| Clone Name | rbaal38n01 |
|---|---|
| Clone Library Name | barley_pub |
>gb|BT016784.1| Zea mays clone Contig617 mRNA sequence Length = 1616 Score = 95.6 bits (48), Expect = 8e-17 Identities = 97/114 (85%) Strand = Plus / Minus Query: 207 gaaggagaccttgatgccgagcagggccatgagctgggccacgaactccgggtgcgcggn 266 |||||| ||||||| |||||||| ||||||||||||| ||||||||| ||||| | | Sbjct: 1285 gaaggaaaccttgacgccgagcaacgccatgagctgggacacgaactctgggtggcctgg 1226 Query: 267 ccacgccgcgcccgtcaccaggttgccgtcngtgaagcaacggtggatcgggtc 320 ||| || ||||| ||||| |||||||| || |||||||| |||||||||||||| Sbjct: 1225 ccaggctgcgccggtcacaaggttgccatcggtgaagcagcggtggatcgggtc 1172
>gb|AY104354.1| Zea mays PCO108571 mRNA sequence Length = 1633 Score = 95.6 bits (48), Expect = 8e-17 Identities = 97/114 (85%) Strand = Plus / Minus Query: 207 gaaggagaccttgatgccgagcagggccatgagctgggccacgaactccgggtgcgcggn 266 |||||| ||||||| |||||||| ||||||||||||| ||||||||| ||||| | | Sbjct: 1259 gaaggaaaccttgacgccgagcaacgccatgagctgggacacgaactctgggtggcctgg 1200 Query: 267 ccacgccgcgcccgtcaccaggttgccgtcngtgaagcaacggtggatcgggtc 320 ||| || ||||| ||||| |||||||| || |||||||| |||||||||||||| Sbjct: 1199 ccaggctgcgccggtcacaaggttgccatcggtgaagcagcggtggatcgggtc 1146
>ref|XM_474305.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1164 Score = 91.7 bits (46), Expect = 1e-15 Identities = 89/104 (85%) Strand = Plus / Minus Query: 207 gaaggagaccttgatgccgagcagggccatgagctgggccacgaactccgggtgcgcggn 266 |||||||||||||||||| |||| ||||||||||||| | |||||||||||| | | Sbjct: 1161 gaaggagaccttgatgccaagcaatgccatgagctgggagatgaactccgggtggccagg 1102 Query: 267 ccacgccgcgcccgtcaccaggttgccgtcngtgaagcaacggt 310 ||| |||||||| ||||| ||||||||||| |||||||| |||| Sbjct: 1101 ccatgccgcgccggtcacaaggttgccgtcggtgaagcagcggt 1058
>emb|AL606652.4| Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0004A17, complete sequence Length = 159894 Score = 91.7 bits (46), Expect = 1e-15 Identities = 89/104 (85%) Strand = Plus / Plus Query: 207 gaaggagaccttgatgccgagcagggccatgagctgggccacgaactccgggtgcgcggn 266 |||||||||||||||||| |||| ||||||||||||| | |||||||||||| | | Sbjct: 26311 gaaggagaccttgatgccaagcaatgccatgagctgggagatgaactccgggtggccagg 26370 Query: 267 ccacgccgcgcccgtcaccaggttgccgtcngtgaagcaacggt 310 ||| |||||||| ||||| ||||||||||| |||||||| |||| Sbjct: 26371 ccatgccgcgccggtcacaaggttgccgtcggtgaagcagcggt 26414
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 91.7 bits (46), Expect = 1e-15 Identities = 89/104 (85%) Strand = Plus / Plus Query: 207 gaaggagaccttgatgccgagcagggccatgagctgggccacgaactccgggtgcgcggn 266 |||||||||||||||||| |||| ||||||||||||| | |||||||||||| | | Sbjct: 34301908 gaaggagaccttgatgccaagcaatgccatgagctgggagatgaactccgggtggccagg 34301967 Query: 267 ccacgccgcgcccgtcaccaggttgccgtcngtgaagcaacggt 310 ||| |||||||| ||||| ||||||||||| |||||||| |||| Sbjct: 34301968 ccatgccgcgccggtcacaaggttgccgtcggtgaagcagcggt 34302011
>gb|DQ351282.1| Oryza rufipogon unknown gene Length = 14907 Score = 91.7 bits (46), Expect = 1e-15 Identities = 89/104 (85%) Strand = Plus / Plus Query: 207 gaaggagaccttgatgccgagcagggccatgagctgggccacgaactccgggtgcgcggn 266 |||||||||||||||||| |||| ||||||||||||| | |||||||||||| | | Sbjct: 9500 gaaggagaccttgatgccaagcaatgccatgagctgggagatgaactccgggtggccagg 9559 Query: 267 ccacgccgcgcccgtcaccaggttgccgtcngtgaagcaacggt 310 ||| |||||||| ||||| ||||||||||| |||||||| |||| Sbjct: 9560 ccatgccgcgccggtcacaaggttgccgtcggtgaagcagcggt 9603
>dbj|AK100753.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023118M23, full insert sequence Length = 1368 Score = 91.7 bits (46), Expect = 1e-15 Identities = 89/104 (85%) Strand = Plus / Minus Query: 207 gaaggagaccttgatgccgagcagggccatgagctgggccacgaactccgggtgcgcggn 266 |||||||||||||||||| |||| ||||||||||||| | |||||||||||| | | Sbjct: 1221 gaaggagaccttgatgccaagcaatgccatgagctgggagatgaactccgggtggccagg 1162 Query: 267 ccacgccgcgcccgtcaccaggttgccgtcngtgaagcaacggt 310 ||| |||||||| ||||| ||||||||||| |||||||| |||| Sbjct: 1161 ccatgccgcgccggtcacaaggttgccgtcggtgaagcagcggt 1118
>emb|AL732356.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0624F09, complete sequence Length = 95419 Score = 91.7 bits (46), Expect = 1e-15 Identities = 89/104 (85%) Strand = Plus / Plus Query: 207 gaaggagaccttgatgccgagcagggccatgagctgggccacgaactccgggtgcgcggn 266 |||||||||||||||||| |||| ||||||||||||| | |||||||||||| | | Sbjct: 74231 gaaggagaccttgatgcctagcaatgccatgagctgggagatgaactccgggtggccagg 74290 Query: 267 ccacgccgcgcccgtcaccaggttgccgtcngtgaagcaacggt 310 ||| |||||||| ||||| ||||||||||| |||||||| |||| Sbjct: 74291 ccatgccgcgccggtcacaaggttgccgtcggtgaagcagcggt 74334
>ref|XM_368328.1| Magnaporthe grisea 70-15 chromosome VI predicted protein (MG00916.4) partial mRNA Length = 378 Score = 44.1 bits (22), Expect = 0.27 Identities = 22/22 (100%) Strand = Plus / Minus Query: 224 cgagcagggccatgagctgggc 245 |||||||||||||||||||||| Sbjct: 40 cgagcagggccatgagctgggc 19
>gb|AC162528.5| Mus musculus BAC clone RP23-4P1 from chromosome 5, complete sequence Length = 219218 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 228 cagggccatgagctgggcca 247 |||||||||||||||||||| Sbjct: 123528 cagggccatgagctgggcca 123509
>gb|AC151577.2| Mus musculus BAC clone RP23-371D23 from chromosome 5, complete sequence Length = 206735 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 228 cagggccatgagctgggcca 247 |||||||||||||||||||| Sbjct: 149931 cagggccatgagctgggcca 149950
>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence Length = 3181762 Score = 40.1 bits (20), Expect = 4.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 269 acgccgcgcccgtcaccaggttgc 292 |||||||||||||||| ||||||| Sbjct: 2199666 acgccgcgcccgtcacgaggttgc 2199643
>emb|BX640415.1| Bordetella pertussis strain Tohama I, complete genome; segment 5/12 Length = 347071 Score = 40.1 bits (20), Expect = 4.2 Identities = 37/43 (86%) Strand = Plus / Minus Query: 254 ccgggtgcgcggnccacgccgcgcccgtcaccaggttgccgtc 296 |||| ||||||| |||||||| | | || |||||||||||||| Sbjct: 229168 ccggatgcgcgggccacgccggggcggtgaccaggttgccgtc 229126
>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence Length = 3173005 Score = 40.1 bits (20), Expect = 4.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 269 acgccgcgcccgtcaccaggttgc 292 |||||||||||||||| ||||||| Sbjct: 361289 acgccgcgcccgtcacgaggttgc 361266
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome Length = 5513844 Score = 40.1 bits (20), Expect = 4.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 224 cgagcagggccatgagctgggcca 247 ||||||||||| |||||||||||| Sbjct: 206260 cgagcagggccttgagctgggcca 206283
>gb|AC026443.4| Homo sapiens chromosome 5 clone CTD-2296H22, complete sequence Length = 118562 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 gttgcatctgtgttgtatat 166 |||||||||||||||||||| Sbjct: 42582 gttgcatctgtgttgtatat 42563
>gb|AY129331.1| Mycobacteriophage CJW1, complete genome Length = 75931 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 236 tgagctgggccacgaactcc 255 |||||||||||||||||||| Sbjct: 28815 tgagctgggccacgaactcc 28796
>dbj|AK019523.1| Mus musculus 0 day neonate head cDNA, RIKEN full-length enriched library, clone:4833439F03 product:unclassifiable, full insert sequence Length = 2472 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 228 cagggccatgagctgggcca 247 |||||||||||||||||||| Sbjct: 1144 cagggccatgagctgggcca 1125
>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence Length = 2325379 Score = 40.1 bits (20), Expect = 4.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 269 acgccgcgcccgtcaccaggttgc 292 |||||||||||||||| ||||||| Sbjct: 1626998 acgccgcgcccgtcacgaggttgc 1627021
>gb|AF377927.1|AF377927 Sclerotinia sclerotiorum clone 113-4 microsatellite sequence Length = 394 Score = 40.1 bits (20), Expect = 4.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 155 tgtgttgtatatcatgtgatgaaa 178 ||||||||||||||||||| |||| Sbjct: 238 tgtgttgtatatcatgtgaagaaa 215
>emb|BX465227.3| Zebrafish DNA sequence from clone RP71-40K24 in linkage group 17, complete sequence Length = 161395 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 144 tatgttgcatctgtgttgta 163 |||||||||||||||||||| Sbjct: 93637 tatgttgcatctgtgttgta 93656 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,867,101 Number of Sequences: 3902068 Number of extensions: 1867101 Number of successful extensions: 37109 Number of sequences better than 10.0: 21 Number of HSP's better than 10.0 without gapping: 21 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 36931 Number of HSP's gapped (non-prelim): 178 length of query: 322 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 300 effective length of database: 17,147,199,772 effective search space: 5144159931600 effective search space used: 5144159931600 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)