ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal37p22
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.054
2dbj|AP005566.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.054
3ref|XM_636411.1| Dictyostelium discoideum hypothetical protein (... 42 0.84
4ref|XM_673664.1| Plasmodium berghei strain ANKA hypothetical pro... 42 0.84
5emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, ... 42 0.84
6emb|AL035522.1|ATT12J5 Arabidopsis thaliana DNA chromosome 4, BA... 42 0.84
7emb|AL022023.1|ATM4E13 Arabidopsis thaliana DNA chromosome 4, BA... 42 0.84
8dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 42 0.84
9dbj|AP003714.2| Oryza sativa (japonica cultivar-group) genomic D... 42 0.84
10dbj|AB025636.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 42 0.84
11dbj|AK107513.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 0.84
12gb|AF096371.1|T2L5 Arabidopsis thaliana BAC T2L5 42 0.84
13gb|AF058826.1|AF058826 Arabidopsis thaliana BAC T26D22 42 0.84
14ref|NM_180624.1| Arabidopsis thaliana RKF1 (RECEPTOR-LIKE KINASE... 40 3.3
15ref|NM_202977.1| Arabidopsis thaliana unknown protein AT4G38360 ... 40 3.3
16ref|NM_119998.1| Arabidopsis thaliana unknown protein AT4G38360 ... 40 3.3
17ref|NM_124403.1| Arabidopsis thaliana PIMT2 (PROTEIN-L-ISOASPART... 40 3.3
18ref|XM_637996.1| Dictyostelium discoideum hypothetical protein (... 40 3.3
19ref|XM_508298.1| PREDICTED: Pan troglodytes similar to Proteasom... 40 3.3
20gb|AY023439.1| Oryza sativa microsatellite MRG5764 containing (T... 40 3.3
21gb|AY496702.1| Arabidopsis thaliana L-isoaspartyl methyltransfer... 40 3.3
22gb|AY632359.1| Gossypium hirsutum BAC 155C17, complete sequence 40 3.3
23ref|NM_148976.1| Homo sapiens proteasome (prosome, macropain) su... 40 3.3
24ref|NM_002786.2| Homo sapiens proteasome (prosome, macropain) su... 40 3.3
25gb|AC126046.3| Mus musculus BAC clone RP23-176P24 from chromosom... 40 3.3
26ref|XM_824337.1| Trypanosoma brucei TREU927 receptor-type adenyl... 40 3.3
27emb|CR932101.1|CNS0KY7M Paramecium tetraurelia centrin-related p... 40 3.3
28gb|AC121793.3| Mus musculus BAC clone RP23-407B23 from chromosom... 40 3.3
29ref|XM_883667.1| Candida albicans SC5314 hypothetical protein (C... 40 3.3
30ref|XM_707396.1| Candida albicans SC5314 hypothetical protein (C... 40 3.3
31gb|AC121783.2| Mus musculus BAC clone RP23-370I9 from 18, comple... 40 3.3
32emb|Z93022.1|HS60N8 Human DNA sequence from clone RP1-60N8 on ch... 40 3.3
33emb|AL603844.7| Human DNA sequence from clone RP11-541I21 on chr... 40 3.3
34emb|AL356423.15| Human DNA sequence from clone RP11-295B17 on ch... 40 3.3
35emb|AL354675.20| Human DNA sequence from clone RP11-217F15 on ch... 40 3.3
36emb|AL121722.9|HSJ788L20 Human DNA sequence from clone RP4-788L2... 40 3.3
37gb|AY091006.1| Arabidopsis thaliana putative receptor serine/thr... 40 3.3
38emb|X61969.1|HSMPNU H.sapiens mRNA for macropain subunit nu 40 3.3
39gb|AY046005.1| Arabidopsis thaliana unknown protein (At4g38360) ... 40 3.3
40gb|BC022372.1| Homo sapiens proteasome (prosome, macropain) subu... 40 3.3
41gb|BC009576.1| Homo sapiens proteasome (prosome, macropain) subu... 40 3.3
42gb|BC015105.1| Homo sapiens proteasome (prosome, macropain) subu... 40 3.3
43gb|BC015356.1| Homo sapiens proteasome (prosome, macropain) subu... 40 3.3
44gb|BC002577.2| Homo sapiens proteasome (prosome, macropain) subu... 40 3.3
45gb|BC008472.1| Homo sapiens proteasome (prosome, macropain) subu... 40 3.3
46emb|AL161593.2|ATCHRIV89 Arabidopsis thaliana DNA chromosome 4, ... 40 3.3
47emb|AL035539.1|ATF22I13 Arabidopsis thaliana DNA chromosome 4, B... 40 3.3
48gb|BC005932.1| Homo sapiens proteasome (prosome, macropain) subu... 40 3.3
49emb|BX927395.18| Zebrafish DNA sequence from clone CH211-72A16 i... 40 3.3
50gb|BT008064.1| Synthetic construct Homo sapiens proteasome (pros... 40 3.3
51gb|BT006647.1| Homo sapiens proteasome (prosome, macropain) subu... 40 3.3
52emb|BX682553.8| Zebrafish DNA sequence from clone DKEY-163K10 in... 40 3.3
53gb|AC023741.4| Drosophila melanogaster X BAC RP98-23O9 (Roswell ... 40 3.3
54gb|AC161107.24| Medicago truncatula clone mth2-192o12, complete ... 40 3.3
55emb|CR623849.1| full-length cDNA clone CS0DA006YP22 of Neuroblas... 40 3.3
56emb|CR620774.1| full-length cDNA clone CS0DI030YJ03 of Placenta ... 40 3.3
57emb|CR617103.1| full-length cDNA clone CS0DI052YO22 of Placenta ... 40 3.3
58emb|CR612800.1| full-length cDNA clone CS0DA012YD16 of Neuroblas... 40 3.3
59emb|CR610121.1| full-length cDNA clone CS0DI083YG05 of Placenta ... 40 3.3
60emb|CR607472.1| full-length cDNA clone CS0DB001YP20 of Neuroblas... 40 3.3
61emb|CR607412.1| full-length cDNA clone CS0DE014YI10 of Placenta ... 40 3.3
62gb|AC135316.15| Medicago truncatula clone mth2-20l8, complete se... 40 3.3
63emb|CR599736.1| full-length cDNA clone CS0DK007YL19 of HeLa cell... 40 3.3
64emb|CR599649.1| full-length cDNA clone CS0DI069YC24 of Placenta ... 40 3.3
65emb|CR598938.1| full-length cDNA clone CS0DI075YJ10 of Placenta ... 40 3.3
66emb|CR597642.1| full-length cDNA clone CL0BB027ZF05 of Neuroblas... 40 3.3
67gb|AC104627.8| Drosophila melanogaster X BAC RP98-4A11 (Roswell ... 40 3.3
68dbj|AP007215.1| Homo sapiens genomic DNA, chromosome 11 clone:CM... 40 3.3
69dbj|AB179294.1| Macaca fascicularis testis cDNA clone: QtsA-1693... 40 3.3
70dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 40 3.3
71gb|AC018523.9|AC018523 Homo sapiens chromosome , clone RP11-140L... 40 3.3
72dbj|AP006345.4| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 3.3
73emb|BX827801.1|CNS0A2X8 Arabidopsis thaliana Full-length cDNA Co... 40 3.3
74emb|BX841987.1|CNS09Y5I Arabidopsis thaliana Full-length cDNA Co... 40 3.3
75gb|AC115606.2| Dictyostelium discoideum chromosome 2 map 159760-... 40 3.3
76emb|BX005056.7| Zebrafish DNA sequence from clone CH211-77A11 in... 40 3.3
77gb|AC090826.15| Homo sapiens chromosome 15, clone CTD-2311M21, c... 40 3.3
78gb|AC084149.5| Homo sapiens BAC clone RP11-221F12 from 2, comple... 40 3.3
79gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N... 40 3.3
80gb|AC069558.5|AC069558 Genomic Sequence For Arabidopsis thaliana... 40 3.3
81dbj|AP004729.3| Oryza sativa (japonica cultivar-group) genomic D... 40 3.3
82gb|AY892634.1| Synthetic construct Homo sapiens clone FLH015536.... 40 3.3
83gb|AY890152.1| Synthetic construct Homo sapiens clone FLH015541.... 40 3.3
84gb|AY890151.1| Synthetic construct Homo sapiens clone FLH015540.... 40 3.3
85emb|AL808104.14| Mouse DNA sequence from clone RP23-30M20 on chr... 40 3.3
86dbj|AK118104.1| Arabidopsis thaliana At5g50240 mRNA for unknown ... 40 3.3
87dbj|AB024031.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 3.3
88dbj|AK130723.1| Homo sapiens cDNA FLJ27213 fis, clone SYN03652 40 3.3
89emb|BX088720.8| Zebrafish DNA sequence from clone CH211-195M2 in... 40 3.3
90gb|AE003490.3| Drosophila melanogaster chromosome X, section 42 ... 40 3.3
91emb|AL935204.10| Zebrafish DNA sequence from clone CH211-230K10,... 40 3.3
92dbj|D00759.1|HUMPSC2 Homo sapiens mRNA for proteasome subunit C2... 40 3.3
93gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 40 3.3
94emb|AL928780.5|CNS08CCA Oryza sativa chromosome 12, . BAC OSJNBa... 40 3.3
95emb|AL731887.5|CNS08C8R Oryza sativa chromosome 12, . BAC OJ1559... 40 3.3
96emb|AL831809.3|CNS08CAM Oryza sativa chromosome 12, . BAC OJ1268... 40 3.3
97dbj|AP006852.1| Candida albicans genomic DNA, chromosome 7, comp... 40 3.3
98dbj|AP006083.1| Lotus japonicus genomic DNA, chromosome 3, clone... 40 3.3
99emb|AL953895.8| Zebrafish DNA sequence from clone CH211-231M14 i... 40 3.3
100gb|M64992.1|HUMPROS30 Human prosomal protein P30-33K (pros-30) m... 40 3.3
101emb|AL627087.11| Mouse DNA sequence from clone RP23-243K17 on ch... 40 3.3
102dbj|AB000302.1| Fagopyrum callianthum chloroplast rbcL and accD ... 40 3.3 
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 46.1 bits (23), Expect = 0.054
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                           
Query: 212      atggccctgaaggcctggatggtgccc 238
                ||||||||||||||||||||| |||||
Sbjct: 10130094 atggccctgaaggcctggatgctgccc 10130120
to top
>dbj|AP005566.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OJ1253_E02
          Length = 166645

 Score = 46.1 bits (23), Expect = 0.054
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 212   atggccctgaaggcctggatggtgccc 238
             ||||||||||||||||||||| |||||
Sbjct: 89772 atggccctgaaggcctggatgctgccc 89798
to top
>ref|XM_636411.1| Dictyostelium discoideum hypothetical protein (DDB0206312), partial
            mRNA
          Length = 3672

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 84   atgatgatgatgatgaattgg 104
            |||||||||||||||||||||
Sbjct: 1876 atgatgatgatgatgaattgg 1856
to top
>ref|XM_673664.1| Plasmodium berghei strain ANKA hypothetical protein (PB000644.01.0)
            partial mRNA
          Length = 7827

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 84   atgatgatgatgatgaattgg 104
            |||||||||||||||||||||
Sbjct: 2393 atgatgatgatgatgaattgg 2413
to top
>emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 82
          Length = 195165

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 83     tatgatgatgatgatgaattg 103
              |||||||||||||||||||||
Sbjct: 169801 tatgatgatgatgatgaattg 169821
to top
>emb|AL035522.1|ATT12J5 Arabidopsis thaliana DNA chromosome 4, BAC clone  T12J5 (ESSAII
             project)
          Length = 84499

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 83    tatgatgatgatgatgaattg 103
             |||||||||||||||||||||
Sbjct: 39879 tatgatgatgatgatgaattg 39899
to top
>emb|AL022023.1|ATM4E13 Arabidopsis thaliana DNA chromosome 4, BAC clone M4E13 (ESSAII project)
          Length = 80346

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 83    tatgatgatgatgatgaattg 103
             |||||||||||||||||||||
Sbjct: 70834 tatgatgatgatgatgaattg 70854
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 84       atgatgatgatgatgaattgg 104
                |||||||||||||||||||||
Sbjct: 21337665 atgatgatgatgatgaattgg 21337645



 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 84       atgatgatgatgatgaattg 103
                ||||||||||||||||||||
Sbjct: 21939268 atgatgatgatgatgaattg 21939249
to top
>dbj|AP003714.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0656E03
          Length = 181786

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 84     atgatgatgatgatgaattgg 104
              |||||||||||||||||||||
Sbjct: 133041 atgatgatgatgatgaattgg 133021
to top
>dbj|AB025636.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MVP2
          Length = 80402

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 84   atgatgatgatgatgaattgg 104
            |||||||||||||||||||||
Sbjct: 2331 atgatgatgatgatgaattgg 2351
to top
>dbj|AK107513.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-129-F01, full
           insert sequence
          Length = 744

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 84  atgatgatgatgatgaattgg 104
           |||||||||||||||||||||
Sbjct: 526 atgatgatgatgatgaattgg 546
to top
>gb|AF096371.1|T2L5 Arabidopsis thaliana BAC T2L5
          Length = 77905

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 82   ctatgatgatgatgatgaatt 102
            |||||||||||||||||||||
Sbjct: 6974 ctatgatgatgatgatgaatt 6954
to top
>gb|AF058826.1|AF058826 Arabidopsis thaliana BAC T26D22
          Length = 113567

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 84    atgatgatgatgatgaattgg 104
             |||||||||||||||||||||
Sbjct: 14187 atgatgatgatgatgaattgg 14207
to top
>ref|NM_180624.1| Arabidopsis thaliana RKF1 (RECEPTOR-LIKE KINASE IN FLOWERS 1); ATP
           binding / kinase/ protein serine/threonine kinase
           AT1G29750 (RKF1) transcript variant AT1G29750.1 mRNA,
           complete cds
          Length = 3649

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 84  atgatgatgatgatgaattg 103
           ||||||||||||||||||||
Sbjct: 330 atgatgatgatgatgaattg 349
to top
>ref|NM_202977.1| Arabidopsis thaliana unknown protein AT4G38360 transcript variant
           AT4G38360.2 mRNA, complete cds
          Length = 1900

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 84  atgatgatgatgatgaattg 103
           ||||||||||||||||||||
Sbjct: 222 atgatgatgatgatgaattg 203
to top
>ref|NM_119998.1| Arabidopsis thaliana unknown protein AT4G38360 transcript variant
           AT4G38360.1 mRNA, complete cds
          Length = 1905

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 84  atgatgatgatgatgaattg 103
           ||||||||||||||||||||
Sbjct: 222 atgatgatgatgatgaattg 203
to top
>ref|NM_124403.1| Arabidopsis thaliana PIMT2 (PROTEIN-L-ISOASPARTATE
           METHYLTRANSFERASE 2); S-adenosylmethionine-dependent
           methyltransferase/ protein-L-isoaspartate (D> AT5G50240
           (PIMT2) mRNA, complete cds
          Length = 810

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 84  atgatgatgatgatgaattg 103
           ||||||||||||||||||||
Sbjct: 184 atgatgatgatgatgaattg 165
to top
>ref|XM_637996.1| Dictyostelium discoideum hypothetical protein (DDB0217798), partial
           mRNA
          Length = 624

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 84  atgatgatgatgatgaattg 103
           ||||||||||||||||||||
Sbjct: 277 atgatgatgatgatgaattg 258
to top
>ref|XM_508298.1| PREDICTED: Pan troglodytes similar to Proteasome subunit alpha type
           1 (Proteasome component C2) (Macropain subunit C2)
           (Multicatalytic endopeptidase complex subunit C2)
           (Proteasome nu chain) (30 kDa prosomal protein)
           (PROS-30) (LOC451040), mRNA
          Length = 813

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 79  aatctatgatgatgatgatg 98
           ||||||||||||||||||||
Sbjct: 676 aatctatgatgatgatgatg 695
to top
>gb|AY023439.1| Oryza sativa microsatellite MRG5764 containing (TCA)X8, genomic
           sequence
          Length = 224

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 84  atgatgatgatgatgaattg 103
           ||||||||||||||||||||
Sbjct: 116 atgatgatgatgatgaattg 97
to top
>gb|AY496702.1| Arabidopsis thaliana L-isoaspartyl methyltransferase 2 (PIMT2)
           gene, complete cds, alternatively spliced
          Length = 1346

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 84  atgatgatgatgatgaattg 103
           ||||||||||||||||||||
Sbjct: 207 atgatgatgatgatgaattg 188
to top
>gb|AY632359.1| Gossypium hirsutum BAC 155C17, complete sequence
          Length = 103930

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 84    atgatgatgatgatgaattg 103
             ||||||||||||||||||||
Sbjct: 45030 atgatgatgatgatgaattg 45011
to top
>ref|NM_148976.1| Homo sapiens proteasome (prosome, macropain) subunit, alpha type, 1
            (PSMA1), transcript variant 1, mRNA
          Length = 1480

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 79   aatctatgatgatgatgatg 98
            ||||||||||||||||||||
Sbjct: 1011 aatctatgatgatgatgatg 1030
to top
>ref|NM_002786.2| Homo sapiens proteasome (prosome, macropain) subunit, alpha type, 1
           (PSMA1), transcript variant 2, mRNA
          Length = 1238

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 79  aatctatgatgatgatgatg 98
           ||||||||||||||||||||
Sbjct: 769 aatctatgatgatgatgatg 788
to top
>gb|AC126046.3| Mus musculus BAC clone RP23-176P24 from chromosome 19, complete sequence
          Length = 240536

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 49     tgttgttgcaatgtaatagagaat 72
              |||||||||||| |||||||||||
Sbjct: 165822 tgttgttgcaatctaatagagaat 165845
to top
>ref|XM_824337.1| Trypanosoma brucei TREU927 receptor-type adenylate cyclase GRESAG 4
            (Tb11.01.5310) partial mRNA
          Length = 3645

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 85   tgatgatgatgatgaattgg 104
            ||||||||||||||||||||
Sbjct: 1863 tgatgatgatgatgaattgg 1882
to top
>emb|CR932101.1|CNS0KY7M Paramecium tetraurelia centrin-related protein gene
          Length = 5100

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 84   atgatgatgatgatgaattg 103
            ||||||||||||||||||||
Sbjct: 2952 atgatgatgatgatgaattg 2971
to top
>gb|AC121793.3| Mus musculus BAC clone RP23-407B23 from chromosome 9, complete sequence
          Length = 194815

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 80    atctatgatgatgatgatga 99
             ||||||||||||||||||||
Sbjct: 40186 atctatgatgatgatgatga 40167
to top
>ref|XM_883667.1| Candida albicans SC5314 hypothetical protein (CaJ7.0152) partial
           mRNA
          Length = 1449

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 84  atgatgatgatgatgaattg 103
           ||||||||||||||||||||
Sbjct: 851 atgatgatgatgatgaattg 870
to top
>ref|XM_707396.1| Candida albicans SC5314 hypothetical protein (CaO19.6918) partial
           mRNA
          Length = 1449

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 84  atgatgatgatgatgaattg 103
           ||||||||||||||||||||
Sbjct: 851 atgatgatgatgatgaattg 870
to top
>gb|AC121783.2| Mus musculus BAC clone RP23-370I9 from 18, complete sequence
          Length = 184366

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 79    aatctatgatgatgatgatg 98
             ||||||||||||||||||||
Sbjct: 87797 aatctatgatgatgatgatg 87778
to top
>emb|Z93022.1|HS60N8 Human DNA sequence from clone RP1-60N8 on chromosome Xp22.11-22.32
             Contains two novel genes, complete sequence
          Length = 113444

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 208   gagcatggccctgaaggcct 227
             ||||||||||||||||||||
Sbjct: 22343 gagcatggccctgaaggcct 22362
to top
>emb|AL603844.7| Human DNA sequence from clone RP11-541I21 on chromosome 1, complete
            sequence
          Length = 220185

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 84   atgatgatgatgatgaattg 103
            ||||||||||||||||||||
Sbjct: 3519 atgatgatgatgatgaattg 3538
to top
>emb|AL356423.15| Human DNA sequence from clone RP11-295B17 on chromosome 13 Contains the
             5' end of the STK24 gene for serine/threonine kinase 24, a
             novel gene, a novel pseudogene, a cytochrome c pseudogene,
             a calmodulin 2 (CALM2) pseudogene and a CpG island,
             complete sequence
          Length = 174041

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 85    tgatgatgatgatgaattgg 104
             ||||||||||||||||||||
Sbjct: 55788 tgatgatgatgatgaattgg 55807
to top
>emb|AL354675.20| Human DNA sequence from clone RP11-217F15 on chromosome 9, complete
              sequence
          Length = 180185

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 84     atgatgatgatgatgaattg 103
              ||||||||||||||||||||
Sbjct: 110071 atgatgatgatgatgaattg 110090
to top
>emb|AL121722.9|HSJ788L20 Human DNA sequence from clone RP4-788L20 on chromosome 20 Contains the
             FOXA2 gene for forkhead box A2, a novel gene, the 5' end
             of the C20orf56 gene for chromosome 20 open reading frame
             56, the 5' end of a novel gene and five CpG islands,
             complete sequence
          Length = 120869

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 82    ctatgatgatgatgatgaat 101
             ||||||||||||||||||||
Sbjct: 69444 ctatgatgatgatgatgaat 69425
to top
>gb|AY091006.1| Arabidopsis thaliana putative receptor serine/threonine kinase
           (At1g29750) mRNA, complete cds
          Length = 3665

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 84  atgatgatgatgatgaattg 103
           ||||||||||||||||||||
Sbjct: 331 atgatgatgatgatgaattg 350
to top
>emb|X61969.1|HSMPNU H.sapiens mRNA for macropain subunit nu
          Length = 1244

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 79  aatctatgatgatgatgatg 98
           ||||||||||||||||||||
Sbjct: 771 aatctatgatgatgatgatg 790
to top
>gb|AY046005.1| Arabidopsis thaliana unknown protein (At4g38360) mRNA, complete cds
          Length = 1921

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 84  atgatgatgatgatgaattg 103
           ||||||||||||||||||||
Sbjct: 222 atgatgatgatgatgaattg 203
to top
>gb|BC022372.1| Homo sapiens proteasome (prosome, macropain) subunit, alpha type,
           1, transcript variant 2, mRNA (cDNA clone MGC:23915
           IMAGE:4770620), complete cds
          Length = 1167

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 79  aatctatgatgatgatgatg 98
           ||||||||||||||||||||
Sbjct: 699 aatctatgatgatgatgatg 718
to top
>gb|BC009576.1| Homo sapiens proteasome (prosome, macropain) subunit, alpha type,
           1, transcript variant 2, mRNA (cDNA clone MGC:14575
           IMAGE:4105838), complete cds
          Length = 958

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 79  aatctatgatgatgatgatg 98
           ||||||||||||||||||||
Sbjct: 720 aatctatgatgatgatgatg 739
to top
>gb|BC015105.1| Homo sapiens proteasome (prosome, macropain) subunit, alpha type,
           1, transcript variant 2, mRNA (cDNA clone MGC:22853
           IMAGE:3950568), complete cds
          Length = 1218

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 79  aatctatgatgatgatgatg 98
           ||||||||||||||||||||
Sbjct: 746 aatctatgatgatgatgatg 765
to top
>gb|BC015356.1| Homo sapiens proteasome (prosome, macropain) subunit, alpha type,
           1, transcript variant 2, mRNA (cDNA clone MGC:21459
           IMAGE:3452219), complete cds
          Length = 1169

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 79  aatctatgatgatgatgatg 98
           ||||||||||||||||||||
Sbjct: 715 aatctatgatgatgatgatg 734
to top
>gb|BC002577.2| Homo sapiens proteasome (prosome, macropain) subunit, alpha type,
           1, transcript variant 2, mRNA (cDNA clone MGC:1667
           IMAGE:3140784), complete cds
          Length = 1219

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 79  aatctatgatgatgatgatg 98
           ||||||||||||||||||||
Sbjct: 731 aatctatgatgatgatgatg 750
to top
>gb|BC008472.1| Homo sapiens proteasome (prosome, macropain) subunit, alpha type,
           1, transcript variant 2, mRNA (cDNA clone MGC:14751
           IMAGE:4282076), complete cds
          Length = 1174

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 79  aatctatgatgatgatgatg 98
           ||||||||||||||||||||
Sbjct: 712 aatctatgatgatgatgatg 731
to top
>emb|AL161593.2|ATCHRIV89 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 89
          Length = 199789

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 84    atgatgatgatgatgaattg 103
             ||||||||||||||||||||
Sbjct: 76269 atgatgatgatgatgaattg 76250
to top
>emb|AL035539.1|ATF22I13 Arabidopsis thaliana DNA chromosome 4, BAC clone  F22I13 (ESSA project)
          Length = 93760

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 84    atgatgatgatgatgaattg 103
             ||||||||||||||||||||
Sbjct: 35312 atgatgatgatgatgaattg 35293
to top
>gb|BC005932.1| Homo sapiens proteasome (prosome, macropain) subunit, alpha type,
           1, transcript variant 2, mRNA (cDNA clone MGC:14542
           IMAGE:4078894), complete cds
          Length = 1215

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 79  aatctatgatgatgatgatg 98
           ||||||||||||||||||||
Sbjct: 747 aatctatgatgatgatgatg 766
to top
>emb|BX927395.18| Zebrafish DNA sequence from clone CH211-72A16 in linkage group 3,
              complete sequence
          Length = 152987

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 84     atgatgatgatgatgaattg 103
              ||||||||||||||||||||
Sbjct: 128895 atgatgatgatgatgaattg 128914
to top
>gb|BT008064.1| Synthetic construct Homo sapiens proteasome (prosome, macropain)
           subunit, alpha type, 1 mRNA, partial cds
          Length = 792

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 79  aatctatgatgatgatgatg 98
           ||||||||||||||||||||
Sbjct: 666 aatctatgatgatgatgatg 685
to top
>gb|BT006647.1| Homo sapiens proteasome (prosome, macropain) subunit, alpha type, 1
           mRNA, complete cds
          Length = 792

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 79  aatctatgatgatgatgatg 98
           ||||||||||||||||||||
Sbjct: 666 aatctatgatgatgatgatg 685
to top
>emb|BX682553.8| Zebrafish DNA sequence from clone DKEY-163K10 in linkage group 3,
             complete sequence
          Length = 89991

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 84    atgatgatgatgatgaattg 103
             ||||||||||||||||||||
Sbjct: 26563 atgatgatgatgatgaattg 26582
to top
>gb|AC023741.4| Drosophila melanogaster X BAC RP98-23O9 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 160440

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 84     atgatgatgatgatgaattg 103
              ||||||||||||||||||||
Sbjct: 158466 atgatgatgatgatgaattg 158485
to top
>gb|AC161107.24| Medicago truncatula clone mth2-192o12, complete sequence
          Length = 106909

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 84   atgatgatgatgatgaattg 103
            ||||||||||||||||||||
Sbjct: 5714 atgatgatgatgatgaattg 5733
to top
>emb|CR623849.1| full-length cDNA clone CS0DA006YP22 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1156

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 79  aatctatgatgatgatgatg 98
           ||||||||||||||||||||
Sbjct: 741 aatctatgatgatgatgatg 760
to top
>emb|CR620774.1| full-length cDNA clone CS0DI030YJ03 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1146

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 79  aatctatgatgatgatgatg 98
           ||||||||||||||||||||
Sbjct: 704 aatctatgatgatgatgatg 723
to top
>emb|CR617103.1| full-length cDNA clone CS0DI052YO22 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1129

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 79  aatctatgatgatgatgatg 98
           ||||||||||||||||||||
Sbjct: 723 aatctatgatgatgatgatg 742
to top
>emb|CR612800.1| full-length cDNA clone CS0DA012YD16 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1218

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 79  aatctatgatgatgatgatg 98
           ||||||||||||||||||||
Sbjct: 801 aatctatgatgatgatgatg 820
to top
>emb|CR610121.1| full-length cDNA clone CS0DI083YG05 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1144

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 79  aatctatgatgatgatgatg 98
           ||||||||||||||||||||
Sbjct: 707 aatctatgatgatgatgatg 726
to top
>emb|CR607472.1| full-length cDNA clone CS0DB001YP20 of Neuroblastoma Cot
            10-normalized of Homo sapiens (human)
          Length = 1527

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 79   aatctatgatgatgatgatg 98
            ||||||||||||||||||||
Sbjct: 1122 aatctatgatgatgatgatg 1141
to top
>emb|CR607412.1| full-length cDNA clone CS0DE014YI10 of Placenta of Homo sapiens
           (human)
          Length = 1165

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 79  aatctatgatgatgatgatg 98
           ||||||||||||||||||||
Sbjct: 730 aatctatgatgatgatgatg 749
to top
>gb|AC135316.15| Medicago truncatula clone mth2-20l8, complete sequence
          Length = 127653

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 84    atgatgatgatgatgaattg 103
             ||||||||||||||||||||
Sbjct: 99217 atgatgatgatgatgaattg 99236
to top
>emb|CR599736.1| full-length cDNA clone CS0DK007YL19 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 1105

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 79  aatctatgatgatgatgatg 98
           ||||||||||||||||||||
Sbjct: 664 aatctatgatgatgatgatg 683
to top
>emb|CR599649.1| full-length cDNA clone CS0DI069YC24 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1133

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 79  aatctatgatgatgatgatg 98
           ||||||||||||||||||||
Sbjct: 709 aatctatgatgatgatgatg 728
to top
>emb|CR598938.1| full-length cDNA clone CS0DI075YJ10 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1090

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 79  aatctatgatgatgatgatg 98
           ||||||||||||||||||||
Sbjct: 664 aatctatgatgatgatgatg 683
to top
>emb|CR597642.1| full-length cDNA clone CL0BB027ZF05 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1143

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 79  aatctatgatgatgatgatg 98
           ||||||||||||||||||||
Sbjct: 704 aatctatgatgatgatgatg 723
to top
>gb|AC104627.8| Drosophila melanogaster X BAC RP98-4A11 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 187921

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 84    atgatgatgatgatgaattg 103
             ||||||||||||||||||||
Sbjct: 94016 atgatgatgatgatgaattg 94035
to top
>dbj|AP007215.1| Homo sapiens genomic DNA, chromosome 11 clone:CMF9-22B7, complete
             sequence
          Length = 38311

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 80    atctatgatgatgatgatga 99
             ||||||||||||||||||||
Sbjct: 30255 atctatgatgatgatgatga 30274
to top
>dbj|AB179294.1| Macaca fascicularis testis cDNA clone: QtsA-16934, similar to human
           proteasome (prosome, macropain) subunit, alpha type,
           1(PSMA1), transcript variant 2, mRNA, RefSeq:
           NM_002786.2
          Length = 1237

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 79  aatctatgatgatgatgatg 98
           ||||||||||||||||||||
Sbjct: 747 aatctatgatgatgatgatg 766
to top
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 85       tgatgatgatgatgaattgg 104
                ||||||||||||||||||||
Sbjct: 27188561 tgatgatgatgatgaattgg 27188580



 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 84       atgatgatgatgatgaattg 103
                ||||||||||||||||||||
Sbjct: 25852170 atgatgatgatgatgaattg 25852151
to top
>gb|AC018523.9|AC018523 Homo sapiens chromosome , clone RP11-140L24, complete sequence
          Length = 166507

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 79    aatctatgatgatgatgatg 98
             ||||||||||||||||||||
Sbjct: 96136 aatctatgatgatgatgatg 96155
to top
>dbj|AP006345.4| Homo sapiens genomic DNA, chromosome 11 clone:RP11-186D19, complete
              sequence
          Length = 150214

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 80     atctatgatgatgatgatga 99
              ||||||||||||||||||||
Sbjct: 123363 atctatgatgatgatgatga 123382
to top
>emb|BX827801.1|CNS0A2X8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH22ZH04 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1801

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 84  atgatgatgatgatgaattg 103
           ||||||||||||||||||||
Sbjct: 176 atgatgatgatgatgaattg 157
to top
>emb|BX841987.1|CNS09Y5I Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL95ZG09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 619

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 78  taatctatgatgatgatgatgaat 101
           ||||| ||||||||||||||||||
Sbjct: 498 taatcgatgatgatgatgatgaat 521
to top
>gb|AC115606.2| Dictyostelium discoideum chromosome 2 map 159760-209066 strain AX4,
            complete sequence
          Length = 49306

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 84   atgatgatgatgatgaattg 103
            ||||||||||||||||||||
Sbjct: 2256 atgatgatgatgatgaattg 2275
to top
>emb|BX005056.7| Zebrafish DNA sequence from clone CH211-77A11 in linkage group 7,
             complete sequence
          Length = 173708

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 84    atgatgatgatgatgaattg 103
             ||||||||||||||||||||
Sbjct: 95155 atgatgatgatgatgaattg 95136
to top
>gb|AC090826.15| Homo sapiens chromosome 15, clone CTD-2311M21, complete sequence
          Length = 169518

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 84    atgatgatgatgatgaattg 103
             ||||||||||||||||||||
Sbjct: 84956 atgatgatgatgatgaattg 84937
to top
>gb|AC084149.5| Homo sapiens BAC clone RP11-221F12 from 2, complete sequence
          Length = 64234

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 80    atctatgatgatgatgatga 99
             ||||||||||||||||||||
Sbjct: 12984 atctatgatgatgatgatga 12965
to top
>gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N18 genomic sequence, complete
             sequence
          Length = 101075

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 84    atgatgatgatgatgaattg 103
             ||||||||||||||||||||
Sbjct: 75062 atgatgatgatgatgaattg 75081
to top
>gb|AC069558.5|AC069558 Genomic Sequence For Arabidopsis thaliana Clone T5G13 From Chromosome
             IV, complete sequence
          Length = 107740

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 84    atgatgatgatgatgaattg 103
             ||||||||||||||||||||
Sbjct: 89256 atgatgatgatgatgaattg 89275
to top
>dbj|AP004729.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:OSJNBa0006A22
          Length = 190690

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 84     atgatgatgatgatgaattg 103
              ||||||||||||||||||||
Sbjct: 161753 atgatgatgatgatgaattg 161734
to top
>gb|AY892634.1| Synthetic construct Homo sapiens clone FLH015536.01L proteasome
           alpha type subunit 1 (PSMA1) mRNA, partial cds
          Length = 792

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 79  aatctatgatgatgatgatg 98
           ||||||||||||||||||||
Sbjct: 666 aatctatgatgatgatgatg 685
to top
>gb|AY890152.1| Synthetic construct Homo sapiens clone FLH015541.01X proteasome
           subunit alpha type 1 (PSMA1) mRNA, complete cds
          Length = 792

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 79  aatctatgatgatgatgatg 98
           ||||||||||||||||||||
Sbjct: 666 aatctatgatgatgatgatg 685
to top
>gb|AY890151.1| Synthetic construct Homo sapiens clone FLH015540.01X proteasome
           subunit alpha type 1 (PSMA1) mRNA, complete cds
          Length = 792

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 79  aatctatgatgatgatgatg 98
           ||||||||||||||||||||
Sbjct: 666 aatctatgatgatgatgatg 685
to top
>emb|AL808104.14| Mouse DNA sequence from clone RP23-30M20 on chromosome 2, complete
             sequence
          Length = 199494

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 84    atgatgatgatgatgaattg 103
             ||||||||||||||||||||
Sbjct: 68161 atgatgatgatgatgaattg 68142
to top
>dbj|AK118104.1| Arabidopsis thaliana At5g50240 mRNA for unknown protein, complete
           cds, clone: RAFL19-36-P11
          Length = 899

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 84  atgatgatgatgatgaattg 103
           ||||||||||||||||||||
Sbjct: 54  atgatgatgatgatgaattg 35
to top
>dbj|AB024031.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K6A12
          Length = 64136

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 84    atgatgatgatgatgaattg 103
             ||||||||||||||||||||
Sbjct: 46155 atgatgatgatgatgaattg 46136
to top
>dbj|AK130723.1| Homo sapiens cDNA FLJ27213 fis, clone SYN03652
          Length = 2903

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 85  tgatgatgatgatgaattgg 104
           ||||||||||||||||||||
Sbjct: 261 tgatgatgatgatgaattgg 242
to top
>emb|BX088720.8| Zebrafish DNA sequence from clone CH211-195M2 in linkage group 22,
              complete sequence
          Length = 190269

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 76     actaatctatgatgatgatgatga 99
              ||||||||| ||||||||||||||
Sbjct: 135241 actaatctaagatgatgatgatga 135264
to top
>gb|AE003490.3| Drosophila melanogaster chromosome X, section 42 of 74 of the complete
              sequence
          Length = 302665

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 84     atgatgatgatgatgaattg 103
              ||||||||||||||||||||
Sbjct: 175587 atgatgatgatgatgaattg 175606
to top
>emb|AL935204.10| Zebrafish DNA sequence from clone CH211-230K10, complete sequence
          Length = 204217

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 84   atgatgatgatgatgaattg 103
            ||||||||||||||||||||
Sbjct: 9860 atgatgatgatgatgaattg 9841
to top
>dbj|D00759.1|HUMPSC2 Homo sapiens mRNA for proteasome subunit C2, complete cds
          Length = 1105

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 79  aatctatgatgatgatgatg 98
           ||||||||||||||||||||
Sbjct: 707 aatctatgatgatgatgatg 726
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 85       tgatgatgatgatgaattgg 104
                ||||||||||||||||||||
Sbjct: 27114161 tgatgatgatgatgaattgg 27114180



 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 84       atgatgatgatgatgaattg 103
                ||||||||||||||||||||
Sbjct: 25780346 atgatgatgatgatgaattg 25780327
to top
>emb|AL928780.5|CNS08CCA Oryza sativa chromosome 12, . BAC OSJNBa0018C20 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 137492

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 84    atgatgatgatgatgaattg 103
             ||||||||||||||||||||
Sbjct: 73621 atgatgatgatgatgaattg 73602
to top
>emb|AL731887.5|CNS08C8R Oryza sativa chromosome 12, . BAC OJ1559_C07 of library Monsanto from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 145816

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 85     tgatgatgatgatgaattgg 104
              ||||||||||||||||||||
Sbjct: 127460 tgatgatgatgatgaattgg 127479
to top
>emb|AL831809.3|CNS08CAM Oryza sativa chromosome 12, . BAC OJ1268_D02 of library Monsanto from
            chromosome 12 of cultivar Nipponbare of ssp. japonica of
            Oryza sativa (rice), complete sequence
          Length = 146585

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 85   tgatgatgatgatgaattgg 104
            ||||||||||||||||||||
Sbjct: 1593 tgatgatgatgatgaattgg 1612
to top
>dbj|AP006852.1| Candida albicans genomic DNA, chromosome 7, complete sequence
          Length = 949626

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 84     atgatgatgatgatgaattg 103
              ||||||||||||||||||||
Sbjct: 278906 atgatgatgatgatgaattg 278925
to top
>dbj|AP006083.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT44D21, TM0127a,
             complete sequence
          Length = 26994

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 84    atgatgatgatgatgaattg 103
             ||||||||||||||||||||
Sbjct: 21014 atgatgatgatgatgaattg 20995
to top
>emb|AL953895.8| Zebrafish DNA sequence from clone CH211-231M14 in linkage group 7,
             complete sequence
          Length = 167156

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 84    atgatgatgatgatgaattg 103
             ||||||||||||||||||||
Sbjct: 79951 atgatgatgatgatgaattg 79932
to top
>gb|M64992.1|HUMPROS30 Human prosomal protein P30-33K (pros-30) mRNA, complete cds
          Length = 1264

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 79   aatctatgatgatgatgatg 98
            ||||||||||||||||||||
Sbjct: 1011 aatctatgatgatgatgatg 1030
to top
>emb|AL627087.11| Mouse DNA sequence from clone RP23-243K17 on chromosome 4, complete
              sequence
          Length = 179705

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 84     atgatgatgatgatgaattg 103
              ||||||||||||||||||||
Sbjct: 105697 atgatgatgatgatgaattg 105716
to top
>dbj|AB000302.1| Fagopyrum callianthum chloroplast rbcL and accD genes, complete and
            partial cds
          Length = 2544

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 78   taatctatgatgatgatgat 97
            ||||||||||||||||||||
Sbjct: 2135 taatctatgatgatgatgat 2154


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,138,302
Number of Sequences: 3902068
Number of extensions: 2138302
Number of successful extensions: 190999
Number of sequences better than 10.0: 102
Number of HSP's better than 10.0 without gapping: 102
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 190339
Number of HSP's gapped (non-prelim): 659
length of query: 257
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 235
effective length of database: 17,147,199,772
effective search space: 4029591946420
effective search space used: 4029591946420
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top