ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal38b09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY123422.1| Triticum aestivum putative Rieske Fe-S precursor ... 143 1e-31
2gb|AC120788.7| Mus musculus chromosome 14, clone RP23-279B13, co... 40 1.3
3gb|AC090496.28| Mus musculus strain C57BL/6J clone rp23-469n6 ma... 40 1.3
4ref|XM_414964.1| PREDICTED: Gallus gallus similar to CREB-bindin... 38 5.3
5gb|AC011899.5| Homo sapiens BAC clone RP11-452C13 from 7, comple... 38 5.3
6gb|AC114806.5| Homo sapiens BAC clone RP11-1251F13 from 4, compl... 38 5.3

>gb|AY123422.1| Triticum aestivum putative Rieske Fe-S precursor protein mRNA,
           complete cds
          Length = 866

 Score =  143 bits (72), Expect = 1e-31
 Identities = 107/118 (90%), Gaps = 2/118 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   agaaacaggtgcttttatagcgggagtactcttat--agcagngtccttaggactggcag 58
           |||||||||||| |||||||| |||||| ||||||  ||||| || ||||||||||||||
Sbjct: 830 agaaacaggtgcatttatagcaggagtagtcttatgtagcagcgttcttaggactggcag 771

                                                                     
Query: 59  gaggcttaacatatcacacgagtgagctctgctgccggagcttgtgtcgcttatttcc 116
           |||||||||||||||||| ||||||||  ||||||||||||||| |||||||||||||
Sbjct: 770 gaggcttaacatatcacaggagtgagcattgctgccggagcttgcgtcgcttatttcc 713



to top

>gb|AC120788.7| Mus musculus chromosome 14, clone RP23-279B13, complete sequence
          Length = 215810

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 46    ttaggactggcaggaggctt 65
             ||||||||||||||||||||
Sbjct: 14455 ttaggactggcaggaggctt 14436



to top

>gb|AC090496.28| Mus musculus strain C57BL/6J clone rp23-469n6 map 14, complete sequence
          Length = 180338

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 46     ttaggactggcaggaggctt 65
              ||||||||||||||||||||
Sbjct: 173120 ttaggactggcaggaggctt 173101



to top

>ref|XM_414964.1| PREDICTED: Gallus gallus similar to CREB-binding protein (LOC416667),
            mRNA
          Length = 8061

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 87   ctgctgccggagcttgtgt 105
            |||||||||||||||||||
Sbjct: 6351 ctgctgccggagcttgtgt 6333



to top

>gb|AC011899.5| Homo sapiens BAC clone RP11-452C13 from 7, complete sequence
          Length = 214229

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 76   acgagtgagctctgctgcc 94
            |||||||||||||||||||
Sbjct: 5036 acgagtgagctctgctgcc 5054



to top

>gb|AC114806.5| Homo sapiens BAC clone RP11-1251F13 from 4, complete sequence
          Length = 138121

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 55     gcaggaggcttaacatatc 73
              |||||||||||||||||||
Sbjct: 107906 gcaggaggcttaacatatc 107924


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 583,862
Number of Sequences: 3902068
Number of extensions: 583862
Number of successful extensions: 36967
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 36959
Number of HSP's gapped (non-prelim): 7
length of query: 116
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 95
effective length of database: 17,151,101,840
effective search space: 1629354674800
effective search space used: 1629354674800
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top