ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal39e15
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF460219.1| Hordeum vulgare subsp. vulgare nuclear transcript... 835 0.0
2emb|AJ242531.1|TAE242531 Triticum aestivum rht-D1a gene for gibb... 492 e-136
3emb|AJ242530.1|ZMA242530 Zea mays partial d8 gene for gibberelli... 373 e-100
4gb|AY103865.1| Zea mays PCO148437 mRNA sequence 349 8e-93
5gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 347 3e-92
6gb|AC087797.5| Oryza sativa chromosome 3 BAC OSJNBb0022E02 genom... 347 3e-92
7dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 347 3e-92
8gb|AY781175.1| Oryza sativa (indica cultivar-group) gibberellic ... 347 3e-92
9dbj|AB030956.1| Oryza sativa (japonica cultivar-group) mRNA for ... 347 3e-92
10ref|XM_469478.1| Oryza sativa (japonica cultivar-group), mRNA 339 8e-90
11gb|BT018988.1| Zea mays clone Contig445.F mRNA sequence 321 2e-84
12gb|AF413142.1| Zea mays cultivar MS153 DWARF8 gene, partial cds 212 1e-51
13gb|AF413203.1| Zea mays cultivar A554 DWARF8 gene, partial cds 204 3e-49
14gb|AF413201.1| Zea mays cultivar A6 DWARF8 gene, partial cds 204 3e-49
15gb|AF413200.1| Zea mays cultivar Ky21 DWARF8 gene, partial cds 204 3e-49
16gb|AF413199.1| Zea mays cultivar IDS28 DWARF8 gene, partial cds 204 3e-49
17gb|AF413198.1| Zea mays cultivar B14A DWARF8 gene, partial cds 204 3e-49
18gb|AF413197.1| Zea mays cultivar CML287 DWARF8 gene, partial cds 204 3e-49
19gb|AF413195.1| Zea mays cultivar NC296 DWARF8 gene, partial cds 204 3e-49
20gb|AF413194.1| Zea mays cultivar NC338 DWARF8 gene, partial cds 204 3e-49
21gb|AF413193.1| Zea mays cultivar CI187 DWARF8 gene, partial cds 204 3e-49
22gb|AF413192.1| Zea mays cultivar EP1 DWARF8 gene, partial cds 204 3e-49
23gb|AF413191.1| Zea mays cultivar CML247 DWARF8 gene, partial cds 204 3e-49
24gb|AF413190.1| Zea mays cultivar CML254 DWARF8 gene, partial cds 204 3e-49
25gb|AF413189.1| Zea mays cultivar B103 DWARF8 gene, partial cds 204 3e-49
26gb|AF413188.1| Zea mays cultivar KUI11 DWARF8 gene, partial cds 204 3e-49
27gb|AF413185.1| Zea mays cultivar NC300 DWARF8 gene, partial cds 204 3e-49
28gb|AF413184.1| Zea mays cultivar B97 DWARF8 gene, partial cds 204 3e-49
29gb|AF413183.1| Zea mays cultivar W153R DWARF8 gene, partial cds 204 3e-49
30gb|AF413182.1| Zea mays cultivar D940Y DWARF8 gene, partial cds 204 3e-49
31gb|AF413181.1| Zea mays cultivar IA2132 DWARF8 gene, partial cds 204 3e-49
32gb|AF413180.1| Zea mays cultivar TZI8 DWARF8 gene, partial cds 204 3e-49
33gb|AF413179.1| Zea mays cultivar IL677A DWARF8 gene, partial cds 204 3e-49
34gb|AF413178.1| Zea mays cultivar NC298 DWARF8 gene, partial cds 204 3e-49
35gb|AF413177.1| Zea mays cultivar SC55 DWARF8 gene, partial cds 204 3e-49
36gb|AF413176.1| Zea mays cultivar MO24W DWARF8 gene, partial cds 204 3e-49
37gb|AF413175.1| Zea mays cultivar CML261 DWARF8 gene, partial cds 204 3e-49
38gb|AF413174.1| Zea mays cultivar CML10 DWARF8 gene, partial cds 204 3e-49
39gb|AF413173.1| Zea mays cultivar A441 DWARF8 gene, partial cds 204 3e-49
40gb|AF413172.1| Zea mays cultivar F44 DWARF8 gene, partial cds 204 3e-49
41gb|AF413171.1| Zea mays cultivar GT112 DWARF8 gene, partial cds 204 3e-49
42gb|AF413170.1| Zea mays cultivar K55 DWARF8 gene, partial cds 204 3e-49
43gb|AF413169.1| Zea mays cultivar N28HT DWARF8 gene, partial cds 204 3e-49
44gb|AF413168.1| Zea mays cultivar NC250 DWARF8 gene, partial cds 204 3e-49
45gb|AF413167.1| Zea mays cultivar CML333 DWARF8 gene, partial cds 204 3e-49
46gb|AF413166.1| Zea mays cultivar KUI2007 DWARF8 gene, partial cds 204 3e-49
47gb|AF413165.1| Zea mays cultivar CML277 DWARF8 gene, partial cds 204 3e-49
48gb|AF413164.1| Zea mays cultivar B84 DWARF8 gene, partial cds 204 3e-49
49gb|AF413163.1| Zea mays cultivar CML281 DWARF8 gene, partial cds 204 3e-49
50gb|AF413162.1| Zea mays cultivar B73 DWARF8 gene, partial cds 204 3e-49
51gb|AF413161.1| Zea mays cultivar B37 DWARF8 gene, partial cds 204 3e-49
52gb|AF413160.1| Zea mays cultivar A272 DWARF8 gene, partial cds 204 3e-49
53gb|AF413159.1| Zea mays cultivar CML5 DWARF8 gene, partial cds 204 3e-49
54gb|AF413158.1| Zea mays cultivar NC320 DWARF8 gene, partial cds 204 3e-49
55gb|AF413157.1| Zea mays cultivar Tzi18 DWARF8 gene, partial cds 204 3e-49
56gb|AF413156.1| Zea mays cultivar NC348 DWARF8 gene, partial cds 204 3e-49
57gb|AF413155.1| Zea mays cultivar A632 DWARF8 gene, partial cds 204 3e-49
58gb|AF413154.1| Zea mays cultivar B104 DWARF8 gene, partial cds 204 3e-49
59gb|AF413153.1| Zea mays cultivar B68 DWARF8 gene, partial cds 204 3e-49
60gb|AF413152.1| Zea mays cultivar KUI3 DWARF8 gene, partial cds 204 3e-49
61gb|AF413151.1| Zea mays cultivar SA24 DWARF8 gene, partial cds 204 3e-49
62gb|AF413150.1| Zea mays cultivar T232 DWARF8 gene, partial cds 204 3e-49
63gb|AF413149.1| Zea mays cultivar W117HT DWARF8 gene, partial cds 204 3e-49
64gb|AF413148.1| Zea mays cultivar SG18 DWARF8 gene, partial cds 204 3e-49
65gb|AF413147.1| Zea mays cultivar NC350 DWARF8 gene, partial cds 204 3e-49
66gb|AF413146.1| Zea mays cultivar NC352 DWARF8 gene, partial cds 204 3e-49
67gb|AF413144.1| Zea mays cultivar NC304 DWARF8 gene, partial cds 204 3e-49
68gb|AF413143.1| Zea mays cultivar ND246 DWARF8 gene, partial cds 204 3e-49
69gb|AF413141.1| Zea mays cultivar NC260 DWARF8 gene, partial cds 204 3e-49
70gb|AF413140.1| Zea mays cultivar CML258 DWARF8 gene, partial cds 204 3e-49
71gb|AF413139.1| Zea mays cultivar NC354 DWARF8 gene, partial cds 204 3e-49
72gb|AF413138.1| Zea mays cultivar Q6199 DWARF8 gene, partial cds 204 3e-49
73gb|AF413137.1| Zea mays cultivar I137TN DWARF8 gene, partial cds 204 3e-49
74gb|AF413136.1| Zea mays cultivar KUI21 DWARF8 gene, partial cds 204 3e-49
75gb|AF413135.1| Zea mays cultivar H99 DWARF8 gene, partial cds 204 3e-49
76gb|AF413134.1| Zea mays cultivar W64A DWARF8 gene, partial cds 204 3e-49
77gb|AF413133.1| Zea mays cultivar PA91 DWARF8 gene, partial cds 204 3e-49
78gb|AF413132.1| Zea mays cultivar SC213 DWARF8 gene, partial cds 204 3e-49
79gb|AF413131.1| Zea mays cultivar TX601 DWARF8 gene, partial cds 204 3e-49
80gb|AF413130.1| Zea mays cultivar U267Y DWARF8 gene, partial cds 204 3e-49
81gb|AF413129.1| Zea mays cultivar WF9 DWARF8 gene, partial cds 204 3e-49
82gb|AF413128.1| Zea mays cultivar KUI43 DWARF8 gene, partial cds 204 3e-49
83gb|AF413127.1| Zea mays cultivar M162W DWARF8 gene, partial cds 204 3e-49
84gb|AF413126.1| Zea mays cultivar Mo17 DWARF8 gene, partial cds 204 3e-49
85gb|AF413125.1| Zea mays cultivar 38-11 DWARF8 gene, partial cds 204 3e-49
86gb|AF413124.1| Zea mays cultivar W182B DWARF8 gene, partial cds 204 3e-49
87gb|AF413123.1| Zea mays cultivar C103 DWARF8 gene, partial cds 204 3e-49
88gb|AF413122.1| Zea mays cultivar OH7B DWARF8 gene, partial cds 204 3e-49
89gb|AF413113.1| Zea mays cultivar I29 DWARF8 gene, partial cds 204 3e-49
90gb|AF413202.1| Zea mays cultivar N192 DWARF8 gene, partial cds 196 7e-47
91gb|AF413196.1| Zea mays cultivar KUI44 DWARF8 gene, partial cds 196 7e-47
92gb|AF413187.1| Zea mays cultivar Tzi10 DWARF8 gene, partial cds 196 7e-47
93gb|AF413186.1| Zea mays cultivar M37W DWARF8 gene, partial cds 196 7e-47
94gb|AF413145.1| Zea mays cultivar F2 DWARF8 gene, partial cds 196 7e-47
95gb|AF413121.1| Zea mays cultivar CM105 DWARF8 gene, partial cds 196 7e-47
96gb|AF413120.1| Zea mays cultivar OH43 DWARF8 gene, partial cds 196 7e-47
97gb|AF413119.1| Zea mays cultivar P39 DWARF8 gene, partial cds 196 7e-47
98gb|AF413118.1| Zea mays cultivar F2834T DWARF8 gene, partial cds 196 7e-47
99gb|AF413117.1| Zea mays cultivar CMV3 DWARF8 gene, partial cds 196 7e-47
100gb|AF413116.1| Zea mays cultivar F7 DWARF8 gene, partial cds 196 7e-47
101gb|AF413115.1| Zea mays cultivar CM174 DWARF8 gene, partial cds 196 7e-47
102gb|AF413114.1| Zea mays cultivar CM7 DWARF8 gene, partial cds 196 7e-47
103gb|AF413112.1| Zea mays cultivar A619 DWARF8 gene, partial cds 196 7e-47
104gb|AY389546.1| Hyacinthus orientalis GAI-like protein mRNA, part... 117 5e-23
105gb|AF492578.1| Calycadenia multiglandulosa clone CLmCod7 GIA/RGA... 58 4e-05
106emb|CR925877.9| Zebrafish DNA sequence from clone DKEY-71B4 in l... 52 0.003
107gb|AF378125.1| Vitis vinifera GAI-like protein 1 (GAI1) gene, co... 50 0.010
108gb|AF492590.1| Dubautia microcephala clone DmiAcopy1 GIA/RGA-lik... 48 0.041
109gb|AF492589.1| Dubautia raillardioides clone DrAcopy1 GIA/RGA-li... 48 0.041
110gb|AF492588.1| Dubautia menziesii clone DmeAcopy1 GIA/RGA-like g... 48 0.041
111gb|AF492587.1| Dubautia knudsenii clone DkAcopy1 GIA/RGA-like gi... 48 0.041
112gb|AF492586.1| Dubautia arborea clone DaAcopy1 GIA/RGA-like gibb... 48 0.041
113gb|AF492584.1| Argyroxiphium kauense clone AkAcopy2 GIA/RGA-like... 48 0.041
114gb|AF492583.1| Argyroxiphium kauense clone AkAcopy1 GIA/RGA-like... 48 0.041
115gb|AF492582.1| Argyroxiphium sandwicense subsp. macrocephalum cl... 48 0.041
116gb|AF492581.1| Argyroxiphium sandwicense subsp. macrocephalum cl... 48 0.041
117gb|AF492580.1| Anisocarpus madioides clone ANm2b GIA/RGA-like gi... 48 0.041
118gb|AF492576.1| Carlquistia muirii clone Cm2 GIA/RGA-like gibbere... 48 0.041
119gb|AF492575.1| Carlquistia muirii clone Cm1 GIA/RGA-like gibbere... 48 0.041
120gb|AF492574.1| Madia sativa clone MsCod2 GIA/RGA-like gibberelli... 48 0.041
121gb|AF492573.1| Madia sativa clone MsCod1 GIA/RGA-like gibberelli... 48 0.041
122gb|AF492572.1| Argyroxiphium sandwicense subsp. macrocephalum cl... 48 0.041
123gb|AF492571.1| Argyroxiphium sandwicense subsp. macrocephalum cl... 48 0.041
124gb|AF492570.1| Argyroxiphium kauense clone AkBcopy1n GIA/RGA-lik... 48 0.041
125gb|AF492569.1| Wilkesia gymnoxiphium clone WgBcopy1 GIA/RGA-like... 48 0.041
126gb|AF492568.1| Wilkesia gymnoxiphium clone WgBcopy2 GIA/RGA-like... 48 0.041
127gb|AF492567.1| Dubautia raillardioides clone DrBcopy GIA/RGA-lik... 48 0.041
128gb|AF492566.1| Dubautia menziesii clone DmeBcopy GIA/RGA-like gi... 48 0.041
129gb|AF492565.1| Dubautia ciliolata subsp. glutinosa clone DcK20B ... 48 0.041
130gb|AF492564.1| Dubautia ciliolata subsp. glutinosa clone DcK05B ... 48 0.041
131gb|AF492563.1| Dubautia arborea clone DaBcopy2 GIA/RGA-like gibb... 48 0.041
132gb|AF492562.1| Dubautia arborea clone DaBcopy1 GIA/RGA-like gibb... 48 0.041
133emb|BX119973.7| Zebrafish DNA sequence from clone RP71-77D7 in l... 48 0.041
134dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.16
135emb|BX649441.5| Zebrafish DNA sequence from clone DKEYP-3B1 in l... 46 0.16
136emb|CT573111.9| Zebrafish DNA sequence from clone CH211-233A24 i... 46 0.16
137gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 46 0.16
138emb|AL935154.2|CNS08CCP Oryza sativa chromosome 12, . BAC OSJNBb... 46 0.16
139emb|AL928830.10| Zebrafish DNA sequence from clone CH211-119E16,... 46 0.16
140gb|AC168149.7| Medicago truncatula clone mth2-84g4, complete seq... 44 0.64
141gb|AC115721.11| Mus musculus chromosome 3, clone RP23-9P8, compl... 44 0.64
142gb|AC160549.5| Mus musculus chromosome 3, clone RP23-276K18, com... 44 0.64
143emb|CR854896.11| Zebrafish DNA sequence from clone DKEY-239B8 in... 44 0.64
144emb|BX276112.19| Zebrafish DNA sequence from clone CH211-220I12 ... 44 0.64
145emb|Z97985.16|HS341D10 Human DNA sequence from clone RP3-341D10 ... 44 0.64
146emb|AL845512.9| Zebrafish DNA sequence from clone CH211-286M4 in... 44 0.64
147emb|AL929301.6| Zebrafish DNA sequence from clone BUSM1-SL7 Cont... 44 0.64
148emb|AL590146.2| Zebrafish DNA sequence from clone RP71-20I5 in l... 44 0.64
149emb|BX901922.9| Zebrafish DNA sequence from clone DKEY-33C12 in ... 44 0.64
150emb|BX088597.18| Zebrafish DNA sequence from clone DKEY-171P23 i... 44 0.64
151emb|BX927402.13| Zebrafish DNA sequence from clone CH211-262G12 ... 44 0.64
152emb|BX004803.11| Zebrafish DNA sequence from clone CH211-119C20 ... 44 0.64
153gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome 44 0.64
154emb|CR545467.4| Zebrafish DNA sequence from clone CH211-196P10 i... 44 0.64
155emb|CR318607.7| Zebrafish DNA sequence from clone CH211-237H22 i... 44 0.64
156emb|BX005378.13| Zebrafish DNA sequence from clone DKEY-40H20 in... 44 0.64
157gb|AC149127.6| Medicago truncatula clone mth2-108o17, complete s... 44 0.64
158gb|AC104442.2| Homo sapiens chromosome 3 clone RP11-905F6, compl... 44 0.64
159emb|BX548044.10| Zebrafish DNA sequence from clone DKEY-10B15 in... 44 0.64
160gb|AC163694.2| Mus musculus BAC clone RP24-80O2 from chromosome ... 44 0.64
161emb|BX908772.11| Zebrafish DNA sequence from clone DKEY-207H9 in... 44 0.64
162emb|BX784038.11| Zebrafish DNA sequence from clone CH211-217K23 ... 44 0.64
163emb|BX571973.15| Zebrafish DNA sequence from clone DKEY-254A11 i... 44 0.64
164emb|BX294189.11| Zebrafish DNA sequence from clone CH211-218D20 ... 44 0.64
165tpg|BK001652.1| TPA: TPA_exp: Homo sapiens growth and differenti... 44 0.64
166gb|AC073487.34| Homo sapiens 12 BAC RP11-762I7 (Roswell Park Can... 44 0.64
167gb|AC026333.28| Homo sapiens 12 BAC RP11-324E6 (Roswell Park Can... 44 0.64
168gb|AC026331.22| Homo sapiens 12 BAC RP11-507N20 (Roswell Park Ca... 44 0.64
169emb|BX470223.14| Zebrafish DNA sequence from clone DKEY-45P9 in ... 44 0.64
170gb|AC008786.6|AC008786 Homo sapiens chromosome 5 clone CTD-2037L... 44 0.64
171emb|BX004769.9| Zebrafish DNA sequence from clone DKEY-15I8 in l... 44 0.64
172emb|BX005434.6| Zebrafish DNA sequence from clone DKEY-106M21, c... 44 0.64
173emb|BX470170.5| Zebrafish DNA sequence from clone CH211-122C9 in... 44 0.64
174emb|BX510654.19| Zebrafish DNA sequence from clone DKEY-271N12 i... 44 0.64
175gb|AC122380.4| Mus musculus BAC clone RP23-476C23 from 10, compl... 44 0.64
176gb|AC135418.3| Oryza sativa (japonica cultivar-group) chromosome... 42 2.5
177gb|AY808430.1| Schistosoma japonicum SJCHGC06490 protein mRNA, p... 42 2.5
178emb|CR956627.17| Mouse DNA sequence from clone RP24-402N1 on chr... 42 2.5
179emb|CR762428.7| Zebrafish DNA sequence from clone CH211-172N16 i... 42 2.5
180emb|CR974459.7| Mouse DNA sequence from clone RP23-179P23 on chr... 42 2.5
181emb|Z81128.2|CET23D8 Caenorhabditis elegans Cosmid T23D8, comple... 42 2.5
182emb|CR847854.12| Zebrafish DNA sequence from clone DKEY-229J6 in... 42 2.5
183emb|BX927062.11| Zebrafish DNA sequence from clone CH211-227N20 ... 42 2.5
184emb|BX927365.7| Zebrafish DNA sequence from clone DKEY-161P7 in ... 42 2.5
185gb|CP000316.1| Polaromonas sp. JS666, complete genome 42 2.5
186emb|CR847931.7| Zebrafish DNA sequence from clone DKEY-182I3 in ... 42 2.5
187emb|BX004968.20| Zebrafish DNA sequence from clone DKEY-35I13 in... 42 2.5
188emb|CR762493.11| Zebrafish DNA sequence from clone DKEY-228B19 i... 42 2.5
189emb|CR628363.12| Mouse DNA sequence from clone RP23-329B21 on ch... 42 2.5
190emb|BX005206.15| Mouse DNA sequence from clone RP23-384P3 on chr... 42 2.5
191emb|CR556702.10| Mouse DNA sequence from clone RP24-370F24 on ch... 42 2.5
192emb|BX571788.8| Mouse DNA sequence from clone RP23-30M5 on chrom... 42 2.5
193emb|BX323574.12| Zebrafish DNA sequence from clone DKEY-180F8, c... 42 2.5
194emb|BX322584.16| Zebrafish DNA sequence from clone RP71-27M6 in ... 42 2.5
195emb|AL805943.6| Mouse DNA sequence from clone RP23-86O13 on chro... 42 2.5
196emb|BX571721.8| Zebrafish DNA sequence from clone DKEY-250L23 in... 42 2.5
197emb|BX510645.7| Zebrafish DNA sequence from clone DKEY-5G21 in l... 42 2.5
198emb|BX546473.10| Zebrafish DNA sequence from clone DKEYP-51F2 in... 42 2.5
199gb|AC013558.10| Homo sapiens chromosome 18, clone RP11-41O4, com... 42 2.5
200gb|AC182036.2| Mus musculus BAC clone RP24-120L13 from chromosom... 42 2.5
201emb|BX323831.7| Zebrafish DNA sequence from clone CH211-12E7 in ... 42 2.5
202emb|BX548049.9| Zebrafish DNA sequence from clone DKEY-217J16 in... 42 2.5
203dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.5
204emb|BX842674.4| Mouse DNA sequence from clone RP24-212K8 on chro... 42 2.5
205emb|BX005383.8| Zebrafish DNA sequence from clone DKEYP-19E1 in ... 42 2.5
206emb|BX571982.6| Zebrafish DNA sequence from clone CH211-204K19 i... 42 2.5
207emb|BX005175.8| Zebrafish DNA sequence from clone DKEY-14H17 in ... 42 2.5
208emb|BX005478.7| Zebrafish DNA sequence from clone CH211-77G9, co... 42 2.5
209emb|BX005018.8| Zebrafish DNA sequence from clone DKEY-209K18, c... 42 2.5
210emb|BX005015.5| Zebrafish DNA sequence from clone CH211-66I11 in... 42 2.5
211dbj|AK108961.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.5
212emb|BX936328.7| Zebrafish DNA sequence from clone CH211-11F20 in... 42 2.5
213emb|AL732411.14| Zebrafish DNA sequence from clone XX-51I9 in li... 42 2.5
214emb|BX276085.8| Zebrafish DNA sequence from clone CH211-194B5 in... 42 2.5
215emb|BX294670.6| Zebrafish DNA sequence from clone CH211-154O6 in... 42 2.5
216emb|BX296562.4| Zebrafish DNA sequence from clone CH211-260G14 i... 42 2.5
217gb|AY110882.1| Zea mays CL25429_1 mRNA sequence 42 2.5
218emb|AL929056.21| Zebrafish DNA sequence from clone CH211-227I14 ... 42 2.5
219emb|BX088535.6| Zebrafish DNA sequence from clone DKEY-18F5 in l... 42 2.5
220emb|CR974488.16| Mouse DNA sequence from clone RP23-124J3 on chr... 42 2.5
221emb|CR974480.18| Mouse DNA sequence from clone RP23-239B4 on chr... 42 2.5
222emb|CR626891.17| Zebrafish DNA sequence from clone DKEY-33P20 in... 42 2.5
223emb|CR396594.10| Zebrafish DNA sequence from clone CH211-158B12 ... 42 2.5
224gb|AC170862.1| Mus musculus chromosome 19, clone wi1-593J16, com... 40 9.9
225ref|XM_631988.1| Dictyostelium discoideum hypothetical protein (... 40 9.9
226gb|AC151762.1| Ornithorhynchus anatinus chromosome UNK clone OAB... 40 9.9
227ref|XM_642357.1| Dictyostelium discoideum fused-like protein kin... 40 9.9
228ref|XM_641566.1| Dictyostelium discoideum hypothetical protein (... 40 9.9
229ref|XM_641276.1| Dictyostelium discoideum SAM domain-containing ... 40 9.9
230ref|XM_637837.1| Dictyostelium discoideum hypothetical protein (... 40 9.9
231gb|CP000150.1| Burkholderia sp. 383 chromosome 3, complete sequence 40 9.9
232ref|XM_637175.1| Dictyostelium discoideum hypothetical protein (... 40 9.9
233ref|XM_636392.1| Dictyostelium discoideum hypothetical protein (... 40 9.9
234ref|XM_635811.1| Dictyostelium discoideum hypothetical protein (... 40 9.9
235gb|AC159421.1| Trypanosoma brucei chromosome 7 clone RPCI93-26A2... 40 9.9
236ref|NM_021494.1| Mus musculus Rab6 interacting protein 1 (Rab6ip... 40 9.9
237gb|CP000070.1| Trypanosoma brucei chromosome 7, complete sequence 40 9.9
238gb|AC159452.1| Trypanosoma brucei chromosome 5 clone RPCI93-5K5,... 40 9.9
239gb|AF335591.1| Homo sapiens WNT4 (WNT4) gene, partial cds 40 9.9
240gb|AC159249.3| Mus musculus BAC clone RP24-177C7 from chromosome... 40 9.9
241gb|AY269087.1| Lycopersicon esculentum GAI-like protein mRNA, co... 40 9.9
242gb|AC114613.12| Mus musculus chromosome 5, clone RP24-80F7, comp... 40 9.9
243ref|XM_423199.1| PREDICTED: Gallus gallus similar to phosphatidy... 40 9.9
244ref|XM_425161.1| PREDICTED: Gallus gallus similar to Krueppel-li... 40 9.9
245gb|BC060230.1| Mus musculus Rab6 interacting protein 1, mRNA (cD... 40 9.9
246gb|AY358060.1| HIV-1 00TH.OUR724I from Thailand gag protein (gag... 40 9.9
247gb|AY253039.1| Macrocephalus sp. WCW-2003 cytochrome oxidase sub... 40 9.9
248gb|AC137980.4| Mus musculus BAC clone RP24-69K24 from chromosome... 40 9.9
249gb|DQ481665.1| Takifugu rubripes HoxBa gene cluster, complete se... 40 9.9
250gb|AY812326.1| Schistosoma japonicum SJCHGC05543 protein mRNA, p... 40 9.9
251gb|AY809521.1| Schistosoma japonicum SJCHGC08185 protein mRNA, p... 40 9.9
252gb|AC034116.10| Mus musculus chromosome 16, clone RP23-428P5, co... 40 9.9
253gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome 40 9.9
254gb|AC116963.2| Dictyostelium discoideum chromosome 2 map 4657875... 40 9.9
255gb|AC122418.4| Mus musculus BAC clone RP24-159E6 from chromosome... 40 9.9
256gb|AC131717.3| Mus musculus chromosome 12 clone RP23-167A18, com... 40 9.9
257ref|XM_001001798.1| PREDICTED: Mus musculus gene model 22, (NCBI... 40 9.9
258emb|CR626888.9| Zebrafish DNA sequence from clone CH211-250B7 in... 40 9.9
259emb|BX927253.9| Zebrafish DNA sequence from clone DKEY-29J8 in l... 40 9.9
260emb|CR974429.7| Mouse DNA sequence from clone RP23-177B9 on chro... 40 9.9
261emb|CR391921.18| Zebrafish DNA sequence from clone CH211-185O22 ... 40 9.9
262gb|AC140235.3| Mus musculus BAC clone RP24-272D15 from chromosom... 40 9.9
263emb|CR382290.16| Zebrafish DNA sequence from clone CH211-236D22 ... 40 9.9
264gb|AC122799.4| Mus musculus BAC clone RP23-308K11 from 16, compl... 40 9.9
265emb|CR956629.5| Pig DNA sequence from clone PigE-42A23 on chromo... 40 9.9
266gb|AC121976.2| Mus musculus BAC clone RP24-286N17 from 8, comple... 40 9.9
267gb|AC121995.2| Mus musculus BAC clone RP24-310M4 from 7, complet... 40 9.9
268emb|CR751228.19| Zebrafish DNA sequence from clone DKEY-168J9 in... 40 9.9
269ref|XM_719581.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 40 9.9
270ref|XM_725583.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 40 9.9
271ref|XM_731379.1| Plasmodium chabaudi chabaudi hypothetical prote... 40 9.9
272gb|AC002382.1| Homo sapiens BAC clone CTB-22J17 from 7, complete... 40 9.9
273ref|XM_729950.1| Plasmodium chabaudi chabaudi hypothetical prote... 40 9.9
274ref|XM_544438.2| PREDICTED: Canis familiaris similar to 1810010N... 40 9.9
275ref|XM_673757.1| Plasmodium berghei strain ANKA hypothetical pro... 40 9.9
276ref|XM_675121.1| Plasmodium berghei strain ANKA hypothetical pro... 40 9.9
277gb|AC102590.9| Mus musculus chromosome 12, clone RP23-335D14, co... 40 9.9
278emb|CR394544.15| Zebrafish DNA sequence from clone DKEY-117I6 in... 40 9.9
279emb|CR933523.10| Zebrafish DNA sequence from clone CH211-127H20 ... 40 9.9
280emb|CR932964.2| Medicago truncatula chromosome 5 clone mte1-60l1... 40 9.9
281gb|CP000284.1| Methylobacillus flagellatus KT, complete genome 40 9.9
282emb|AL445253.13| Human DNA sequence from clone RP4-660K3 on chro... 40 9.9
283emb|AL358858.19| Human DNA sequence from clone RP11-239I22 on ch... 40 9.9
284gb|AE014816.1| Plasmodium falciparum 3D7 chromosome 14 section 1... 40 9.9
285emb|AL050344.31|HSJ799D16 Human DNA sequence from clone RP4-799D... 40 9.9
286emb|CR391971.7| Zebrafish DNA sequence from clone CH211-260O6 in... 40 9.9
287emb|AJ862840.1| Streptomyces griseus subsp. griseus streptomycin... 40 9.9
288emb|CR861389.1| Pongo pygmaeus mRNA; cDNA DKFZp459F172 (from clo... 40 9.9
289emb|AL929356.1|PFA929356 Plasmodium falciparum strain 3D7, chrom... 40 9.9
290emb|AL031745.8|PFMAL1P2 Plasmodium falciparum DNA from MAL1P2 40 9.9
291emb|CR925699.6| Zebrafish DNA sequence from clone RP71-18J1 in l... 40 9.9
292emb|CR376736.5| Zebrafish DNA sequence from clone DKEYP-86G11 in... 40 9.9
293emb|CR381576.10| Zebrafish DNA sequence from clone DKEY-245F17 i... 40 9.9
294emb|AL669951.18| Mouse DNA sequence from clone RP23-94F11 on chr... 40 9.9
295emb|BX511084.9| Zebrafish DNA sequence from clone DKEY-265C15 in... 40 9.9
296emb|BX548018.9| Zebrafish DNA sequence from clone DKEY-23O18 in ... 40 9.9
297emb|CR786576.5| Zebrafish DNA sequence from clone DKEY-223D7 in ... 40 9.9
298emb|AL954689.16| Zebrafish DNA sequence from clone DKEYP-51G2 in... 40 9.9
299emb|BX649235.2| Mouse DNA sequence from clone RP24-85D2 on chrom... 40 9.9
300emb|BX679668.12| Mouse DNA sequence from clone RP23-83P7 on chro... 40 9.9
301emb|CR812485.4| Human DNA sequence from clone CTD-2344H23 on chr... 40 9.9
302emb|BX950214.7| Zebrafish DNA sequence from clone CH211-214C2 in... 40 9.9
303gb|AC142261.5| Mus musculus BAC clone RP24-469C3 from chromosome... 40 9.9
304gb|AC105213.5| Homo sapiens chromosome 8, clone RP11-346A14, com... 40 9.9
305gb|AC109130.8| Homo sapiens 3 BAC RP11-236N13 (Roswell Park Canc... 40 9.9
306emb|BX548251.5| Zebrafish DNA sequence from clone BUSM1-127I14, ... 40 9.9
307emb|BX537326.9| Zebrafish DNA sequence from clone DKEY-4I23 in l... 40 9.9
308emb|BX322647.12| Zebrafish DNA sequence from clone DKEYP-86F8 in... 40 9.9
309emb|BX470112.27| Zebrafish DNA sequence from clone DKEYP-1B2 in ... 40 9.9
310emb|BX322794.6| Zebrafish DNA sequence from clone RP71-44B8 in l... 40 9.9
311emb|BX510949.10| Zebrafish DNA sequence from clone DKEY-97E19 in... 40 9.9
312gb|AC123595.1| Homo sapiens chromosome 5 clone RP11-213H15, comp... 40 9.9
313gb|AC174806.2| Mus musculus BAC clone RP24-526I8 from chromosome... 40 9.9
314gb|AC078905.5| Homo sapiens chromosome 15, clone RP11-138H10, co... 40 9.9
315gb|AC012400.11| Homo sapiens chromosome 8, clone RP11-120I21, co... 40 9.9
316gb|AY033057.1|AY033055S3 Homo sapiens secreted glycoprotein Wnt4... 40 9.9
317gb|AC026469.8| Homo sapiens chromosome 16 clone RP11-442O1, comp... 40 9.9
318emb|BX510366.5| Zebrafish DNA sequence from clone DKEY-189P24 in... 40 9.9
319emb|BX511000.12| Zebrafish DNA sequence from clone DKEY-217F4 in... 40 9.9
320gb|AY242058.1| Oryza sativa (japonica cultivar-group) MONOCULM 1... 40 9.9
321emb|BX296558.8| Zebrafish DNA sequence from clone CH211-261N20 i... 40 9.9
322gb|AF376800.1|AF376800 Plasmodium falciparum myosin D gene, comp... 40 9.9
323emb|BX276126.11| Zebrafish DNA sequence from clone CH211-232L22 ... 40 9.9
324emb|BX571804.4| Mouse DNA sequence from clone RP23-133K13 on chr... 40 9.9
325emb|AL109844.14|HSJ636L22 Human DNA sequence from clone RP4-636L... 40 9.9
326dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 9.9
327emb|BX255947.6| Zebrafish DNA sequence from clone CH211-260D9 in... 40 9.9
328gb|DQ006269.1| Gossypium hirsutum GIA/RGA-like gibberellin respo... 40 9.9
329gb|AC157212.2| Mus musculus BAC clone RP23-171A13 from chromosom... 40 9.9
330gb|AC079954.18| Homo sapiens 12 BAC RP11-179A1 (Roswell Park Can... 40 9.9
331gb|AY208992.1| Gossypium hirsutum GIA/RGA-like gibberellin respo... 40 9.9
332gb|AC131210.3| Homo sapiens 3 BAC RP13-635I23 (Roswell Park Canc... 40 9.9
333gb|AC117075.2| Dictyostelium discoideum chromosome 2 map 5201047... 40 9.9
334gb|AC116956.2| Dictyostelium discoideum chromosome 2 map 1418423... 40 9.9
335gb|AC113431.2| Homo sapiens chromosome 5 clone RP11-90F2, comple... 40 9.9
336dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 40 9.9
337gb|AE014848.1| Plasmodium falciparum 3D7 chromosome 12, section ... 40 9.9
338gb|AC125603.7| Homo sapiens 12 BAC RP11-497G19 (Roswell Park Can... 40 9.9
339gb|AC127285.4| Mus musculus BAC clone RP23-336P20 from chromosom... 40 9.9
340dbj|BA000016.3| Clostridium perfringens str. 13 DNA, complete ge... 40 9.9
341dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 40 9.9
342emb|BX545918.4| Zebrafish DNA sequence from clone DKEYP-22F11 in... 40 9.9
343emb|BX663494.4| Zebrafish DNA sequence from clone CH211-234N7 in... 40 9.9
344emb|BX537271.3| Zebrafish DNA sequence from clone CH211-261P7 in... 40 9.9
345emb|BX005004.12| Zebrafish DNA sequence from clone DKEY-11L18, c... 40 9.9
346dbj|AP003616.4| Oryza sativa (japonica cultivar-group) genomic D... 40 9.9
347emb|BX000696.19| Zebrafish DNA sequence from clone CH211-107E16 ... 40 9.9
348emb|BX005468.9| Mouse DNA sequence from clone RP23-142E21 on chr... 40 9.9
349emb|BX248394.5| Zebrafish DNA sequence from clone CH211-205P19 i... 40 9.9
350emb|BX324233.5| Zebrafish DNA sequence from clone CH211-230L11 i... 40 9.9
351emb|AL808135.13| Mouse DNA sequence from clone RP23-186D8 on chr... 40 9.9
352emb|BX005057.8| Zebrafish DNA sequence from clone DKEY-12L12 in ... 40 9.9
353emb|BX072582.6| Zebrafish DNA sequence from clone DKEY-222O19 in... 40 9.9
354gb|AY326307.1| Cucurbita maxima gibberellic acid insensitive phl... 40 9.9
355ref|XM_565863.1| Anopheles gambiae str. PEST ENSANGP00000025972 ... 40 9.9
356emb|CR854941.8| Zebrafish DNA sequence from clone CH211-214G6 in... 40 9.9
357emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple... 40 9.9
358emb|CR762435.19| Zebrafish DNA sequence from clone CH211-238C15 ... 40 9.9
359emb|BX248136.12| Zebrafish DNA sequence from clone DKEY-81B15 in... 40 9.9
360emb|BX248390.7| Zebrafish DNA sequence from clone DKEY-34F16 in ... 40 9.9
361emb|BX936320.11| Zebrafish DNA sequence from clone CH211-112L17 ... 40 9.9
362emb|BX927240.11| Zebrafish DNA sequence from clone DKEY-16N13 in... 40 9.9
363emb|BX908398.10| Zebrafish DNA sequence from clone CH211-231A1 i... 40 9.9
364emb|BX649502.4| Zebrafish DNA sequence from clone DKEY-204F11 in... 40 9.9
365emb|BX255939.3| Zebrafish DNA sequence from clone DKEY-5G7 in li... 40 9.9
366emb|CR854899.16| Zebrafish DNA sequence from clone CH211-268B14 ... 40 9.9
367emb|AL133279.7|CNS01DUM Human chromosome 14 DNA sequence BAC R-7... 40 9.9
368dbj|AP001747.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 9.9
369gb|AC157321.1| Homo sapiens chromosome 1 clone WI2-2467L18, comp... 40 9.9
370emb|BX004784.9| Zebrafish DNA sequence from clone DKEY-82I7 in l... 40 9.9
371gb|AC099692.4| Mus musculus chromosome 13, clone RP23-198N22, co... 40 9.9
372emb|CR847940.9| Zebrafish DNA sequence from clone CH211-250O24 i... 40 9.9
373emb|AL929266.9| Zebrafish DNA sequence from clone CH211-67E16 in... 40 9.9
374emb|BX001021.7| Zebrafish DNA sequence from clone BUSM1-140K9 in... 40 9.9
375ref|NM_001038605.1| Felis catus voltage-dependent L type calcium... 40 9.9
376gb|DQ128075.1| Felis catus voltage-dependent L type calcium chan... 40 9.9
377emb|BX950172.16| Zebrafish DNA sequence from clone DKEY-20F24 in... 40 9.9
378emb|AL929172.6| Zebrafish DNA sequence from clone DKEYP-46C10 in... 40 9.9
379emb|CR847961.12| Zebrafish DNA sequence from clone DKEY-154B7 in... 40 9.9
380emb|AL939130.1|SCO939130 Streptomyces coelicolor A3(2) complete ... 40 9.9
381emb|AL935291.6| Zebrafish DNA sequence from clone CH211-226M23 i... 40 9.9
382gb|AC148329.3| Mus musculus BAC clone RP24-176F13 from Y, comple... 40 9.9
383gb|AC140938.1| Gallus gallus BAC clone TAM32-30F4 from chromosom... 40 9.9
384emb|CR392035.10| Zebrafish DNA sequence from clone CH211-184N9 i... 40 9.9
385emb|AL845287.10| Zebrafish DNA sequence from clone DKEY-78K11, c... 40 9.9
386gb|DQ083453.1| Baeacris punctulatus cytochrome oxidase subunit I... 40 9.9
387gb|DQ083452.1| Baeacris pseudopunctulatus cytochrome oxidase sub... 40 9.9
388gb|AY842961.1| Entamoeba dispar strain SAW 760 array unit [ALL],... 40 9.9
389emb|AJ245569.1|MMU245569 Mus musculus partial mRNA for hypotheti... 40 9.9
390gb|M23404.1|CHKEATP Chicken erythrocyte anion transport protein ... 40 9.9
391gb|AC090159.12| Homo sapiens chromosome 11, clone RP11-406D1, co... 40 9.9
392dbj|AP001626.1| Homo sapiens genomic DNA, chromosome 21, clone:K... 40 9.9
393dbj|AB017602.1| Homo sapiens PDE9A gene for cGMP phosphodiestera... 40 9.9

>gb|AF460219.1| Hordeum vulgare subsp. vulgare nuclear transcription factor SLN1
            gene, complete cds
          Length = 4098

 Score =  835 bits (421), Expect = 0.0
 Identities = 424/425 (99%)
 Strand = Plus / Minus

                                                                        
Query: 302  aagtgcgtgtgcgtgcgccggagagccggggcgggcgggcggccggggttgtgtcgtagc 361
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3727 aagtgcgtgtgcgtgcgccggagagccggggcgggcgggcggccggggttgtgtcgtagc 3668

                                                                        
Query: 362  gctccatgctctcacgatgtctacttacagcgttcaaaactcgcgatcacggcgcggcga 421
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3667 gctccatgctctcacgatgtctacttacagcgttcaaaactcgcgatcacggcgcggcga 3608

                                                                        
Query: 422  ggcgccatgcggaagtggcgatcagcgggcgcgtgtgccacccgagagtcaggcaccctt 481
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3607 ggcgccatgcggaagtggcgatcagcgggcgcgtgtgccacccgagagtcaggcaccctt 3548

                                                                        
Query: 482  ccttctcttccaccttgtacccgtcgccgccggcgaagagggccagcagcgtgctcgcct 541
            ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3547 ccttctcctccaccttgtacccgtcgccgccggcgaagagggccagcagcgtgctcgcct 3488

                                                                        
Query: 542  gcttgtaggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttcc 601
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3487 gcttgtaggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttcc 3428

                                                                        
Query: 602  gccactgccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgt 661
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3427 gccactgccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgt 3368

                                                                        
Query: 662  tgcagatctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcgg 721
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3367 tgcagatctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcgg 3308

                 
Query: 722  cagga 726
            |||||
Sbjct: 3307 cagga 3303



 Score =  533 bits (269), Expect = e-148
 Identities = 276/277 (99%), Gaps = 1/277 (0%)
 Strand = Plus / Minus

                                                                        
Query: 1    gtccggcccgtgcttattt-aatatgagcgattggaggaattacacatagcaatagtaat 59
            ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 4029 gtccggcccgtgcttatttcaatatgagcgattggaggaattacacatagcaatagtaat 3970

                                                                        
Query: 60   agacatttaaacataataataatagtaatagggcttaataaggagttttacgggtgatgg 119
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3969 agacatttaaacataataataatagtaatagggcttaataaggagttttacgggtgatgg 3910

                                                                        
Query: 120  tgaactgggaacgaaggagggattacattacatgccggcggtctggtcggagttggtcgt 179
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3909 tgaactgggaacgaaggagggattacattacatgccggcggtctggtcggagttggtcgt 3850

                                                                        
Query: 180  gtccatgtcttcacgccggacgcagaaccaaaccgtagagtggtaacccgatcgatccta 239
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3849 gtccatgtcttcacgccggacgcagaaccaaaccgtagagtggtaacccgatcgatccta 3790

                                                 
Query: 240  gccggtcgctgcaattcagcgtatcactgacatttag 276
            |||||||||||||||||||||||||||||||||||||
Sbjct: 3789 gccggtcgctgcaattcagcgtatcactgacatttag 3753



to top

>emb|AJ242531.1|TAE242531 Triticum aestivum rht-D1a gene for gibberellin response modulator
          Length = 1872

 Score =  492 bits (248), Expect = e-136
 Identities = 296/312 (94%)
 Strand = Plus / Minus

                                                                        
Query: 408  tcacggcgcggcgaggcgccatgcggaagtggcgatcagcgggcgcgtgtgccacccgag 467
            ||||||| |||| ||||||||||| || ||||||||||||||||||||||||||||| ||
Sbjct: 1872 tcacggcccggccaggcgccatgccgaggtggcgatcagcgggcgcgtgtgccaccccag 1813

                                                                        
Query: 468  agtcaggcacccttccttctcttccaccttgtacccgtcgccgccggcgaagagggccag 527
             |||||||| ||||||||||| ||||||||||| |||||||||||||||||||| |||||
Sbjct: 1812 cgtcaggcagccttccttctcctccaccttgtagccgtcgccgccggcgaagagcgccag 1753

                                                                        
Query: 528  cagcgtgctcgcctgcttgtaggcattggagcccaggtgcacggtctcgaacccggcgtt 587
            ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 1752 cagcgtgctcgcctgcttgtaggcattggagcccaggtggacggtctcgaacccggcgtt 1693

                                                                        
Query: 588  gcccagccggttccgccactgccccagtgtctcgtgccgctctgtgcgctccgtgccctc 647
            ||||||||||||||||||||| ||||| |||||||| ||||||||||||||||  |||||
Sbjct: 1692 gcccagccggttccgccactggcccagcgtctcgtggcgctctgtgcgctccgccccctc 1633

                                                                        
Query: 648  gcaggccaccacgttgcagatctgccggccgaggtacacctcggacatgacctggtccgt 707
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1632 gcaggccaccacgttgcagatctgccggccgaggtacacctcggacatgacctggtccgt 1573

                        
Query: 708  gccggcggcggc 719
            ||||||||||||
Sbjct: 1572 gccggcggcggc 1561



to top

>emb|AJ242530.1|ZMA242530 Zea mays partial d8 gene for gibberellin response modulator
          Length = 1890

 Score =  373 bits (188), Expect = e-100
 Identities = 278/308 (90%)
 Strand = Plus / Minus

                                                                        
Query: 415  gcggcgaggcgccatgcggaagtggcgatcagcgggcgcgtgtgccacccgagagtcagg 474
            ||||||| |||||| || || |||||||| ||||||||||| |||||||| || ||||||
Sbjct: 1877 gcggcgacgcgccacgccgaggtggcgatgagcgggcgcgtatgccaccccagggtcagg 1818

                                                                        
Query: 475  cacccttccttctcttccaccttgtacccgtcgccgccggcgaagagggccagcagcgtg 534
            ||||| |||||||| |||||| ||||||||||||||||||||||||| ||||||||||||
Sbjct: 1817 cacccgtccttctcctccaccctgtacccgtcgccgccggcgaagagcgccagcagcgtg 1758

                                                                        
Query: 535  ctcgcctgcttgtaggcattggagcccaggtgcacggtctcgaacccggcgttgcccagc 594
            ||||||||||||||||||||||||||||||||||||| | ||||||||| |  ||| || 
Sbjct: 1757 ctcgcctgcttgtaggcattggagcccaggtgcacgggcgcgaacccggagccgccgagg 1698

                                                                        
Query: 595  cggttccgccactgccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggcc 654
            ||| | |||||||| ||||| |||||||| ||||| |||||||||| ||||||||| |||
Sbjct: 1697 cggctgcgccactggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgcc 1638

                                                                        
Query: 655  accacgttgcagatctgccggccgaggtacacctcggacatgacctggtccgtgccggcg 714
            ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||
Sbjct: 1637 accacgttgcagatctgccggccgaggtacacctccgacatgacctggtccgtgccgccg 1578

                    
Query: 715  gcggcggc 722
            || |||||
Sbjct: 1577 gccgcggc 1570



to top

>gb|AY103865.1| Zea mays PCO148437 mRNA sequence
          Length = 2490

 Score =  349 bits (176), Expect = 8e-93
 Identities = 275/308 (89%)
 Strand = Plus / Minus

                                                                        
Query: 415  gcggcgaggcgccatgcggaagtggcgatcagcgggcgcgtgtgccacccgagagtcagg 474
            ||||||| |||||| || || |||||||| ||||||||||| |||||||| || ||||||
Sbjct: 2076 gcggcgacgcgccacgccgaggtggcgatgagcgggcgcgtatgccaccccagggtcagg 2017

                                                                        
Query: 475  cacccttccttctcttccaccttgtacccgtcgccgccggcgaagagggccagcagcgtg 534
            ||||| |||||||| |||| | ||||||||||||||||||||||||| ||||||||||||
Sbjct: 2016 cacccgtccttctcctccaacctgtacccgtcgccgccggcgaagagcgccagcagcgtg 1957

                                                                        
Query: 535  ctcgcctgcttgtaggcattggagcccaggtgcacggtctcgaacccggcgttgcccagc 594
            ||||||||||||||||||||||||||||||||||||| | ||||||||| |  ||| |  
Sbjct: 1956 ctcgcctgcttgtaggcattggagcccaggtgcacgggcgcgaacccggagccgccgaag 1897

                                                                        
Query: 595  cggttccgccactgccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggcc 654
            ||| | |||||||| ||||  |||||||| ||||| |||||||||| ||||||||| |||
Sbjct: 1896 cggctgcgccactggcccaacgtctcgtggcgctccgtgcgctccgcgccctcgcacgcc 1837

                                                                        
Query: 655  accacgttgcagatctgccggccgaggtacacctcggacatgacctggtccgtgccggcg 714
            ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||
Sbjct: 1836 accacgttgcagatctgccggccgaggtacacctccgacatgacctggtccgtgccgccg 1777

                    
Query: 715  gcggcggc 722
            || |||||
Sbjct: 1776 gccgcggc 1769



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  347 bits (175), Expect = 3e-92
 Identities = 274/307 (89%)
 Strand = Plus / Minus

                                                                            
Query: 404      gcgatcacggcgcggcgaggcgccatgcggaagtggcgatcagcgggcgcgtgtgccacc 463
                ||||||||| |||||||| ||||||||| || |||||||| ||||||||||||||||| |
Sbjct: 28219823 gcgatcacgccgcggcgacgcgccatgccgaggtggcgatgagcgggcgcgtgtgccagc 28219764

                                                                            
Query: 464      cgagagtcaggcacccttccttctcttccaccttgtacccgtcgccgccggcgaagaggg 523
                | || || ||||| || |||||||| ||||||  ||| ||||||||||||||||| || |
Sbjct: 28219763 ccagcgtgaggcagccctccttctcctccacccggtagccgtcgccgccggcgaaaagcg 28219704

                                                                            
Query: 524      ccagcagcgtgctcgcctgcttgtaggcattggagcccaggtgcacggtctcgaacccgg 583
                | || |||||||||||||| |||||||||||||||||||||||||||| |||||| ||||
Sbjct: 28219703 cgaggagcgtgctcgcctgtttgtaggcattggagcccaggtgcacgggctcgaagccgg 28219644

                                                                            
Query: 584      cgttgcccagccggttccgccactgccccagtgtctcgtgccgctctgtgcgctccgtgc 643
                ||  ||| || ||||| |||||||||||||| |||||||| ||||| |||||||||| ||
Sbjct: 28219643 cgcggccgaggcggttgcgccactgccccagcgtctcgtggcgctccgtgcgctccgcgc 28219584

                                                                            
Query: 644      cctcgcaggccaccacgttgcagatctgccggccgaggtacacctcggacatgacctggt 703
                ||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 28219583 cctcgcacgccacgacgttgcagatctgccggccgaggtacacctcggacatgacctggt 28219524

                       
Query: 704      ccgtgcc 710
                |||||||
Sbjct: 28219523 ccgtgcc 28219517



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                                    
Query: 13       cttatttaatatgagcgattggaggaattacacata 48
                |||||||||||||||||||||||| |||||||||||
Sbjct: 28220134 cttatttaatatgagcgattggagaaattacacata 28220099



to top

>gb|AC087797.5| Oryza sativa chromosome 3 BAC OSJNBb0022E02 genomic sequence, complete
             sequence
          Length = 122497

 Score =  347 bits (175), Expect = 3e-92
 Identities = 274/307 (89%)
 Strand = Plus / Minus

                                                                         
Query: 404   gcgatcacggcgcggcgaggcgccatgcggaagtggcgatcagcgggcgcgtgtgccacc 463
             ||||||||| |||||||| ||||||||| || |||||||| ||||||||||||||||| |
Sbjct: 70964 gcgatcacgccgcggcgacgcgccatgccgaggtggcgatgagcgggcgcgtgtgccagc 70905

                                                                         
Query: 464   cgagagtcaggcacccttccttctcttccaccttgtacccgtcgccgccggcgaagaggg 523
             | || || ||||| || |||||||| ||||||  ||| ||||||||||||||||| || |
Sbjct: 70904 ccagcgtgaggcagccctccttctcctccacccggtagccgtcgccgccggcgaaaagcg 70845

                                                                         
Query: 524   ccagcagcgtgctcgcctgcttgtaggcattggagcccaggtgcacggtctcgaacccgg 583
             | || |||||||||||||| |||||||||||||||||||||||||||| |||||| ||||
Sbjct: 70844 cgaggagcgtgctcgcctgtttgtaggcattggagcccaggtgcacgggctcgaagccgg 70785

                                                                         
Query: 584   cgttgcccagccggttccgccactgccccagtgtctcgtgccgctctgtgcgctccgtgc 643
             ||  ||| || ||||| |||||||||||||| |||||||| ||||| |||||||||| ||
Sbjct: 70784 cgcggccgaggcggttgcgccactgccccagcgtctcgtggcgctccgtgcgctccgcgc 70725

                                                                         
Query: 644   cctcgcaggccaccacgttgcagatctgccggccgaggtacacctcggacatgacctggt 703
             ||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 70724 cctcgcacgccacgacgttgcagatctgccggccgaggtacacctcggacatgacctggt 70665

                    
Query: 704   ccgtgcc 710
             |||||||
Sbjct: 70664 ccgtgcc 70658



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                                 
Query: 13    cttatttaatatgagcgattggaggaattacacata 48
             |||||||||||||||||||||||| |||||||||||
Sbjct: 71275 cttatttaatatgagcgattggagaaattacacata 71240



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  347 bits (175), Expect = 3e-92
 Identities = 274/307 (89%)
 Strand = Plus / Minus

                                                                            
Query: 404      gcgatcacggcgcggcgaggcgccatgcggaagtggcgatcagcgggcgcgtgtgccacc 463
                ||||||||| |||||||| ||||||||| || |||||||| ||||||||||||||||| |
Sbjct: 28311147 gcgatcacgccgcggcgacgcgccatgccgaggtggcgatgagcgggcgcgtgtgccagc 28311088

                                                                            
Query: 464      cgagagtcaggcacccttccttctcttccaccttgtacccgtcgccgccggcgaagaggg 523
                | || || ||||| || |||||||| ||||||  ||| ||||||||||||||||| || |
Sbjct: 28311087 ccagcgtgaggcagccctccttctcctccacccggtagccgtcgccgccggcgaaaagcg 28311028

                                                                            
Query: 524      ccagcagcgtgctcgcctgcttgtaggcattggagcccaggtgcacggtctcgaacccgg 583
                | || |||||||||||||| |||||||||||||||||||||||||||| |||||| ||||
Sbjct: 28311027 cgaggagcgtgctcgcctgtttgtaggcattggagcccaggtgcacgggctcgaagccgg 28310968

                                                                            
Query: 584      cgttgcccagccggttccgccactgccccagtgtctcgtgccgctctgtgcgctccgtgc 643
                ||  ||| || ||||| |||||||||||||| |||||||| ||||| |||||||||| ||
Sbjct: 28310967 cgcggccgaggcggttgcgccactgccccagcgtctcgtggcgctccgtgcgctccgcgc 28310908

                                                                            
Query: 644      cctcgcaggccaccacgttgcagatctgccggccgaggtacacctcggacatgacctggt 703
                ||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 28310907 cctcgcacgccacgacgttgcagatctgccggccgaggtacacctcggacatgacctggt 28310848

                       
Query: 704      ccgtgcc 710
                |||||||
Sbjct: 28310847 ccgtgcc 28310841



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                                    
Query: 13       cttatttaatatgagcgattggaggaattacacata 48
                |||||||||||||||||||||||| |||||||||||
Sbjct: 28311458 cttatttaatatgagcgattggagaaattacacata 28311423



to top

>gb|AY781175.1| Oryza sativa (indica cultivar-group) gibberellic acid-insensitive
            (GAI) gene, promoter region and complete cds
          Length = 3494

 Score =  347 bits (175), Expect = 3e-92
 Identities = 274/307 (89%)
 Strand = Plus / Minus

                                                                        
Query: 404  gcgatcacggcgcggcgaggcgccatgcggaagtggcgatcagcgggcgcgtgtgccacc 463
            ||||||||| |||||||| ||||||||| || |||||||| ||||||||||||||||| |
Sbjct: 3385 gcgatcacgccgcggcgacgcgccatgccgaggtggcgatgagcgggcgcgtgtgccagc 3326

                                                                        
Query: 464  cgagagtcaggcacccttccttctcttccaccttgtacccgtcgccgccggcgaagaggg 523
            | || || ||||| || |||||||| ||||||  ||| ||||||||||||||||| || |
Sbjct: 3325 ccagcgtgaggcagccctccttctcctccacccggtagccgtcgccgccggcgaaaagcg 3266

                                                                        
Query: 524  ccagcagcgtgctcgcctgcttgtaggcattggagcccaggtgcacggtctcgaacccgg 583
            | || |||||||||||||| |||||||||||||||||||||||||||| |||||| ||||
Sbjct: 3265 cgaggagcgtgctcgcctgtttgtaggcattggagcccaggtgcacgggctcgaagccgg 3206

                                                                        
Query: 584  cgttgcccagccggttccgccactgccccagtgtctcgtgccgctctgtgcgctccgtgc 643
            ||  ||| || ||||| |||||||||||||| |||||||| ||||| |||||||||| ||
Sbjct: 3205 cgcggccgaggcggttgcgccactgccccagcgtctcgtggcgctccgtgcgctccgcgc 3146

                                                                        
Query: 644  cctcgcaggccaccacgttgcagatctgccggccgaggtacacctcggacatgacctggt 703
            ||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3145 cctcgcacgccacgacgttgcagatctgccggccgaggtacacctcggacatgacctggt 3086

                   
Query: 704  ccgtgcc 710
            |||||||
Sbjct: 3085 ccgtgcc 3079



to top

>dbj|AB030956.1| Oryza sativa (japonica cultivar-group) mRNA for OsGAI, complete cds
          Length = 2500

 Score =  347 bits (175), Expect = 3e-92
 Identities = 274/307 (89%)
 Strand = Plus / Minus

                                                                        
Query: 404  gcgatcacggcgcggcgaggcgccatgcggaagtggcgatcagcgggcgcgtgtgccacc 463
            ||||||||| |||||||| ||||||||| || |||||||| ||||||||||||||||| |
Sbjct: 2097 gcgatcacgccgcggcgacgcgccatgccgaggtggcgatgagcgggcgcgtgtgccagc 2038

                                                                        
Query: 464  cgagagtcaggcacccttccttctcttccaccttgtacccgtcgccgccggcgaagaggg 523
            | || || ||||| || |||||||| ||||||  ||| ||||||||||||||||| || |
Sbjct: 2037 ccagcgtgaggcagccctccttctcctccacccggtagccgtcgccgccggcgaaaagcg 1978

                                                                        
Query: 524  ccagcagcgtgctcgcctgcttgtaggcattggagcccaggtgcacggtctcgaacccgg 583
            | || |||||||||||||| |||||||||||||||||||||||||||| |||||| ||||
Sbjct: 1977 cgaggagcgtgctcgcctgtttgtaggcattggagcccaggtgcacgggctcgaagccgg 1918

                                                                        
Query: 584  cgttgcccagccggttccgccactgccccagtgtctcgtgccgctctgtgcgctccgtgc 643
            ||  ||| || ||||| |||||||||||||| |||||||| ||||| |||||||||| ||
Sbjct: 1917 cgcggccgaggcggttgcgccactgccccagcgtctcgtggcgctccgtgcgctccgcgc 1858

                                                                        
Query: 644  cctcgcaggccaccacgttgcagatctgccggccgaggtacacctcggacatgacctggt 703
            ||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1857 cctcgcacgccacgacgttgcagatctgccggccgaggtacacctcggacatgacctggt 1798

                   
Query: 704  ccgtgcc 710
            |||||||
Sbjct: 1797 ccgtgcc 1791



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                                
Query: 13   cttatttaatatgagcgattggaggaattacacata 48
            |||||||||||||||||||||||| |||||||||||
Sbjct: 2408 cttatttaatatgagcgattggagaaattacacata 2373



to top

>ref|XM_469478.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2109

 Score =  339 bits (171), Expect = 8e-90
 Identities = 270/303 (89%)
 Strand = Plus / Minus

                                                                        
Query: 408  tcacggcgcggcgaggcgccatgcggaagtggcgatcagcgggcgcgtgtgccacccgag 467
            ||||| |||||||| ||||||||| || |||||||| ||||||||||||||||| || ||
Sbjct: 2109 tcacgccgcggcgacgcgccatgccgaggtggcgatgagcgggcgcgtgtgccagcccag 2050

                                                                        
Query: 468  agtcaggcacccttccttctcttccaccttgtacccgtcgccgccggcgaagagggccag 527
             || ||||| || |||||||| ||||||  ||| ||||||||||||||||| || || ||
Sbjct: 2049 cgtgaggcagccctccttctcctccacccggtagccgtcgccgccggcgaaaagcgcgag 1990

                                                                        
Query: 528  cagcgtgctcgcctgcttgtaggcattggagcccaggtgcacggtctcgaacccggcgtt 587
             |||||||||||||| |||||||||||||||||||||||||||| |||||| ||||||  
Sbjct: 1989 gagcgtgctcgcctgtttgtaggcattggagcccaggtgcacgggctcgaagccggcgcg 1930

                                                                        
Query: 588  gcccagccggttccgccactgccccagtgtctcgtgccgctctgtgcgctccgtgccctc 647
            ||| || ||||| |||||||||||||| |||||||| ||||| |||||||||| ||||||
Sbjct: 1929 gccgaggcggttgcgccactgccccagcgtctcgtggcgctccgtgcgctccgcgccctc 1870

                                                                        
Query: 648  gcaggccaccacgttgcagatctgccggccgaggtacacctcggacatgacctggtccgt 707
            ||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1869 gcacgccacgacgttgcagatctgccggccgaggtacacctcggacatgacctggtccgt 1810

               
Query: 708  gcc 710
            |||
Sbjct: 1809 gcc 1807



to top

>gb|BT018988.1| Zea mays clone Contig445.F mRNA sequence
          Length = 1241

 Score =  321 bits (162), Expect = 2e-84
 Identities = 270/306 (88%)
 Strand = Plus / Minus

                                                                       
Query: 408 tcacggcgcggcgaggcgccatgcggaagtggcgatcagcgggcgcgtgtgccacccgag 467
           |||||| ||||||| |||||| || || |||||||| ||||||||||| ||||| || ||
Sbjct: 949 tcacggagcggcgacgcgccacgccgaggtggcgatgagcgggcgcgtatgccatcccag 890

                                                                       
Query: 468 agtcaggcacccttccttctcttccaccttgtacccgtcgccgccggcgaagagggccag 527
           |||||||||||| |||||||| |||||| |||||||||||||||||||||||||||||||
Sbjct: 889 agtcaggcacccgtccttctcctccaccctgtacccgtcgccgccggcgaagagggccag 830

                                                                       
Query: 528 cagcgtgctcgcctgcttgtaggcattggagcccaggtgcacggtctcgaacccggcgtt 587
           ||||||||| |||||||||||||| ||||| ||||||||||||| |||||||||||    
Sbjct: 829 cagcgtgcttgcctgcttgtaggcgttggatcccaggtgcacgggctcgaacccggaccc 770

                                                                       
Query: 588 gcccagccggttccgccactgccccagtgtctcgtgccgctctgtgcgctccgtgccctc 647
           ||| || |||   ||||||||  |||| |||||||| ||||| |||||||| | ||||||
Sbjct: 769 gccgaggcggccgcgccactggaccagcgtctcgtggcgctccgtgcgctcggcgccctc 710

                                                                       
Query: 648 gcaggccaccacgttgcagatctgccggccgaggtacacctcggacatgacctggtccgt 707
           ||| ||||| | |||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 709 gcacgccacgatgttgcagatctgccggccgaggtacacctcggacatcacctggtccgt 650

                 
Query: 708 gccggc 713
           ||||||
Sbjct: 649 gccggc 644



to top

>gb|AF413142.1| Zea mays cultivar MS153 DWARF8 gene, partial cds
          Length = 2624

 Score =  212 bits (107), Expect = 1e-51
 Identities = 158/175 (90%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2624 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2565

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            ||||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2564 gccccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2505

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2504 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2450



to top

>gb|AF413203.1| Zea mays cultivar A554 DWARF8 gene, partial cds
          Length = 2476

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2476 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2417

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2416 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2357

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2356 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2302



to top

>gb|AF413201.1| Zea mays cultivar A6 DWARF8 gene, partial cds
          Length = 2631

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2631 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2572

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2571 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2512

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2511 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2457



to top

>gb|AF413200.1| Zea mays cultivar Ky21 DWARF8 gene, partial cds
          Length = 2983

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2983 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2924

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2923 gtcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2864

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2863 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2809



to top

>gb|AF413199.1| Zea mays cultivar IDS28 DWARF8 gene, partial cds
          Length = 2983

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2983 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2924

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2923 gtcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2864

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2863 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2809



to top

>gb|AF413198.1| Zea mays cultivar B14A DWARF8 gene, partial cds
          Length = 2638

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2638 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2579

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2578 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2519

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2518 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2464



to top

>gb|AF413197.1| Zea mays cultivar CML287 DWARF8 gene, partial cds
          Length = 2638

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2638 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2579

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2578 gtcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2519

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2518 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2464



to top

>gb|AF413195.1| Zea mays cultivar NC296 DWARF8 gene, partial cds
          Length = 2638

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2638 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2579

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2578 gtcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2519

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2518 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2464



to top

>gb|AF413194.1| Zea mays cultivar NC338 DWARF8 gene, partial cds
          Length = 2638

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2638 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2579

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2578 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2519

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2518 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2464



to top

>gb|AF413193.1| Zea mays cultivar CI187 DWARF8 gene, partial cds
          Length = 2633

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2633 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2574

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2573 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2514

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2513 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2459



to top

>gb|AF413192.1| Zea mays cultivar EP1 DWARF8 gene, partial cds
          Length = 2638

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2638 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2579

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2578 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2519

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2518 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2464



to top

>gb|AF413191.1| Zea mays cultivar CML247 DWARF8 gene, partial cds
          Length = 2635

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2635 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2576

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2575 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2516

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2515 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2461



to top

>gb|AF413190.1| Zea mays cultivar CML254 DWARF8 gene, partial cds
          Length = 2638

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2638 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2579

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2578 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2519

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2518 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2464



to top

>gb|AF413189.1| Zea mays cultivar B103 DWARF8 gene, partial cds
          Length = 2639

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2639 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2580

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2579 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2520

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2519 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2465



to top

>gb|AF413188.1| Zea mays cultivar KUI11 DWARF8 gene, partial cds
          Length = 2638

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||| ||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2638 aggcattggaccccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2579

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            ||||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2578 gccccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2519

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2518 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2464



to top

>gb|AF413185.1| Zea mays cultivar NC300 DWARF8 gene, partial cds
          Length = 2605

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2605 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2546

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2545 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2486

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2485 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2431



to top

>gb|AF413184.1| Zea mays cultivar B97 DWARF8 gene, partial cds
          Length = 2638

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2638 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2579

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2578 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2519

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2518 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2464



to top

>gb|AF413183.1| Zea mays cultivar W153R DWARF8 gene, partial cds
          Length = 2620

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2620 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2561

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2560 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2501

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2500 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2446



to top

>gb|AF413182.1| Zea mays cultivar D940Y DWARF8 gene, partial cds
          Length = 2638

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2638 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2579

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2578 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2519

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2518 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2464



to top

>gb|AF413181.1| Zea mays cultivar IA2132 DWARF8 gene, partial cds
          Length = 2619

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2619 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2560

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2559 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2500

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2499 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2445



to top

>gb|AF413180.1| Zea mays cultivar TZI8 DWARF8 gene, partial cds
          Length = 2638

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2638 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2579

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2578 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2519

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2518 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2464



to top

>gb|AF413179.1| Zea mays cultivar IL677A DWARF8 gene, partial cds
          Length = 2638

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2638 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2579

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2578 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2519

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2518 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2464



to top

>gb|AF413178.1| Zea mays cultivar NC298 DWARF8 gene, partial cds
          Length = 2638

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2638 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2579

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2578 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2519

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2518 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2464



to top

>gb|AF413177.1| Zea mays cultivar SC55 DWARF8 gene, partial cds
          Length = 2638

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2638 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2579

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2578 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2519

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2518 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2464



to top

>gb|AF413176.1| Zea mays cultivar MO24W DWARF8 gene, partial cds
          Length = 2630

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2630 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2571

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2570 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2511

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2510 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2456



to top

>gb|AF413175.1| Zea mays cultivar CML261 DWARF8 gene, partial cds
          Length = 2623

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2623 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2564

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2563 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2504

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2503 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2449



to top

>gb|AF413174.1| Zea mays cultivar CML10 DWARF8 gene, partial cds
          Length = 2638

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2638 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2579

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2578 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2519

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2518 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2464



to top

>gb|AF413173.1| Zea mays cultivar A441 DWARF8 gene, partial cds
          Length = 2639

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2639 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2580

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2579 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2520

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2519 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2465



to top

>gb|AF413172.1| Zea mays cultivar F44 DWARF8 gene, partial cds
          Length = 2639

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2639 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2580

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2579 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2520

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2519 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2465



to top

>gb|AF413171.1| Zea mays cultivar GT112 DWARF8 gene, partial cds
          Length = 2633

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2633 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2574

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2573 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2514

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2513 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2459



to top

>gb|AF413170.1| Zea mays cultivar K55 DWARF8 gene, partial cds
          Length = 2639

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2639 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2580

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2579 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2520

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2519 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2465



to top

>gb|AF413169.1| Zea mays cultivar N28HT DWARF8 gene, partial cds
          Length = 2638

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2638 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2579

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2578 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2519

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2518 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2464



to top

>gb|AF413168.1| Zea mays cultivar NC250 DWARF8 gene, partial cds
          Length = 2638

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2638 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2579

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2578 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2519

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2518 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2464



to top

>gb|AF413167.1| Zea mays cultivar CML333 DWARF8 gene, partial cds
          Length = 2638

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2638 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2579

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2578 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2519

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2518 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2464



to top

>gb|AF413166.1| Zea mays cultivar KUI2007 DWARF8 gene, partial cds
          Length = 2639

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2639 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2580

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2579 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2520

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2519 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2465



to top

>gb|AF413165.1| Zea mays cultivar CML277 DWARF8 gene, partial cds
          Length = 2638

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2638 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2579

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2578 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2519

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2518 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2464



to top

>gb|AF413164.1| Zea mays cultivar B84 DWARF8 gene, partial cds
          Length = 2638

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2638 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2579

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2578 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2519

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2518 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2464



to top

>gb|AF413163.1| Zea mays cultivar CML281 DWARF8 gene, partial cds
          Length = 2645

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2645 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2586

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2585 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2526

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2525 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2471



to top

>gb|AF413162.1| Zea mays cultivar B73 DWARF8 gene, partial cds
          Length = 2638

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2638 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2579

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2578 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2519

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2518 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2464



to top

>gb|AF413161.1| Zea mays cultivar B37 DWARF8 gene, partial cds
          Length = 2638

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2638 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2579

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2578 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2519

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2518 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2464



to top

>gb|AF413160.1| Zea mays cultivar A272 DWARF8 gene, partial cds
          Length = 2639

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2639 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2580

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2579 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2520

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2519 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2465



to top

>gb|AF413159.1| Zea mays cultivar CML5 DWARF8 gene, partial cds
          Length = 2641

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2641 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2582

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2581 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2522

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2521 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2467



to top

>gb|AF413158.1| Zea mays cultivar NC320 DWARF8 gene, partial cds
          Length = 2633

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2633 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2574

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2573 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2514

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2513 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2459



to top

>gb|AF413157.1| Zea mays cultivar Tzi18 DWARF8 gene, partial cds
          Length = 2638

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2638 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2579

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2578 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2519

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2518 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2464



to top

>gb|AF413156.1| Zea mays cultivar NC348 DWARF8 gene, partial cds
          Length = 2638

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2638 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2579

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2578 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2519

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2518 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2464



to top

>gb|AF413155.1| Zea mays cultivar A632 DWARF8 gene, partial cds
          Length = 2638

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2638 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2579

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2578 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2519

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2518 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2464



to top

>gb|AF413154.1| Zea mays cultivar B104 DWARF8 gene, partial cds
          Length = 2638

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2638 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2579

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2578 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2519

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2518 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2464



to top

>gb|AF413153.1| Zea mays cultivar B68 DWARF8 gene, partial cds
          Length = 2637

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2637 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2578

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2577 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2518

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2517 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2463



to top

>gb|AF413152.1| Zea mays cultivar KUI3 DWARF8 gene, partial cds
          Length = 2639

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2639 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2580

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2579 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2520

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2519 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2465



to top

>gb|AF413151.1| Zea mays cultivar SA24 DWARF8 gene, partial cds
          Length = 2633

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2633 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2574

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2573 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2514

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2513 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2459



to top

>gb|AF413150.1| Zea mays cultivar T232 DWARF8 gene, partial cds
          Length = 2638

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2638 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2579

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2578 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2519

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2518 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2464



to top

>gb|AF413149.1| Zea mays cultivar W117HT DWARF8 gene, partial cds
          Length = 2616

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2616 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2557

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2556 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2497

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2496 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2442



to top

>gb|AF413148.1| Zea mays cultivar SG18 DWARF8 gene, partial cds
          Length = 2638

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2638 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2579

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2578 gtcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2519

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2518 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2464



to top

>gb|AF413147.1| Zea mays cultivar NC350 DWARF8 gene, partial cds
          Length = 2638

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2638 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2579

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2578 gtcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2519

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2518 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2464



to top

>gb|AF413146.1| Zea mays cultivar NC352 DWARF8 gene, partial cds
          Length = 2423

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2423 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2364

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2363 gtcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2304

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2303 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2249



to top

>gb|AF413144.1| Zea mays cultivar NC304 DWARF8 gene, partial cds
          Length = 2591

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2591 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2532

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2531 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2472

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2471 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2417



to top

>gb|AF413143.1| Zea mays cultivar ND246 DWARF8 gene, partial cds
          Length = 2577

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2577 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2518

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2517 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2458

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2457 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2403



to top

>gb|AF413141.1| Zea mays cultivar NC260 DWARF8 gene, partial cds
          Length = 2655

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2655 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2596

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2595 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2536

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2535 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2481



to top

>gb|AF413140.1| Zea mays cultivar CML258 DWARF8 gene, partial cds
          Length = 2657

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2657 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2598

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2597 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2538

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2537 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2483



to top

>gb|AF413139.1| Zea mays cultivar NC354 DWARF8 gene, partial cds
          Length = 2657

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2657 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2598

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2597 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2538

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2537 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2483



to top

>gb|AF413138.1| Zea mays cultivar Q6199 DWARF8 gene, partial cds
          Length = 2657

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2657 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2598

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2597 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2538

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2537 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2483



to top

>gb|AF413137.1| Zea mays cultivar I137TN DWARF8 gene, partial cds
          Length = 2649

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2649 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2590

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2589 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2530

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2529 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2475



to top

>gb|AF413136.1| Zea mays cultivar KUI21 DWARF8 gene, partial cds
          Length = 2654

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2654 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2595

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2594 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2535

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2534 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2480



to top

>gb|AF413135.1| Zea mays cultivar H99 DWARF8 gene, partial cds
          Length = 2654

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2654 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2595

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2594 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2535

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2534 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2480



to top

>gb|AF413134.1| Zea mays cultivar W64A DWARF8 gene, partial cds
          Length = 2654

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2654 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2595

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2594 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2535

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2534 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2480



to top

>gb|AF413133.1| Zea mays cultivar PA91 DWARF8 gene, partial cds
          Length = 2654

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2654 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2595

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2594 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2535

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2534 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2480



to top

>gb|AF413132.1| Zea mays cultivar SC213 DWARF8 gene, partial cds
          Length = 2654

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2654 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2595

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2594 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2535

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2534 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2480



to top

>gb|AF413131.1| Zea mays cultivar TX601 DWARF8 gene, partial cds
          Length = 2653

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2653 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2594

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2593 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2534

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2533 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2479



to top

>gb|AF413130.1| Zea mays cultivar U267Y DWARF8 gene, partial cds
          Length = 2654

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2654 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2595

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2594 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2535

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2534 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2480



to top

>gb|AF413129.1| Zea mays cultivar WF9 DWARF8 gene, partial cds
          Length = 2653

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2653 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2594

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2593 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2534

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2533 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2479



to top

>gb|AF413128.1| Zea mays cultivar KUI43 DWARF8 gene, partial cds
          Length = 2426

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2426 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2367

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2366 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2307

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2306 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2252



to top

>gb|AF413127.1| Zea mays cultivar M162W DWARF8 gene, partial cds
          Length = 2458

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2458 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2399

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2398 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2339

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2338 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2284



to top

>gb|AF413126.1| Zea mays cultivar Mo17 DWARF8 gene, partial cds
          Length = 2631

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2631 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2572

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2571 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2512

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2511 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2457



to top

>gb|AF413125.1| Zea mays cultivar 38-11 DWARF8 gene, partial cds
          Length = 2624

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2624 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2565

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2564 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2505

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2504 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2450



to top

>gb|AF413124.1| Zea mays cultivar W182B DWARF8 gene, partial cds
          Length = 2611

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2611 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2552

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2551 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2492

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2491 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2437



to top

>gb|AF413123.1| Zea mays cultivar C103 DWARF8 gene, partial cds
          Length = 2556

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2556 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2497

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2496 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2437

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2436 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2382



to top

>gb|AF413122.1| Zea mays cultivar OH7B DWARF8 gene, partial cds
          Length = 2611

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2611 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2552

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2551 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2492

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2491 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2437



to top

>gb|AF413113.1| Zea mays cultivar I29 DWARF8 gene, partial cds
          Length = 2978

 Score =  204 bits (103), Expect = 3e-49
 Identities = 157/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2978 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2919

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2918 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2859

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2858 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2804



to top

>gb|AF413202.1| Zea mays cultivar N192 DWARF8 gene, partial cds
          Length = 2455

 Score =  196 bits (99), Expect = 7e-47
 Identities = 156/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2455 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2396

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||| ||||||||||
Sbjct: 2395 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccacgacgttgcaga 2336

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2335 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2281



to top

>gb|AF413196.1| Zea mays cultivar KUI44 DWARF8 gene, partial cds
          Length = 2645

 Score =  196 bits (99), Expect = 7e-47
 Identities = 156/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            ||||||||||||| |||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2645 aggcattggagccaaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2586

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2585 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2526

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2525 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2471



to top

>gb|AF413187.1| Zea mays cultivar Tzi10 DWARF8 gene, partial cds
          Length = 2639

 Score =  196 bits (99), Expect = 7e-47
 Identities = 156/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||| ||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2639 aggcattggagctcaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2580

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2579 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2520

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2519 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2465



to top

>gb|AF413186.1| Zea mays cultivar M37W DWARF8 gene, partial cds
          Length = 2638

 Score =  196 bits (99), Expect = 7e-47
 Identities = 156/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||| ||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2638 aggcattggagctcaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2579

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2578 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2519

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2518 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2464



to top

>gb|AF413145.1| Zea mays cultivar F2 DWARF8 gene, partial cds
          Length = 2431

 Score =  196 bits (99), Expect = 7e-47
 Identities = 156/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2431 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2372

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 2371 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccaccacgttgcaga 2312

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||| ||||||||||||||||| |||| |||||
Sbjct: 2311 tctgccggccgaggtacacctccgacttgacctggtccgtgccgccggccgcggc 2257



to top

>gb|AF413121.1| Zea mays cultivar CM105 DWARF8 gene, partial cds
          Length = 2413

 Score =  196 bits (99), Expect = 7e-47
 Identities = 156/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2413 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2354

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||| ||||||||||
Sbjct: 2353 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccacgacgttgcaga 2294

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2293 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2239



to top

>gb|AF413120.1| Zea mays cultivar OH43 DWARF8 gene, partial cds
          Length = 2377

 Score =  196 bits (99), Expect = 7e-47
 Identities = 156/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2377 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2318

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||| ||||||||||
Sbjct: 2317 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccacgacgttgcaga 2258

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2257 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2203



to top

>gb|AF413119.1| Zea mays cultivar P39 DWARF8 gene, partial cds
          Length = 2932

 Score =  196 bits (99), Expect = 7e-47
 Identities = 156/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2932 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2873

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||| ||||||||||
Sbjct: 2872 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccacgacgttgcaga 2813

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2812 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2758



to top

>gb|AF413118.1| Zea mays cultivar F2834T DWARF8 gene, partial cds
          Length = 2972

 Score =  196 bits (99), Expect = 7e-47
 Identities = 156/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2972 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2913

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||| ||||||||||
Sbjct: 2912 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccacgacgttgcaga 2853

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2852 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2798



to top

>gb|AF413117.1| Zea mays cultivar CMV3 DWARF8 gene, partial cds
          Length = 2972

 Score =  196 bits (99), Expect = 7e-47
 Identities = 156/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2972 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2913

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||| ||||||||||
Sbjct: 2912 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccacgacgttgcaga 2853

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2852 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2798



to top

>gb|AF413116.1| Zea mays cultivar F7 DWARF8 gene, partial cds
          Length = 2972

 Score =  196 bits (99), Expect = 7e-47
 Identities = 156/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2972 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2913

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||| ||||||||||
Sbjct: 2912 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccacgacgttgcaga 2853

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2852 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2798



to top

>gb|AF413115.1| Zea mays cultivar CM174 DWARF8 gene, partial cds
          Length = 2972

 Score =  196 bits (99), Expect = 7e-47
 Identities = 156/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2972 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2913

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||| ||||||||||
Sbjct: 2912 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccacgacgttgcaga 2853

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2852 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2798



to top

>gb|AF413114.1| Zea mays cultivar CM7 DWARF8 gene, partial cds
          Length = 2967

 Score =  196 bits (99), Expect = 7e-47
 Identities = 156/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2967 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2908

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||| ||||||||||
Sbjct: 2907 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccacgacgttgcaga 2848

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2847 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2793



to top

>gb|AF413112.1| Zea mays cultivar A619 DWARF8 gene, partial cds
          Length = 2971

 Score =  196 bits (99), Expect = 7e-47
 Identities = 156/175 (89%)
 Strand = Plus / Minus

                                                                        
Query: 548  aggcattggagcccaggtgcacggtctcgaacccggcgttgcccagccggttccgccact 607
            |||||||||||||||||||||||| | ||||||||| |  ||| || ||| | |||||||
Sbjct: 2971 aggcattggagcccaggtgcacgggcgcgaacccggagccgccgaggcggctgcgccact 2912

                                                                        
Query: 608  gccccagtgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcaga 667
            | ||||| |||||||| ||||| |||||||||| ||||||||| ||||| ||||||||||
Sbjct: 2911 ggcccagcgtctcgtggcgctccgtgcgctccgcgccctcgcacgccacgacgttgcaga 2852

                                                                   
Query: 668  tctgccggccgaggtacacctcggacatgacctggtccgtgccggcggcggcggc 722
            |||||||||||||||||||||| ||||||||||||||||||||| |||| |||||
Sbjct: 2851 tctgccggccgaggtacacctccgacatgacctggtccgtgccgccggccgcggc 2797



to top

>gb|AY389546.1| Hyacinthus orientalis GAI-like protein mRNA, partial cds
          Length = 648

 Score =  117 bits (59), Expect = 5e-23
 Identities = 217/267 (81%), Gaps = 2/267 (0%)
 Strand = Plus / Minus

                                                                       
Query: 436 gtggcgatcagcgggcgcgtgtgccacccgagagtcaggcacccttccttctcttccacc 495
           |||||||| ||||| |  |||||||||||||| || || || || || ||||| || |||
Sbjct: 621 gtggcgatgagcggtctggtgtgccacccgagcgtgagacaaccatctttctcctctacc 562

                                                                       
Query: 496 ttgtacccgtcgccgccggcgaagagggccagcagcgtgctcgcctgcttgtaggcattg 555
            ||||||| | |||||||||||| || ||||||||| |||||||||||||| | || || 
Sbjct: 561 ctgtacccattgccgccggcgaaaagcgccagcagcatgctcgcctgcttgaacgcgttc 502

                                                                       
Query: 556 gagcccaggtgcacggtctcgaacccggc-gttgcccagccggttccgccactgccccag 614
           || |||| ||| || | |||||||||||| |  |   ||| |||||| ||||||  ||| 
Sbjct: 501 gaacccaagtggaccggctcgaacccggccggcgataagc-ggttcctccactggaccaa 443

                                                                       
Query: 615 tgtctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacgttgcagatctgccg 674
            |||||||||| ||| || || ||||  ||||||||||||||||||||||||||||| ||
Sbjct: 442 cgtctcgtgcctctcggtccgttccgcaccctcgcaggccaccacgttgcagatctgacg 383

                                      
Query: 675 gccgaggtacacctcggacatgacctg 701
           ||| || |||||||| ||||| |||||
Sbjct: 382 gcccagatacacctccgacatcacctg 356



to top

>gb|AF492578.1| Calycadenia multiglandulosa clone CLmCod7 GIA/RGA-like gibberellin
            response modulator (GAI) gene, partial cds
          Length = 1622

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 643  ccctcgcaggccaccacgttgcagatctgccggccgaggtacacctcggacat 695
            ||||| || |||||||||||||| |||||||| || | |||||||||||||||
Sbjct: 1446 ccctcacacgccaccacgttgcatatctgccgccctaagtacacctcggacat 1394



to top

>emb|CR925877.9| Zebrafish DNA sequence from clone DKEY-71B4 in linkage group 1,
             complete sequence
          Length = 73246

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 64    atttaaacataataataatagtaata 89
             ||||||||||||||||||||||||||
Sbjct: 27822 atttaaacataataataatagtaata 27797



to top

>gb|AF378125.1| Vitis vinifera GAI-like protein 1 (GAI1) gene, complete cds
          Length = 2238

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 643  ccctcgcaggccaccacgttgcagatctg 671
            |||||||||||||||||||| ||||||||
Sbjct: 1623 ccctcgcaggccaccacgttacagatctg 1595



to top

>gb|AF492590.1| Dubautia microcephala clone DmiAcopy1 GIA/RGA-like gibberellin
            response modulator (GAI-A) gene, partial cds
          Length = 1612

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 652  gccaccacgttgcagatctgccggccgaggtacacctcggacat 695
            |||||||||||||| |||||||| || | ||||||||| |||||
Sbjct: 1427 gccaccacgttgcatatctgccgccctaagtacacctccgacat 1384



to top

>gb|AF492589.1| Dubautia raillardioides clone DrAcopy1 GIA/RGA-like gibberellin
            response modulator (GAI-A) gene, partial cds
          Length = 1619

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 652  gccaccacgttgcagatctgccggccgaggtacacctcggacat 695
            |||||||||||||| |||||||| || | ||||||||| |||||
Sbjct: 1434 gccaccacgttgcatatctgccgccctaagtacacctccgacat 1391



to top

>gb|AF492588.1| Dubautia menziesii clone DmeAcopy1 GIA/RGA-like gibberellin response
            modulator (GAI-A) gene, partial cds
          Length = 1613

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 652  gccaccacgttgcagatctgccggccgaggtacacctcggacat 695
            |||||||||||||| |||||||| || | ||||||||| |||||
Sbjct: 1428 gccaccacgttgcatatctgccgccctaagtacacctctgacat 1385



to top

>gb|AF492587.1| Dubautia knudsenii clone DkAcopy1 GIA/RGA-like gibberellin response
            modulator (GAI) gene, partial cds
          Length = 1613

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 652  gccaccacgttgcagatctgccggccgaggtacacctcggacat 695
            |||||||||||||| |||||||| || | ||||||||| |||||
Sbjct: 1428 gccaccacgttgcatatctgccgccctaagtacacctccgacat 1385



to top

>gb|AF492586.1| Dubautia arborea clone DaAcopy1 GIA/RGA-like gibberellin response
            modulator (GAI-A) gene, partial cds
          Length = 1604

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 652  gccaccacgttgcagatctgccggccgaggtacacctcggacat 695
            |||||||||||||| |||||||| || | ||||||||| |||||
Sbjct: 1419 gccaccacgttgcatatctgccgccctaagtacacctctgacat 1376



to top

>gb|AF492584.1| Argyroxiphium kauense clone AkAcopy2 GIA/RGA-like gibberellin
            response modulator (GAI-A) gene, partial cds
          Length = 2477

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 652  gccaccacgttgcagatctgccggccgaggtacacctcggacat 695
            |||||||||||||| |||||||| || | ||||||||| |||||
Sbjct: 2292 gccaccacgttgcatatctgccgccctaagtacacctccgacat 2249



to top

>gb|AF492583.1| Argyroxiphium kauense clone AkAcopy1 GIA/RGA-like gibberellin
            response modulator (GAI-A) gene, partial cds
          Length = 2465

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 652  gccaccacgttgcagatctgccggccgaggtacacctcggacat 695
            |||||||||||||| |||||||| || | ||||||||| |||||
Sbjct: 2280 gccaccacgttgcatatctgccgccctaagtacacctccgacat 2237



to top

>gb|AF492582.1| Argyroxiphium sandwicense subsp. macrocephalum clone AsAcopy2
            GIA/RGA-like gibberellin response modulator (GAI-A) gene,
            partial cds
          Length = 2468

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 652  gccaccacgttgcagatctgccggccgaggtacacctcggacat 695
            |||||||||||||| |||||||| || | ||||||||| |||||
Sbjct: 2283 gccaccacgttgcatatctgccgccctaagtacacctccgacat 2240



to top

>gb|AF492581.1| Argyroxiphium sandwicense subsp. macrocephalum clone AsAcopy1
            GIA/RGA-like gibberellin response modulator (GAI-A) gene,
            partial cds
          Length = 2471

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 652  gccaccacgttgcagatctgccggccgaggtacacctcggacat 695
            |||||||||||||| |||||||| || | ||||||||| |||||
Sbjct: 2286 gccaccacgttgcatatctgccgccctaagtacacctccgacat 2243



to top

>gb|AF492580.1| Anisocarpus madioides clone ANm2b GIA/RGA-like gibberellin response
           modulator (GAI) gene, partial cds
          Length = 430

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 652 gccaccacgttgcagatctgccggccgaggtacacctcggacat 695
           |||||||||||||| |||||||| || | ||||||||| |||||
Sbjct: 245 gccaccacgttgcatatctgccgccctaagtacacctccgacat 202



to top

>gb|AF492576.1| Carlquistia muirii clone Cm2 GIA/RGA-like gibberellin response
            modulator (GAI) gene, partial cds
          Length = 2686

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 652  gccaccacgttgcagatctgccggccgaggtacacctcggacat 695
            |||||||||||||| |||||||| || | ||||||||| |||||
Sbjct: 2501 gccaccacgttgcatatctgccgacccaagtacacctccgacat 2458



to top

>gb|AF492575.1| Carlquistia muirii clone Cm1 GIA/RGA-like gibberellin response
            modulator (GAI) gene, partial cds
          Length = 2686

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 652  gccaccacgttgcagatctgccggccgaggtacacctcggacat 695
            |||||||||||||| |||||||| || | ||||||||| |||||
Sbjct: 2501 gccaccacgttgcatatctgccgacccaagtacacctccgacat 2458



to top

>gb|AF492574.1| Madia sativa clone MsCod2 GIA/RGA-like gibberellin response
            modulator-like protein (GAI-B) gene, partial sequence
          Length = 1604

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 652  gccaccacgttgcagatctgccggccgaggtacacctcggacat 695
            |||||||||||||| |||||||| || | ||||||||| |||||
Sbjct: 1419 gccaccacgttgcatatctgccgccctaagtacacctccgacat 1376



to top

>gb|AF492573.1| Madia sativa clone MsCod1 GIA/RGA-like gibberellin response modulator
            (GAI) gene, partial cds
          Length = 1607

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 652  gccaccacgttgcagatctgccggccgaggtacacctcggacat 695
            |||||||||||||| |||||||| || | ||||||||| |||||
Sbjct: 1422 gccaccacgttgcatatctgccgccctaagtacacctccgacat 1379



to top

>gb|AF492572.1| Argyroxiphium sandwicense subsp. macrocephalum clone AsBcopy2
            GIA/RGA-like gibberellin response modulator (GAI-B) gene,
            partial cds
          Length = 2589

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 652  gccaccacgttgcagatctgccggccgaggtacacctcggacat 695
            |||||||||||||| |||||||| || | ||||||||| |||||
Sbjct: 2404 gccaccacgttgcatatctgccgccctaagtacacctccgacat 2361



to top

>gb|AF492571.1| Argyroxiphium sandwicense subsp. macrocephalum clone AsBcopy1
            GIA/RGA-like gibberellin response modulator (GAI-B) gene,
            partial cds
          Length = 2590

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 652  gccaccacgttgcagatctgccggccgaggtacacctcggacat 695
            |||||||||||||| |||||||| || | ||||||||| |||||
Sbjct: 2405 gccaccacgttgcatatctgccgccctaagtacacctccgacat 2362



to top

>gb|AF492570.1| Argyroxiphium kauense clone AkBcopy1n GIA/RGA-like gibberellin
            response modulator (GAI-B) gene, partial cds
          Length = 2598

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 652  gccaccacgttgcagatctgccggccgaggtacacctcggacat 695
            |||||||||||||| |||||||| || | ||||||||| |||||
Sbjct: 2413 gccaccacgttgcatatctgccgccctaagtacacctccgacat 2370



to top

>gb|AF492569.1| Wilkesia gymnoxiphium clone WgBcopy1 GIA/RGA-like gibberellin
            response modulator (GAI-B) gene, partial cds
          Length = 2562

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 652  gccaccacgttgcagatctgccggccgaggtacacctcggacat 695
            |||||||||||||| |||||||| || | ||||||||| |||||
Sbjct: 2377 gccaccacgttgcatatctgccgccctaagtacacctccgacat 2334



to top

>gb|AF492568.1| Wilkesia gymnoxiphium clone WgBcopy2 GIA/RGA-like gibberellin
            response modulator (GAI-B) gene, partial cds
          Length = 2554

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 652  gccaccacgttgcagatctgccggccgaggtacacctcggacat 695
            |||||||||||||| |||||||| || | ||||||||| |||||
Sbjct: 2369 gccaccacgttgcatatctgccgccctaagtacacctccgacat 2326



to top

>gb|AF492567.1| Dubautia raillardioides clone DrBcopy GIA/RGA-like gibberellin
            response modulator (GAI-B) gene, partial cds
          Length = 2504

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 652  gccaccacgttgcagatctgccggccgaggtacacctcggacat 695
            |||||||||||||| |||||||| || | ||||||||| |||||
Sbjct: 2319 gccaccacgttgcatatctgccgccctaagtacacctcagacat 2276



to top

>gb|AF492566.1| Dubautia menziesii clone DmeBcopy GIA/RGA-like gibberellin response
            modulator (GAI-B) gene, partial cds
          Length = 2439

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 652  gccaccacgttgcagatctgccggccgaggtacacctcggacat 695
            |||||||||||||| |||||||| || | ||||||||| |||||
Sbjct: 2254 gccaccacgttgcatatctgccgccctaagtacacctccgacat 2211



to top

>gb|AF492565.1| Dubautia ciliolata subsp. glutinosa clone DcK20B GIA/RGA-like
            gibberellin response modulator (GAI-B) gene, partial cds
          Length = 2476

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 652  gccaccacgttgcagatctgccggccgaggtacacctcggacat 695
            |||||||||||||| |||||||| || | ||||||||| |||||
Sbjct: 2291 gccaccacgttgcatatctgccgccctaagtacacctccgacat 2248



to top

>gb|AF492564.1| Dubautia ciliolata subsp. glutinosa clone DcK05B GIA/RGA-like
            gibberellin response modulator (GAI-B) gene, partial cds
          Length = 2441

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 652  gccaccacgttgcagatctgccggccgaggtacacctcggacat 695
            |||||||||||||| |||||||| || | ||||||||| |||||
Sbjct: 2256 gccaccacgttgcatatctgccgccctaagtacacctccgacat 2213



to top

>gb|AF492563.1| Dubautia arborea clone DaBcopy2 GIA/RGA-like gibberellin response
            modulator (GAI-B) gene, partial cds
          Length = 2514

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 652  gccaccacgttgcagatctgccggccgaggtacacctcggacat 695
            |||||||||||||| |||||||| || | ||||||||| |||||
Sbjct: 2329 gccaccacgttgcatatctgccgccctaagtacacctccgacat 2286



to top

>gb|AF492562.1| Dubautia arborea clone DaBcopy1 GIA/RGA-like gibberellin response
            modulator (GAI-B) gene, partial cds
          Length = 2514

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 652  gccaccacgttgcagatctgccggccgaggtacacctcggacat 695
            |||||||||||||| |||||||| || | ||||||||| |||||
Sbjct: 2329 gccaccacgttgcatatctgccgccctaagtacacctccgacat 2286



to top

>emb|BX119973.7| Zebrafish DNA sequence from clone RP71-77D7 in linkage group 13, complete
              sequence
          Length = 182073

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 67     taaacataataataatagtaatag 90
              ||||||||||||||||||||||||
Sbjct: 162132 taaacataataataatagtaatag 162109



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                          
Query: 618     ctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacg 660
               |||||||||||| || |||||||  |||||||| |||||||||
Sbjct: 1852856 ctcgtgccgctccgtccgctccgccccctcgcacgccaccacg 1852898



to top

>emb|BX649441.5| Zebrafish DNA sequence from clone DKEYP-3B1 in linkage group 20,
             complete sequence
          Length = 114252

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 64    atttaaacataataataatagtaatag 90
             |||||||||||||||||||| ||||||
Sbjct: 89318 atttaaacataataataataataatag 89344



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 65    tttaaacataataataatagtaata 89
             ||||||||||||||||||| |||||
Sbjct: 89968 tttaaacataataataataataata 89992



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 65    tttaaacataataataatagtaata 89
             ||||||||||||||||||| |||||
Sbjct: 89673 tttaaacataataataataataata 89697



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 65    tttaaacataataataatagtaata 89
             ||||||||||||||||||| |||||
Sbjct: 89188 tttaaacataataataataataata 89212



 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 65    tttaaacataataataatagtaat 88
             ||||||||||||||||||| ||||
Sbjct: 89769 tttaaacataataataataataat 89792



to top

>emb|CT573111.9| Zebrafish DNA sequence from clone CH211-233A24 in linkage group 13,
             complete sequence
          Length = 77487

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 68    aaacataataataatagtaatag 90
             |||||||||||||||||||||||
Sbjct: 41523 aaacataataataatagtaatag 41545



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                          
Query: 618     ctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacg 660
               |||||||||||| || |||||||  |||||||| |||||||||
Sbjct: 1852834 ctcgtgccgctccgtccgctccgccccctcgcacgccaccacg 1852876



to top

>emb|AL935154.2|CNS08CCP Oryza sativa chromosome 12, . BAC OSJNBb0109O08 of library OSJNBb from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 128619

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                        
Query: 618   ctcgtgccgctctgtgcgctccgtgccctcgcaggccaccacg 660
             |||||||||||| || |||||||  |||||||| |||||||||
Sbjct: 47574 ctcgtgccgctccgtccgctccgccccctcgcacgccaccacg 47616



to top

>emb|AL928830.10| Zebrafish DNA sequence from clone CH211-119E16, complete sequence
          Length = 182614

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 68     aaacataataataatagtaatag 90
              |||||||||||||||||||||||
Sbjct: 136170 aaacataataataatagtaatag 136148



to top

>gb|AC168149.7| Medicago truncatula clone mth2-84g4, complete sequence
          Length = 122726

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 64     atttaaacataataataatagtaata 89
              |||||||||||||||||||| |||||
Sbjct: 117230 atttaaacataataataataataata 117255



to top

>gb|AC115721.11| Mus musculus chromosome 3, clone RP23-9P8, complete sequence
          Length = 218746

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 72     ataataataatagtaatagggcttaa 97
              |||||||||||||||||| |||||||
Sbjct: 122917 ataataataatagtaatatggcttaa 122892



to top

>gb|AC160549.5| Mus musculus chromosome 3, clone RP23-276K18, complete sequence
          Length = 157222

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 72    ataataataatagtaatagggcttaa 97
             |||||||||||||||||| |||||||
Sbjct: 19267 ataataataatagtaatatggcttaa 19242



to top

>emb|CR854896.11| Zebrafish DNA sequence from clone DKEY-239B8 in linkage group 13,
             complete sequence
          Length = 165556

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 64    atttaaacataataataatagt 85
             ||||||||||||||||||||||
Sbjct: 34913 atttaaacataataataatagt 34892



to top

>emb|BX276112.19| Zebrafish DNA sequence from clone CH211-220I12 in linkage group 24,
             complete sequence
          Length = 146065

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 64    atttaaacataataataatagtaata 89
             |||| |||||||||||||||||||||
Sbjct: 25133 attttaacataataataatagtaata 25158



to top

>emb|Z97985.16|HS341D10 Human DNA sequence from clone RP3-341D10 on chromosome X Contains a
             chondroitin beta 1,4 N-acetylgalactosaminyltransferase
             (ChGn) pseudogene, a novel gene similar to
             ADP-ribosylation factor-like 2 (ARL2), variant 1, a novel
             gene, the 3' end of a novel gene (FLJ12687) and a CpG
             island, complete sequence
          Length = 82517

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 62    acatttaaacataataataata 83
             ||||||||||||||||||||||
Sbjct: 43259 acatttaaacataataataata 43280



to top

>emb|AL845512.9| Zebrafish DNA sequence from clone CH211-286M4 in linkage group 4
             Contains the gene for a novel protein similar to mouse and
             human F-box protein 7  (FBXO7), the gene for a novel
             protein similar to human exportin tRNA (nuclear export
             receptor for tRNAs) (XPOT), the gene for a novel protein
             similar to parathyroid hormone-like hormone (PTHLH), the
             3' end of a novel gene, a novel gene and two CpG islands,
             complete sequence
          Length = 192940

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 64    atttaaacataataataatagtaata 89
             |||||||||||||||||||| |||||
Sbjct: 59091 atttaaacataataataataataata 59066



to top

>emb|AL929301.6| Zebrafish DNA sequence from clone BUSM1-SL7 Contains two genes for
            novel serine proteases, a novel serine protease
            pseudogene, three genes similar to vertebrate PIM1 (pim-1
            oncogene), a putative novel gene and a CpG island,
            complete sequence
          Length = 64032

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 64   atttaaacataataataatagt 85
            ||||||||||||||||||||||
Sbjct: 2466 atttaaacataataataatagt 2487



to top

>emb|AL590146.2| Zebrafish DNA sequence from clone RP71-20I5 in linkage group 9
            Contains a gene for a novel protein similar to human
            FLJ20730 protein,  a gene for a novel protein similar to
            rat steroid sensitive gene-1 protein (SSG-1), a gene for
            a novel protein similar to vertebrate coagulation factor
            V and VIII, a gene for a novel protein similar to human
            G-protein coupled receptor RE2, a gene for a novel
            transcript and a CpG island, complete sequence
          Length = 121086

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 68   aaacataataataatagtaata 89
            ||||||||||||||||||||||
Sbjct: 7813 aaacataataataatagtaata 7834



to top

>emb|BX901922.9| Zebrafish DNA sequence from clone DKEY-33C12 in linkage group 13,
              complete sequence
          Length = 242350

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 64     atttaaacataataataatagt 85
              ||||||||||||||||||||||
Sbjct: 222616 atttaaacataataataatagt 222637



 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 64     atttaaacataataataatagt 85
              ||||||||||||||||||||||
Sbjct: 169288 atttaaacataataataatagt 169309



 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 64     atttaaacataataataata 83
              ||||||||||||||||||||
Sbjct: 198172 atttaaacataataataata 198191



 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 64    atttaaacataataataata 83
             ||||||||||||||||||||
Sbjct: 98121 atttaaacataataataata 98140



to top

>emb|BX088597.18| Zebrafish DNA sequence from clone DKEY-171P23 in linkage group 5,
             complete sequence
          Length = 172098

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 67    taaacataataataatagtaat 88
             ||||||||||||||||||||||
Sbjct: 68684 taaacataataataatagtaat 68663



to top

>emb|BX927402.13| Zebrafish DNA sequence from clone CH211-262G12 in linkage group 10,
              complete sequence
          Length = 155963

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 68     aaacataataataatagtaata 89
              ||||||||||||||||||||||
Sbjct: 106019 aaacataataataatagtaata 106040



to top

>emb|BX004803.11| Zebrafish DNA sequence from clone CH211-119C20 in linkage group 20
             Contains a novel gene simialr to human and mouse CASKIN2
             (CASK interacting protein 2), a novel gene for a
             nucleoside-diphosphate kinase (wu:fk59e05) and a CpG
             island, complete sequence
          Length = 167376

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 69    aacataataataatagtaatag 90
             ||||||||||||||||||||||
Sbjct: 88238 aacataataataatagtaatag 88217



to top

>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 657     cacgttgcagatctgccggccg 678
               ||||||||||||||||||||||
Sbjct: 4545983 cacgttgcagatctgccggccg 4545962



to top

>emb|CR545467.4| Zebrafish DNA sequence from clone CH211-196P10 in linkage group 16,
             complete sequence
          Length = 161708

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 60    agacatttaaacataataataatagtaata 89
             ||||||||| |||||||||||||| |||||
Sbjct: 48021 agacatttacacataataataataataata 47992



to top

>emb|CR318607.7| Zebrafish DNA sequence from clone CH211-237H22 in linkage group 14,
             complete sequence
          Length = 111412

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 64    atttaaacataataataatagtaata 89
             |||||||||||||||||||| |||||
Sbjct: 55962 atttaaacataataataataataata 55937



to top

>emb|BX005378.13| Zebrafish DNA sequence from clone DKEY-40H20 in linkage group 5,
             complete sequence
          Length = 168015

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 64    atttaaacataataataatagtaata 89
             |||| |||||||||||||||||||||
Sbjct: 73834 attttaacataataataatagtaata 73809



to top

>gb|AC149127.6| Medicago truncatula clone mth2-108o17, complete sequence
          Length = 92727

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 64    atttaaacataataataatagtaata 89
             |||||||||||||||||||| |||||
Sbjct: 41221 atttaaacataataataataataata 41196



to top

>gb|AC104442.2| Homo sapiens chromosome 3 clone RP11-905F6, complete sequence
          Length = 219227

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 72    ataataataatagtaatagggc 93
             ||||||||||||||||||||||
Sbjct: 80304 ataataataatagtaatagggc 80325



to top

>emb|BX548044.10| Zebrafish DNA sequence from clone DKEY-10B15 in linkage group 10,
             complete sequence
          Length = 250011

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 64    atttaaacataataataatagt 85
             ||||||||||||||||||||||
Sbjct: 77302 atttaaacataataataatagt 77281



to top

>gb|AC163694.2| Mus musculus BAC clone RP24-80O2 from chromosome 16, complete sequence
          Length = 244730

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 69     aacataataataatagtaatag 90
              ||||||||||||||||||||||
Sbjct: 133658 aacataataataatagtaatag 133637



to top

>emb|BX908772.11| Zebrafish DNA sequence from clone DKEY-207H9 in linkage group 18,
              complete sequence
          Length = 173801

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 64     atttaaacataataataatagtaata 89
              |||||||||||||||||||| |||||
Sbjct: 162595 atttaaacataataataataataata 162620



to top

>emb|BX784038.11| Zebrafish DNA sequence from clone CH211-217K23 in linkage group 10,
             complete sequence
          Length = 195221

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 64    atttaaacataataataatagt 85
             ||||||||||||||||||||||
Sbjct: 96348 atttaaacataataataatagt 96327



to top

>emb|BX571973.15| Zebrafish DNA sequence from clone DKEY-254A11 in linkage group 22,
             complete sequence
          Length = 214325

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 68    aaacataataataatagtaata 89
             ||||||||||||||||||||||
Sbjct: 45872 aaacataataataatagtaata 45851



to top

>emb|BX294189.11| Zebrafish DNA sequence from clone CH211-218D20 in linkage group 9,
             complete sequence
          Length = 194025

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 62    acatttaaacataataataata 83
             ||||||||||||||||||||||
Sbjct: 80832 acatttaaacataataataata 80853



to top

>tpg|BK001652.1| TPA: TPA_exp: Homo sapiens growth and differentiation factor 11
           (GDF11) gene, promoter region
          Length = 381

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 328 cggggcgggcgggcggccgggg 349
           ||||||||||||||||||||||
Sbjct: 217 cggggcgggcgggcggccgggg 196



to top

>gb|AC073487.34| Homo sapiens 12 BAC RP11-762I7 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 54666

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 328  cggggcgggcgggcggccgggg 349
            ||||||||||||||||||||||
Sbjct: 7963 cggggcgggcgggcggccgggg 7942



to top

>gb|AC026333.28| Homo sapiens 12 BAC RP11-324E6 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 204793

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 72     ataataataatagtaatagggc 93
              ||||||||||||||||||||||
Sbjct: 203327 ataataataatagtaatagggc 203306



to top

>gb|AC026331.22| Homo sapiens 12 BAC RP11-507N20 (Roswell Park Cancer Institute
           Human BAC Library) complete sequence
          Length = 5531

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 72  ataataataatagtaatagggc 93
           ||||||||||||||||||||||
Sbjct: 543 ataataataatagtaatagggc 522



to top

>emb|BX470223.14| Zebrafish DNA sequence from clone DKEY-45P9 in linkage group 10, complete
              sequence
          Length = 247644

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 64     atttaaacataataataatagt 85
              ||||||||||||||||||||||
Sbjct: 210193 atttaaacataataataatagt 210214



 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 64     atttaaacataataataatagt 85
              ||||||||||||||||||||||
Sbjct: 172585 atttaaacataataataatagt 172606



to top

>gb|AC008786.6|AC008786 Homo sapiens chromosome 5 clone CTD-2037L6, complete sequence
          Length = 177472

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 64    atttaaacataataataatagtaata 89
             ||||||| ||||||||||||||||||
Sbjct: 44956 atttaaaaataataataatagtaata 44931



to top

>emb|BX004769.9| Zebrafish DNA sequence from clone DKEY-15I8 in linkage group 9,
             complete sequence
          Length = 154745

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 64    atttaaacataataataatagtaata 89
             |||||||||||||||||||| |||||
Sbjct: 79726 atttaaacataataataataataata 79701



to top

>emb|BX005434.6| Zebrafish DNA sequence from clone DKEY-106M21, complete sequence
          Length = 158952

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 64     atttaaacataataataatagtaata 89
              |||||||||||||||||||| |||||
Sbjct: 105933 atttaaacataataataataataata 105958



to top

>emb|BX470170.5| Zebrafish DNA sequence from clone CH211-122C9 in linkage group 18,
             complete sequence
          Length = 108112

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 64    atttaaacataataataatagtaata 89
             |||||||||||||||||||| |||||
Sbjct: 58355 atttaaacataataataataataata 58330



to top

>emb|BX510654.19| Zebrafish DNA sequence from clone DKEY-271N12 in linkage group 10,
             complete sequence
          Length = 160557

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 64    atttaaacataataataatagt 85
             ||||||||||||||||||||||
Sbjct: 24598 atttaaacataataataatagt 24619



to top

>gb|AC122380.4| Mus musculus BAC clone RP23-476C23 from 10, complete sequence
          Length = 210627

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 328   cggggcgggcgggcggccgggg 349
             ||||||||||||||||||||||
Sbjct: 49476 cggggcgggcgggcggccgggg 49497



to top

>gb|AC135418.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0035J16, complete sequence
          Length = 170233

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 702   gtccgtgccggcggcggcggc 722
             |||||||||||||||||||||
Sbjct: 91166 gtccgtgccggcggcggcggc 91146



to top

>gb|AY808430.1| Schistosoma japonicum SJCHGC06490 protein mRNA, partial cds
          Length = 1390

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 72  ataataataatagtaatagggcttaataa 100
           |||||||||||||||||| |||| |||||
Sbjct: 991 ataataataatagtaatatggctaaataa 963



to top

>emb|CR956627.17| Mouse DNA sequence from clone RP24-402N1 on chromosome X, complete
             sequence
          Length = 155119

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    acataataataatagtaatag 90
             |||||||||||||||||||||
Sbjct: 32188 acataataataatagtaatag 32168



to top

>emb|CR762428.7| Zebrafish DNA sequence from clone CH211-172N16 in linkage group 1,
             complete sequence
          Length = 140219

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 71    cataataataatagtaatagg 91
             |||||||||||||||||||||
Sbjct: 54646 cataataataatagtaatagg 54626



to top

>emb|CR974459.7| Mouse DNA sequence from clone RP23-179P23 on chromosome X, complete
              sequence
          Length = 226435

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     acataataataatagtaatag 90
              |||||||||||||||||||||
Sbjct: 137759 acataataataatagtaatag 137739



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    acataataataatagtaatag 90
             |||||||||||||||||||||
Sbjct: 17568 acataataataatagtaatag 17548



to top

>emb|Z81128.2|CET23D8 Caenorhabditis elegans Cosmid T23D8, complete sequence
          Length = 34576

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 65    tttaaacataataataatagtaata 89
             ||||||||||||||||||| |||||
Sbjct: 33979 tttaaacataataataataataata 33955



to top

>emb|CR847854.12| Zebrafish DNA sequence from clone DKEY-229J6 in linkage group 8,
            complete sequence
          Length = 155365

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 65   tttaaacataataataatagtaata 89
            ||||||||||||||||||| |||||
Sbjct: 3356 tttaaacataataataataataata 3380



to top

>emb|BX927062.11| Zebrafish DNA sequence from clone CH211-227N20 in linkage group 13,
              complete sequence
          Length = 154186

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 63     catttaaacataataataatagtaa 87
              |||||||| ||||||||||||||||
Sbjct: 141636 catttaaatataataataatagtaa 141612



to top

>emb|BX927365.7| Zebrafish DNA sequence from clone DKEY-161P7 in linkage group 23,
              complete sequence
          Length = 229608

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     acataataataatagtaatag 90
              |||||||||||||||||||||
Sbjct: 111374 acataataataatagtaatag 111354



to top

>gb|CP000316.1| Polaromonas sp. JS666, complete genome
          Length = 5200264

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 674    ggccgaggtacacctcggaca 694
              |||||||||||||||||||||
Sbjct: 608789 ggccgaggtacacctcggaca 608809



to top

>emb|CR847931.7| Zebrafish DNA sequence from clone DKEY-182I3 in linkage group 15,
             complete sequence
          Length = 134584

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 65    tttaaacataataataatagtaata 89
             ||||||||||||||||||| |||||
Sbjct: 60686 tttaaacataataataataataata 60662



 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 66    ttaaacataataataatagtaata 89
             |||||||||||||||||| |||||
Sbjct: 60658 ttaaacataataataataataata 60635



to top

>emb|BX004968.20| Zebrafish DNA sequence from clone DKEY-35I13 in linkage group 15,
              complete sequence
          Length = 208706

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 65     tttaaacataataataatagtaata 89
              ||||||||||||||||||| |||||
Sbjct: 205653 tttaaacataataataataataata 205677



to top

>emb|CR762493.11| Zebrafish DNA sequence from clone DKEY-228B19 in linkage group 13,
             complete sequence
          Length = 168643

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 64    atttaaacataataataatagtaat 88
             |||||||||||||||||||| ||||
Sbjct: 18816 atttaaacataataataataataat 18840



to top

>emb|CR628363.12| Mouse DNA sequence from clone RP23-329B21 on chromosome X, complete
              sequence
          Length = 196122

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     acataataataatagtaatag 90
              |||||||||||||||||||||
Sbjct: 140622 acataataataatagtaatag 140602



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    acataataataatagtaatag 90
             |||||||||||||||||||||
Sbjct: 22834 acataataataatagtaatag 22814



to top

>emb|BX005206.15| Mouse DNA sequence from clone RP23-384P3 on chromosome X, complete
              sequence
          Length = 202812

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     acataataataatagtaatag 90
              |||||||||||||||||||||
Sbjct: 187692 acataataataatagtaatag 187672



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    acataataataatagtaatag 90
             |||||||||||||||||||||
Sbjct: 67495 acataataataatagtaatag 67475



to top

>emb|CR556702.10| Mouse DNA sequence from clone RP24-370F24 on chromosome X, complete
             sequence
          Length = 148966

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    acataataataatagtaatag 90
             |||||||||||||||||||||
Sbjct: 73039 acataataataatagtaatag 73019



to top

>emb|BX571788.8| Mouse DNA sequence from clone RP23-30M5 on chromosome X, complete
              sequence
          Length = 233695

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     acataataataatagtaatag 90
              |||||||||||||||||||||
Sbjct: 118589 acataataataatagtaatag 118569



to top

>emb|BX323574.12| Zebrafish DNA sequence from clone DKEY-180F8, complete sequence
          Length = 171724

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 65     tttaaacataataataatagtaata 89
              |||||| ||||||||||||||||||
Sbjct: 135745 tttaaaaataataataatagtaata 135769



to top

>emb|BX322584.16| Zebrafish DNA sequence from clone RP71-27M6 in linkage group 14,
             complete sequence
          Length = 144727

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 65    tttaaacataataataatagtaata 89
             ||||||||||||||||||| |||||
Sbjct: 38205 tttaaacataataataataataata 38181



to top

>emb|AL805943.6| Mouse DNA sequence from clone RP23-86O13 on chromosome 4 Contains a
             opsin 1 (cone pigments) (Opn1) pseudogene, complete
             sequence
          Length = 192561

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 65    tttaaacataataataatagtaata 89
             |||||| ||||||||||||||||||
Sbjct: 86845 tttaaatataataataatagtaata 86821



to top

>emb|BX571721.8| Zebrafish DNA sequence from clone DKEY-250L23 in linkage group 8,
              complete sequence
          Length = 168402

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 65     tttaaacataataataatagtaata 89
              ||||||||||||||||||| |||||
Sbjct: 129751 tttaaacataataataataataata 129727



to top

>emb|BX510645.7| Zebrafish DNA sequence from clone DKEY-5G21 in linkage group 14, complete
              sequence
          Length = 218603

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                               
Query: 57     aatagacatttaaacataataataatagtaata 89
              ||||||||| || |||||||||||||| |||||
Sbjct: 118075 aatagacatatacacataataataataataata 118043



to top

>emb|BX546473.10| Zebrafish DNA sequence from clone DKEYP-51F2 in linkage group 3, complete
              sequence
          Length = 211253

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                               
Query: 68     aaacataataataatagtaatagggcttaataa 100
              |||||||||||||||| |||||| | |||||||
Sbjct: 120229 aaacataataataatattaatagtgattaataa 120197



to top

>gb|AC013558.10| Homo sapiens chromosome 18, clone RP11-41O4, complete sequence
          Length = 133557

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 65    tttaaacataataataatagtaata 89
             |||||| ||||||||||||||||||
Sbjct: 71226 tttaaaaataataataatagtaata 71202



to top

>gb|AC182036.2| Mus musculus BAC clone RP24-120L13 from chromosome y, complete sequence
          Length = 185554

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    acataataataatagtaatag 90
             |||||||||||||||||||||
Sbjct: 79424 acataataataatagtaatag 79444



to top

>emb|BX323831.7| Zebrafish DNA sequence from clone CH211-12E7 in linkage group 23,
             complete sequence
          Length = 180638

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    acataataataatagtaatag 90
             |||||||||||||||||||||
Sbjct: 87273 acataataataatagtaatag 87293



to top

>emb|BX548049.9| Zebrafish DNA sequence from clone DKEY-217J16 in linkage group 25,
             complete sequence
          Length = 175348

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 64    atttaaacataataataatagtaat 88
             |||||||||||||||||||| ||||
Sbjct: 24216 atttaaacataataataataataat 24192



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 702      gtccgtgccggcggcggcggc 722
                |||||||||||||||||||||
Sbjct: 19387817 gtccgtgccggcggcggcggc 19387797



to top

>emb|BX842674.4| Mouse DNA sequence from clone RP24-212K8 on chromosome X, complete
             sequence
          Length = 50448

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    acataataataatagtaatag 90
             |||||||||||||||||||||
Sbjct: 35662 acataataataatagtaatag 35642



to top

>emb|BX005383.8| Zebrafish DNA sequence from clone DKEYP-19E1 in linkage group 25,
             complete sequence
          Length = 142728

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 64    atttaaacataataataatagtaat 88
             |||||||||||||||||||| ||||
Sbjct: 39399 atttaaacataataataataataat 39423



to top

>emb|BX571982.6| Zebrafish DNA sequence from clone CH211-204K19 in linkage group 6,
              complete sequence
          Length = 162020

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 69     aacataataataatagtaata 89
              |||||||||||||||||||||
Sbjct: 158417 aacataataataatagtaata 158397



to top

>emb|BX005175.8| Zebrafish DNA sequence from clone DKEY-14H17 in linkage group 11,
              complete sequence
          Length = 234851

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 69     aacataataataatagtaata 89
              |||||||||||||||||||||
Sbjct: 210421 aacataataataatagtaata 210401



to top

>emb|BX005478.7| Zebrafish DNA sequence from clone CH211-77G9, complete sequence
          Length = 152152

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                               
Query: 57     aatagacatttaaacataataataatagtaata 89
              |||| ||||| |||||||||||||||| |||||
Sbjct: 133494 aataaacattaaaacataataataataataata 133526



to top

>emb|BX005018.8| Zebrafish DNA sequence from clone DKEY-209K18, complete sequence
          Length = 183614

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 65     tttaaacataataataatagtaata 89
              ||||||||||||||||||| |||||
Sbjct: 109097 tttaaacataataataataataata 109073



to top

>emb|BX005015.5| Zebrafish DNA sequence from clone CH211-66I11 in linkage group 9,
             complete sequence
          Length = 172283

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                              
Query: 57    aatagacatttaaacataataataatagtaata 89
             |||| ||||| |||||||||||||||| |||||
Sbjct: 31106 aataaacattaaaacataataataataataata 31074



to top

>dbj|AK108961.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-153-D03, full
           insert sequence
          Length = 1196

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 701 ggtccgtgccggcggcggcgg 721
           |||||||||||||||||||||
Sbjct: 659 ggtccgtgccggcggcggcgg 679



to top

>emb|BX936328.7| Zebrafish DNA sequence from clone CH211-11F20 in linkage group 18,
             complete sequence
          Length = 113038

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 69    aacataataataatagtaata 89
             |||||||||||||||||||||
Sbjct: 65831 aacataataataatagtaata 65811



to top

>emb|AL732411.14| Zebrafish DNA sequence from clone XX-51I9 in linkage group 9, complete
             sequence
          Length = 64799

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 65    tttaaacataataataatagtaata 89
             |||||| ||||||||||||||||||
Sbjct: 38059 tttaaaaataataataatagtaata 38083



to top

>emb|BX276085.8| Zebrafish DNA sequence from clone CH211-194B5 in linkage group 19,
              complete sequence
          Length = 202683

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                               
Query: 57     aatagacatttaaacataataataatagtaata 89
              |||||| ||| |||||||||||||||| |||||
Sbjct: 151903 aatagaaattaaaacataataataataataata 151871



to top

>emb|BX294670.6| Zebrafish DNA sequence from clone CH211-154O6 in linkage group 16,
              complete sequence
          Length = 199070

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 64     atttaaacataataataatagtaat 88
              |||||||| ||||||||||||||||
Sbjct: 188256 atttaaacgtaataataatagtaat 188280



to top

>emb|BX296562.4| Zebrafish DNA sequence from clone CH211-260G14 in linkage group 20,
             complete sequence
          Length = 129328

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 57    aatagacatttaaacataataataatagtaata 89
             ||||||||| || |||||||||||||| |||||
Sbjct: 77580 aatagacatatacacataataataataataata 77612



to top

>gb|AY110882.1| Zea mays CL25429_1 mRNA sequence
          Length = 1072

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 72  ataataataatagtaatagggctta 96
           |||| ||||||||||||||||||||
Sbjct: 102 ataacaataatagtaatagggctta 126



to top

>emb|AL929056.21| Zebrafish DNA sequence from clone CH211-227I14 in linkage group 8,
             complete sequence
          Length = 157468

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 65    tttaaacataataataatagtaata 89
             ||||||||||||||||||| |||||
Sbjct: 50513 tttaaacataataataataataata 50537



to top

>emb|BX088535.6| Zebrafish DNA sequence from clone DKEY-18F5 in linkage group 14, complete
              sequence
          Length = 197465

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 65     tttaaacataataataatagtaata 89
              ||||||||||||||||||| |||||
Sbjct: 147199 tttaaacataataataataataata 147175



to top

>emb|CR974488.16| Mouse DNA sequence from clone RP23-124J3 on chromosome X, complete
             sequence
          Length = 86599

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    acataataataatagtaatag 90
             |||||||||||||||||||||
Sbjct: 17710 acataataataatagtaatag 17690



to top

>emb|CR974480.18| Mouse DNA sequence from clone RP23-239B4 on chromosome X, complete
             sequence
          Length = 103306

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    acataataataatagtaatag 90
             |||||||||||||||||||||
Sbjct: 19704 acataataataatagtaatag 19684



to top

>emb|CR626891.17| Zebrafish DNA sequence from clone DKEY-33P20 in linkage group 14,
              complete sequence
          Length = 187607

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 65     tttaaacataataataatagtaata 89
              ||||||||||||||||||| |||||
Sbjct: 102988 tttaaacataataataataataata 102964



to top

>emb|CR396594.10| Zebrafish DNA sequence from clone CH211-158B12 in linkage group 3,
             complete sequence
          Length = 48245

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 65    tttaaacataataataatagtaata 89
             ||||||||||||||||||| |||||
Sbjct: 24345 tttaaacataataataataataata 24369



to top

>gb|AC170862.1| Mus musculus chromosome 19, clone wi1-593J16, complete sequence
          Length = 40693

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 70    acataataataatagtaata 89
             ||||||||||||||||||||
Sbjct: 18551 acataataataatagtaata 18532



to top

>ref|XM_631988.1| Dictyostelium discoideum hypothetical protein (DDB0187660), partial
            mRNA
          Length = 2565

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 70   acataataataatagtaata 89
            ||||||||||||||||||||
Sbjct: 1506 acataataataatagtaata 1525



to top

>gb|AC151762.1| Ornithorhynchus anatinus chromosome UNK clone OABb-451A1, complete
             sequence
          Length = 160077

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 72    ataataataatagtaatagg 91
             ||||||||||||||||||||
Sbjct: 32979 ataataataatagtaatagg 32960



to top

>ref|XM_642357.1| Dictyostelium discoideum fused-like protein kinase (DDB0229382),
            partial mRNA
          Length = 6744

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 67   taaacataataataatagtaatag 90
            |||| |||||||||||||||||||
Sbjct: 4638 taaaaataataataatagtaatag 4661



to top

>ref|XM_641566.1| Dictyostelium discoideum hypothetical protein (DDB0190921), partial
           mRNA
          Length = 627

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 67  taaacataataataatagtaatag 90
           |||| |||||||||||||||||||
Sbjct: 363 taaaaataataataatagtaatag 386



to top

>ref|XM_641276.1| Dictyostelium discoideum SAM domain-containing protein
           (DDB0231307), partial mRNA
          Length = 1923

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 67  taaacataataataatagtaatag 90
           |||| |||||||||||||||||||
Sbjct: 387 taaaaataataataatagtaatag 410



to top

>ref|XM_637837.1| Dictyostelium discoideum hypothetical protein (DDB0217895), partial
           mRNA
          Length = 4389

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 67  taaacataataataatagtaatag 90
           |||| |||||||||||||||||||
Sbjct: 756 taaaaataataataatagtaatag 779



to top

>gb|CP000150.1| Burkholderia sp. 383 chromosome 3, complete sequence
          Length = 1395069

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 704     ccgtgccggcggcggcggca 723
               ||||||||||||||||||||
Sbjct: 1149404 ccgtgccggcggcggcggca 1149423



to top

>ref|XM_637175.1| Dictyostelium discoideum hypothetical protein (DDB0205351), partial
            mRNA
          Length = 4230

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 63   catttaaacataataataatagta 86
            |||||||| |||||||||||||||
Sbjct: 992  catttaaatataataataatagta 1015



to top

>ref|XM_636392.1| Dictyostelium discoideum hypothetical protein (DDB0218202), partial
           mRNA
          Length = 876

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 67  taaacataataataatagtaatag 90
           |||| |||||||||||||||||||
Sbjct: 762 taaaaataataataatagtaatag 785



to top

>ref|XM_635811.1| Dictyostelium discoideum hypothetical protein (DDB0204099), partial
            mRNA
          Length = 3117

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 70   acataataataatagtaata 89
            ||||||||||||||||||||
Sbjct: 2103 acataataataatagtaata 2122



to top

>gb|AC159421.1| Trypanosoma brucei chromosome 7 clone RPCI93-26A24, complete sequence
          Length = 158050

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 67     taaacataataataatagtaatag 90
              |||| |||||||||||||||||||
Sbjct: 118723 taaaaataataataatagtaatag 118700



to top

>ref|NM_021494.1| Mus musculus Rab6 interacting protein 1 (Rab6ip1), mRNA
          Length = 4972

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 330 gggcgggcgggcggccgggg 349
           ||||||||||||||||||||
Sbjct: 176 gggcgggcgggcggccgggg 195



to top

>gb|CP000070.1| Trypanosoma brucei chromosome 7, complete sequence
          Length = 2205233

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 67      taaacataataataatagtaatag 90
               |||| |||||||||||||||||||
Sbjct: 1191400 taaaaataataataatagtaatag 1191423



to top

>gb|AC159452.1| Trypanosoma brucei chromosome 5 clone RPCI93-5K5, complete sequence
          Length = 158740

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 72     ataataataatagtaatagg 91
              ||||||||||||||||||||
Sbjct: 152499 ataataataatagtaatagg 152480



to top

>gb|AF335591.1| Homo sapiens WNT4 (WNT4) gene, partial cds
          Length = 6876

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 330  gggcgggcgggcggccgggg 349
            ||||||||||||||||||||
Sbjct: 5377 gggcgggcgggcggccgggg 5358



to top

>gb|AC159249.3| Mus musculus BAC clone RP24-177C7 from chromosome y, complete sequence
          Length = 146406

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 70    acataataataatagtaata 89
             ||||||||||||||||||||
Sbjct: 83117 acataataataatagtaata 83136



to top

>gb|AY269087.1| Lycopersicon esculentum GAI-like protein mRNA, complete cds
          Length = 2145

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 487  tcttccaccttgtacccgtcgccgccggcgaa 518
            ||||||||| |||| || ||||||||||||||
Sbjct: 1705 tcttccaccctgtaaccatcgccgccggcgaa 1674



to top

>gb|AC114613.12| Mus musculus chromosome 5, clone RP24-80F7, complete sequence
          Length = 190200

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 62     acatttaaacataataataa 81
              ||||||||||||||||||||
Sbjct: 136656 acatttaaacataataataa 136675



to top

>ref|XM_423199.1| PREDICTED: Gallus gallus similar to phosphatidylinositol glycan,
           class B (LOC425437), partial mRNA
          Length = 1710

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 91  ggcttaataaggagttttac 110
           ||||||||||||||||||||
Sbjct: 409 ggcttaataaggagttttac 428



to top

>ref|XM_425161.1| PREDICTED: Gallus gallus similar to Krueppel-like factor 15
            (LOC427588), mRNA
          Length = 2088

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 623  gccgctctgtgcgctccgtg 642
            ||||||||||||||||||||
Sbjct: 2063 gccgctctgtgcgctccgtg 2082



to top

>gb|BC060230.1| Mus musculus Rab6 interacting protein 1, mRNA (cDNA clone MGC:77991
           IMAGE:6840562), complete cds
          Length = 4972

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 330 gggcgggcgggcggccgggg 349
           ||||||||||||||||||||
Sbjct: 176 gggcgggcgggcggccgggg 195



to top

>gb|AY358060.1| HIV-1 00TH.OUR724I from Thailand gag protein (gag) and pol protein
            (pol) genes, partial cds; vif protein (vif), vpr protein
            (vpr), tat protein (tat), rev protein (rev), vpu protein
            (vpu), and env protein (env) genes, complete cds; and nef
            protein (nef) gene, partial cds
          Length = 8377

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 67   taaacataataataatagtaatag 90
            |||| |||||||||||||||||||
Sbjct: 5981 taaagataataataatagtaatag 6004



to top

>gb|AY253039.1| Macrocephalus sp. WCW-2003 cytochrome oxidase subunit I gene,
           partial cds; mitochondrial
          Length = 1059

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 75  ataataatagtaatagggct 94
           ||||||||||||||||||||
Sbjct: 526 ataataatagtaatagggct 507



to top

>gb|AC137980.4| Mus musculus BAC clone RP24-69K24 from chromosome 9, complete sequence
          Length = 221263

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 68     aaacataataataatagtaa 87
              ||||||||||||||||||||
Sbjct: 185503 aaacataataataatagtaa 185522



to top

>gb|DQ481665.1| Takifugu rubripes HoxBa gene cluster, complete sequence
          Length = 294716

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 70     acataataataatagtaata 89
              ||||||||||||||||||||
Sbjct: 105937 acataataataatagtaata 105956



to top

>gb|AY812326.1| Schistosoma japonicum SJCHGC05543 protein mRNA, partial cds
          Length = 2114

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 70   acataataataatagtaata 89
            ||||||||||||||||||||
Sbjct: 2029 acataataataatagtaata 2010


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,689,933
Number of Sequences: 3902068
Number of extensions: 6689933
Number of successful extensions: 779170
Number of sequences better than 10.0: 393
Number of HSP's better than 10.0 without gapping: 392
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 766479
Number of HSP's gapped (non-prelim): 12678
length of query: 726
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 703
effective length of database: 17,143,297,704
effective search space: 12051738285912
effective search space used: 12051738285912
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top