| Clone Name | rbaal38p01 |
|---|---|
| Clone Library Name | barley_pub |
| No. | Definition | Score (bits) |
E Value |
1 | gb|AY103682.1| Zea mays PCO122909 mRNA sequence | 48 | 0.012 | 2 | gb|AC162881.2| Echinops telfairi, clone Echinops telfairi -24528... | 40 | 3.0 | 3 | gb|AC148756.2| Medicago truncatula clone mth2-22d18, complete se... | 40 | 3.0 |
|---|
>gb|AY103682.1| Zea mays PCO122909 mRNA sequence Length = 1641 Score = 48.1 bits (24), Expect = 0.012 Identities = 33/36 (91%) Strand = Plus / Minus Query: 196 acttcagtagggtcttcacgatggatttcacattca 231 ||||||| ||||||||||| ||||||||||| |||| Sbjct: 1382 acttcaggagggtcttcacaatggatttcacgttca 1347
>gb|AC162881.2| Echinops telfairi, clone Echinops telfairi -24528857A5, complete sequence Length = 39811 Score = 40.1 bits (20), Expect = 3.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 30 cacagcagaataagttgacagcaa 53 |||||||||||||| ||||||||| Sbjct: 4635 cacagcagaataagatgacagcaa 4658
>gb|AC148756.2| Medicago truncatula clone mth2-22d18, complete sequence Length = 107160 Score = 40.1 bits (20), Expect = 3.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 89 aaaccaaacgagaaaaacaa 108 |||||||||||||||||||| Sbjct: 41908 aaaccaaacgagaaaaacaa 41889 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,815,371 Number of Sequences: 3902068 Number of extensions: 1815371 Number of successful extensions: 27243 Number of sequences better than 10.0: 3 Number of HSP's better than 10.0 without gapping: 3 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 27240 Number of HSP's gapped (non-prelim): 3 length of query: 231 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 209 effective length of database: 17,147,199,772 effective search space: 3583764752348 effective search space used: 3583764752348 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)