.6| Homo sapiens chromosome 5 clone CTC-313D10, complete sequence Length = 119004 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 90339 aaggatatgagcagacacttc 90359
>gb|AC008816.8| Homo sapiens chromosome 5 clone CTD-2122K17, complete sequence Length = 174293 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 142478 aaggatatgagcagacacttc 142498
>gb|AC003006.1|AC003006 Human DNA from overlapping chromosome 19-specific cosmids R32543, , and F15613 containing ZNF gene family member, genomic sequence, complete sequence Length = 84114 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 31156 aaggatatgagcagacacttc 31176
>gb|AF305205.1|AF305205 Triticum aestivum cytosolic acetyl-CoA carboxylase Acc-2,2 gene, partial cds Length = 3393 Score = 42.1 bits (21), Expect = 2.0 Identities = 36/41 (87%) Strand = Plus / Minus Query: 113 gatttgaatcttggtggactggggataccaatgtccctcta 153 |||||||| | |||||| |||||||||||| ||||||||| Sbjct: 1558 gatttgaaccatggtgggctggggataccacagtccctcta 1518
>gb|AC027058.9| Homo sapiens chromosome 4, clone RP11-481K13, complete sequence Length = 155624 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 49706 aaggatatgagcagacacttc 49726
>gb|AC016558.6| Homo sapiens chromosome 5 clone CTC-420I8, complete sequence Length = 162884 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Plus Query: 3 ttattaacttttatttttacaaaatggtg 31 |||||||||||| || ||||||||||||| Sbjct: 18260 ttattaactttttttattacaaaatggtg 18288
>gb|AC020938.4| Homo sapiens chromosome 5 clone CTD-2300O5, complete sequence Length = 57339 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Plus Query: 3 ttattaacttttatttttacaaaatggtg 31 |||||||||||| || ||||||||||||| Sbjct: 40621 ttattaactttttttattacaaaatggtg 40649
>gb|AC148702.1| Macaca mulatta Major Histocompatibility Complex BAC MMU326H24, complete sequence Length = 202513 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 104740 aaggatatgagcagacacttc 104760
>gb|AC073848.4|AC073848 Homo sapiens BAC clone RP11-669M16 from 4, complete sequence Length = 163636 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 8004 aaggatatgagcagacacttc 7984
>gb|AC019212.4|AC019212 Homo sapiens BAC clone RP11-462H12 from X, complete sequence Length = 213793 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 98136 aaggatatgagcagacacttc 98156
>gb|AC025519.10|AC025519 Homo sapiens, clone RP11-484J3, complete sequence Length = 171464 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 43692 aaggatatgagcagacacttc 43712
>gb|AC010523.6|AC010523 Homo sapiens chromosome 19 clone LLNLR-273E6, complete sequence Length = 40055 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 17094 aaggatatgagcagacacttc 17074
>gb|AC142495.2| Homo sapiens chromosome X clone LL0XNC01-31A6 map Xp11.23, complete sequence Length = 41905 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 33377 aaggatatgagcagacacttc 33357
>gb|AC068339.6| Homo sapiens chromosome 11, clone RP11-328E22, complete sequence Length = 155491 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 76239 aaggatatgagcagacacttc 76219
>gb|AC121324.5| Homo sapiens chromosome 15, clone RP11-959E3, complete sequence Length = 192087 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 81288 aaggatatgagcagacacttc 81268
>gb|AC079341.6| Homo sapiens BAC clone RP11-63B13 from 4, complete sequence Length = 149819 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 6555 aaggatatgagcagacacttc 6575
>gb|AC024022.6| Homo sapiens BAC clone RP11-63A11 from 4, complete sequence Length = 186755 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 107761 aaggatatgagcagacacttc 107781
>gb|AC079755.6| Homo sapiens BAC clone RP11-85L2 from 4, complete sequence Length = 184471 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 aaggatatgagcagacacttc 423 ||||||||||||||||||||| Sbjct: 14199 aaggatatgagcagacacttc 14179 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 6,518,266 Number of Sequences: 3902068 Number of extensions: 6518266 Number of successful extensions: 146502 Number of sequences better than 10.0: 444 Number of HSP's better than 10.0 without gapping: 447 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 144798 Number of HSP's gapped (non-prelim): 1700 length of query: 575 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 552 effective length of database: 17,143,297,704 effective search space: 9463100332608 effective search space used: 9463100332608 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
