ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal38j10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC154910.3| Mus musculus BAC clone RP23-70L9 from chromosome ... 40 1.3
2gb|AC092248.1|AC092248 Drosophila melanogaster, chromosome 2L, r... 40 1.3
3gb|AC092227.1|AC092227 Drosophila melanogaster, chromosome 2L, r... 40 1.3
4gb|AC068466.4| Homo sapiens chromosome 8, clone RP11-370A22, com... 40 1.3
5gb|AE003643.3| Drosophila melanogaster chromosome 2L, section 52... 40 1.3
6gb|AC137155.3| Mus musculus BAC clone RP23-66E11 from 12, comple... 40 1.3
7gb|AC125018.15| Mus musculus chromosome 7, clone RP24-158A20, co... 38 5.3
8gb|AC111130.17| Mus musculus chromosome 5, clone RP23-339G19, co... 38 5.3
9gb|AC149571.3| Rhinolophus ferrumequinum clone VMRC7-305L23, com... 38 5.3
10emb|AL359389.15| Human DNA sequence from clone RP11-40E20 on chr... 38 5.3
11gb|AC018946.12| Homo sapiens chromosome 15, clone RP11-154B12, c... 38 5.3
12gb|DP000033.1| Carollia perspicillata target 116 genomic scaffold 38 5.3
13gb|DP000028.1| Rhinolophus ferrumequinum target 1 genomic scaffold 38 5.3
14gb|AC091167.19| Homo sapiens chromosome 15, clone RP11-697E2, co... 38 5.3
15gb|AC131677.5| Mus musculus BAC clone RP23-330O8 from chromosome... 38 5.3

>gb|AC154910.3| Mus musculus BAC clone RP23-70L9 from chromosome 12, complete sequence
          Length = 243671

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 38    aaattctaccacacactcca 57
             ||||||||||||||||||||
Sbjct: 91689 aaattctaccacacactcca 91670



to top

>gb|AC092248.1|AC092248 Drosophila melanogaster, chromosome 2L, region 35X-35X, BAC clone
            BACR37K07, complete sequence
          Length = 157722

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 63   tagatacagatcgataaaat 82
            ||||||||||||||||||||
Sbjct: 1675 tagatacagatcgataaaat 1656



to top

>gb|AC092227.1|AC092227 Drosophila melanogaster, chromosome 2L, region 35X-35X, BAC clone
             BACR20P10, complete sequence
          Length = 157482

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 63    tagatacagatcgataaaat 82
             ||||||||||||||||||||
Sbjct: 50472 tagatacagatcgataaaat 50491



to top

>gb|AC068466.4| Homo sapiens chromosome 8, clone RP11-370A22, complete sequence
          Length = 179597

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 25     ccagaaaccagataaattct 44
              ||||||||||||||||||||
Sbjct: 139066 ccagaaaccagataaattct 139085



to top

>gb|AE003643.3| Drosophila melanogaster chromosome 2L, section 52 of 83 of the
            complete sequence
          Length = 236144

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 63   tagatacagatcgataaaat 82
            ||||||||||||||||||||
Sbjct: 9018 tagatacagatcgataaaat 8999



to top

>gb|AC137155.3| Mus musculus BAC clone RP23-66E11 from 12, complete sequence
          Length = 211064

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 38     aaattctaccacacactcca 57
              ||||||||||||||||||||
Sbjct: 180354 aaattctaccacacactcca 180335



to top

>gb|AC125018.15| Mus musculus chromosome 7, clone RP24-158A20, complete sequence
          Length = 162317

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 45    accacacactccaactcat 63
             |||||||||||||||||||
Sbjct: 59593 accacacactccaactcat 59575



to top

>gb|AC111130.17| Mus musculus chromosome 5, clone RP23-339G19, complete sequence
          Length = 212923

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 54    tccaactcatagatacaga 72
             |||||||||||||||||||
Sbjct: 83315 tccaactcatagatacaga 83333



to top

>gb|AC149571.3| Rhinolophus ferrumequinum clone VMRC7-305L23, complete sequence
          Length = 190426

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 50    acactccaactcatagatacaga 72
             |||||| ||||||||||||||||
Sbjct: 20411 acactctaactcatagatacaga 20389



to top

>emb|AL359389.15| Human DNA sequence from clone RP11-40E20 on chromosome 6 Contains the
            RU2 gene (RU2S), complete sequence
          Length = 84411

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 75   gataaaatgtgaattacag 93
            |||||||||||||||||||
Sbjct: 7522 gataaaatgtgaattacag 7540



to top

>gb|AC018946.12| Homo sapiens chromosome 15, clone RP11-154B12, complete sequence
          Length = 173701

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 36     ataaattctaccacacact 54
              |||||||||||||||||||
Sbjct: 164658 ataaattctaccacacact 164676



to top

>gb|DP000033.1| Carollia perspicillata target 116 genomic scaffold
          Length = 347743

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 55    ccaactcatagatacagat 73
             |||||||||||||||||||
Sbjct: 33706 ccaactcatagatacagat 33724



to top

>gb|DP000028.1| Rhinolophus ferrumequinum target 1 genomic scaffold
          Length = 1756392

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 50     acactccaactcatagatacaga 72
              |||||| ||||||||||||||||
Sbjct: 636255 acactctaactcatagatacaga 636233



to top

>gb|AC091167.19| Homo sapiens chromosome 15, clone RP11-697E2, complete sequence
          Length = 202381

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 36   ataaattctaccacacact 54
            |||||||||||||||||||
Sbjct: 6391 ataaattctaccacacact 6409



to top

>gb|AC131677.5| Mus musculus BAC clone RP23-330O8 from chromosome 10, complete sequence
          Length = 224587

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 44     taccacacactccaactca 62
              |||||||||||||||||||
Sbjct: 134884 taccacacactccaactca 134866


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 877,652
Number of Sequences: 3902068
Number of extensions: 877652
Number of successful extensions: 58061
Number of sequences better than 10.0: 15
Number of HSP's better than 10.0 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 58005
Number of HSP's gapped (non-prelim): 56
length of query: 116
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 95
effective length of database: 17,151,101,840
effective search space: 1629354674800
effective search space used: 1629354674800
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top