ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal38p16
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL136081.10| Human DNA sequence from clone RP5-886K12 on chr... 44 0.23
2emb|CT010448.4| Mouse DNA sequence from clone RP23-290P4 on chro... 40 3.5
3gb|AC126802.4| Mus musculus BAC clone RP24-543J12 from chromosom... 40 3.5
4gb|AC003108.1|HUAC003108 Human Chromosome 16 BAC clone CIT987SK-... 40 3.5
5gb|AC009468.3| Homo sapiens BAC clone GS1-278J22 from 7, complet... 40 3.5
6gb|AC142323.1| Pan troglodytes BAC clone RP43-72N8 from 7, compl... 40 3.5
7gb|AC008632.6|AC008632 Homo sapiens chromosome 5 clone CTB-164N1... 40 3.5
8gb|AC008663.6|AC008663 Homo sapiens chromosome 5 clone CTB-33O18... 40 3.5
9gb|AC012621.8| Homo sapiens chromosome 16 clone CTD-2055J8, comp... 40 3.5
10gb|AC026316.16| Homo sapiens 3 BAC RP11-373E16 (Roswell Park Can... 40 3.5

>emb|AL136081.10| Human DNA sequence from clone RP5-886K12 on chromosome 6, complete
             sequence
          Length = 99850

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 228   aaatagctagaggagaagaaaa 249
             ||||||||||||||||||||||
Sbjct: 12428 aaatagctagaggagaagaaaa 12449



to top

>emb|CT010448.4| Mouse DNA sequence from clone RP23-290P4 on chromosome 17, complete
             sequence
          Length = 136671

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 49    ctctccttttgccaaacata 68
             ||||||||||||||||||||
Sbjct: 87147 ctctccttttgccaaacata 87166



to top

>gb|AC126802.4| Mus musculus BAC clone RP24-543J12 from chromosome 5, complete sequence
          Length = 154808

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 174    agggaaaaactgagagtcag 193
              ||||||||||||||||||||
Sbjct: 111213 agggaaaaactgagagtcag 111232



to top

>gb|AC003108.1|HUAC003108 Human Chromosome 16 BAC clone CIT987SK-327O24, complete sequence
          Length = 164564

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 227   taaatagctagaggagaaga 246
             ||||||||||||||||||||
Sbjct: 90152 taaatagctagaggagaaga 90133



to top

>gb|AC009468.3| Homo sapiens BAC clone GS1-278J22 from 7, complete sequence
          Length = 152517

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    aaatagctagaggagaagaa 247
              ||||||||||||||||||||
Sbjct: 118837 aaatagctagaggagaagaa 118856



to top

>gb|AC142323.1| Pan troglodytes BAC clone RP43-72N8 from 7, complete sequence
          Length = 190220

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    aaatagctagaggagaagaa 247
              ||||||||||||||||||||
Sbjct: 141606 aaatagctagaggagaagaa 141625



to top

>gb|AC008632.6|AC008632 Homo sapiens chromosome 5 clone CTB-164N12, complete sequence
          Length = 112687

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 228   aaatagctagaggagaagaa 247
             ||||||||||||||||||||
Sbjct: 22660 aaatagctagaggagaagaa 22679



to top

>gb|AC008663.6|AC008663 Homo sapiens chromosome 5 clone CTB-33O18, complete sequence
          Length = 142859

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 228   aaatagctagaggagaagaa 247
             ||||||||||||||||||||
Sbjct: 95302 aaatagctagaggagaagaa 95321



to top

>gb|AC012621.8| Homo sapiens chromosome 16 clone CTD-2055J8, complete sequence
          Length = 145023

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 227   taaatagctagaggagaaga 246
             ||||||||||||||||||||
Sbjct: 65831 taaatagctagaggagaaga 65812



to top

>gb|AC026316.16| Homo sapiens 3 BAC RP11-373E16 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 164409

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 224   aaataaatagctagaggagaagaa 247
             ||||||||||||||| ||||||||
Sbjct: 20645 aaataaatagctagaagagaagaa 20622


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,709,989
Number of Sequences: 3902068
Number of extensions: 2709989
Number of successful extensions: 49938
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 49922
Number of HSP's gapped (non-prelim): 16
length of query: 271
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 249
effective length of database: 17,147,199,772
effective search space: 4269652743228
effective search space used: 4269652743228
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top