| Clone Name | rbaal38g13 |
|---|---|
| Clone Library Name | barley_pub |
| No. | Definition | Score (bits) |
E Value |
1 | emb|AL121590.11|HSJ167O22 Human DNA sequence from clone RP1-167O... | 40 | 1.2 | 2 | gb|AC009779.18| Homo sapiens 12 BAC RP11-644F5 (Roswell Park Can... | 40 | 1.2 |
|---|
>emb|AL121590.11|HSJ167O22 Human DNA sequence from clone RP1-167O22 on chromosome 20 Contains ESTs, STSs and GSSs, complete sequence Length = 74974 Score = 40.1 bits (20), Expect = 1.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 48 aacatcatttatttagttta 67 |||||||||||||||||||| Sbjct: 36991 aacatcatttatttagttta 36972
>gb|AC009779.18| Homo sapiens 12 BAC RP11-644F5 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 192550 Score = 40.1 bits (20), Expect = 1.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 48 aacatcatttatttagttta 67 |||||||||||||||||||| Sbjct: 119176 aacatcatttatttagttta 119195 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 540,011 Number of Sequences: 3902068 Number of extensions: 540011 Number of successful extensions: 42205 Number of sequences better than 10.0: 2 Number of HSP's better than 10.0 without gapping: 2 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 42203 Number of HSP's gapped (non-prelim): 2 length of query: 103 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 82 effective length of database: 17,151,101,840 effective search space: 1406390350880 effective search space used: 1406390350880 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)