>emb|CT571256.7| Mouse DNA sequence from clone RP24-135B13 on chromosome 13, complete
              sequence
          Length = 183340

 Score = 42.1 bits (21), Expect = 0.68
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 107    taaaaatacagaaaagaaata 127
              |||||||||||||||||||||
Sbjct: 170520 taaaaatacagaaaagaaata 170540

>gb|AE001387.1| Plasmodium falciparum 3D7 chromosome 2 section 24 of 73 of the
           complete sequence
          Length = 15540

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 109 aaaatacagaaaagaaatac 128
           ||||||||||||||||||||
Sbjct: 540 aaaatacagaaaagaaatac 521

>gb|AC117570.11| Mus musculus chromosome 9, clone RP23-18M12, complete sequence
          Length = 238598

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 66     attttcttcccagtcttttg 85
              ||||||||||||||||||||
Sbjct: 182688 attttcttcccagtcttttg 182707

>gb|AC008558.7|AC008558 Homo sapiens chromosome 5 clone CTC-531G16, complete sequence
          Length = 210532

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 62     tgccattttcttcccagtct 81
              ||||||||||||||||||||
Sbjct: 117297 tgccattttcttcccagtct 117316

>gb|AC112907.7| Homo sapiens 3 BAC RP11-573D15 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 132875

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 106   gtaaaaatacagaaaagaaa 125
             ||||||||||||||||||||
Sbjct: 28394 gtaaaaatacagaaaagaaa 28413


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,642,239
Number of Sequences: 3902068
Number of extensions: 1642239
Number of successful extensions: 146495
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 146479
Number of HSP's gapped (non-prelim): 16
length of query: 212
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 190
effective length of database: 17,147,199,772
effective search space: 3257967956680
effective search space used: 3257967956680
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)