ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal38o07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds 139 4e-30
2gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/... 131 9e-28
3emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlo... 129 4e-27
4gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll... 127 1e-26
5ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predic... 121 9e-25
6ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predic... 121 9e-25
7emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chloro... 121 9e-25
8gb|AY100470.1| Oryza sativa (indica cultivar-group) putative sol... 121 9e-25
9dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 121 9e-25
10dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic D... 121 9e-25
11dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic D... 121 9e-25
12dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 9e-25
13dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 9e-25
14emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chloro... 121 9e-25
15dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 9e-25
16dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 9e-25
17dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 9e-25
18dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 9e-25
19dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 9e-25
20gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/... 119 4e-24
21gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding p... 119 4e-24
22gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast c... 117 1e-23
23dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 113 2e-22
24dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic D... 113 2e-22
25dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic D... 113 2e-22
26dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clon... 113 2e-22
27dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clon... 113 2e-22
28dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clon... 113 2e-22
29dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clon... 113 2e-22
30dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clon... 113 2e-22
31dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clon... 113 2e-22
32gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protei... 113 2e-22
33dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRN... 113 2e-22
34gb|K00976.1|PETCAB102 Petunia major chlorophyll a/b binding prot... 111 9e-22
35gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein g... 109 3e-21
36emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chl... 105 5e-20
37emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b bin... 105 5e-20
38emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll ... 105 5e-20
39gb|AY109324.1| Zea mays CL187_1 mRNA sequence 105 5e-20
40gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b bi... 105 5e-20
41gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene... 105 5e-20
42emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding pr... 103 2e-19
43gb|M30620.1|TOMCBPE2 Tomato chlorophyll a/b-binding protein Cab-... 103 2e-19
44gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b... 101 8e-19
45emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putat... 100 3e-18
46ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2... 98 1e-17
47ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2... 98 1e-17
48ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll bindin... 98 1e-17
49ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) ... 98 1e-17
50gb|AY142513.1| Arabidopsis thaliana putative photosystem II type... 98 1e-17
51gb|AY045806.1| Arabidopsis thaliana putative photosystem II type... 98 1e-17
52gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 ma... 98 1e-17
53gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 ma... 98 1e-17
54gb|AY081587.1| Arabidopsis thaliana photosystem II type I chloro... 98 1e-17
55gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 98 1e-17
56gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 98 1e-17
57gb|AY065125.1| Arabidopsis thaliana photosystem II type I chloro... 98 1e-17
58gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 ... 98 1e-17
59gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 ... 98 1e-17
60gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 ... 98 1e-17
61gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 98 1e-17
62gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 ... 98 1e-17
63emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Co... 98 1e-17
64emb|BX819530.1|CNS0A9V8 Arabidopsis thaliana Full-length cDNA Co... 98 1e-17
65emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Co... 98 1e-17
66emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Co... 98 1e-17
67emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Co... 98 1e-17
68emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II c... 98 1e-17
69emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/... 98 1e-17
70gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein... 96 5e-17
71gb|M30622.1|TOMCBPF2 Tomato chlorophyll a/b-binding protein Cab-... 96 5e-17
72gb|BT014208.1| Lycopersicon esculentum clone 133385R, mRNA sequence 94 2e-16
73gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding p... 94 2e-16
74emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding... 92 8e-16
75gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence 90 3e-15
76emb|X52744.1|NTCAB40 Tabacco Cab40 mRNA for major chlorophyll a/... 90 3e-15
77gb|K00974.1|PETCAB4 Petunia major chlorophyll a/b binding protei... 90 3e-15
78gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b ... 90 3e-15
79emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Co... 88 1e-14
80emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein 88 1e-14
81emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll... 88 1e-14
82gb|M14443.1|TOMCBPA Tomato chlorophyll a/b-binding protein gene ... 86 5e-14
83dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 g... 86 5e-14
84dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue... 84 2e-13
85emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-h... 84 2e-13
86gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding pro... 84 2e-13
87gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genom... 82 8e-13
88gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 82 8e-13
89dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 82 8e-13
90emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Co... 82 8e-13
91emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding pr... 82 8e-13
92dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 8e-13
93dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 8e-13
94gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding prot... 82 8e-13
95gb|U21113.1|STU21113 Solanum tuberosum chlorophyll a/b binding p... 82 8e-13
96dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for ... 82 8e-13
97ref|XM_478729.1| Oryza sativa (japonica cultivar-group), mRNA 80 3e-12
98ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group... 80 3e-12
99ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group... 80 3e-12
100ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group... 80 3e-12
101ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group... 80 3e-12
102ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group... 80 3e-12
103ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group... 80 3e-12
104ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group... 80 3e-12
105gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protei... 80 3e-12
106dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 80 3e-12
107dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic D... 80 3e-12
108dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clon... 80 3e-12
109dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 3e-12
110dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 3e-12
111emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/... 80 3e-12
112dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 3e-12
113dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 3e-12
114dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 3e-12
115dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 3e-12
116dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 3e-12
117dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 3e-12
118dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 3e-12
119gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding p... 80 3e-12
120gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll... 80 3e-12
121gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein... 80 3e-12
122emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll ... 80 3e-12
123gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosyste... 80 3e-12
124emb|AJ318069.1|STU318069 Solanum tuberosum mRNA for ferredoxin-t... 78 1e-11
125gb|M14449.1|TOMCBPG Tomato chlorophyll a/b-binding protein gene ... 78 1e-11
126emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll... 76 5e-11
127emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b bind... 76 5e-11
128emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chloro... 76 5e-11
129emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting... 76 5e-11
130dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harv... 76 5e-11
131gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 74 2e-10
132gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence 74 2e-10
133emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding ... 74 2e-10
134emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b... 74 2e-10
135gb|K00975.1|PETCAB10 Petunia major chlorophyll a/b binding prote... 74 2e-10
136ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll bindin... 72 7e-10
137ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BIND... 72 7e-10
138gb|AF339687.1| Arabidopsis thaliana putative photosystem II type... 72 7e-10
139gb|AF326864.1| Arabidopsis thaliana putative photosystem II type... 72 7e-10
140gb|AY120776.1| Arabidopsis thaliana putative photosystem II type... 72 7e-10
141gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 72 7e-10
142gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 72 7e-10
143gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430... 72 7e-10
144emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Co... 72 7e-10
145gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N... 72 7e-10
146gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete s... 72 7e-10
147emb|X74731.1|AHLHCB A.hypochondriacus Lhcb1*Ah1 mRNA 72 7e-10
148emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II ... 72 7e-10
149gb|BT002103.1| Arabidopsis thaliana putative photosystem II type... 72 7e-10
150gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll... 72 7e-10
151emb|X68333.1|HHLHC H.helix mRNA for light harvesting chlorophyll... 72 7e-10
152gb|M30618.1|TOMCBPD2 Tomato chlorophyll a/b-binding protein Cab-... 72 7e-10
153gb|M30616.1|TOMCBPC2 Tomato chlorophyll a/b-binding protein Cab-... 72 7e-10
154gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene ... 72 7e-10
155emb|AJ843976.1| Plantago major partial mRNA for light harvesting... 70 3e-09
156dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light... 70 3e-09
157dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene... 70 3e-09
158emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chl... 70 3e-09
159emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chloro... 70 3e-09
160gb|AY112240.1| Zea mays CL187_6 mRNA sequence 70 3e-09
161gb|U21114.1|STU21114 Solanum tuberosum chlorophyll a/b binding p... 70 3e-09
162gb|U21112.1|STU21112 Solanum tuberosum chlorophyll a/b binding p... 70 3e-09
163gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding p... 70 3e-09
164dbj|AB012636.1| Nicotiana sylvestris Lhcb1*1 gene for light harv... 70 3e-09
165gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (L... 68 1e-08
166emb|AJ538931.1|NTA538931 Nicotiana tabacum cDNA-AFLP-fragment BT... 68 1e-08
167emb|AJ538874.1|NTA538874 Nicotiana tabacum cDNA-AFLP-fragment BT... 68 1e-08
168emb|AJ538840.1|NTA538840 Nicotiana tabacum cDNA-AFLP-fragment BT... 68 1e-08
169dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene... 68 1e-08
170emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b bindin... 68 1e-08
171gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chl... 68 1e-08
172dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harv... 68 1e-08
173ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BIND... 66 5e-08
174ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding ... 66 5e-08
175gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence 66 5e-08
176gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472)... 66 5e-08
177gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-bin... 66 5e-08
178gb|AY050935.1| Arabidopsis thaliana putative photosystem II type... 66 5e-08
179gb|AY128345.1| Arabidopsis thaliana photosystem II type I chloro... 66 5e-08
180gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 66 5e-08
181gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 66 5e-08
182gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 66 5e-08
183gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 66 5e-08
184gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 m... 66 5e-08
185gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 66 5e-08
186gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 66 5e-08
187gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 66 5e-08
188emb|BX814964.1|CNS0AE8Q Arabidopsis thaliana Full-length cDNA Co... 66 5e-08
189emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Co... 66 5e-08
190gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P... 66 5e-08
191gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete s... 66 5e-08
192emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophy... 66 5e-08
193emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophy... 66 5e-08
194emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophy... 66 5e-08
195emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/... 66 5e-08
196gb|AF133340.1|AF133340 Phalaenopsis sp. 'KCbutterfly' putative c... 66 5e-08
197gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding prot... 66 5e-08
198gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab... 66 5e-08
199gb|M95068.1|MZEORFI Zea mays putative light-harvesting chlorophy... 66 5e-08
200dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRN... 66 5e-08
201emb|Z13987.1|STCABPSII S.tuberosum gene for chlorophyll a/b-bind... 64 2e-07
202emb|Z75663.1|AGCHLABBP A.graveolens mRNA for chlorophyll a/b bin... 64 2e-07
203emb|X52743.1|NTCAB21 Tabacco Cab21 mRNA for major chlorophyll a/... 64 2e-07
204emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding pr... 64 2e-07
205gb|J01253.1|PEACAB15 Pea major chlorophyll a/b-binding thylakoid... 64 2e-07
206emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding p... 60 3e-06
207gb|AC139600.16| Medicago truncatula clone mth2-20m4, complete se... 58 1e-05
208emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Co... 58 1e-05
209emb|X63197.1|HVLHBC H.vulgare lhbC mRNA for type III LHCII CAB p... 58 1e-05
210gb|AF162200.1|AF162200 Lactuca sativa light-harvesting chlorophy... 58 1e-05
211gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding p... 58 1e-05
212gb|K00972.1|PETCAB146 Petunia major chlorophyll a/b binding prot... 58 1e-05
213dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone... 58 1e-05
214dbj|AB012639.1| Nicotiana sylvestris Lhcb1*7 gene for light harv... 58 1e-05
215gb|M15214.1|TOMCBPH Tomato chlorophyll a/b-binding protein gene ... 56 4e-05
216dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-b... 56 4e-05
217dbj|AB006081.1| Fagus crenata mRNA for chlorophyll a/b-binding p... 56 4e-05
218gb|DQ460158.1| Nicotiana tabacum cDNA-AFLP fragment H-N_BC4M24-1... 54 2e-04
219gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II ch... 54 2e-04
220gb|M64619.1|PEACAB66 Pea cab gene, complete cds 54 2e-04
221gb|K02067.1|PEACAB80 Pea (P.sativum) gene AB80 encoding major li... 54 2e-04
222gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting comple... 52 7e-04
223gb|DQ124219.1| Fagus sylvatica putative chlorophyll a/b-binding ... 52 7e-04
224gb|AF279250.1|AF279250 Vigna radiata LHCII type I chlorophyll a/... 52 7e-04
225emb|AJ538488.1|NTA538488 Nicotiana tabacum cDNA-AFLP-fragment BC... 52 7e-04
226dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvest... 52 7e-04
227gb|DQ471302.1| Carya cathayensis putative chloroplast chlorophyl... 50 0.003
228emb|X02360.1|PECAB22R Petunia gene for chlorophyll a/b binding p... 50 0.003
229gb|AY104614.1| Zea mays PCO084486 mRNA sequence 50 0.003
230dbj|AB236867.1| Panax ginseng cab mRNA for chlorophyll a/b bindi... 48 0.011
231emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Co... 48 0.011
232emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-bi... 46 0.042
233emb|X12980.1|GMCAB2 Soybean Cab2 gene for minor PSII LHCII chlor... 46 0.042
234gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding... 44 0.17
235gb|AF220527.1|AF220527 Euphorbia esula chlorophyll a/b binding p... 44 0.17
236emb|X02359.1|PECAB22L Petunia gene for chlorophyll a/b binding p... 44 0.17
237gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete ... 42 0.66
238emb|AJ234428.1|HVU234428 Hordeum vulgare partial mRNA; clone cMW... 42 0.66
239dbj|D14002.1|LAUCAB Lettuce mRNA for light-harvesting chlorophyl... 42 0.66
240gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein... 40 2.6
241emb|AL939127.1|SCO939127 Streptomyces coelicolor A3(2) complete ... 40 2.6
242gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlor... 40 2.6
243gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlor... 40 2.6
244gb|AY617093.1| Pinus remota chloroplast light harvesting chlorop... 40 2.6
245gb|AY617092.1| Pinus monophylla chloroplast light harvesting chl... 40 2.6
246gb|AY617091.1| Pinus strobus chloroplast light harvesting chloro... 40 2.6
247gb|AY617090.1| Pinus monticola chloroplast light harvesting chlo... 40 2.6
248gb|AY617089.1| Pinus lambertiana chloroplast light harvesting ch... 40 2.6
249gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlor... 40 2.6
250gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chl... 40 2.6
251gb|AY617084.1| Pinus contorta chloroplast light harvesting chlor... 40 2.6
252gb|AY617083.1| Pinus radiata chloroplast light harvesting chloro... 40 2.6
253gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlo... 40 2.6
254gb|M97171.1|SOYCAB6A Glycine max chlorophyll a/b binding protein... 40 2.6
255gb|AF139465.2|AF139465 Vigna radiata LHCII type III chlorophyll ... 40 2.6
256emb|X74732.1|AHLHAH A.hypochondriacus Lhcb2*Ah1 mRNA 40 2.6
257emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b bindi... 40 2.6
258emb|CR942590.2| Xenopus tropicalis finished cDNA, clone TGas107o14 40 2.6

>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds
          Length = 1044

 Score =  139 bits (70), Expect = 4e-30
 Identities = 96/105 (91%)
 Strand = Plus / Minus

                                                                       
Query: 100 agcttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtc 159
           |||||||||||||||||| |||||||||||||||||||| ||||||||| ||||||||||
Sbjct: 867 agcttacttgccgggcacgaagttggtggcgaaggcccaggcgttgttgttgacggggtc 808

                                                        
Query: 160 ggcaaggtggtcggcgaggttctccaatgggcccttgccagtgac 204
           ||  |||||||||||||||||||| |  ||||||||||| |||||
Sbjct: 807 ggagaggtggtcggcgaggttctcgagggggcccttgccggtgac 763



 Score = 40.1 bits (20), Expect = 2.6
 Identities = 42/49 (85%), Gaps = 4/49 (8%)
 Strand = Plus / Minus

                                                            
Query: 36  gcacacttcatcgcgtacgt----acgtgcactgtcggtttctagacac 80
           |||||||| |||||||||||    |||||||| ||||||||| ||||||
Sbjct: 926 gcacacttgatcgcgtacgtacgcacgtgcacggtcggtttccagacac 878



to top

>gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/b-binding protein
           (CipLhcb1*2) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 932

 Score =  131 bits (66), Expect = 9e-28
 Identities = 95/105 (90%)
 Strand = Plus / Minus

                                                                       
Query: 103 ttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggc 162
           |||||| || || ||||||||||||||| ||||||| ||||||||| |||| ||||||||
Sbjct: 851 ttactttccagggacaaagttggtggcgtaggcccaggcgttgttgttgacagggtcggc 792

                                                        
Query: 163 aaggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
           |||||| ||||||||||||||||| || |||||||||||||||||
Sbjct: 791 aaggtgatcggcgaggttctccaaaggtcccttgccagtgacaat 747



to top

>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding
           protein
          Length = 869

 Score =  129 bits (65), Expect = 4e-27
 Identities = 91/100 (91%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||||||||||||||||||||||||  ||||||| ||||||||| ||||||||||||| |
Sbjct: 808 acttgccgggcacaaagttggtggcataggcccatgcgttgttgttgacggggtcggcga 749

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
           ||||||||||||||||||| |  ||||||||||| |||||
Sbjct: 748 ggtggtcggcgaggttctcgagcgggcccttgccggtgac 709



to top

>gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB)
           mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1042

 Score =  127 bits (64), Expect = 1e-26
 Identities = 93/103 (90%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||||||||| || |||||||||||||||||||| || |||||| |||| ||||| ||||
Sbjct: 826 acttgccgggaacgaagttggtggcgaaggcccaagcattgttgttgactgggtcagcaa 767

                                                      
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
           ||||||| ||||||||||||||||||||||| ||||| |||||
Sbjct: 766 ggtggtctgcgaggttctccaatgggccctttccagtcacaat 724



to top

>ref|NM_191799.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 798

 Score =  121 bits (61), Expect = 9e-25
 Identities = 90/100 (90%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||||||||| || |||||||||||| ||||||| ||||||||| ||||||||||||| |
Sbjct: 796 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 737

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
           |||||||||| |||||||||| ||| |||||||| |||||
Sbjct: 736 ggtggtcggccaggttctccagtggccccttgccggtgac 697



to top

>ref|NM_192636.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 789

 Score =  121 bits (61), Expect = 9e-25
 Identities = 90/100 (90%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||||||||| || |||||||||||| ||||||| ||||||||| ||||||||||||| |
Sbjct: 784 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 725

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
           ||||||||||||||||||| |  ||||||||||| |||||
Sbjct: 724 ggtggtcggcgaggttctcgagggggcccttgccggtgac 685



to top

>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding protein
          Length = 1664

 Score =  121 bits (61), Expect = 9e-25
 Identities = 90/100 (90%)
 Strand = Plus / Minus

                                                                        
Query: 105  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
            |||||||||| || |||||||||||| ||||||| ||||||||| ||||||||||||| |
Sbjct: 1245 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 1186

                                                    
Query: 165  ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
            ||||||||||||||||||| |  ||||||||||| |||||
Sbjct: 1185 ggtggtcggcgaggttctcgagggggcccttgccggtgac 1146



to top

>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase
             IV-1 gene, complete cds
          Length = 15000

 Score =  121 bits (61), Expect = 9e-25
 Identities = 90/100 (90%)
 Strand = Plus / Plus

                                                                         
Query: 105   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
             |||||||||| || |||||||||||| ||||||| ||||||||| ||||||||||||| |
Sbjct: 13878 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 13937

                                                     
Query: 165   ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             |||||||||| |||||||||| ||| |||||||| |||||
Sbjct: 13938 ggtggtcggccaggttctccagtggccccttgccggtgac 13977



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  121 bits (61), Expect = 9e-25
 Identities = 90/100 (90%)
 Strand = Plus / Minus

                                                                            
Query: 105      acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
                |||||||||| || |||||||||||| ||||||| ||||||||| ||||||||||||| |
Sbjct: 30025133 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 30025074

                                                        
Query: 165      ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
                |||||||||| |||||||||| ||| |||||||| |||||
Sbjct: 30025073 ggtggtcggccaggttctccagtggccccttgccggtgac 30025034



 Score =  121 bits (61), Expect = 9e-25
 Identities = 90/100 (90%)
 Strand = Plus / Minus

                                                                            
Query: 105      acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
                |||||||||| || |||||||||||| ||||||| ||||||||| ||||||||||||| |
Sbjct: 23604327 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 23604268

                                                        
Query: 165      ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
                ||||||||||||||||||| |  ||||||||||| |||||
Sbjct: 23604267 ggtggtcggcgaggttctcgagggggcccttgccggtgac 23604228



to top

>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0690B02
          Length = 153116

 Score =  121 bits (61), Expect = 9e-25
 Identities = 90/100 (90%)
 Strand = Plus / Minus

                                                                         
Query: 105   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
             |||||||||| || |||||||||||| ||||||| ||||||||| ||||||||||||| |
Sbjct: 21123 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 21064

                                                     
Query: 165   ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             |||||||||| |||||||||| ||| |||||||| |||||
Sbjct: 21063 ggtggtcggccaggttctccagtggccccttgccggtgac 21024



to top

>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0518F01
          Length = 154541

 Score =  121 bits (61), Expect = 9e-25
 Identities = 90/100 (90%)
 Strand = Plus / Minus

                                                                         
Query: 105   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
             |||||||||| || |||||||||||| ||||||| ||||||||| ||||||||||||| |
Sbjct: 67026 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 66967

                                                     
Query: 165   ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             ||||||||||||||||||| |  ||||||||||| |||||
Sbjct: 66966 ggtggtcggcgaggttctcgagggggcccttgccggtgac 66927



to top

>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full
           insert sequence
          Length = 1180

 Score =  121 bits (61), Expect = 9e-25
 Identities = 90/100 (90%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||||||||| || |||||||||||| ||||||| ||||||||| ||||||||||||| |
Sbjct: 855 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 796

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
           ||||||||||||||||||| |  ||||||||||| |||||
Sbjct: 795 ggtggtcggcgaggttctcgagggggcccttgccggtgac 756



to top

>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full
           insert sequence
          Length = 1126

 Score =  121 bits (61), Expect = 9e-25
 Identities = 90/100 (90%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||||||||| || |||||||||||| ||||||| ||||||||| ||||||||||||| |
Sbjct: 854 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 795

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
           ||||||||||||||||||| |  ||||||||||| |||||
Sbjct: 794 ggtggtcggcgaggttctcgagggggcccttgccggtgac 755



to top

>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding protein
          Length = 1442

 Score =  121 bits (61), Expect = 9e-25
 Identities = 90/100 (90%)
 Strand = Plus / Minus

                                                                        
Query: 105  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
            |||||||||| || |||||||||||| ||||||| ||||||||| ||||||||||||| |
Sbjct: 1284 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 1225

                                                    
Query: 165  ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
            ||||||||||||||||||| |  ||||||||||| |||||
Sbjct: 1224 ggtggtcggcgaggttctcgagggggcccttgccggtgac 1185



to top

>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full
           insert sequence
          Length = 1055

 Score =  121 bits (61), Expect = 9e-25
 Identities = 90/100 (90%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||||||||| || |||||||||||| ||||||| ||||||||| ||||||||||||| |
Sbjct: 877 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 818

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
           |||||||||| |||||||||| ||| |||||||| |||||
Sbjct: 817 ggtggtcggccaggttctccagtggccccttgccggtgac 778



to top

>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full
           insert sequence
          Length = 1055

 Score =  121 bits (61), Expect = 9e-25
 Identities = 90/100 (90%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||||||||| || |||||||||||| ||||||| ||||||||| ||||||||||||| |
Sbjct: 877 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 818

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
           |||||||||| |||||||||| ||| |||||||| |||||
Sbjct: 817 ggtggtcggccaggttctccagtggccccttgccggtgac 778



to top

>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full
           insert sequence
          Length = 1057

 Score =  121 bits (61), Expect = 9e-25
 Identities = 90/100 (90%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||||||||| || |||||||||||| ||||||| ||||||||| ||||||||||||| |
Sbjct: 879 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 820

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
           |||||||||| |||||||||| ||| |||||||| |||||
Sbjct: 819 ggtggtcggccaggttctccagtggccccttgccggtgac 780



to top

>dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-E02, full
           insert sequence
          Length = 650

 Score =  121 bits (61), Expect = 9e-25
 Identities = 90/100 (90%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||||||||| || |||||||||||| ||||||| ||||||||| ||||||||||||| |
Sbjct: 384 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 325

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
           ||||||||||||||||||| |  ||||||||||| |||||
Sbjct: 324 ggtggtcggcgaggttctcgagggggcccttgccggtgac 285



to top

>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full
           insert sequence
          Length = 1057

 Score =  121 bits (61), Expect = 9e-25
 Identities = 90/100 (90%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||||||||| || |||||||||||| ||||||| ||||||||| ||||||||||||| |
Sbjct: 879 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 820

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
           |||||||||| |||||||||| ||| |||||||| |||||
Sbjct: 819 ggtggtcggccaggttctccagtggccccttgccggtgac 780



to top

>gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/b binding protein
           (CipLhcb1) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 975

 Score =  119 bits (60), Expect = 4e-24
 Identities = 92/103 (89%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| || |||||||||||| ||||||| ||||||||| |||| ||||| ||||
Sbjct: 848 actttccggggacgaagttggtggcgtaggcccaggcgttgttgttgactgggtcagcaa 789

                                                      
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
           ||||||||||||||||||||||||| ||||| || ||||||||
Sbjct: 788 ggtggtcggcgaggttctccaatggtccctttccggtgacaat 746



to top

>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor
           (Wcab) mRNA, complete cds
          Length = 918

 Score =  119 bits (60), Expect = 4e-24
 Identities = 92/103 (89%)
 Strand = Plus / Minus

                                                                       
Query: 102 cttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcgg 161
           ||||||||||||| ||||||||||||||||| ||||| || |||||| ||||||||||||
Sbjct: 811 cttacttgccggggacaaagttggtggcgaatgcccatgcattgttgttgacggggtcgg 752

                                                      
Query: 162 caaggtggtcggcgaggttctccaatgggcccttgccagtgac 204
           | | |||||| ||||||||||| | |||||||||||| |||||
Sbjct: 751 cgatgtggtcagcgaggttctcaagtgggcccttgcccgtgac 709



to top

>gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast chlorophyll a/b binding
           protein mRNA, complete cds
          Length = 997

 Score =  117 bits (59), Expect = 1e-23
 Identities = 88/98 (89%)
 Strand = Plus / Minus

                                                                       
Query: 107 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaagg 166
           |||||||| || |||||||||||||||||||| ||||||||| ||||||||||||| |||
Sbjct: 867 ttgccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcggcgagg 808

                                                 
Query: 167 tggtcggcgaggttctccaatgggcccttgccagtgac 204
           ||||||||||||||||| |  ||||| ||||| |||||
Sbjct: 807 tggtcggcgaggttctcgatggggcctttgccggtgac 770



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  113 bits (57), Expect = 2e-22
 Identities = 89/100 (89%)
 Strand = Plus / Minus

                                                                            
Query: 105      acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
                |||||||||| || |||||||||||| | ||||| ||||||||| ||||||||||||| |
Sbjct: 10793780 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 10793721

                                                        
Query: 165      ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
                ||||||||||||||||||| |  ||||||||||| |||||
Sbjct: 10793720 ggtggtcggcgaggttctcgagggggcccttgccggtgac 10793681



to top

>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0512H04
          Length = 151049

 Score =  113 bits (57), Expect = 2e-22
 Identities = 89/100 (89%)
 Strand = Plus / Minus

                                                                         
Query: 105   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
             |||||||||| || |||||||||||| | ||||| ||||||||| ||||||||||||| |
Sbjct: 17503 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 17444

                                                     
Query: 165   ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             ||||||||||||||||||| |  ||||||||||| |||||
Sbjct: 17443 ggtggtcggcgaggttctcgagggggcccttgccggtgac 17404



to top

>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OSJNBb0085I16
          Length = 141701

 Score =  113 bits (57), Expect = 2e-22
 Identities = 89/100 (89%)
 Strand = Plus / Minus

                                                                          
Query: 105    acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
              |||||||||| || |||||||||||| | ||||| ||||||||| ||||||||||||| |
Sbjct: 130398 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 130339

                                                      
Query: 165    ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
              ||||||||||||||||||| |  ||||||||||| |||||
Sbjct: 130338 ggtggtcggcgaggttctcgagggggcccttgccggtgac 130299



to top

>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full
           insert sequence
          Length = 1013

 Score =  113 bits (57), Expect = 2e-22
 Identities = 89/100 (89%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||||||||| || |||||||||||| | ||||| ||||||||| ||||||||||||| |
Sbjct: 848 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 789

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
           ||||||||||||||||||| |  ||||||||||| |||||
Sbjct: 788 ggtggtcggcgaggttctcgagggggcccttgccggtgac 749



to top

>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full
           insert sequence
          Length = 1021

 Score =  113 bits (57), Expect = 2e-22
 Identities = 89/100 (89%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||||||||| || |||||||||||| | ||||| ||||||||| ||||||||||||| |
Sbjct: 853 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 794

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
           ||||||||||||||||||| |  ||||||||||| |||||
Sbjct: 793 ggtggtcggcgaggttctcgagggggcccttgccggtgac 754



to top

>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full
           insert sequence
          Length = 1056

 Score =  113 bits (57), Expect = 2e-22
 Identities = 89/100 (89%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||||||||| || |||||||||||| | ||||| ||||||||| ||||||||||||| |
Sbjct: 855 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 796

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
           ||||||||||||||||||| |  ||||||||||| |||||
Sbjct: 795 ggtggtcggcgaggttctcgagggggcccttgccggtgac 756



to top

>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full
           insert sequence
          Length = 1235

 Score =  113 bits (57), Expect = 2e-22
 Identities = 89/100 (89%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||||||||| || |||||||||||| | ||||| ||||||||| ||||||||||||| |
Sbjct: 853 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 794

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
           ||||||||||||||||||| |  ||||||||||| |||||
Sbjct: 793 ggtggtcggcgaggttctcgagggggcccttgccggtgac 754



to top

>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full
           insert sequence
          Length = 1040

 Score =  113 bits (57), Expect = 2e-22
 Identities = 89/100 (89%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||||||||| || |||||||||||| ||||||| ||||||||| ||||||||||||| |
Sbjct: 862 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 803

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
           ||||||||   ||||||||||| ||||||||||| |||||
Sbjct: 802 ggtggtcgagcaggttctccaaggggcccttgccggtgac 763



to top

>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full
           insert sequence
          Length = 1045

 Score =  113 bits (57), Expect = 2e-22
 Identities = 89/100 (89%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||||||||| || |||||||||||| | ||||| ||||||||| ||||||||||||| |
Sbjct: 853 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 794

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
           ||||||||||||||||||| |  ||||||||||| |||||
Sbjct: 793 ggtggtcggcgaggttctcgagggggcccttgccggtgac 754



to top

>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA,
           complete cds
          Length = 1022

 Score =  113 bits (57), Expect = 2e-22
 Identities = 89/100 (89%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||||||||| ||||||||||||||| ||||||| ||||||||| ||||||||||||| |
Sbjct: 838 acttgccggggacaaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 779

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
           ||||||| | || |||||||| ||| |||||||| |||||
Sbjct: 778 ggtggtctgtgatgttctccagtggccccttgccggtgac 739



to top

>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 1022

 Score =  113 bits (57), Expect = 2e-22
 Identities = 89/100 (89%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||||||||| || |||||||||||| | ||||| ||||||||| ||||||||||||| |
Sbjct: 834 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 775

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
           ||||||||||||||||||| |  ||||||||||| |||||
Sbjct: 774 ggtggtcggcgaggttctcgagggggcccttgccggtgac 735



to top

>gb|K00976.1|PETCAB102 Petunia major chlorophyll a/b binding protein (Cab) clone pCab102,
           3' end and flank
          Length = 302

 Score =  111 bits (56), Expect = 9e-22
 Identities = 91/103 (88%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| |||||||| ||||| ||||||||||| |||||| | |||||||| ||||
Sbjct: 187 actttccgggaacaaagtttgtggcaaaggcccacgcattgttgttaacggggtcagcaa 128

                                                      
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
           ||||||| ||||||||||||||||| || || |||||||||||
Sbjct: 127 ggtggtcagcgaggttctccaatggaccttttccagtgacaat 85



to top

>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds
          Length = 1191

 Score =  109 bits (55), Expect = 3e-21
 Identities = 87/98 (88%)
 Strand = Plus / Minus

                                                                       
Query: 110 ccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtgg 169
           |||||||| ||||||||||| | |  ||||||||||||| |||| |||||||||| ||||
Sbjct: 994 ccgggcacgaagttggtggcaatgagccacgcgttgttgttgacagggtcggcaatgtgg 935

                                                 
Query: 170 tcggcgaggttctccaatgggcccttgccagtgacaat 207
           ||||| |||| |||||||||||||||||| ||||||||
Sbjct: 934 tcggcaaggtcctccaatgggcccttgccggtgacaat 897



to top

>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding
            protein
          Length = 2261

 Score =  105 bits (53), Expect = 5e-20
 Identities = 88/100 (88%)
 Strand = Plus / Minus

                                                                        
Query: 105  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
            |||||||||| || |||||||||||| ||||||| ||||||||| |||||||||||||||
Sbjct: 1808 acttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggcaa 1749

                                                    
Query: 165  ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             |||||| ||||||||||| |  |||||||| || |||||
Sbjct: 1748 tgtggtcagcgaggttctcgagcgggcccttcccggtgac 1709



to top

>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor
          Length = 2780

 Score =  105 bits (53), Expect = 5e-20
 Identities = 88/100 (88%)
 Strand = Plus / Minus

                                                                        
Query: 105  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
            |||||||||| || |||||||||||| | ||||| ||||||||| ||||||||||||  |
Sbjct: 2719 acttgccggggacgaagttggtggcgtaagcccaggcgttgttgttgacggggtcggtga 2660

                                                    
Query: 165  ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
            ||||||||||||||||||| |  ||||||||||| |||||
Sbjct: 2659 ggtggtcggcgaggttctcgatggggcccttgccggtgac 2620



to top

>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein
           LHCP
          Length = 967

 Score =  105 bits (53), Expect = 5e-20
 Identities = 88/100 (88%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||||||||| || |||||||||||| ||||||| ||||||||| |||||||||||||||
Sbjct: 860 acttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggcaa 801

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
            |||||| ||||||||||| |  |||||||| || |||||
Sbjct: 800 tgtggtcagcgaggttctcgagcgggcccttcccggtgac 761



to top

>gb|AY109324.1| Zea mays CL187_1 mRNA sequence
          Length = 2262

 Score =  105 bits (53), Expect = 5e-20
 Identities = 88/100 (88%)
 Strand = Plus / Minus

                                                                        
Query: 105  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
            |||||||||| || |||||||||||| ||||||| ||||||||| |||||||||||||||
Sbjct: 1808 acttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggcaa 1749

                                                    
Query: 165  ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             |||||| ||||||||||| |  |||||||| || |||||
Sbjct: 1748 tgtggtcagcgaggttctcgagcgggcccttcccggtgac 1709



to top

>gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b binding protein
           3C-like mRNA, complete cds
          Length = 1055

 Score =  105 bits (53), Expect = 5e-20
 Identities = 94/108 (87%)
 Strand = Plus / Minus

                                                                       
Query: 100 agcttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtc 159
           |||| |||| ||||| |||||||| ||||| |||||||| ||||||||| | || |||||
Sbjct: 842 agctcactttccgggaacaaagtttgtggcaaaggcccaagcgttgttgttaactgggtc 783

                                                           
Query: 160 ggcaaggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
            |||||||||||||| |||||||||||||| ||||| || ||||||||
Sbjct: 782 agcaaggtggtcggcaaggttctccaatggaccctttccggtgacaat 735



to top

>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds
          Length = 1913

 Score =  105 bits (53), Expect = 5e-20
 Identities = 88/100 (88%)
 Strand = Plus / Minus

                                                                        
Query: 105  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
            |||||||||| || |||||||||||||||||||| |||||||||  |||||||||||| |
Sbjct: 1532 acttgccggggacgaagttggtggcgaaggcccaggcgttgttggcgacggggtcggcga 1473

                                                    
Query: 165  ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             ||||||||| |||||||| |  ||||||||||| |||||
Sbjct: 1472 tgtggtcggccaggttctcgatggggcccttgccggtgac 1433



to top

>emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding protein cab 25
          Length = 1184

 Score =  103 bits (52), Expect = 2e-19
 Identities = 90/103 (87%)
 Strand = Plus / Minus

                                                                        
Query: 105  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
            |||| ||||| |||||||| ||||| ||||||||||| |||||| | |||||||| ||||
Sbjct: 1029 actttccgggaacaaagtttgtggcaaaggcccacgcattgttgttaacggggtcagcaa 970

                                                       
Query: 165  ggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
            |||| || ||||||||||||||||| || || |||||||||||
Sbjct: 969  ggtgatcagcgaggttctccaatggaccttttccagtgacaat 927



to top

>gb|M30620.1|TOMCBPE2 Tomato chlorophyll a/b-binding protein Cab-3A gene, 3' end
          Length = 351

 Score =  103 bits (52), Expect = 2e-19
 Identities = 90/103 (87%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| |||||||| ||||| |||||||| ||||||||| | || ||||||||||
Sbjct: 349 actttccgggaacaaagtttgtggcaaaggcccaggcgttgttgttaactgggtcggcaa 290

                                                      
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
            ||||||||| |||||||||||||| ||||| || ||||||||
Sbjct: 289 tgtggtcggcaaggttctccaatggaccctttccggtgacaat 247



to top

>gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b-binding protein
           mRNA, partial cds
          Length = 575

 Score =  101 bits (51), Expect = 8e-19
 Identities = 83/94 (88%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||||||||| |||||||||||||| || ||||| || |||||| ||||||||||||| |
Sbjct: 470 acttgccggggacaaagttggtggcaaaagcccaggcattgttgttgacggggtcggcga 411

                                             
Query: 165 ggtggtcggcgaggttctccaatgggcccttgcc 198
           |||| ||||| | |||||||||||| ||||||||
Sbjct: 410 ggtgatcggccaagttctccaatggccccttgcc 377



to top

>emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putative chlorophyll a/b
           binding protein (cab gene)
          Length = 760

 Score = 99.6 bits (50), Expect = 3e-18
 Identities = 64/69 (92%)
 Strand = Plus / Minus

                                                                       
Query: 139 cgcgttgttgntgacggggtcggcaaggtggtcggcgaggttctccaatgggcccttgcc 198
           |||||||||| |||| |||||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 760 cgcgttgttgttgacagggtcggcaatgtggtcggcaaggttctccaatgggcccttgcc 701

                    
Query: 199 agtgacaat 207
            ||||||||
Sbjct: 700 ggtgacaat 692



to top

>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.3 mRNA, complete cds
          Length = 3299

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 87/100 (87%)
 Strand = Plus / Plus

                                                                        
Query: 105  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
            |||| ||||| || |||||||||||||||||||| ||||||||| |||| |||||||| |
Sbjct: 2487 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 2546

                                                    
Query: 165  ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
              |||||||||||||||||||| || ||||| || |||||
Sbjct: 2547 aatggtcggcgaggttctccaaaggtccctttccggtgac 2586



to top

>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.2 mRNA, complete cds
          Length = 3338

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 87/100 (87%)
 Strand = Plus / Plus

                                                                        
Query: 105  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
            |||| ||||| || |||||||||||||||||||| ||||||||| |||| |||||||| |
Sbjct: 2487 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 2546

                                                    
Query: 165  ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
              |||||||||||||||||||| || ||||| || |||||
Sbjct: 2547 aatggtcggcgaggttctccaaaggtccctttccggtgac 2586



to top

>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2)
           transcript variant AT2G34420.1 mRNA, complete cds
          Length = 1354

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 87/100 (87%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| || |||||||||||||||||||| ||||||||| |||| |||||||| |
Sbjct: 851 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 792

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             |||||||||||||||||||| || ||||| || |||||
Sbjct: 791 aatggtcggcgaggttctccaaaggtccctttccggtgac 752



to top

>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant
           AT2G34420.2 mRNA, complete cds
          Length = 1312

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 87/100 (87%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| || |||||||||||||||||||| ||||||||| |||| |||||||| |
Sbjct: 809 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 750

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             |||||||||||||||||||| || ||||| || |||||
Sbjct: 749 aatggtcggcgaggttctccaaaggtccctttccggtgac 710



to top

>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 829

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 87/100 (87%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| || |||||||||||||||||||| ||||||||| |||| |||||||| |
Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 737

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             |||||||||||||||||||| || ||||| || |||||
Sbjct: 736 aatggtcggcgaggttctccaaaggtccctttccggtgac 697



to top

>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 1015

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 87/100 (87%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| || |||||||||||||||||||| ||||||||| |||| |||||||| |
Sbjct: 851 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 792

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             |||||||||||||||||||| || ||||| || |||||
Sbjct: 791 aatggtcggcgaggttctccaaaggtccctttccggtgac 752



to top

>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete
             sequence
          Length = 112763

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 87/100 (87%)
 Strand = Plus / Plus

                                                                         
Query: 105   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
             |||| ||||| || |||||||||||||||||||| ||||||||| |||| |||||||| |
Sbjct: 93205 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 93264

                                                     
Query: 165   ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
               |||||||||||||||||||| || ||||| || |||||
Sbjct: 93265 aatggtcggcgaggttctccaaaggtccctttccggtgac 93304



 Score = 71.9 bits (36), Expect = 7e-10
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                         
Query: 105   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
             |||| ||||| || |||||||| ||||||||||| || |||||| |||| || || || |
Sbjct: 96103 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 96044

                                                        
Query: 165   ggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
              |||||| |||||||||||||| || ||||| || ||||||||
Sbjct: 96043 agtggtccgcgaggttctccaacggtccctttccggtgacaat 96001



to top

>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete
             sequence
          Length = 93060

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 87/100 (87%)
 Strand = Plus / Minus

                                                                         
Query: 105   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
             |||| ||||| || |||||||||||||||||||| ||||||||| |||| |||||||| |
Sbjct: 80997 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 80938

                                                     
Query: 165   ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
               |||||||||||||||||||| || ||||| || |||||
Sbjct: 80937 aatggtcggcgaggttctccaaaggtccctttccggtgac 80898



 Score = 71.9 bits (36), Expect = 7e-10
 Identities = 86/103 (83%)
 Strand = Plus / Plus

                                                                         
Query: 105   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
             |||| ||||| || |||||||| ||||||||||| || |||||| |||| || || || |
Sbjct: 78099 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 78158

                                                        
Query: 165   ggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
              |||||| |||||||||||||| || ||||| || ||||||||
Sbjct: 78159 agtggtccgcgaggttctccaacggtccctttccggtgacaat 78201



to top

>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420) mRNA, complete cds
          Length = 883

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 87/100 (87%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| || |||||||||||||||||||| ||||||||| |||| |||||||| |
Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 737

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             |||||||||||||||||||| || ||||| || |||||
Sbjct: 736 aatggtcggcgaggttctccaaaggtccctttccggtgac 697



to top

>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 87/100 (87%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| || |||||||||||||||||||| ||||||||| |||| |||||||| |
Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 737

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             |||||||||||||||||||| || ||||| || |||||
Sbjct: 736 aatggtcggcgaggttctccaaaggtccctttccggtgac 697



to top

>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 87/100 (87%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| || |||||||||||||||||||| ||||||||| |||| |||||||| |
Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 737

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             |||||||||||||||||||| || ||||| || |||||
Sbjct: 736 aatggtcggcgaggttctccaaaggtccctttccggtgac 697



to top

>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420; T31E10.24) mRNA, complete cds
          Length = 969

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 87/100 (87%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| || |||||||||||||||||||| ||||||||| |||| |||||||| |
Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 788

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             |||||||||||||||||||| || ||||| || |||||
Sbjct: 787 aatggtcggcgaggttctccaaaggtccctttccggtgac 748



to top

>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 87/100 (87%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| || |||||||||||||||||||| ||||||||| |||| |||||||| |
Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 788

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             |||||||||||||||||||| || ||||| || |||||
Sbjct: 787 aatggtcggcgaggttctccaaaggtccctttccggtgac 748



to top

>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 87/100 (87%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| || |||||||||||||||||||| ||||||||| |||| |||||||| |
Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 788

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             |||||||||||||||||||| || ||||| || |||||
Sbjct: 787 aatggtcggcgaggttctccaaaggtccctttccggtgac 748



to top

>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 1024

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 87/100 (87%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| || |||||||||||||||||||| ||||||||| |||| |||||||| |
Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 788

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             |||||||||||||||||||| || ||||| || |||||
Sbjct: 787 aatggtcggcgaggttctccaaaggtccctttccggtgac 748



to top

>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 995

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 87/100 (87%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| || |||||||||||||||||||| ||||||||| |||| |||||||| |
Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 788

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             |||||||||||||||||||| || ||||| || |||||
Sbjct: 787 aatggtcggcgaggttctccaaaggtccctttccggtgac 748



to top

>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 87/100 (87%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| || |||||||||||||||||||| ||||||||| |||| |||||||| |
Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 788

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             |||||||||||||||||||| || ||||| || |||||
Sbjct: 787 aatggtcggcgaggttctccaaaggtccctttccggtgac 748



to top

>emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL87ZD09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 949

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 87/100 (87%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| || |||||||||||||||||||| ||||||||| | || ||||||||||
Sbjct: 828 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttaactgggtcggcaa 769

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             |||||||||||||||||||| || ||||| || |||||
Sbjct: 768 aatggtcggcgaggttctccaaaggtccctttccggtgac 729



to top

>emb|BX819530.1|CNS0A9V8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB87ZE01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 291

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 87/100 (87%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| || |||||||||||||||||||| ||||||||| |||| |||||||| |
Sbjct: 167 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 108

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             |||||||||||||||||||| || ||||| || |||||
Sbjct: 107 aatggtcggcgaggttctccaaaggtccctttccggtgac 68



to top

>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS62ZC05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 903

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 87/100 (87%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| || |||||||||||||||||||| ||||||||| |||| |||||||| |
Sbjct: 828 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 769

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             |||||||||||||||||||| || ||||| || |||||
Sbjct: 768 aatggtcggcgaggttctccaaaggtccctttccggtgac 729



to top

>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS5ZF09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 885

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 87/100 (87%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| || |||||||||||||||||||| ||||||||| |||| |||||||| |
Sbjct: 831 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 772

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             |||||||||||||||||||| || ||||| || |||||
Sbjct: 771 aatggtcggcgaggttctccaaaggtccctttccggtgac 732



to top

>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB71ZG07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 919

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 87/100 (87%)
 Strand = Plus / Plus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| || |||||||||||||||||||| ||||||||| |||| |||||||| |
Sbjct: 88  actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 147

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             |||||||||||||||||||| || ||||| || |||||
Sbjct: 148 aatggtcggcgaggttctccaaaggtccctttccggtgac 187



to top

>emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II chlorophyll a/b binding
            protein
          Length = 1405

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 87/100 (87%)
 Strand = Plus / Minus

                                                                        
Query: 105  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
            |||| ||||| || |||||||||||||||||||| ||||||||| |||| |||||||| |
Sbjct: 1096 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 1037

                                                    
Query: 165  ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
              |||||||||||||||||||| || ||||| || |||||
Sbjct: 1036 aatggtcggcgaggttctccaaaggtccctttccggtgac 997



to top

>emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/b binding protein
          Length = 964

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 87/100 (87%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| ||||||||||||||| ||| ||| || |||||| | || ||||| ||||
Sbjct: 869 actttccggggacaaagttggtggcgtaggaccaggcattgttgttaactgggtcagcaa 810

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
           |||||||||| |||||||||||||| ||||| ||||||||
Sbjct: 809 ggtggtcggctaggttctccaatggaccctttccagtgac 770



to top

>gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein (cab3) mRNA, nuclear
           gene encoding chloroplast protein, complete cds
          Length = 977

 Score = 95.6 bits (48), Expect = 5e-17
 Identities = 89/103 (86%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||||||||| || |||||||||||| ||||||| || |||||| |||| ||||| ||||
Sbjct: 821 acttgccggggacgaagttggtggcgtaggcccaggcattgttgttgactgggtccgcaa 762

                                                      
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
           |||| || || |||||||||||||| ||||| || ||||||||
Sbjct: 761 ggtgatcagcaaggttctccaatggacccttaccggtgacaat 719



to top

>gb|M30622.1|TOMCBPF2 Tomato chlorophyll a/b-binding protein Cab-3B gene, 3' end
          Length = 351

 Score = 95.6 bits (48), Expect = 5e-17
 Identities = 89/103 (86%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| |||||||| ||||| |||||||| ||||||||| | || ||||| ||||
Sbjct: 349 actttccgggaacaaagtttgtggcaaaggcccaggcgttgttgttaactgggtcagcaa 290

                                                      
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
            ||||||||| || ||||||||||| ||||| |||||||||||
Sbjct: 289 tgtggtcggcaagattctccaatggaccctttccagtgacaat 247



to top

>gb|BT014208.1| Lycopersicon esculentum clone 133385R, mRNA sequence
          Length = 958

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 85/98 (86%)
 Strand = Plus / Minus

                                                                       
Query: 110 ccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtgg 169
           ||||| |||||||| |||||||| ||||| || |||||| | |||||||| |||||||||
Sbjct: 835 ccggggacaaagtttgtggcgaaagcccaggcattgttgtttacggggtctgcaaggtgg 776

                                                 
Query: 170 tcggcgaggttctccaatgggcccttgccagtgacaat 207
           || || |||||||||||||| ||||| || ||||||||
Sbjct: 775 tcagcaaggttctccaatggaccctttccggtgacaat 738



to top

>gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-1) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 76/86 (88%)
 Strand = Plus / Minus

                                                                       
Query: 110 ccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtgg 169
           ||||| |||||||| |||||||| ||||| ||||||||| | |||||||| |||||||||
Sbjct: 791 ccggggacaaagtttgtggcgaaagcccaagcgttgttgttaacggggtctgcaaggtgg 732

                                     
Query: 170 tcggcgaggttctccaatgggccctt 195
           || || |||||||||||||| |||||
Sbjct: 731 tcagcaaggttctccaatggaccctt 706



to top

>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein
          Length = 2100

 Score = 91.7 bits (46), Expect = 8e-16
 Identities = 90/105 (85%)
 Strand = Plus / Minus

                                                                        
Query: 100  agcttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtc 159
            |||||| |||||||| || |||||||||||| ||||||| ||||||||| |||| |||||
Sbjct: 1683 agcttagttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgactgggtc 1624

                                                         
Query: 160  ggcaaggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             || | |||||| ||||||||||| |  ||||||||||| |||||
Sbjct: 1623 agcgatgtggtcagcgaggttctcgagcgggcccttgccggtgac 1579



to top

>gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence
          Length = 775

 Score = 89.7 bits (45), Expect = 3e-15
 Identities = 86/100 (86%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| || |||||||||||||||||||| ||||||||| |||| || || || |
Sbjct: 630 actttccggggacgaagttggtggcgaaggcccatgcgttgttgttgactggatcagcca 571

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             ||||||||||||||||||||||| ||||| || |||||
Sbjct: 570 aatggtcggcgaggttctccaatggtccctttccggtgac 531



to top

>emb|X52744.1|NTCAB40 Tabacco Cab40 mRNA for major chlorophyll a/b binding protein
          Length = 1080

 Score = 89.7 bits (45), Expect = 3e-15
 Identities = 86/100 (86%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| |||||||| |||||  ||||||| || |||||| | || ||||| ||||
Sbjct: 865 actttccgggaacaaagtttgtggcataggcccaggcattgttgttaactgggtctgcaa 806

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
           |||||||||| |||||||||||||| ||||| ||||||||
Sbjct: 805 ggtggtcggcaaggttctccaatggaccctttccagtgac 766



to top

>gb|K00974.1|PETCAB4 Petunia major chlorophyll a/b binding protein (Cab) clone pCab4, 3'
           end
          Length = 387

 Score = 89.7 bits (45), Expect = 3e-15
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 116 acaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcg 175
           |||||||| |||||| ||| ||| || |||||| | || |||||||||||||||||||| 
Sbjct: 383 acaaagtttgtggcgtaggaccaagcattgttgttaactgggtcggcaaggtggtcggca 324

                                           
Query: 176 aggttctccaatgggcccttgccagtgacaat 207
           |||||||||||||| ||||| ||||| |||||
Sbjct: 323 aggttctccaatggaccctttccagtaacaat 292



to top

>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds
          Length = 1633

 Score = 89.7 bits (45), Expect = 3e-15
 Identities = 86/100 (86%)
 Strand = Plus / Minus

                                                                        
Query: 105  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
            |||||||||| || |||||||||||||||||||| ||||||||| ||||||||||||| |
Sbjct: 1193 acttgccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcggcga 1134

                                                    
Query: 165  ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
            | ||||| || | |||||| |  |||||||| || |||||
Sbjct: 1133 gatggtccgccaagttctcgagggggcccttcccggtgac 1094



to top

>emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL5ZG08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 911

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 73/83 (87%)
 Strand = Plus / Minus

                                                                       
Query: 122 ttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcgaggttc 181
           ||||||||||||||||| ||||||||| |||| |||||||| |  |||||||||||||||
Sbjct: 814 ttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaatggtcggcgaggttc 755

                                  
Query: 182 tccaatgggcccttgccagtgac 204
           ||||| || ||||| || |||||
Sbjct: 754 tccaaaggtccctttccggtgac 732



to top

>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein
          Length = 934

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 88/103 (85%)
 Strand = Plus / Minus

                                                                       
Query: 102 cttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcgg 161
           |||| |||||||| || ||||| ||||| || ||||| ||||||||| ||||||||||||
Sbjct: 820 cttatttgccggggacgaagtttgtggcaaatgcccaagcgttgttgttgacggggtcgg 761

                                                      
Query: 162 caaggtggtcggcgaggttctccaatgggcccttgccagtgac 204
           | | |||||| ||||||||||| |  ||||||||||| |||||
Sbjct: 760 cgatgtggtcagcgaggttctcaagagggcccttgccggtgac 718



to top

>emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll a/b binding protein
          Length = 1361

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 88/103 (85%)
 Strand = Plus / Minus

                                                                        
Query: 105  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
            |||| ||||| || |||||||||||  ||||||| ||||||||| |||| ||  | ||||
Sbjct: 1040 actttccggggacgaagttggtggcataggcccaggcgttgttgttgacaggtccagcaa 981

                                                       
Query: 165  ggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
            |||| |||||||||||||||||||| ||||| || ||||||||
Sbjct: 980  ggtgatcggcgaggttctccaatggaccctttccggtgacaat 938



to top

>gb|M14443.1|TOMCBPA Tomato chlorophyll a/b-binding protein gene Cab-1B, complete cds
          Length = 1253

 Score = 85.7 bits (43), Expect = 5e-14
 Identities = 84/98 (85%)
 Strand = Plus / Minus

                                                                       
Query: 110 ccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtgg 169
           ||||| |||||||| |||||||| ||||| || |||||| | |||||||| |||||||| 
Sbjct: 981 ccggggacaaagtttgtggcgaaagcccaggcattgttgtttacggggtctgcaaggtga 922

                                                 
Query: 170 tcggcgaggttctccaatgggcccttgccagtgacaat 207
           || || |||||||||||||| ||||| || ||||||||
Sbjct: 921 tcagcaaggttctccaatggaccctttccggtgacaat 884



to top

>dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 genes for light
            harvesting chlorophyll a/b-binding protein, complete cds
          Length = 7965

 Score = 85.7 bits (43), Expect = 5e-14
 Identities = 84/98 (85%)
 Strand = Plus / Minus

                                                                        
Query: 110  ccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtgg 169
            ||||| |||||||| |||||| ||||||| || |||||| | || ||||| |||||||||
Sbjct: 7665 ccggggacaaagtttgtggcgtaggcccaagcattgttgttaactgggtctgcaaggtgg 7606

                                                  
Query: 170  tcggcgaggttctccaatgggcccttgccagtgacaat 207
            || || |||||||| ||||||||||| ||||| |||||
Sbjct: 7605 tcagcaaggttctctaatgggccctttccagtaacaat 7568



 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                        
Query: 110  ccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtgg 169
            ||||| |||||||| |||||  ||| ||| ||||||||| | || ||||| |||||||||
Sbjct: 5125 ccggggacaaagtttgtggcataggaccaggcgttgttgttaacagggtctgcaaggtgg 5066

                                      
Query: 170  tcggcgaggttctccaatgggccctt 195
            || || ||||||||||||||||||||
Sbjct: 5065 tcagcaaggttctccaatgggccctt 5040



 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                        
Query: 116  acaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcg 175
            |||||||| |||||| ||| ||| ||||||||| | || ||||| ||||| ||||| || 
Sbjct: 2666 acaaagtttgtggcgtaggaccaggcgttgttgttaactgggtcagcaagatggtcagca 2607

                                            
Query: 176  aggttctccaatgggcccttgccagtgacaat 207
            |||||||||||||| || || ||||| |||||
Sbjct: 2606 aggttctccaatggaccttttccagtaacaat 2575



to top

>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds
          Length = 695

 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                       
Query: 119 aagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcgagg 178
           |||||||||||||||||||| ||||||||| |||||||||| || ||||||||||| | |
Sbjct: 693 aagttggtggcgaaggcccaggcgttgttgttgacggggtcagcgaggtggtcggccaag 634

                
Query: 179 ttctc 183
           |||||
Sbjct: 633 ttctc 629



to top

>emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1078

 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 68/77 (88%)
 Strand = Plus / Minus

                                                                       
Query: 107 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaagg 166
           ||||| || ||||||||||||||| ||||||| ||||||||| |||| ||||| || |||
Sbjct: 834 ttgccagggacaaagttggtggcgtaggcccaggcgttgttgttgacagggtcagcgagg 775

                            
Query: 167 tggtcggcgaggttctc 183
           || ||||||||||||||
Sbjct: 774 tgatcggcgaggttctc 758



to top

>gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding protein of LHCII type I
           precursor (CAB) mRNA, nuclear gene encoding chloroplast
           protein, complete cds
          Length = 1015

 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 80/93 (86%)
 Strand = Plus / Minus

                                                                       
Query: 103 ttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggc 162
           |||||| ||||| ||||||||||||||  ||||||| || |||||| | || || || ||
Sbjct: 824 ttactttccggggacaaagttggtggcataggcccatgcattgttgttcactggatcagc 765

                                            
Query: 163 aaggtggtcggcgaggttctccaatgggccctt 195
           |||| ||||||| ||||||||||||||||||||
Sbjct: 764 aagggggtcggctaggttctccaatgggccctt 732



to top

>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete
             sequence
          Length = 139771

 Score = 81.8 bits (41), Expect = 8e-13
 Identities = 85/100 (85%)
 Strand = Plus / Plus

                                                                         
Query: 105   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
             |||||||||| || |||||||||||| | ||||| |||||||||  |||||||||||| |
Sbjct: 78974 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcga 79033

                                                     
Query: 165   ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
              |||||||  ||||||||| |  ||||||||||| |||||
Sbjct: 79034 cgtggtcgaagaggttctcgatggggcccttgccggtgac 79073



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 81.8 bits (41), Expect = 8e-13
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                            
Query: 105      acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
                |||||||||| || |||||||||||| | ||||| |||||||||  |||||||||||| |
Sbjct: 21808842 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcga 21808783

                                                        
Query: 165      ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
                 |||||||  ||||||||| |  ||||||||||| |||||
Sbjct: 21808782 cgtggtcgaagaggttctcgatggggcccttgccggtgac 21808743



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 81.8 bits (41), Expect = 8e-13
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                            
Query: 105      acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
                |||||||||| || |||||||||||| | ||||| |||||||||  |||||||||||| |
Sbjct: 21801871 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcga 21801812

                                                        
Query: 165      ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
                 |||||||  ||||||||| |  ||||||||||| |||||
Sbjct: 21801811 cgtggtcgaagaggttctcgatggggcccttgccggtgac 21801772



to top

>emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL46ZF04 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 959

 Score = 81.8 bits (41), Expect = 8e-13
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| || |||||||||||| ||||||| |||||||||  ||| |||||||| |
Sbjct: 838 actttccggggacgaagttggtggcggaggcccaagcgttgttgtagactgggtcggcca 779

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             |||||||||||||||||||| || ||||| || |||||
Sbjct: 778 aatggtcggcgaggttctccaaaggtccctttccggtgac 739



to top

>emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding protein cab 13
          Length = 1019

 Score = 81.8 bits (41), Expect = 8e-13
 Identities = 79/92 (85%)
 Strand = Plus / Minus

                                                                       
Query: 116 acaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcg 175
           ||||| || ||||| ||||||||||| |||||| | |||||||| |||||||| || |||
Sbjct: 909 acaaaatttgtggcaaaggcccacgcattgttgttaacggggtcagcaaggtgatcagcg 850

                                           
Query: 176 aggttctccaatgggcccttgccagtgacaat 207
           |||||||||||||| || || || ||||||||
Sbjct: 849 aggttctccaatggaccttttccggtgacaat 818



to top

>dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075I09, full
           insert sequence
          Length = 1106

 Score = 81.8 bits (41), Expect = 8e-13
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||||||||| || |||||||||||| | ||||| |||||||||  |||||||||||| |
Sbjct: 841 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcga 782

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
            |||||||  ||||||||| |  ||||||||||| |||||
Sbjct: 781 cgtggtcgaagaggttctcgatggggcccttgccggtgac 742



to top

>dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-A06, full
           insert sequence
          Length = 685

 Score = 81.8 bits (41), Expect = 8e-13
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||||||||| || |||||||||||| | ||||| |||||||||  |||||||||||| |
Sbjct: 416 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcga 357

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
            |||||||  ||||||||| |  ||||||||||| |||||
Sbjct: 356 cgtggtcgaagaggttctcgatggggcccttgccggtgac 317



to top

>gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding protein (RCABP89) mRNA,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 1027

 Score = 81.8 bits (41), Expect = 8e-13
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||||||||| || |||||||||||| | ||||| |||||||||  |||||||||||| |
Sbjct: 830 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcga 771

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
            |||||||  ||||||||| |  ||||||||||| |||||
Sbjct: 770 cgtggtcgaagaggttctcgatggggcccttgccggtgac 731



to top

>gb|U21113.1|STU21113 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-4) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score = 81.8 bits (41), Expect = 8e-13
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 116 acaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcg 175
           |||||||| |||||| ||||||| || |||||| | |||||||| ||||||||||| || 
Sbjct: 785 acaaagtttgtggcgtaggcccaggcattgttgttaacggggtctgcaaggtggtcagca 726

                               
Query: 176 aggttctccaatgggccctt 195
           |||||||||||||| |||||
Sbjct: 725 aggttctccaatggaccctt 706



to top

>dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting
            chlorophyll a/b-binding protein, complete cds
          Length = 7299

 Score = 81.8 bits (41), Expect = 8e-13
 Identities = 85/100 (85%)
 Strand = Plus / Plus

                                                                        
Query: 105  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
            |||| ||||| |||||||| |||||  ||||||| ||||||||| | || ||||| ||||
Sbjct: 1872 actttccgggaacaaagtttgtggcataggcccaagcgttgttgttaactgggtcagcaa 1931

                                                    
Query: 165  ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
            | |||||||| |||||||||||||| ||||| || |||||
Sbjct: 1932 gatggtcggcaaggttctccaatggaccctttccggtgac 1971



 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 72/85 (84%)
 Strand = Plus / Minus

                                                                        
Query: 105  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
            |||| ||||| |||||||| |||||  | ||||| || |||||| | || ||||| ||||
Sbjct: 5161 actttccgggaacaaagttagtggcatatgcccaggcattgttgttaactgggtcagcaa 5102

                                     
Query: 165  ggtggtcggcgaggttctccaatgg 189
            |||||||||| ||||||||||||||
Sbjct: 5101 ggtggtcggcaaggttctccaatgg 5077



to top

>ref|XM_478729.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 972

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 122 ttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcgaggttc 181
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 816 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 757

                                  
Query: 182 tccaatgggcccttgccagtgac 204
           ||||| ||||||||||| |||||
Sbjct: 756 tccaaggggcccttgccggtgac 734



to top

>ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 995

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 122 ttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcgaggttc 181
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 781

                                  
Query: 182 tccaatgggcccttgccagtgac 204
           ||||| ||||||||||| |||||
Sbjct: 780 tccaaggggcccttgccggtgac 758



to top

>ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1007

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 122 ttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcgaggttc 181
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 781

                                  
Query: 182 tccaatgggcccttgccagtgac 204
           ||||| ||||||||||| |||||
Sbjct: 780 tccaaggggcccttgccggtgac 758



to top

>ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1108

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 122 ttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcgaggttc 181
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 842 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 783

                                  
Query: 182 tccaatgggcccttgccagtgac 204
           ||||| ||||||||||| |||||
Sbjct: 782 tccaaggggcccttgccggtgac 760



to top

>ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1000

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 122 ttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcgaggttc 181
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786

                                  
Query: 182 tccaatgggcccttgccagtgac 204
           ||||| ||||||||||| |||||
Sbjct: 785 tccaaggggcccttgccggtgac 763



to top

>ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1012

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 122 ttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcgaggttc 181
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786

                                  
Query: 182 tccaatgggcccttgccagtgac 204
           ||||| ||||||||||| |||||
Sbjct: 785 tccaaggggcccttgccggtgac 763



to top

>ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1032

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 122 ttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcgaggttc 181
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 847 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 788

                                  
Query: 182 tccaatgggcccttgccagtgac 204
           ||||| ||||||||||| |||||
Sbjct: 787 tccaaggggcccttgccggtgac 765



to top

>ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1159

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 122 ttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcgaggttc 181
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 880 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 821

                                  
Query: 182 tccaatgggcccttgccagtgac 204
           ||||| ||||||||||| |||||
Sbjct: 820 tccaaggggcccttgccggtgac 798



to top

>gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 987

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 78/91 (85%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| |||||||||||||| || ||||| ||||||||| |||| ||||| ||||
Sbjct: 851 actttccgggaacaaagttggtggcaaaagcccaggcgttgttgttgactgggtcagcaa 792

                                          
Query: 165 ggtggtcggcgaggttctccaatgggccctt 195
           | ||||| || ||||||||||| || |||||
Sbjct: 791 gatggtcagcaaggttctccaaaggaccctt 761



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                            
Query: 122      ttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcgaggttc 181
                ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 22434853 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 22434794

                                       
Query: 182      tccaatgggcccttgccagtgac 204
                ||||| ||||||||||| |||||
Sbjct: 22434793 tccaaggggcccttgccggtgac 22434771



to top

>dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0406F06
          Length = 144533

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                         
Query: 122   ttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcgaggttc 181
             ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 95920 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 95861

                                    
Query: 182   tccaatgggcccttgccagtgac 204
             ||||| ||||||||||| |||||
Sbjct: 95860 tccaaggggcccttgccggtgac 95838



to top

>dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C08, full
           insert sequence
          Length = 1111

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 122 ttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcgaggttc 181
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786

                                  
Query: 182 tccaatgggcccttgccagtgac 204
           ||||| ||||||||||| |||||
Sbjct: 785 tccaaggggcccttgccggtgac 763



to top

>dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-206-G05, full
           insert sequence
          Length = 1012

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 122 ttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcgaggttc 181
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786

                                  
Query: 182 tccaatgggcccttgccagtgac 204
           ||||| ||||||||||| |||||
Sbjct: 785 tccaaggggcccttgccggtgac 763



to top

>dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-F03, full
           insert sequence
          Length = 1000

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 122 ttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcgaggttc 181
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786

                                  
Query: 182 tccaatgggcccttgccagtgac 204
           ||||| ||||||||||| |||||
Sbjct: 785 tccaaggggcccttgccggtgac 763



to top

>emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/b binding protein
          Length = 983

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 87/103 (84%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| ||||||||||||||  ||||||| || |||||| |||| ||||| | ||
Sbjct: 813 actttccgggaacaaagttggtggcataggcccatgcattgttgttgacagggtcagaaa 754

                                                      
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
           | ||||| || ||||||||||| || ||||| |||||||||||
Sbjct: 753 gatggtcagcaaggttctccaaaggaccctttccagtgacaat 711



to top

>dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-C03, full
           insert sequence
          Length = 973

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 122 ttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcgaggttc 181
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 816 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 757

                                  
Query: 182 tccaatgggcccttgccagtgac 204
           ||||| ||||||||||| |||||
Sbjct: 756 tccaaggggcccttgccggtgac 734



to top

>dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C07, full
           insert sequence
          Length = 1012

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 122 ttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcgaggttc 181
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786

                                  
Query: 182 tccaatgggcccttgccagtgac 204
           ||||| ||||||||||| |||||
Sbjct: 785 tccaaggggcccttgccggtgac 763



to top

>dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-E11, full
           insert sequence
          Length = 995

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 122 ttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcgaggttc 181
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 781

                                  
Query: 182 tccaatgggcccttgccagtgac 204
           ||||| ||||||||||| |||||
Sbjct: 780 tccaaggggcccttgccggtgac 758



to top

>dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-D10, full
           insert sequence
          Length = 1007

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 122 ttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcgaggttc 181
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 781

                                  
Query: 182 tccaatgggcccttgccagtgac 204
           ||||| ||||||||||| |||||
Sbjct: 780 tccaaggggcccttgccggtgac 758



to top

>dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D02, full
           insert sequence
          Length = 1000

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 122 ttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcgaggttc 181
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786

                                  
Query: 182 tccaatgggcccttgccagtgac 204
           ||||| ||||||||||| |||||
Sbjct: 785 tccaaggggcccttgccggtgac 763



to top

>dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023001G03, full
           insert sequence
          Length = 1107

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 122 ttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcgaggttc 181
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 841 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 782

                                  
Query: 182 tccaatgggcccttgccagtgac 204
           ||||| ||||||||||| |||||
Sbjct: 781 tccaaggggcccttgccggtgac 759



to top

>dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-G12, full
           insert sequence
          Length = 1032

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 122 ttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcgaggttc 181
           ||||||||| || |||| |||||||||  |||||||||||| |||||||||   ||||||
Sbjct: 847 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 788

                                  
Query: 182 tccaatgggcccttgccagtgac 204
           ||||| ||||||||||| |||||
Sbjct: 787 tccaaggggcccttgccggtgac 765



to top

>gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding protein (CARCAB1) mRNA,
           complete cds
          Length = 983

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 78/91 (85%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| ||||||||||||||  ||||||| ||||||||| |||| ||||||||||
Sbjct: 850 actttccgggaacaaagttggtggcataggcccatgcgttgttgttgactgggtcggcaa 791

                                          
Query: 165 ggtggtcggcgaggttctccaatgggccctt 195
           | || || || ||||||||||| || |||||
Sbjct: 790 gatgatcagcaaggttctccaaaggtccctt 760



to top

>gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB2) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1027

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 69/79 (87%)
 Strand = Plus / Minus

                                                                       
Query: 117 caaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcga 176
           ||||||| |||||||||||||| || |||||| | || |||||||||||||| || || |
Sbjct: 802 caaagtttgtggcgaaggcccaagcattgttgttaactgggtcggcaaggtgatcagcaa 743

                              
Query: 177 ggttctccaatgggccctt 195
           ||||||||||||| |||||
Sbjct: 742 ggttctccaatggaccctt 724



to top

>gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein of PS II mRNA, partial
           cds
          Length = 551

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 110 ccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtgg 169
           ||||| || |||||||||||| | ||||| ||||||||| ||||||||||||| ||||| 
Sbjct: 389 ccggggacgaagttggtggcgtaagcccaggcgttgttgttgacggggtcggccaggtga 330

                      
Query: 170 tcggcgaggtt 180
           |||||||||||
Sbjct: 329 tcggcgaggtt 319



to top

>emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll a/b binding protein
          Length = 980

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 78/91 (85%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| |||||||||||||| |||  ||| || |||||| | || ||||| ||||
Sbjct: 851 actttccggggacaaagttggtggcaaagttccaagcattgttgttaaccgggtcagcaa 792

                                          
Query: 165 ggtggtcggcgaggttctccaatgggccctt 195
           ||||||| |||||||| ||||||||||||||
Sbjct: 791 ggtggtcagcgaggttttccaatgggccctt 761



to top

>gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosystem II chlorophyll
           A/B-binding protein gene, complete cds
          Length = 1260

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 78/91 (85%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| ||||||||||||||  ||||||| || |||||| |||| ||||| ||||
Sbjct: 990 actttccggggacaaagttggtggcataggcccaagcattgttgttgactgggtcagcaa 931

                                          
Query: 165 ggtggtcggcgaggttctccaatgggccctt 195
           ||||||| || | |||||||||||| |||||
Sbjct: 930 ggtggtcagccaagttctccaatggtccctt 900



to top

>emb|AJ318069.1|STU318069 Solanum tuberosum mRNA for ferredoxin-thioredoxin-reductase
           catalytic subunit B (ftrbpot gene)
          Length = 701

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 75/86 (87%), Gaps = 1/86 (1%)
 Strand = Plus / Plus

                                                                       
Query: 110 ccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtgg 169
           ||||| |||||||| |||||||| ||| | ||||||||| | |||||||| |||||||||
Sbjct: 6   ccggggacaaagtttgtggcgaaagccaa-gcgttgttgttaacggggtctgcaaggtgg 64

                                     
Query: 170 tcggcgaggttctccaatgggccctt 195
           || || |||||||||||||| |||||
Sbjct: 65  tcagcaaggttctccaatggaccctt 90



to top

>gb|M14449.1|TOMCBPG Tomato chlorophyll a/b-binding protein gene Cab-1D, complete cds
          Length = 351

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 110 ccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtgg 169
           ||||| |||||||| |||||| ||| ||| ||||||||| | || ||||| |||||||| 
Sbjct: 344 ccgggaacaaagttagtggcgtaggaccaggcgttgttgtttactgggtctgcaaggtga 285

                                                 
Query: 170 tcggcgaggttctccaatgggcccttgccagtgacaat 207
           || || |||||||||||||| ||||| ||||| |||||
Sbjct: 284 tcagcaaggttctccaatggtccctttccagtaacaat 247



to top

>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein
          Length = 1197

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                       
Query: 107 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaagg 166
           |||||||| || |||||||||||  ||||||| ||||||||| | ||||||||||| |||
Sbjct: 884 ttgccggggacgaagttggtggcataggcccaggcgttgttgctaacggggtcggccagg 825

                            
Query: 167 tggtcggcgaggttctc 183
           || || |||||||||||
Sbjct: 824 tgatcagcgaggttctc 808



to top

>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein
          Length = 2574

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                        
Query: 107  ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaagg 166
            |||||||| || |||||||||||  ||||||| ||||||||| | ||||||||||| |||
Sbjct: 1962 ttgccggggacgaagttggtggcataggcccaggcgttgttgctaacggggtcggccagg 1903

                             
Query: 167  tggtcggcgaggttctc 183
            || || |||||||||||
Sbjct: 1902 tgatcagcgaggttctc 1886



to top

>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein
          Length = 1006

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                       
Query: 107 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaagg 166
           |||||||| || |||||||||||| ||||||| ||||||||| | |||||||| || |||
Sbjct: 869 ttgccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtcagccagg 810

                            
Query: 167 tggtcggcgaggttctc 183
           || || |||||||||||
Sbjct: 809 tgatcagcgaggttctc 793



to top

>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b-
           binding protein ( LHCP )
          Length = 1030

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 61/69 (88%)
 Strand = Plus / Minus

                                                                       
Query: 103 ttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggc 162
           |||||||||||| || |||||||||||||||||||| || |||||| | |||||||||||
Sbjct: 975 ttacttgccggggacgaagttggtggcgaaggcccaggcattgttgtttacggggtcggc 916

                    
Query: 163 aaggtggtc 171
            || |||||
Sbjct: 915 gagatggtc 907



to top

>dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3102

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 88/105 (83%)
 Strand = Plus / Minus

                                                                        
Query: 103  ttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggc 162
            |||||| ||||| |||||||| |||||  ||||||| ||||||||| | |||||||| ||
Sbjct: 2708 ttactttccggggacaaagtttgtggcataggcccaggcgttgttgttaacggggtcagc 2649

                                                         
Query: 163  aaggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
            |||||| ||  | |||||||| ||||| || || |||||||||||
Sbjct: 2648 aaggtgatcaacaaggttctctaatggaccttttccagtgacaat 2604



to top

>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           3C (LHCP) mRNA, partial cds
          Length = 661

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 aagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcgagg 178
           ||||||||||| || ||||| || |||||| ||||||| ||||||||||| ||||| | |
Sbjct: 658 aagttggtggcaaacgcccaggcattgttgttgacgggatcggcaaggtgatcggccaag 599

                               
Query: 179 ttctccaatgggcccttgcc 198
           ||||||| ||| ||||||||
Sbjct: 598 ttctccagtggccccttgcc 579



to top

>gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence
          Length = 827

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 84/100 (84%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| ||||||||||||||||||||||| ||||||||| | || || ||||| |
Sbjct: 630 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 571

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             ||||| || || |||||||| || ||||| ||||||||
Sbjct: 570 aatggtcagcaagattctccaacggtcccttaccagtgac 531



to top

>emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding protein
          Length = 2774

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 84/100 (84%)
 Strand = Plus / Minus

                                                                        
Query: 105  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
            |||| ||||| || |||||||||||||||||||| ||||||||| |||| || || || |
Sbjct: 2374 actttccggggacgaagttggtggcgaaggcccatgcgttgttgttgactggatcagcca 2315

                                                    
Query: 165  ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
              ||||||||||| |||||||| || ||||| || |||||
Sbjct: 2314 aatggtcggcgagattctccaacggtccctttccggtgac 2275



to top

>emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b-binding polypeptide
          Length = 2775

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 84/100 (84%)
 Strand = Plus / Minus

                                                                        
Query: 105  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
            |||| ||||| || |||||||||||||||||||| ||||||||| |||| || || || |
Sbjct: 2375 actttccggggacgaagttggtggcgaaggcccatgcgttgttgttgactggatcagcca 2316

                                                    
Query: 165  ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
              ||||||||||| |||||||| || ||||| || |||||
Sbjct: 2315 aatggtcggcgagattctccaacggtccctttccggtgac 2276



to top

>gb|K00975.1|PETCAB10 Petunia major chlorophyll a/b binding protein (Cab) clone pCab10,
           3' end and flank
          Length = 367

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 84/100 (84%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| |||||||| |||||| ||| ||| ||||||||| | || || |||||||
Sbjct: 229 actttccgggaacaaagtttgtggcgtaggaccaagcgttgttgttaactggatcggcaa 170

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
           | ||||| || |||||||||||||| ||||| || |||||
Sbjct: 169 gatggtcagcaaggttctccaatggaccctttccggtgac 130



to top

>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1)
           mRNA, complete cds
          Length = 1008

 Score = 71.9 bits (36), Expect = 7e-10
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| || |||||||| ||||||||||| || |||||| |||| || || || |
Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 802

                                                      
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
            |||||| |||||||||||||| || ||||| || ||||||||
Sbjct: 801 agtggtccgcgaggttctccaacggtccctttccggtgacaat 759



to top

>ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BINDING PROTEIN 3);
           chlorophyll binding AT1G29910 (CAB3) mRNA, complete cds
          Length = 1020

 Score = 71.9 bits (36), Expect = 7e-10
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| ||||||||||| ||||||||||| ||||||||| |||| || ||||| |
Sbjct: 855 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggcca 796

                                                      
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
             ||||| || |||||||| |  || ||||| |||||||||||
Sbjct: 795 aatggtcagcaaggttctctatcggtcccttaccagtgacaat 753



to top

>gb|AF339687.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 851

 Score = 71.9 bits (36), Expect = 7e-10
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| || |||||||| ||||||||||| || |||||| |||| || || || |
Sbjct: 799 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 740

                                                      
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
            |||||| |||||||||||||| || ||||| || ||||||||
Sbjct: 739 agtggtccgcgaggttctccaacggtccctttccggtgacaat 697



to top

>gb|AF326864.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 1019

 Score = 71.9 bits (36), Expect = 7e-10
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| || |||||||| ||||||||||| || |||||| |||| || || || |
Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 802

                                                      
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
            |||||| |||||||||||||| || ||||| || ||||||||
Sbjct: 801 agtggtccgcgaggttctccaacggtccctttccggtgacaat 759



to top

>gb|AY120776.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 1003

 Score = 71.9 bits (36), Expect = 7e-10
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| || |||||||| ||||||||||| || |||||| |||| || || || |
Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 802

                                                      
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
            |||||| |||||||||||||| || ||||| || ||||||||
Sbjct: 801 agtggtccgcgaggttctccaacggtccctttccggtgacaat 759



to top

>gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910)
           mRNA, complete cds
          Length = 870

 Score = 71.9 bits (36), Expect = 7e-10
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| ||||||||||| ||||||||||| ||||||||| |||| || ||||| |
Sbjct: 802 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggcca 743

                                                      
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
             ||||| || |||||||| |  || ||||| |||||||||||
Sbjct: 742 aatggtcagcaaggttctctatcggtcccttaccagtgacaat 700



to top

>gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910;
           F1N18.5) mRNA, complete cds
          Length = 1019

 Score = 71.9 bits (36), Expect = 7e-10
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| ||||||||||| ||||||||||| ||||||||| |||| || ||||| |
Sbjct: 855 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggcca 796

                                                      
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
             ||||| || |||||||| |  || ||||| |||||||||||
Sbjct: 795 aatggtcagcaaggttctctatcggtcccttaccagtgacaat 753



to top

>gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430/T31E10.23) mRNA, complete
           cds
          Length = 1009

 Score = 71.9 bits (36), Expect = 7e-10
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| || |||||||| ||||||||||| || |||||| |||| || || || |
Sbjct: 867 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 808

                                                      
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
            |||||| |||||||||||||| || ||||| || ||||||||
Sbjct: 807 agtggtccgcgaggttctccaacggtccctttccggtgacaat 765



to top

>emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS41ZH03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 638

 Score = 71.9 bits (36), Expect = 7e-10
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| || |||||||| ||||||||||| || |||||| |||| || || || |
Sbjct: 519 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 460

                                                      
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
            |||||| |||||||||||||| || ||||| || ||||||||
Sbjct: 459 agtggtccgcgaggttctccaacggtccctttccggtgacaat 417



to top

>gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N18 genomic sequence, complete
             sequence
          Length = 101075

 Score = 71.9 bits (36), Expect = 7e-10
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                         
Query: 105   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
             |||| ||||| ||||||||||| ||||||||||| ||||||||| |||| || ||||| |
Sbjct: 22540 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggcca 22481

                                                        
Query: 165   ggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
               ||||| || |||||||| |  || ||||| |||||||||||
Sbjct: 22480 aatggtcagcaaggttctctatcggtcccttaccagtgacaat 22438



 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 83/100 (83%)
 Strand = Plus / Minus

                                                                         
Query: 105   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
             |||| ||||| |||||||||||||| |||||||| ||||||||| |||| || ||||| |
Sbjct: 19894 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 19835

                                                     
Query: 165   ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
               ||||| || |||||||| |  || ||||| ||||||||
Sbjct: 19834 aatggtcagcaaggttctctatcggtcccttaccagtgac 19795



 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 83/100 (83%)
 Strand = Plus / Plus

                                                                         
Query: 105   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
             |||| ||||| ||||||||||||||||||||||| ||||||||| | || || ||||| |
Sbjct: 16113 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 16172

                                                     
Query: 165   ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
               ||||| || |||||||| |  || ||||| ||||||||
Sbjct: 16173 aatggtcagcaaggttctctatcggtcccttaccagtgac 16212



to top

>gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete sequence
          Length = 979

 Score = 71.9 bits (36), Expect = 7e-10
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| || |||||||| ||||||||||| || |||||| |||| || || || |
Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 802

                                                      
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
            |||||| |||||||||||||| || ||||| || ||||||||
Sbjct: 801 agtggtccgcgaggttctccaacggtccctttccggtgacaat 759



to top

>emb|X74731.1|AHLHCB A.hypochondriacus Lhcb1*Ah1 mRNA
          Length = 699

 Score = 71.9 bits (36), Expect = 7e-10
 Identities = 77/91 (84%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| ||||||||||| ||  ||||||| || |||||| | || ||||| ||||
Sbjct: 559 actttccgggtacaaagttggtagcataggcccaagcattgttgttaaccgggtcagcaa 500

                                          
Query: 165 ggtggtcggcgaggttctccaatgggccctt 195
           | ||||| || ||||||||||||||||||||
Sbjct: 499 gatggtcagcaaggttctccaatgggccctt 469



to top

>emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II type I chlorophyll a/b
            binding protein
          Length = 1301

 Score = 71.9 bits (36), Expect = 7e-10
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                        
Query: 105  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
            |||| ||||| || |||||||| ||||||||||| || |||||| |||| || || || |
Sbjct: 1099 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 1040

                                                       
Query: 165  ggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
             |||||| |||||||||||||| || ||||| || ||||||||
Sbjct: 1039 agtggtccgcgaggttctccaacggtccctttccggtgacaat 997



to top

>gb|BT002103.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 853

 Score = 71.9 bits (36), Expect = 7e-10
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| || |||||||| ||||||||||| || |||||| |||| || || || |
Sbjct: 799 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 740

                                                      
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
            |||||| |||||||||||||| || ||||| || ||||||||
Sbjct: 739 agtggtccgcgaggttctccaacggtccctttccggtgacaat 697



to top

>gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB3) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1011

 Score = 71.9 bits (36), Expect = 7e-10
 Identities = 77/91 (84%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           ||||||||||  ||||||| || ||||||||||| || |||||| | || ||||| ||||
Sbjct: 858 acttgccgggagcaaagtttgtagcgaaggcccaagcattgttgttaactgggtctgcaa 799

                                          
Query: 165 ggtggtcggcgaggttctccaatgggccctt 195
           | || || ||||||||||||||||| |||||
Sbjct: 798 gatgatcagcgaggttctccaatggaccctt 768



to top

>emb|X68333.1|HHLHC H.helix mRNA for light harvesting chlorophyll a/b binding protein
          Length = 686

 Score = 71.9 bits (36), Expect = 7e-10
 Identities = 77/91 (84%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| ||||||||||||||  ||||||| || |||||| | || || || ||||
Sbjct: 580 actttccggggacaaagttggtggcataggcccatgcattgttgtttactggatcagcaa 521

                                          
Query: 165 ggtggtcggcgaggttctccaatgggccctt 195
           | |||||||| |||||||||||||| |||||
Sbjct: 520 gatggtcggctaggttctccaatggaccctt 490



to top

>gb|M30618.1|TOMCBPD2 Tomato chlorophyll a/b-binding protein Cab-1C gene, 3' end
          Length = 351

 Score = 71.9 bits (36), Expect = 7e-10
 Identities = 77/91 (84%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| |||||||| ||||| || ||||| ||||||||| | || ||||| ||||
Sbjct: 349 actttccgggaacaaagtttgtggcaaaagcccaggcgttgttgtttactgggtctgcaa 290

                                          
Query: 165 ggtggtcggcgaggttctccaatgggccctt 195
           |||| || || |||||||||||||| |||||
Sbjct: 289 ggtgatcagcaaggttctccaatggaccctt 259



to top

>gb|M30616.1|TOMCBPC2 Tomato chlorophyll a/b-binding protein Cab-1A gene , 3' end
          Length = 351

 Score = 71.9 bits (36), Expect = 7e-10
 Identities = 77/91 (84%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| |||||||| ||||| || ||||| ||||||||| | || ||||| ||||
Sbjct: 349 actttccgggaacaaagtttgtggcaaatgcccaggcgttgttgtttacagggtctgcaa 290

                                          
Query: 165 ggtggtcggcgaggttctccaatgggccctt 195
           |||| || || |||||||||||||| |||||
Sbjct: 289 ggtgatcagcaaggttctccaatggaccctt 259



to top

>gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene Cab-3C, complete cds
          Length = 1135

 Score = 71.9 bits (36), Expect = 7e-10
 Identities = 80/95 (84%)
 Strand = Plus / Minus

                                                                       
Query: 110 ccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtgg 169
           ||||| |||||||| |||||||||||||| || |||||  |||| ||||| || || |||
Sbjct: 999 ccggggacaaagtttgtggcgaaggcccaagcattgttattgactgggtcagcgagatgg 940

                                              
Query: 170 tcggcgaggttctccaatgggcccttgccagtgac 204
           || || |||||||||||||| ||||| || |||||
Sbjct: 939 tcagcaaggttctccaatggaccctttccggtgac 905



to top

>emb|AJ843976.1| Plantago major partial mRNA for light harvesting protein 1 (lhc1
           gene)
          Length = 688

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                       
Query: 131 aaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcgaggttctccaatggg 190
           |||||||| ||||||||| | |||||||| || |||||||| || ||||||||||| |||
Sbjct: 662 aaggcccaagcgttgttgttaacggggtctgctaggtggtcagcaaggttctccaacggg 603

                         
Query: 191 cccttgccagtgac 204
           ||||| || |||||
Sbjct: 602 ccctttccggtgac 589



to top

>dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light harvesting a/b binding
           protein, complete cds
          Length = 1055

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                       
Query: 110 ccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtgg 169
           ||||| || |||||||||||| ||||||| || |||||| | ||||||||||| ||||| 
Sbjct: 892 ccggggacgaagttggtggcgtaggcccaggcattgttgttcacggggtcggccaggtga 833

                         
Query: 170 tcggcgaggttctc 183
           ||||| ||||||||
Sbjct: 832 tcggcaaggttctc 819



to top

>dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene for light-harvesting
            chlorophyll a/b-binding protein 2, complete cds
          Length = 3125

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 73/86 (84%)
 Strand = Plus / Minus

                                                                        
Query: 110  ccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtgg 169
            ||||| || |||||||||||| ||||||| |||||||||   ||||||||||| | ||||
Sbjct: 3017 ccgggaacgaagttggtggcgtaggcccatgcgttgttggcaacggggtcggccaagtgg 2958

                                      
Query: 170  tcggcgaggttctccaatgggccctt 195
            |||   | ||||||||||||||||||
Sbjct: 2957 tcgttcaagttctccaatgggccctt 2932



to top

>emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chlorophyll a/b-binding
           protein
          Length = 1126

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 107 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaagg 166
           |||||||| || ||||| |||||| | ||||| |||||||||  |||||||||||| | |
Sbjct: 824 ttgccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggcgacg 765

                                                 
Query: 167 tggtcggcgaggttctccaatgggcccttgccagtgac 204
           ||||||  ||||||||| |  ||||||||||| |||||
Sbjct: 764 tggtcgaagaggttctcgatggggcccttgccggtgac 727



to top

>emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chlorophyll a/b-binding protein
          Length = 1083

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 122 ttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcgaggttc 181
           ||||||||| ||||||| || |||||| | ||||||||||| ||||| ||||||||||||
Sbjct: 873 ttggtggcgtaggcccaggcattgttgttcacggggtcggccaggtgatcggcgaggttc 814

             
Query: 182 tc 183
           ||
Sbjct: 813 tc 812



to top

>gb|AY112240.1| Zea mays CL187_6 mRNA sequence
          Length = 770

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 107 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaagg 166
           |||||||| || ||||| |||||| | ||||| |||||||||  |||||||||||| | |
Sbjct: 472 ttgccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggcgacg 413

                                                 
Query: 167 tggtcggcgaggttctccaatgggcccttgccagtgac 204
           ||||||  ||||||||| |  ||||||||||| |||||
Sbjct: 412 tggtcgaagaggttctcgatggggcccttgccggtgac 375



to top

>gb|U21114.1|STU21114 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-5) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 73/86 (84%)
 Strand = Plus / Minus

                                                                       
Query: 110 ccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtgg 169
           ||||| |||||||| |||||  | | ||| ||||||||| | |||||||| |||||||||
Sbjct: 791 ccgggaacaaagtttgtggcataagaccaggcgttgttgttaacggggtctgcaaggtgg 732

                                     
Query: 170 tcggcgaggttctccaatgggccctt 195
           || || |||||||||||||| |||||
Sbjct: 731 tctgcaaggttctccaatggaccctt 706



to top

>gb|U21112.1|STU21112 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-3 gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 73/86 (84%)
 Strand = Plus / Minus

                                                                       
Query: 110 ccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtgg 169
           ||||| |||||||| |||||  | | ||| ||||||||| | |||||||| |||||||||
Sbjct: 791 ccggggacaaagtttgtggcataagaccaggcgttgttgttaacggggtctgcaaggtgg 732

                                     
Query: 170 tcggcgaggttctccaatgggccctt 195
           || || |||||||||||||| |||||
Sbjct: 731 tcagcaaggttctccaatggaccctt 706



to top

>gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-2) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 73/86 (84%)
 Strand = Plus / Minus

                                                                       
Query: 110 ccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtgg 169
           ||||| |||||||| ||||| |||||||| || |||||| |||| || || |||||||||
Sbjct: 791 ccgggaacaaagtttgtggcaaaggcccatgcattgttgttgactggatctgcaaggtgg 732

                                     
Query: 170 tcggcgaggttctccaatgggccctt 195
           || || || ||||||||||| |||||
Sbjct: 731 tcagcaagattctccaatggaccctt 706



to top

>dbj|AB012636.1| Nicotiana sylvestris Lhcb1*1 gene for light harvesting chlorophyll
           a/b-binding protein, complete cds
          Length = 3659

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 73/86 (84%)
 Strand = Plus / Minus

                                                                       
Query: 110 ccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtgg 169
           ||||| |||||||| |||||| | ||||| || |||||| | || ||||| |||||||||
Sbjct: 927 ccggggacaaagtttgtggcgtacgcccaagcattgttgttaactgggtctgcaaggtgg 868

                                     
Query: 170 tcggcgaggttctccaatgggccctt 195
           || || |||||||| |||||||||||
Sbjct: 867 tcagcaaggttctctaatgggccctt 842



to top

>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA,
           complete cds
          Length = 998

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 107 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaagg 166
           |||||||| || |||||||||||| ||||||| ||||||||| | |||||||| || |||
Sbjct: 860 ttgccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtcagccagg 801

                            
Query: 167 tggtcggcgaggttctc 183
           || || | |||||||||
Sbjct: 800 tgatcagtgaggttctc 784



to top

>emb|AJ538931.1|NTA538931 Nicotiana tabacum cDNA-AFLP-fragment BT21-M1-005
          Length = 332

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 155 gggtcggcaaggtggtcggcgaggttctccaatgggcccttgccagtgac 204
           ||||| |||||||||||||| |||||||||||||| ||||| ||||||||
Sbjct: 327 gggtcagcaaggtggtcggcaaggttctccaatggaccctttccagtgac 278



to top

>emb|AJ538874.1|NTA538874 Nicotiana tabacum cDNA-AFLP-fragment BT2-M23-004
          Length = 311

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 155 gggtcggcaaggtggtcggcgaggttctccaatgggcccttgccagtgac 204
           ||||| |||||||||||||| |||||||||||||| ||||| ||||||||
Sbjct: 306 gggtcagcaaggtggtcggcaaggttctccaatggaccctttccagtgac 257



to top

>emb|AJ538840.1|NTA538840 Nicotiana tabacum cDNA-AFLP-fragment BT2-M11-016
          Length = 315

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 155 gggtcggcaaggtggtcggcgaggttctccaatgggcccttgccagtgac 204
           ||||| |||||||||||||| |||||||||||||| ||||| ||||||||
Sbjct: 310 gggtcagcaaggtggtcggcaaggttctccaatggaccctttccagtgac 261



to top

>dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene for light-harvesting
            chlorophyll a/b-binding protein 1, complete cds
          Length = 1975

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 84/101 (83%)
 Strand = Plus / Minus

                                                                        
Query: 107  ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaagg 166
            |||||||| || |||||||||||| | ||||| |||||||||   |||||||| || | |
Sbjct: 1848 ttgccgggaacgaagttggtggcgtatgcccatgcgttgttggcaacggggtctgccaag 1789

                                                     
Query: 167  tggtcggcgaggttctccaatgggcccttgccagtgacaat 207
            ||||||   | ||||||||| |||||||||||||| |||||
Sbjct: 1788 tggtcgttcaagttctccaaggggcccttgccagtcacaat 1748



to top

>emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b binding protein
          Length = 1656

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 87/105 (82%)
 Strand = Plus / Minus

                                                                        
Query: 103  ttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggc 162
            |||||| ||||| |||||||| |||||  ||||||| ||||||||| | |||||||| ||
Sbjct: 1305 ttactttccggggacaaagtttgtggcataggcccaggcgttgttgttaacggggtcagc 1246

                                                         
Query: 163  aaggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
            |||||| ||  | ||||| || ||||| || || |||||||||||
Sbjct: 1245 aaggtgatcaacaaggttatctaatggaccttttccagtgacaat 1201



to top

>gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chlorophyll a/b-binding
           polypeptide (Lhcb1) mRNA, partial cds
          Length = 414

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 119 aagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcgagg 178
           |||||||||||  ||||||| ||||||||| | ||||||||||| ||||| || ||||||
Sbjct: 273 aagttggtggcataggcccaggcgttgttgttaacggggtcggccaggtgatcagcgagg 214

                
Query: 179 ttctc 183
           |||||
Sbjct: 213 ttctc 209



to top

>dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3386

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 132  aggcccacgcgttgttgntgacggggtcggcaaggtggtcggcgaggttctccaatgggc 191
            ||||||| ||||||||| | || ||||||||||||||||| || |||||||| ||||| |
Sbjct: 2225 aggcccaagcgttgttgttaactgggtcggcaaggtggtcagcaaggttctctaatggac 2166

                         
Query: 192  ccttgccagtgac 204
            |||| || |||||
Sbjct: 2165 cctttccggtgac 2153



to top

>ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BINDING PROTEIN 1);
           chlorophyll binding AT1G29930 (CAB1) mRNA, complete cds
          Length = 1044

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 83/100 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| ||||||||||||||||||||||| ||||||||| | || || ||||| |
Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 809

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             ||||| || |||||||| |  || ||||| ||||||||
Sbjct: 808 aatggtcagcaaggttctctatcggtcccttaccagtgac 769



to top

>ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding AT1G29920 (CAB2)
           mRNA, complete cds
          Length = 1176

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 83/100 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| |||||||||||||| |||||||| ||||||||| |||| || ||||| |
Sbjct: 869 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 810

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             ||||| || |||||||| |  || ||||| ||||||||
Sbjct: 809 aatggtcagcaaggttctctatcggtcccttaccagtgac 770



to top

>gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence
          Length = 762

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 83/100 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| |||||||||||||| |||||||| ||||||||| |||| || ||||| |
Sbjct: 760 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 701

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             ||||| || |||||||| |  || ||||| ||||||||
Sbjct: 700 aatggtcagcaaggttctctatcggtcccttaccagtgac 661



to top

>gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472) putative
           photosystem II type I chlorophyll a /b binding protein
           (At1g29920) mRNA, complete cds
          Length = 1044

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 83/100 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| |||||||||||||| |||||||| ||||||||| |||| || ||||| |
Sbjct: 855 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 796

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             ||||| || |||||||| |  || ||||| ||||||||
Sbjct: 795 aatggtcagcaaggttctctatcggtcccttaccagtgac 756



to top

>gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein
           (At1g29930) mRNA, complete cds
          Length = 835

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 83/100 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| ||||||||||||||||||||||| ||||||||| | || || ||||| |
Sbjct: 802 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 743

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             ||||| || |||||||| |  || ||||| ||||||||
Sbjct: 742 aatggtcagcaaggttctctatcggtcccttaccagtgac 703



to top

>gb|AY050935.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At1g29930) mRNA, complete cds
          Length = 1014

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 83/100 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| ||||||||||||||||||||||| ||||||||| | || || ||||| |
Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 809

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             ||||| || |||||||| |  || ||||| ||||||||
Sbjct: 808 aatggtcagcaaggttctctatcggtcccttaccagtgac 769



to top

>gb|AY128345.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein, putative (At1g29920) mRNA, complete cds
          Length = 994

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 83/100 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| |||||||||||||| |||||||| ||||||||| |||| || ||||| |
Sbjct: 855 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 796

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             ||||| || |||||||| |  || ||||| ||||||||
Sbjct: 795 aatggtcagcaaggttctctatcggtcccttaccagtgac 756



to top

>gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920)
           mRNA, complete cds
          Length = 898

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 83/100 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| |||||||||||||| |||||||| ||||||||| |||| || ||||| |
Sbjct: 802 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 743

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             ||||| || |||||||| |  || ||||| ||||||||
Sbjct: 742 aatggtcagcaaggttctctatcggtcccttaccagtgac 703



to top

>gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920;
           F1N18.4) mRNA, complete cds
          Length = 1007

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 83/100 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| |||||||||||||| |||||||| ||||||||| |||| || ||||| |
Sbjct: 854 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 795

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             ||||| || |||||||| |  || ||||| ||||||||
Sbjct: 794 aatggtcagcaaggttctctatcggtcccttaccagtgac 755



to top

>gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 804

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 83/100 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| |||||||||||||| |||||||| ||||||||| |||| || ||||| |
Sbjct: 802 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 743

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             ||||| || |||||||| |  || ||||| ||||||||
Sbjct: 742 aatggtcagcaaggttctctatcggtcccttaccagtgac 703



to top

>gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1019

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 83/100 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| ||||||||||||||||||||||| ||||||||| | || || ||||| |
Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 809

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             ||||| || |||||||| |  || ||||| ||||||||
Sbjct: 808 aatggtcagcaaggttctctatcggtcccttaccagtgac 769



to top

>gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1045

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 83/100 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| ||||||||||||||||||||||| ||||||||| | || || ||||| |
Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 809

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             ||||| || |||||||| |  || ||||| ||||||||
Sbjct: 808 aatggtcagcaaggttctctatcggtcccttaccagtgac 769



to top

>gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 1027

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 83/100 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| |||||||||||||| |||||||| ||||||||| |||| || ||||| |
Sbjct: 848 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 789

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             ||||| || |||||||| |  || ||||| ||||||||
Sbjct: 788 aatggtcagcaaggttctctatcggtcccttaccagtgac 749



to top

>gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 1027

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 83/100 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| |||||||||||||| |||||||| ||||||||| |||| || ||||| |
Sbjct: 854 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 795

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             ||||| || |||||||| |  || ||||| ||||||||
Sbjct: 794 aatggtcagcaaggttctctatcggtcccttaccagtgac 755



to top

>gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 999

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 83/100 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| ||||||||||||||||||||||| ||||||||| | || || ||||| |
Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 809

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             ||||| || |||||||| |  || ||||| ||||||||
Sbjct: 808 aatggtcagcaaggttctctatcggtcccttaccagtgac 769



to top

>emb|BX814964.1|CNS0AE8Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS20ZE02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 307

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 83/100 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| ||||||||||||||||||||||| ||||||||| | || || ||||| |
Sbjct: 172 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 113

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             ||||| || |||||||| |  || ||||| ||||||||
Sbjct: 112 aatggtcagcaaggttctctatcggtcccttaccagtgac 73



to top

>emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS89ZA03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 930

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 83/100 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| ||||||||||||||||||||||| ||||||||| | || || ||||| |
Sbjct: 837 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 778

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             ||||| || |||||||| |  || ||||| ||||||||
Sbjct: 777 aatggtcagcaaggttctctatcggtcccttaccagtgac 738



to top

>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence,
           complete sequence
          Length = 82053

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 83/100 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| ||||||||||||||||||||||| ||||||||| | || || ||||| |
Sbjct: 748 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 689

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             ||||| || |||||||| |  || ||||| ||||||||
Sbjct: 688 aatggtcagcaaggttctctatcggtcccttaccagtgac 649



to top

>gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete sequence
          Length = 1041

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 83/100 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| |||||||||||||| |||||||| ||||||||| |||| || ||||| |
Sbjct: 869 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 810

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             ||||| || |||||||| |  || ||||| ||||||||
Sbjct: 809 aatggtcagcaaggttctctatcggtcccttaccagtgac 770



to top

>emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophyll a/b binding protein
          Length = 1109

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 83/100 (83%)
 Strand = Plus / Minus

                                                                        
Query: 105  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
            |||| ||||| ||||||||||||||||||||||| ||||||||| | || || ||||| |
Sbjct: 1019 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 960

                                                    
Query: 165  ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
              ||||| || |||||||| |  || ||||| ||||||||
Sbjct: 959  aatggtcagcaaggttctctatcggtcccttaccagtgac 920



to top

>emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophyll a/b binding protein
          Length = 1060

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 83/100 (83%)
 Strand = Plus / Minus

                                                                        
Query: 105  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
            |||| ||||| ||||||||||| ||||||||||| ||||||||| |||| || ||||| |
Sbjct: 1008 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggcca 949

                                                    
Query: 165  ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
              ||||| || |||||||| |  || ||||| ||||||||
Sbjct: 948  aatggtcagcaaggttctctatcggtcccttaccagtgac 909



to top

>emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophyll a/b binding protein
          Length = 999

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 83/100 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| |||||||||||||| |||||||| ||||||||| |||| || ||||| |
Sbjct: 947 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 888

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             ||||| || |||||||| |  || ||||| ||||||||
Sbjct: 887 aatggtcagcaaggttctctatcggtcccttaccagtgac 848



to top

>emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/b binding protein
          Length = 1025

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 83/100 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| |||||||| |||||  | | ||| ||||||||| | || ||||| ||||
Sbjct: 857 actttccgggaacaaagttagtggcataagaccaggcgttgttgttaaccgggtcagcaa 798

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
           ||||||| || |||||||||||||| ||||| || |||||
Sbjct: 797 ggtggtcagcaaggttctccaatggaccctttccggtgac 758



to top

>gb|AF133340.1|AF133340 Phalaenopsis sp. 'KCbutterfly' putative chlorophyll a/b-binding
           protein mRNA, complete cds
          Length = 1118

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                       
Query: 116 acaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcg 175
           ||||||||||||||  | ||||| ||||| ||| | || ||||| |||||||||||||| 
Sbjct: 874 acaaagttggtggcataagcccaggcgttattgttcaccgggtcagcaaggtggtcggcc 815

                                           
Query: 176 aggttctccaatgggcccttgccagtgacaat 207
           | ||||||||  || ||||| |||||||||||
Sbjct: 814 aagttctccagcggaccctttccagtgacaat 783



to top

>gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding protein mRNA, complete cds
          Length = 1100

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 83/100 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||||||||| ||||| ||||||||| | ||||| |||||||||  |||||||||||| |
Sbjct: 837 acttgccggggacaaaattggtggcgtatgcccaggcgttgttggcgacggggtcggcga 778

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
            |||||||   | |||||| |  ||||||||||| |||||
Sbjct: 777 cgtggtcgaaaaagttctcgatggggcccttgccggtgac 738



to top

>gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab-E) gene, complete cds
          Length = 1815

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 83/100 (83%)
 Strand = Plus / Minus

                                                                        
Query: 105  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
            |||| ||||| |||||||| |||||  | | ||| ||||||||| | || ||||| ||||
Sbjct: 1777 actttccgggaacaaagttagtggcataagaccaggcgttgttgttaaccgggtcagcaa 1718

                                                    
Query: 165  ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
            ||||||| || |||||||||||||| ||||| || |||||
Sbjct: 1717 ggtggtcagcaaggttctccaatggaccctttccggtgac 1678



to top

>gb|M95068.1|MZEORFI Zea mays putative light-harvesting chlorophyll A/B binding  protein
           mRNA, partial cds
          Length = 191

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 81/98 (82%)
 Strand = Plus / Minus

                                                                       
Query: 107 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaagg 166
           |||||||| || ||||| |||||| | ||||| |||||||||  |||||||||||  | |
Sbjct: 106 ttgccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggssacg 47

                                                 
Query: 167 tggtcggcgaggttctccaatgggcccttgccagtgac 204
           ||||||  ||||||||| |  ||||||||||| |||||
Sbjct: 46  tggtcgaagaggttctcgatggggcccttgccggtgac 9



to top

>dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRNA for type II
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 989

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 83/100 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||||||||| || |||||||||||| | | ||| |||||||||  |||||||||||  |
Sbjct: 822 acttgccggggacgaagttggtggcgtatgaccaggcgttgttggcgacggggtcggtga 763

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
            |||||||  ||||||||| |  ||||||||||| |||||
Sbjct: 762 cgtggtcgaagaggttctcgatggggcccttgccggtgac 723



to top

>emb|Z13987.1|STCABPSII S.tuberosum gene for chlorophyll a/b-binding protein PS II type I
          Length = 2432

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                        
Query: 105  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
            |||| ||||| |||||||| ||||| || ||||| ||||||||| | || || || ||||
Sbjct: 1702 actttccgggaacaaagtttgtggcaaaagcccatgcgttgttgttaactggatcagcaa 1643

                                                       
Query: 165  ggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
            ||||||| || || || ||||||||||| || || ||||||||
Sbjct: 1642 ggtggtctgcaagattttccaatgggccttttccggtgacaat 1600



to top

>emb|Z75663.1|AGCHLABBP A.graveolens mRNA for chlorophyll a/b binding protein
          Length = 963

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 76/91 (83%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| |||||||| ||||| |||||||| || |||||| | || ||||| ||||
Sbjct: 835 actttccgggaacaaagttagtggcaaaggcccaggcattgttgttaacagggtctgcaa 776

                                          
Query: 165 ggtggtcggcgaggttctccaatgggccctt 195
           ||||||| || | |||||| ||||| |||||
Sbjct: 775 ggtggtcagccaagttctctaatggaccctt 745



to top

>emb|X52743.1|NTCAB21 Tabacco Cab21 mRNA for major chlorophyll a/b binding protein
          Length = 953

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| |||||||| |||||| | ||||| || |||||| | || ||||| ||||
Sbjct: 858 actttccggggacaaagtttgtggcgtatgcccaagcattgttgttaactgggtctgcaa 799

                                                      
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
           | ||||| || |||||||||||||| || || ||||| |||||
Sbjct: 798 gatggtcagcaaggttctccaatggaccttttccagtaacaat 756



to top

>emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding protein of photosystem II
          Length = 518

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| || |||||||| ||||||||||| ||||||||| |||| ||||| || |
Sbjct: 373 actttccggggacgaagttggtagcgaaggcccatgcgttgttgttgactgggtcagcca 314

                                                      
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
             || || ||||| |||||||| || ||||| || ||||||||
Sbjct: 313 aatgatcagcgagattctccaacggtccctttccggtgacaat 271



to top

>gb|J01253.1|PEACAB15 Pea major chlorophyll a/b-binding thylakoid protein (polypeptide
           15) mRNA, clone pAB96
          Length = 822

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| ||||||||||| ||  | | ||| ||||||||| | || ||||||||||
Sbjct: 686 actttccgggaacaaagttggtagcatatgaccatgcgttgttgttcactgggtcggcaa 627

                                                      
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
           | || ||||| ||||||||||| || ||||| ||||| |||||
Sbjct: 626 gatgatcggcaaggttctccaaaggaccctttccagttacaat 584



to top

>emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding protein cab 91R
          Length = 1173

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 80/97 (82%)
 Strand = Plus / Minus

                                                                        
Query: 105  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
            |||| ||||| |||||||| || ||| | | ||| ||||||||| | || ||||||||||
Sbjct: 1032 actttccggggacaaagttagttgcgtaagaccatgcgttgttgttaactgggtcggcaa 973

                                                 
Query: 165  ggtggtcggcgaggttctccaatgggcccttgccagt 201
            |||| || || ||||||||||| || ||||| |||||
Sbjct: 972  ggtgatcagcaaggttctccaaaggaccctttccagt 936



to top

>gb|AC139600.16| Medicago truncatula clone mth2-20m4, complete sequence
          Length = 124732

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 64/76 (84%)
 Strand = Plus / Plus

                                                                        
Query: 105  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
            |||| ||||| |||||||| |||||||||||||| ||||||||| | || ||||| || |
Sbjct: 8573 actttccggggacaaagtttgtggcgaaggcccaagcgttgttgttaactgggtcagcga 8632

                            
Query: 165  ggtggtcggcgaggtt 180
             |||||| || |||||
Sbjct: 8633 tgtggtcagcaaggtt 8648



to top

>emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS93ZB12 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 972

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 83/100 (83%), Gaps = 1/100 (1%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| |||||||||||||| |||||||| ||||||||| |||| || ||||| |
Sbjct: 839 actttccgggaacaaagttggtggc-aaggcccaagcgttgttgttgactggatcggcca 781

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
             ||||| || |||||||| |  || ||||| ||||||||
Sbjct: 780 aatggtcagcaaggttctctatcggtcccttaccagtgac 741



to top

>emb|X63197.1|HVLHBC H.vulgare lhbC mRNA for type III LHCII CAB precursor protein
          Length = 928

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 73/88 (82%)
 Strand = Plus / Minus

                                                                       
Query: 117 caaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcga 176
           |||| |||||||||||  |||| || || |||  ||| |||||| | |||||||||   |
Sbjct: 823 caaatttggtggcgaaaacccatgcattattggcgacagggtcgtcgaggtggtcgaaca 764

                                       
Query: 177 ggttctccaatgggcccttgccagtgac 204
           |||||||||||||||||||||| |||||
Sbjct: 763 ggttctccaatgggcccttgccggtgac 736



to top

>gb|AF162200.1|AF162200 Lactuca sativa light-harvesting chlorophyll a/b binding protein
           mRNA, complete sequence; nuclear gene for chloroplast
           product
          Length = 643

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 155 gggtcggcaaggtggtcggcgaggttctccaatgggccctt 195
           ||||| ||||||||||| ||||||||||||||||| |||||
Sbjct: 578 gggtcagcaaggtggtcagcgaggttctccaatggtccctt 538



to top

>gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 986

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 82/100 (82%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||||||||| || ||||| |||||| | ||||| |||||||||   || || || ||||
Sbjct: 847 acttgccgggaacgaagttagtggcgtaagcccaagcgttgttggcaacaggatcagcaa 788

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
            ||||||| | |||||||| | |||||||||||| |||||
Sbjct: 787 tgtggtcgactaggttctcaactgggcccttgccggtgac 748



to top

>gb|K00972.1|PETCAB146 Petunia major chlorophyll a/b binding protein (Cab) clone pCab146,
           3' end and flank
          Length = 498

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 82/100 (82%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| |||||||| || ||  ||| ||| || |||||| | || || || ||||
Sbjct: 376 actttccgggaacaaagtttgtagcataggaccatgcattgttgttaactggatcagcaa 317

                                                   
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
           |||||||||| |||||||||||||| ||||| || |||||
Sbjct: 316 ggtggtcggcaaggttctccaatggaccctttccggtgac 277



to top

>dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT10J15, TM0007,
             complete sequence
          Length = 92741

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                         
Query: 116   acaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcg 175
             ||||||||||||||  ||||||| || |||||| | || ||||| | ||||||||| || 
Sbjct: 65572 acaaagttggtggcataggcccaggcattgttgttaactgggtcagaaaggtggtctgca 65631

                                 
Query: 176   aggttctccaatgggccctt 195
             ||||||||||| || |||||
Sbjct: 65632 aggttctccaaaggcccctt 65651



to top

>dbj|AB012639.1| Nicotiana sylvestris Lhcb1*7 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3663

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 152  acggggtcggcaaggtggtcggcgaggttctccaatgggcccttgccagtgac 204
            |||||||| ||||| ||||| || |||||||||||||| ||||| ||||||||
Sbjct: 3300 acggggtctgcaagatggtcagcaaggttctccaatggaccctttccagtgac 3248



to top

>gb|M15214.1|TOMCBPH Tomato chlorophyll a/b-binding protein gene Cab-3T, complete cds
          Length = 339

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 54/63 (85%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| |||||||| ||||| ||||||||  |||||||| | || ||||||||||
Sbjct: 337 actttccgggaacaaagtttgtggcaaaggcccagacgttgttgttaactgggtcggcaa 278

              
Query: 165 ggt 167
           |||
Sbjct: 277 ggt 275



 Score = 48.1 bits (24), Expect = 0.011
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 168 ggtcggcgaggttctccaatgggcccttgccagtgacaat 207
           ||||||| |||||||||||||| ||||| || ||||||||
Sbjct: 286 ggtcggcaaggttctccaatggaccctttccggtgacaat 247



to top

>dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-binding protein
           precursor, complete cds
          Length = 964

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 54/63 (85%)
 Strand = Plus / Minus

                                                                       
Query: 110 ccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtgg 169
           ||||| || |||||||||||| ||||||| |||||||||   ||||||||||| | ||||
Sbjct: 839 ccgggaacgaagttggtggcgtaggcccaggcgttgttggcaacggggtcggccaagtgg 780

              
Query: 170 tcg 172
           |||
Sbjct: 779 tcg 777



to top

>dbj|AB006081.1| Fagus crenata mRNA for chlorophyll a/b-binding protein, complete
           cds
          Length = 1010

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 83/99 (83%), Gaps = 2/99 (2%)
 Strand = Plus / Minus

                                                                       
Query: 110 ccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtgg 169
           ||||| |||||||| |||||  | ||||| || |||||| |||| ||||| |||||||||
Sbjct: 835 ccggggacaaagtttgtggcataagcccaagcattgttggtgactgggtcagcaaggtgg 776

                                                  
Query: 170 tcggcgaggttctccaatggg-cccttgccagtgacaat 207
           || || ||||||| ||||||| ||||| ||||| |||||
Sbjct: 775 tcagcaaggttct-caatgggtccctttccagtcacaat 738



to top

>gb|DQ460158.1| Nicotiana tabacum cDNA-AFLP fragment H-N_BC4M24-157 sequence
          Length = 112

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 155 gggtcggcaaggtggtcggcgaggttctccaatgg 189
           ||||| |||||||||||||| ||||||||||||||
Sbjct: 92  gggtcagcaaggtggtcggcaaggttctccaatgg 58



to top

>gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II chlorophyll a/b binding
           protein (CABII) mRNA, partial cds
          Length = 714

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                       
Query: 107 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaagg 166
           |||||||| || |||||||||||| | ||||| |||||||||  ||||||||| || |  
Sbjct: 574 ttgccggggacgaagttggtggcgtaagcccaggcgttgttggcgacggggtcagcgaca 515

                                                 
Query: 167 tggtcggcgaggttctccaatgggcccttgccagtgac 204
           ||||||  ||||||||| |  || |||||||| |||||
Sbjct: 514 tggtcgaagaggttctcgatgggtcccttgccggtgac 477



to top

>gb|M64619.1|PEACAB66 Pea cab gene, complete cds
          Length = 1666

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                        
Query: 110  ccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtgg 169
            ||||| ||||||||||||||  | | ||| || |||||| |||| ||||| ||||| || 
Sbjct: 1512 ccgggaacaaagttggtggcatatgaccatgcattgttgttgactgggtctgcaagatga 1453

                                                  
Query: 170  tcggcgaggttctccaatgggcccttgccagtgacaat 207
            || || ||||||||||| || ||||| ||||| |||||
Sbjct: 1452 tcagcaaggttctccaaaggaccctttccagttacaat 1415



to top

>gb|K02067.1|PEACAB80 Pea (P.sativum) gene AB80 encoding major light-harvesting chlorophyll
            a/b-binding protein (polypeptide 15) complex precursor,
            complete coding sequence
          Length = 1993

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                        
Query: 110  ccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtgg 169
            ||||| ||||||||||||||  | | ||| || |||||| |||| ||||| ||||| || 
Sbjct: 1813 ccgggaacaaagttggtggcatatgaccatgcattgttgttgactgggtctgcaagatga 1754

                                                  
Query: 170  tcggcgaggttctccaatgggcccttgccagtgacaat 207
            || || ||||||||||| || ||||| ||||| |||||
Sbjct: 1753 tcagcaaggttctccaaaggaccctttccagttacaat 1716



to top

>gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting complex II protein
           (Lhcb) mRNA, complete cds; nuclear gene for chloroplast
           product
          Length = 1024

 Score = 52.0 bits (26), Expect = 7e-04
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                       
Query: 122 ttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcgaggttc 181
           ||||||||| ||||  | ||||||||| || |||||| ||| ||||||||||  ||||||
Sbjct: 775 ttggtggcgtaggcgaaggcgttgttggtgccggggttggccaggtggtcggacaggttc 716

                            
Query: 182 tccaatgggcccttgcc 198
           | ||  |||||||||||
Sbjct: 715 tgcagggggcccttgcc 699



to top

>gb|DQ124219.1| Fagus sylvatica putative chlorophyll a/b-binding protein mRNA,
           partial cds
          Length = 780

 Score = 52.0 bits (26), Expect = 7e-04
 Identities = 78/93 (83%), Gaps = 2/93 (2%)
 Strand = Plus / Minus

                                                                       
Query: 116 acaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcg 175
           |||||||| |||||  | ||||| || |||||| |||| ||||| ||||||||||| || 
Sbjct: 773 acaaagtttgtggcataagcccaggcattgttggtgactgggtcagcaaggtggtcagca 714

                                            
Query: 176 aggttctccaatggg-cccttgccagtgacaat 207
           ||||||| ||||||| ||||| ||||| |||||
Sbjct: 713 aggttct-caatgggtccctttccagtcacaat 682



to top

>gb|AF279250.1|AF279250 Vigna radiata LHCII type I chlorophyll a/b-binding protein
           (CipLhcb1*3) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 941

 Score = 52.0 bits (26), Expect = 7e-04
 Identities = 67/81 (82%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| |||||||| |||||  | ||||| || |||||| |||| ||||| ||||
Sbjct: 848 actttccggggacaaagtttgtggcatatgcccaagcattgttgttgacagggtcagcaa 789

                                
Query: 165 ggtggtcggcgaggttctcca 185
           ||||||| || ||||| ||||
Sbjct: 788 ggtggtctgcaaggttttcca 768



to top

>emb|AJ538488.1|NTA538488 Nicotiana tabacum cDNA-AFLP-fragment BC2-M23-037
          Length = 135

 Score = 52.0 bits (26), Expect = 7e-04
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 152 acggggtcggcaaggtggtcggcgaggttctcca 185
           |||||||| |||||||||||||| ||||||||||
Sbjct: 133 acggggtcagcaaggtggtcggcaaggttctcca 100



to top

>dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-4, complete cds
          Length = 988

 Score = 52.0 bits (26), Expect = 7e-04
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                       
Query: 122 ttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcgaggttc 181
           ||||||||| ||||  | ||||||||| || |||||| ||| ||||||||||  ||||||
Sbjct: 759 ttggtggcgtaggcgaaggcgttgttggtgccggggttggccaggtggtcggacaggttc 700

                            
Query: 182 tccaatgggcccttgcc 198
           | ||  |||||||||||
Sbjct: 699 tgcagggggcccttgcc 683



to top

>gb|DQ471302.1| Carya cathayensis putative chloroplast chlorophyll a/b-binding
           protein (ABC) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 993

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 167 tggtcggcgaggttctccaatgggcccttgccagtgacaat 207
           ||||| || |||||||||||||| ||||||||||| |||||
Sbjct: 740 tggtcagccaggttctccaatggtcccttgccagtcacaat 700



to top

>emb|X02360.1|PECAB22R Petunia gene for chlorophyll a/b binding protein cab 22R
          Length = 1187

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 81/100 (81%)
 Strand = Plus / Minus

                                                                        
Query: 105  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
            |||| ||||| |||||||| || ||  ||| ||| || |||||| | || || || ||||
Sbjct: 1032 actttccgggaacaaagtttgtagcataggaccatgcattgttgttaactggatcagcaa 973

                                                    
Query: 165  ggtggtcggcgaggttctccaatgggcccttgccagtgac 204
            |||| ||||| |||||||||||||| ||||| || |||||
Sbjct: 972  ggtgatcggcaaggttctccaatggaccctttccggtgac 933



to top

>gb|AY104614.1| Zea mays PCO084486 mRNA sequence
          Length = 1214

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 141 cgttgttgntgacggggtcggcaaggtggtcg 172
           |||||||| ||||||||||||| |||||||||
Sbjct: 955 cgttgttgttgacggggtcggcgaggtggtcg 924



to top

>dbj|AB236867.1| Panax ginseng cab mRNA for chlorophyll a/b binding protein,
           complete cds
          Length = 935

 Score = 48.1 bits (24), Expect = 0.011
 Identities = 83/103 (80%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| |||||||| |||||  | ||||| || ||||||   || ||||| ||||
Sbjct: 818 actttccgggtacaaagttagtggcataagcccatgcattgttggctactgggtcagcaa 759

                                                      
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
           ||||||||   |||||||| | ||||||||| || ||||||||
Sbjct: 758 ggtggtcgtaaaggttctcaattgggccctttccggtgacaat 716



to top

>emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL40ZF08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 907

 Score = 48.1 bits (24), Expect = 0.011
 Identities = 51/59 (86%), Gaps = 1/59 (1%)
 Strand = Plus / Plus

                                                                      
Query: 105 acttgccgggcacaaagttggtggcgaaggccc-acgcgttgttgntgacggggtcggc 162
           |||| ||||| ||||||||||| |||||||||| | ||||||||| |||| || |||||
Sbjct: 53  actttccgggaacaaagttggttgcgaaggccctatgcgttgttgttgactggatcggc 111



to top

>emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-binding protein
          Length = 1036

 Score = 46.1 bits (23), Expect = 0.042
 Identities = 75/90 (83%), Gaps = 2/90 (2%)
 Strand = Plus / Minus

                                                                       
Query: 119 aagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcgagg 178
           ||||||||||| |||||||| || |||||    || ||||| ||||||||||| | ||||
Sbjct: 857 aagttggtggcaaaggcccaggcattgttagccactgggtcagcaaggtggtctgagagg 798

                                         
Query: 179 ttctccaatggg-cccttgccagtgacaat 207
           |||| ||||||| ||||| ||||| |||||
Sbjct: 797 ttct-caatgggaccctttccagtaacaat 769



to top

>emb|X12980.1|GMCAB2 Soybean Cab2 gene for minor PSII LHCII chlorophyll a/b binding
            protein
          Length = 1354

 Score = 46.1 bits (23), Expect = 0.042
 Identities = 70/86 (81%)
 Strand = Plus / Minus

                                                                        
Query: 122  ttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcgaggttc 181
            ||||||||  ||||||| || |||||| | || || || |||||||||||||| | ||||
Sbjct: 1002 ttggtggcataggcccaggcattgttgtttactggatcagcaaggtggtcggccaagttc 943

                                      
Query: 182  tccaatgggcccttgccagtgacaat 207
            || || || ||||| ||||| |||||
Sbjct: 942  tctaagggtccctttccagtcacaat 917



to top

>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 980

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgac 153
           |||| ||||| || ||||||||||| |||||||| || |||||| ||||
Sbjct: 841 actttccggggacgaagttggtggcaaaggcccatgcattgttgttgac 793



to top

>gb|AF220527.1|AF220527 Euphorbia esula chlorophyll a/b binding protein precursor, mRNA,
           complete cds
          Length = 927

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 84/105 (80%)
 Strand = Plus / Minus

                                                                       
Query: 103 ttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggc 162
           |||||| ||||| || |||||||| || || ||||| || |||||| | || |||||   
Sbjct: 807 ttactttccggggacgaagttggtcgcaaaagcccaagcattgttgttaaccgggtcaaa 748

                                                        
Query: 163 aaggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
           |||||||||||| | ||| |||| ||| ||||| || ||||||||
Sbjct: 747 aaggtggtcggccaagttttccagtggcccctttccggtgacaat 703



to top

>emb|X02359.1|PECAB22L Petunia gene for chlorophyll a/b binding protein cab 22L
          Length = 1187

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 72/89 (80%)
 Strand = Plus / Minus

                                                                        
Query: 116  acaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaaggtggtcggcg 175
            |||||||| || ||| ||| ||| || |||||  |||| |||||  ||||||| || || 
Sbjct: 1021 acaaagttagtagcgtaggaccaagcattgttattgaccgggtctacaaggtgatcagca 962

                                         
Query: 176  aggttctccaatgggcccttgccagtgac 204
            ||||| |||||||||||||| || |||||
Sbjct: 961  aggttttccaatgggccctttccggtgac 933



to top

>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome
          Length = 2584158

 Score = 42.1 bits (21), Expect = 0.66
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 158    tcggcaaggtggtcggcgagg 178
              |||||||||||||||||||||
Sbjct: 459968 tcggcaaggtggtcggcgagg 459988



to top

>emb|AJ234428.1|HVU234428 Hordeum vulgare partial mRNA; clone cMWG0701.rev
          Length = 326

 Score = 42.1 bits (21), Expect = 0.66
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 aggtggtcggcgaggttctccaatgggcccttgccagtgac 204
           |||||||| ||||||||||| |  |||||||| ||||||||
Sbjct: 7   aggtggtcagcgaggttctcgagcgggcccttaccagtgac 47



to top

>dbj|D14002.1|LAUCAB Lettuce mRNA for light-harvesting chlorophyll a/b-binding protein
           (LHCP), complete cds
          Length = 905

 Score = 42.1 bits (21), Expect = 0.66
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 155 gggtcggcaaggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
           ||||| ||||||||||| || | ||||||||| || ||||| || ||||||||
Sbjct: 793 gggtcagcaaggtggtcagccaagttctccaacggcccctttcctgtgacaat 741



to top

>gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 1042

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 82/103 (79%)
 Strand = Plus / Minus

                                                                       
Query: 105 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgntgacggggtcggcaa 164
           |||| ||||| || |||||||| || |||||||| || |||||| | || || || || |
Sbjct: 874 actttccgggaacgaagttggtagcaaaggcccatgcattgttgttaactggatcagcca 815

                                                      
Query: 165 ggtggtcggcgaggttctccaatgggcccttgccagtgacaat 207
             ||||| || || |||||||| || ||||| |||||||||||
Sbjct: 814 aatggtcagcaagattctccaaaggtcccttaccagtgacaat 772



to top

>emb|AL939127.1|SCO939127 Streptomyces coelicolor A3(2) complete genome; segment 24/29
          Length = 290850

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 159    cggcaaggtggtcggcgagg 178
              ||||||||||||||||||||
Sbjct: 288986 cggcaaggtggtcggcgagg 288967



to top

>gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 152 acggggtcggcaaggtggtcggcgaggttctc 183
           ||||||||||| ||||| || |||||||||||
Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctc 738



to top

>gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 759

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 152 acggggtcggcaaggtggtcggcgaggttctc 183
           ||||||||||| ||||| || |||||||||||
Sbjct: 758 acggggtcggcgaggtgatcagcgaggttctc 727



to top

>gb|AY617093.1| Pinus remota chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 152 acggggtcggcaaggtggtcggcgaggttctc 183
           ||||||||||| ||||| || |||||||||||
Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctc 738



to top

>gb|AY617092.1| Pinus monophylla chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 152 acggggtcggcaaggtggtcggcgaggttctc 183
           ||||||||||| ||||| || |||||||||||
Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctc 738



to top

>gb|AY617091.1| Pinus strobus chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 152 acggggtcggcaaggtggtcggcgaggttctc 183
           ||||||||||| ||||| || |||||||||||
Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctc 738



to top

>gb|AY617090.1| Pinus monticola chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 152 acggggtcggcaaggtggtcggcgaggttctc 183
           ||||||||||| ||||| || |||||||||||
Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctc 738



to top

>gb|AY617089.1| Pinus lambertiana chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 152 acggggtcggcaaggtggtcggcgaggttctc 183
           ||||||||||| ||||| || |||||||||||
Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctc 738



to top

>gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 152 acggggtcggcaaggtggtcggcgaggttctc 183
           ||||||||||| ||||| || |||||||||||
Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctc 738



to top

>gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 152 acggggtcggcaaggtggtcggcgaggttctc 183
           ||||||||||| ||||| || |||||||||||
Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctc 738


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,175,145
Number of Sequences: 3902068
Number of extensions: 1175145
Number of successful extensions: 58523
Number of sequences better than 10.0: 258
Number of HSP's better than 10.0 without gapping: 255
Number of HSP's successfully gapped in prelim test: 4
Number of HSP's that attempted gapping in prelim test: 57979
Number of HSP's gapped (non-prelim): 547
length of query: 207
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 185
effective length of database: 17,147,199,772
effective search space: 3172231957820
effective search space used: 3172231957820
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top